>Feature sequence001 301 1449 gene locus_tag LOCUS_00010 301 1449 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_00010 3285 1642 gene locus_tag LOCUS_00020 gene pgm 3285 1642 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_00020 4321 3455 gene locus_tag LOCUS_00030 4321 3455 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_00030 4453 5562 gene locus_tag LOCUS_00040 4453 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_00040 5595 7235 gene locus_tag LOCUS_00050 5595 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7500 8672 gene locus_tag LOCUS_00060 7500 8672 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_00060 8672 9316 gene locus_tag LOCUS_00070 8672 9316 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114116.1 protein_id gnl|my_center|LOCUS_00070 12051 9448 gene locus_tag LOCUS_00080 12051 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027019.1 protein_id gnl|my_center|LOCUS_00080 15496 12377 gene locus_tag LOCUS_00090 15496 12377 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881459.1 protein_id gnl|my_center|LOCUS_00090 16608 15499 gene locus_tag LOCUS_00100 16608 15499 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462329.1 protein_id gnl|my_center|LOCUS_00100 16896 17786 gene locus_tag LOCUS_00110 16896 17786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705518.1 protein_id gnl|my_center|LOCUS_00110 17817 18323 gene locus_tag LOCUS_00120 17817 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18316 19224 gene locus_tag LOCUS_00130 18316 19224 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_00130 19593 20615 gene locus_tag LOCUS_00140 19593 20615 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_00140 20659 21375 gene locus_tag LOCUS_00150 20659 21375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532065.1 protein_id gnl|my_center|LOCUS_00150 21362 22102 gene locus_tag LOCUS_00160 21362 22102 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897909.1 protein_id gnl|my_center|LOCUS_00160 22373 22131 gene locus_tag LOCUS_00170 22373 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 <1 837 gene locus_tag LOCUS_00180 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880909.1:cellulose synthase catalytic subunit (UDP-forming) 937 3198 gene locus_tag LOCUS_00190 937 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 3206 4243 gene locus_tag LOCUS_00200 3206 4243 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_00200 4240 6762 gene locus_tag LOCUS_00210 4240 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 6850 7155 gene locus_tag LOCUS_00220 6850 7155 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_00220 7159 8895 gene locus_tag LOCUS_00230 7159 8895 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_00230 8885 9241 gene locus_tag LOCUS_00240 8885 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 9283 9714 gene locus_tag LOCUS_00250 9283 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 10234 9686 gene locus_tag LOCUS_00260 10234 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11966 10224 gene locus_tag LOCUS_00270 11966 10224 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_00270 13046 11970 gene locus_tag LOCUS_00280 13046 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_00280 14161 13151 gene locus_tag LOCUS_00290 14161 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 15172 14336 gene locus_tag LOCUS_00300 15172 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 15608 16060 gene locus_tag LOCUS_00310 gene mraZ 15608 16060 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY1 protein_id gnl|my_center|LOCUS_00310 16060 16995 gene locus_tag LOCUS_00320 gene rsmH 16060 16995 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_00320 17001 17237 gene locus_tag LOCUS_00330 17001 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 17312 18979 gene locus_tag LOCUS_00340 gene ftsI 17312 18979 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_00340 18967 20499 gene locus_tag LOCUS_00350 gene murE 18967 20499 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIF4 protein_id gnl|my_center|LOCUS_00350 20489 21850 gene locus_tag LOCUS_00360 gene murF 20489 21850 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_00360 >Feature sequence003 1522 365 gene locus_tag LOCUS_00370 1522 365 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 protein_id gnl|my_center|LOCUS_00370 3135 1642 gene locus_tag LOCUS_00380 3135 1642 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477189.1 protein_id gnl|my_center|LOCUS_00380 3395 4309 gene locus_tag LOCUS_00390 gene mmsR 3395 4309 CDS product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 protein_id gnl|my_center|LOCUS_00390 6328 4334 gene locus_tag LOCUS_00400 6328 4334 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_00400 6327 6530 gene locus_tag LOCUS_00410 6327 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 7697 6516 gene locus_tag LOCUS_00420 7697 6516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_00420 7802 8656 gene locus_tag LOCUS_00430 7802 8656 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087853.1 protein_id gnl|my_center|LOCUS_00430 11453 8832 gene locus_tag LOCUS_00440 11453 8832 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103006.1 protein_id gnl|my_center|LOCUS_00440 12276 11545 gene locus_tag LOCUS_00450 12276 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 12797 12273 gene locus_tag LOCUS_00460 12797 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 13981 12872 gene locus_tag LOCUS_00470 13981 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_00470 14644 14321 gene locus_tag LOCUS_00480 14644 14321 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_00480 18464 14733 gene locus_tag LOCUS_00490 gene oplaH 18464 14733 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_00490 19303 18665 gene locus_tag LOCUS_00500 19303 18665 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481612.1 protein_id gnl|my_center|LOCUS_00500 >Feature sequence004 548 1243 gene locus_tag LOCUS_00510 548 1243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_00510 1941 1372 gene locus_tag LOCUS_00520 gene nudE 1941 1372 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 protein_id gnl|my_center|LOCUS_00520 1988 2653 gene locus_tag LOCUS_00530 1988 2653 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_00530 2650 3057 gene locus_tag LOCUS_00540 gene hslR 2650 3057 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_00540 3072 3929 gene locus_tag LOCUS_00550 gene hslO 3072 3929 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_00550 4166 5701 gene locus_tag LOCUS_00560 gene pckA 4166 5701 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_00560 6334 5894 gene locus_tag LOCUS_00570 6334 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8453 6348 gene locus_tag LOCUS_00580 8453 6348 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263020.1 protein_id gnl|my_center|LOCUS_00580 8868 11216 gene locus_tag LOCUS_00590 8868 11216 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_00590 11392 12978 gene locus_tag LOCUS_00600 gene gshA 11392 12978 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_00600 13439 13963 gene locus_tag LOCUS_00610 gene dsbB1 13439 13963 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_00610 14086 14565 gene locus_tag LOCUS_00620 gene algQ 14086 14565 CDS product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 protein_id gnl|my_center|LOCUS_00620 15074 14637 gene locus_tag LOCUS_00630 15074 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15707 15183 gene locus_tag LOCUS_00640 15707 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 15786 17639 gene locus_tag LOCUS_00650 15786 17639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_00650 19136 17757 gene locus_tag LOCUS_00660 gene glmU 19136 17757 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NR32 protein_id gnl|my_center|LOCUS_00660 <19779 19270 gene locus_tag LOCUS_00670 <19779 19270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455470.1:zinc ABC transporter substrate-binding protein >Feature sequence005 <1 1065 gene locus_tag LOCUS_00680 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706770.1:histidine kinase 1713 1099 gene locus_tag LOCUS_00690 1713 1099 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262765.1 protein_id gnl|my_center|LOCUS_00690 2405 3499 gene locus_tag LOCUS_00700 2405 3499 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_00700 4205 5896 gene locus_tag LOCUS_00710 4205 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 6002 6862 gene locus_tag LOCUS_00720 6002 6862 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_00720 7782 6889 gene locus_tag LOCUS_00730 7782 6889 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 protein_id gnl|my_center|LOCUS_00730 7918 8439 gene locus_tag LOCUS_00740 7918 8439 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_00740 9716 8703 gene locus_tag LOCUS_00750 9716 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_00750 10103 12199 gene locus_tag LOCUS_00760 10103 12199 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I60 protein_id gnl|my_center|LOCUS_00760 13593 12262 gene locus_tag LOCUS_00770 13593 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 14248 13580 gene locus_tag LOCUS_00780 14248 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 16075 15056 gene locus_tag LOCUS_00790 16075 15056 CDS product UDP-glucuronate 5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 protein_id gnl|my_center|LOCUS_00790 18022 16082 gene locus_tag LOCUS_00800 18022 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 18992 18006 gene locus_tag LOCUS_00810 18992 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence006 <1 914 gene locus_tag LOCUS_00820 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VJ8:ATP phosphoribosyltransferase regulatory subunit 929 2221 gene locus_tag LOCUS_00830 gene purA 929 2221 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_00830 2253 3665 gene locus_tag LOCUS_00840 gene thrC 2253 3665 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_00840 3780 4262 gene locus_tag LOCUS_00850 3780 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 protein_id gnl|my_center|LOCUS_00850 4391 5239 gene locus_tag LOCUS_00860 4391 5239 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_00860 5229 6023 gene locus_tag LOCUS_00870 gene hyi 5229 6023 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_00870 6179 6406 gene locus_tag LOCUS_00880 6179 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6748 6539 gene locus_tag LOCUS_00890 gene cspA 6748 6539 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_00890 7053 7949 gene locus_tag LOCUS_00900 7053 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_00900 8881 7931 gene locus_tag LOCUS_00910 8881 7931 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_00910 9187 9420 gene locus_tag LOCUS_00920 9187 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 9466 10080 gene locus_tag LOCUS_00930 9466 10080 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_00930 12440 10149 gene locus_tag LOCUS_00940 gene feoB 12440 10149 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G9 protein_id gnl|my_center|LOCUS_00940 12676 12437 gene locus_tag LOCUS_00950 12676 12437 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_00950 13215 13700 gene locus_tag LOCUS_00960 13215 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 15996 14071 gene locus_tag LOCUS_00970 gene rnb 15996 14071 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL65 protein_id gnl|my_center|LOCUS_00970 16241 18091 gene locus_tag LOCUS_00980 gene phoD 16241 18091 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence007 358 912 gene locus_tag LOCUS_00990 358 912 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_00990 1282 2754 gene locus_tag LOCUS_01000 1282 2754 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_01000 2751 3953 gene locus_tag LOCUS_01010 gene mexE 2751 3953 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706652.1 protein_id gnl|my_center|LOCUS_01010 3950 7117 gene locus_tag LOCUS_01020 gene czcA 3950 7117 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_01020 8070 7171 gene locus_tag LOCUS_01030 gene yfeX 8070 7171 CDS product deferrochelatase/peroxidase YfeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262388.1 protein_id gnl|my_center|LOCUS_01030 8210 9094 gene locus_tag LOCUS_01040 8210 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_01040 9133 9447 gene locus_tag LOCUS_01050 9133 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9380 10099 gene locus_tag LOCUS_01060 9380 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10207 10536 gene locus_tag LOCUS_01070 gene qacF 10207 10536 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_01070 12357 10582 gene locus_tag LOCUS_01080 gene ercS 12357 10582 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_01080 13504 12341 gene locus_tag LOCUS_01090 13504 12341 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_01090 15757 13589 gene locus_tag LOCUS_01100 gene nosR 15757 13589 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 protein_id gnl|my_center|LOCUS_01100 15842 16105 gene locus_tag LOCUS_01110 15842 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence008 476 1642 gene locus_tag LOCUS_01120 476 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1697 2890 gene locus_tag LOCUS_01130 1697 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2892 3770 gene locus_tag LOCUS_01140 2892 3770 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528101.1 protein_id gnl|my_center|LOCUS_01140 3718 5109 gene locus_tag LOCUS_01150 3718 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 7050 5086 gene locus_tag LOCUS_01160 7050 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8244 7492 gene locus_tag LOCUS_01170 8244 7492 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_01170 9757 8417 gene locus_tag LOCUS_01180 9757 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_01180 11262 9844 gene locus_tag LOCUS_01190 11262 9844 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_01190 12712 11489 gene locus_tag LOCUS_01200 12712 11489 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_01200 12766 13122 gene locus_tag LOCUS_01210 gene yfgD 12766 13122 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 protein_id gnl|my_center|LOCUS_01210 13119 13736 gene locus_tag LOCUS_01220 13119 13736 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_01220 13733 14122 gene locus_tag LOCUS_01230 13733 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 14161 14733 gene locus_tag LOCUS_01240 14161 14733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_01240 15090 14857 gene locus_tag LOCUS_01250 15090 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 15870 15550 gene locus_tag LOCUS_01260 15870 15550 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKZ9 protein_id gnl|my_center|LOCUS_01260 16023 16436 gene locus_tag LOCUS_01270 16023 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083895.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence009 715 1269 gene locus_tag LOCUS_01280 gene tesA 715 1269 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 protein_id gnl|my_center|LOCUS_01280 1324 2151 gene locus_tag LOCUS_01290 1324 2151 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 protein_id gnl|my_center|LOCUS_01290 3455 2394 gene locus_tag LOCUS_01300 3455 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4400 3459 gene locus_tag LOCUS_01310 gene lipA 4400 3459 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_01310 4804 5298 gene locus_tag LOCUS_01320 4804 5298 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_01320 5826 5305 gene locus_tag LOCUS_01330 5826 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6013 6351 gene locus_tag LOCUS_01340 6013 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 6925 6443 gene locus_tag LOCUS_01350 gene nifX 6925 6443 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_01350 7822 7127 gene locus_tag LOCUS_01360 7822 7127 CDS product haloacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980655.1 protein_id gnl|my_center|LOCUS_01360 8761 7961 gene locus_tag LOCUS_01370 8761 7961 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256130.1 protein_id gnl|my_center|LOCUS_01370 9280 8831 gene locus_tag LOCUS_01380 gene osmC 9280 8831 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_01380 9845 9282 gene locus_tag LOCUS_01390 9845 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_01390 10264 9881 gene locus_tag LOCUS_01400 10264 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 10564 11952 gene locus_tag LOCUS_01410 10564 11952 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_01410 12703 12011 gene locus_tag LOCUS_01420 12703 12011 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 protein_id gnl|my_center|LOCUS_01420 13754 12801 gene locus_tag LOCUS_01430 13754 12801 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_01430 15587 13791 gene locus_tag LOCUS_01440 15587 13791 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_01440 17016 15601 gene locus_tag LOCUS_01450 17016 15601 CDS product pyruvate carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105540.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence010 <1 2373 gene locus_tag LOCUS_01460 <1 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RQ0:leucine--tRNA ligase 2421 2936 gene locus_tag LOCUS_01470 gene lptE 2421 2936 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NM00 protein_id gnl|my_center|LOCUS_01470 2933 3937 gene locus_tag LOCUS_01480 gene holA 2933 3937 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_01480 3877 4056 gene locus_tag LOCUS_01490 3877 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4384 4977 gene locus_tag LOCUS_01500 4384 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_01500 5952 5113 gene locus_tag LOCUS_01510 5952 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6363 5983 gene locus_tag LOCUS_01520 6363 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6482 7231 gene locus_tag LOCUS_01530 6482 7231 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_01530 7669 7304 gene locus_tag LOCUS_01540 7669 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8337 7687 gene locus_tag LOCUS_01550 gene ubiX 8337 7687 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_01550 9713 8334 gene locus_tag LOCUS_01560 gene mpl 9713 8334 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_01560 9981 10928 gene locus_tag LOCUS_01570 gene fbp 9981 10928 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LZ0 protein_id gnl|my_center|LOCUS_01570 12891 10975 gene locus_tag LOCUS_01580 12891 10975 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_01580 13772 12888 gene locus_tag LOCUS_01590 13772 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16119 13792 gene locus_tag LOCUS_01600 16119 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence011 2509 470 gene locus_tag LOCUS_01610 2509 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2584 3333 gene locus_tag LOCUS_01620 2584 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3923 3549 gene locus_tag LOCUS_01630 3923 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4756 3920 gene locus_tag LOCUS_01640 4756 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_01640 5715 4813 gene locus_tag LOCUS_01650 5715 4813 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_01650 5987 6838 gene locus_tag LOCUS_01660 gene frmB 5987 6838 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_01660 6950 7714 gene locus_tag LOCUS_01670 6950 7714 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_01670 8813 7701 gene locus_tag LOCUS_01680 8813 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 8929 9870 gene locus_tag LOCUS_01690 8929 9870 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_01690 10632 9901 gene locus_tag LOCUS_01700 gene mtnC 10632 9901 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_01700 11183 10638 gene locus_tag LOCUS_01710 gene mtnD 11183 10638 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 protein_id gnl|my_center|LOCUS_01710 11936 11289 gene locus_tag LOCUS_01720 gene mtnB 11936 11289 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_01720 12946 11933 gene locus_tag LOCUS_01730 gene mtnA 12946 11933 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_01730 14727 13069 gene locus_tag LOCUS_01740 gene pgi 14727 13069 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_01740 15328 14948 gene locus_tag LOCUS_01750 gene panD 15328 14948 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_01750 16380 15487 gene locus_tag LOCUS_01760 gene panC 16380 15487 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_01760 >Feature sequence012 1310 447 gene locus_tag LOCUS_01770 1310 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_01770 1585 1355 gene locus_tag LOCUS_01780 gene rpsR 1585 1355 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_01780 2036 1599 gene locus_tag LOCUS_01790 gene rpsF 2036 1599 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG67 protein_id gnl|my_center|LOCUS_01790 2533 2907 gene locus_tag LOCUS_01800 2533 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_01800 3011 3445 gene locus_tag LOCUS_01810 3011 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3518 4090 gene locus_tag LOCUS_01820 3518 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4131 4547 gene locus_tag LOCUS_01830 4131 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5017 4571 gene locus_tag LOCUS_01840 5017 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5413 5039 gene locus_tag LOCUS_01850 5413 5039 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869283.1 protein_id gnl|my_center|LOCUS_01850 7533 5413 gene locus_tag LOCUS_01860 7533 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 10520 7842 gene locus_tag LOCUS_01870 10520 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11752 10649 gene locus_tag LOCUS_01880 11752 10649 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 protein_id gnl|my_center|LOCUS_01880 12012 11749 gene locus_tag LOCUS_01890 12012 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12114 12902 gene locus_tag LOCUS_01900 12114 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence013 1048 1650 gene locus_tag LOCUS_01910 gene lexA1 1048 1650 CDS product LexA repressor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB9 protein_id gnl|my_center|LOCUS_01910 1677 2099 gene locus_tag LOCUS_01920 1677 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2360 2109 gene locus_tag LOCUS_01930 2360 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 3058 2600 gene locus_tag LOCUS_01940 3058 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3628 3068 gene locus_tag LOCUS_01950 3628 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 5704 3803 gene locus_tag LOCUS_01960 gene htpG 5704 3803 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_01960 7467 5941 gene locus_tag LOCUS_01970 gene thiDE 7467 5941 CDS product phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947297.1 protein_id gnl|my_center|LOCUS_01970 8320 7496 gene locus_tag LOCUS_01980 gene thiG 8320 7496 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GC6 protein_id gnl|my_center|LOCUS_01980 8550 8323 gene locus_tag LOCUS_01990 8550 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 9626 8547 gene locus_tag LOCUS_02000 9626 8547 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_02000 11559 9628 gene locus_tag LOCUS_02010 gene thiC 11559 9628 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR6 protein_id gnl|my_center|LOCUS_02010 12478 11996 gene locus_tag LOCUS_02020 12478 11996 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_02020 13014 12475 gene locus_tag LOCUS_02030 13014 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13319 13122 gene locus_tag LOCUS_02040 13319 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence014 <1 1518 gene locus_tag LOCUS_02050 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096762.1:bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase 1898 2512 gene locus_tag LOCUS_02060 1898 2512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380698.1 protein_id gnl|my_center|LOCUS_02060 3163 2513 gene locus_tag LOCUS_02070 3163 2513 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_02070 4288 3215 gene locus_tag LOCUS_02080 4288 3215 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSD8 protein_id gnl|my_center|LOCUS_02080 4515 4354 gene locus_tag LOCUS_02090 4515 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6021 4678 gene locus_tag LOCUS_02100 6021 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8309 6036 gene locus_tag LOCUS_02110 8309 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9367 8606 gene locus_tag LOCUS_02120 gene fabG 9367 8606 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_02120 10900 9518 gene locus_tag LOCUS_02130 10900 9518 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390757.1 protein_id gnl|my_center|LOCUS_02130 12069 10903 gene locus_tag LOCUS_02140 12069 10903 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_02140 12347 12817 gene locus_tag LOCUS_02150 12347 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13392 12976 gene locus_tag LOCUS_02160 13392 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 13523 13873 gene locus_tag LOCUS_02170 13523 13873 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence015 944 1813 gene locus_tag LOCUS_02180 944 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1797 2969 gene locus_tag LOCUS_02190 1797 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4405 3116 gene locus_tag LOCUS_02200 4405 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5060 4422 gene locus_tag LOCUS_02210 5060 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6067 5201 gene locus_tag LOCUS_02220 6067 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 6741 6064 gene locus_tag LOCUS_02230 gene rpoE 6741 6064 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_02230 7290 8489 gene locus_tag LOCUS_02240 7290 8489 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_02240 9147 10988 gene locus_tag LOCUS_02250 9147 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 11041 13581 gene locus_tag LOCUS_02260 11041 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence016 <1 683 gene locus_tag LOCUS_02270 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390754.1:dTDP-glucose 4,6-dehydratase 964 749 gene locus_tag LOCUS_02280 964 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02280 1297 1079 gene locus_tag LOCUS_02290 1297 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02290 1793 2773 gene locus_tag LOCUS_02300 1793 2773 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252926.1 protein_id gnl|my_center|LOCUS_02300 4908 3316 gene locus_tag LOCUS_02310 gene nifA 4908 3316 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_02310 6496 4925 gene locus_tag LOCUS_02320 6496 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6976 7548 gene locus_tag LOCUS_02330 gene rnfA 6976 7548 CDS product electron transport complex subunit RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC6 protein_id gnl|my_center|LOCUS_02330 7571 8098 gene locus_tag LOCUS_02340 gene rnfB 7571 8098 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_02340 8100 9578 gene locus_tag LOCUS_02350 gene rnfC 8100 9578 CDS product electron transport complex subunit RnfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC4 protein_id gnl|my_center|LOCUS_02350 9575 10666 gene locus_tag LOCUS_02360 gene rnfD 9575 10666 CDS product electron transport complex subunit RnfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC3 protein_id gnl|my_center|LOCUS_02360 10678 11322 gene locus_tag LOCUS_02370 10678 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11319 11987 gene locus_tag LOCUS_02380 gene rnfE 11319 11987 CDS product electron transport complex subunit RnfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC1 protein_id gnl|my_center|LOCUS_02380 11998 12261 gene locus_tag LOCUS_02390 gene rnfH 11998 12261 CDS product protein RnfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC0 protein_id gnl|my_center|LOCUS_02390 12434 12510 gene locus_tag LOCUS_t00010 12434 12510 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13179 12835 gene locus_tag LOCUS_02400 13179 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 <13879 13222 gene locus_tag LOCUS_02410 <13879 13222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942015.1:HNH endonuclease >Feature sequence017 1780 389 gene locus_tag LOCUS_02420 1780 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3105 2557 gene locus_tag LOCUS_02430 gene orn 3105 2557 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_02430 3176 4240 gene locus_tag LOCUS_02440 gene rsgA 3176 4240 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_02440 4312 5133 gene locus_tag LOCUS_02450 gene rhdA 4312 5133 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_02450 5272 6192 gene locus_tag LOCUS_02460 gene psd 5272 6192 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_02460 7181 6255 gene locus_tag LOCUS_02470 gene lysS 7181 6255 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 protein_id gnl|my_center|LOCUS_02470 7839 7273 gene locus_tag LOCUS_02480 gene efp 7839 7273 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_02480 7875 8897 gene locus_tag LOCUS_02490 gene yjeK 7875 8897 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 protein_id gnl|my_center|LOCUS_02490 9323 10975 gene locus_tag LOCUS_02500 9323 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_02500 11296 13398 gene locus_tag LOCUS_02510 gene fimX 11296 13398 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_02510 13878 13453 gene locus_tag LOCUS_02520 13878 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence018 <1 590 gene locus_tag LOCUS_02530 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400934.1:5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 831 1217 gene locus_tag LOCUS_02540 gene pcaC 831 1217 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_02540 1218 1961 gene locus_tag LOCUS_02550 1218 1961 CDS product pteridine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_02550 2387 1965 gene locus_tag LOCUS_02560 2387 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2599 4380 gene locus_tag LOCUS_02570 gene recJ 2599 4380 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_02570 4473 4973 gene locus_tag LOCUS_02580 4473 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4983 6806 gene locus_tag LOCUS_02590 4983 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7104 6892 gene locus_tag LOCUS_02600 7104 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7259 8638 gene locus_tag LOCUS_02610 gene fumC1 7259 8638 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51404 protein_id gnl|my_center|LOCUS_02610 9141 8668 gene locus_tag LOCUS_02620 gene ybaK 9141 8668 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT9 protein_id gnl|my_center|LOCUS_02620 9506 9138 gene locus_tag LOCUS_02630 9506 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10233 9511 gene locus_tag LOCUS_02640 10233 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 11363 10383 gene locus_tag LOCUS_02650 gene thiL 11363 10383 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_02650 11939 11439 gene locus_tag LOCUS_02660 gene nusB 11939 11439 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_02660 12421 11945 gene locus_tag LOCUS_02670 gene ribH 12421 11945 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_02670 13610 12492 gene locus_tag LOCUS_02680 gene ribB 13610 12492 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_02680 13803 13621 gene locus_tag LOCUS_02690 13803 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence019 <1 2751 gene locus_tag LOCUS_02700 <1 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206955.1:peptidase M16 2811 3242 gene locus_tag LOCUS_02710 2811 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3281 6019 gene locus_tag LOCUS_02720 3281 6019 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303634.1 protein_id gnl|my_center|LOCUS_02720 6365 6183 gene locus_tag LOCUS_02730 6365 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6661 8319 gene locus_tag LOCUS_02740 6661 8319 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 protein_id gnl|my_center|LOCUS_02740 8316 8924 gene locus_tag LOCUS_02750 8316 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8955 10004 gene locus_tag LOCUS_02760 8955 10004 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_02760 10013 10783 gene locus_tag LOCUS_02770 10013 10783 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_02770 10783 11475 gene locus_tag LOCUS_02780 10783 11475 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602844.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02780 11504 12424 gene locus_tag LOCUS_02790 gene ygbT 11504 12424 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46896 protein_id gnl|my_center|LOCUS_02790 12425 12715 gene locus_tag LOCUS_02800 gene ygbF 12425 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_404470.2 protein_id gnl|my_center|LOCUS_02800 12811 >13802 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccgcacacgcggggctaaaccg >Feature sequence020 939 2072 gene locus_tag LOCUS_02810 939 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2645 2427 gene locus_tag LOCUS_02820 2645 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3259 2657 gene locus_tag LOCUS_02830 3259 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3784 3287 gene locus_tag LOCUS_02840 3784 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4514 3876 gene locus_tag LOCUS_02850 4514 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4759 5667 gene locus_tag LOCUS_02860 4759 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5683 6483 gene locus_tag LOCUS_02870 5683 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7127 6645 gene locus_tag LOCUS_02880 7127 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7858 7253 gene locus_tag LOCUS_02890 7858 7253 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_02890 7957 8814 gene locus_tag LOCUS_02900 7957 8814 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_02900 8915 10936 gene locus_tag LOCUS_02910 gene fadH1 8915 10936 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_02910 <13717 11056 gene locus_tag LOCUS_02920 <13717 11056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228970.1:serine protease >Feature sequence021 2 445 gene locus_tag LOCUS_02930 2 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 463 897 gene locus_tag LOCUS_02940 gene rnhA 463 897 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYE5 protein_id gnl|my_center|LOCUS_02940 894 1589 gene locus_tag LOCUS_02950 gene dnaQ 894 1589 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1H0 protein_id gnl|my_center|LOCUS_02950 2055 1762 gene locus_tag LOCUS_02960 2055 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 2309 2073 gene locus_tag LOCUS_02970 2309 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 2619 2260 gene locus_tag LOCUS_02980 2619 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02980 3226 4869 gene locus_tag LOCUS_02990 gene fimL 3226 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_02990 4882 5520 gene locus_tag LOCUS_03000 4882 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 6126 5812 gene locus_tag LOCUS_03010 6126 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_03010 6519 7589 gene locus_tag LOCUS_03020 6519 7589 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402788.1 protein_id gnl|my_center|LOCUS_03020 8785 7625 gene locus_tag LOCUS_03030 8785 7625 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_03030 9775 9284 gene locus_tag LOCUS_03040 9775 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_03040 11420 9759 gene locus_tag LOCUS_03050 gene cysI 11420 9759 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_03050 11973 11593 gene locus_tag LOCUS_03060 11973 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence022 333 812 gene locus_tag LOCUS_03070 333 812 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_03070 809 1552 gene locus_tag LOCUS_03080 gene znuC 809 1552 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPH6 protein_id gnl|my_center|LOCUS_03080 1549 2343 gene locus_tag LOCUS_03090 gene znuB 1549 2343 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_03090 2581 2348 gene locus_tag LOCUS_03100 2581 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3379 2606 gene locus_tag LOCUS_03110 3379 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_03110 4102 3482 gene locus_tag LOCUS_03120 4102 3482 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266297.1 protein_id gnl|my_center|LOCUS_03120 4144 5478 gene locus_tag LOCUS_03130 gene dinF 4144 5478 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 protein_id gnl|my_center|LOCUS_03130 5776 6405 gene locus_tag LOCUS_03140 5776 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 7297 6368 gene locus_tag LOCUS_03150 7297 6368 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_03150 7435 7974 gene locus_tag LOCUS_03160 7435 7974 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_03160 8015 8590 gene locus_tag LOCUS_03170 8015 8590 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_03170 8723 9349 gene locus_tag LOCUS_03180 8723 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10437 9364 gene locus_tag LOCUS_03190 10437 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11049 10441 gene locus_tag LOCUS_03200 11049 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12730 11084 gene locus_tag LOCUS_03210 12730 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence023 <1 779 gene locus_tag LOCUS_03220 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6E9:thioredoxin reductase 1139 1975 gene locus_tag LOCUS_03230 1139 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755976.1 protein_id gnl|my_center|LOCUS_03230 2012 2338 gene locus_tag LOCUS_03240 2012 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3477 2509 gene locus_tag LOCUS_03250 3477 2509 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207004.1 protein_id gnl|my_center|LOCUS_03250 3745 5235 gene locus_tag LOCUS_03260 3745 5235 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_03260 5440 6738 gene locus_tag LOCUS_03270 gene aspB 5440 6738 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL11 protein_id gnl|my_center|LOCUS_03270 6959 7549 gene locus_tag LOCUS_03280 6959 7549 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254136.1 protein_id gnl|my_center|LOCUS_03280 7574 8737 gene locus_tag LOCUS_03290 7574 8737 CDS product tellurium resistance protein TerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054787.1 protein_id gnl|my_center|LOCUS_03290 8816 9271 gene locus_tag LOCUS_03300 8816 9271 CDS product tellurite resistance TerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371299.1 protein_id gnl|my_center|LOCUS_03300 9281 10309 gene locus_tag LOCUS_03310 9281 10309 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_03310 10378 10950 gene locus_tag LOCUS_03320 10378 10950 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388649.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence024 583 254 gene locus_tag LOCUS_03330 583 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 708 1673 gene locus_tag LOCUS_03340 gene tal 708 1673 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFG6 protein_id gnl|my_center|LOCUS_03340 1756 2631 gene locus_tag LOCUS_03350 1756 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4539 2689 gene locus_tag LOCUS_03360 4539 2689 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_03360 4787 5656 gene locus_tag LOCUS_03370 gene xthA 4787 5656 CDS product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_03370 6162 6509 gene locus_tag LOCUS_03380 gene sypA 6162 6509 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263829.1 protein_id gnl|my_center|LOCUS_03380 6557 7459 gene locus_tag LOCUS_03390 gene sypB 6557 7459 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263830.1 protein_id gnl|my_center|LOCUS_03390 7456 9564 gene locus_tag LOCUS_03400 gene sypC 7456 9564 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_03400 9564 10271 gene locus_tag LOCUS_03410 gene sypD 9564 10271 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263832.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence025 2605 1634 gene locus_tag LOCUS_03420 2605 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3813 2614 gene locus_tag LOCUS_03430 3813 2614 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_03430 5191 4061 gene locus_tag LOCUS_03440 5191 4061 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_03440 6801 5209 gene locus_tag LOCUS_03450 gene gpmI 6801 5209 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF05 protein_id gnl|my_center|LOCUS_03450 7133 7546 gene locus_tag LOCUS_03460 7133 7546 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_03460 7586 8071 gene locus_tag LOCUS_03470 gene secB 7586 8071 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR3 protein_id gnl|my_center|LOCUS_03470 8292 9332 gene locus_tag LOCUS_03480 gene ldh 8292 9332 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_03480 9342 10430 gene locus_tag LOCUS_03490 9342 10430 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_03490 10423 11406 gene locus_tag LOCUS_03500 10423 11406 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence026 8072 7647 gene locus_tag LOCUS_03510 8072 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8446 8075 gene locus_tag LOCUS_03520 8446 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8952 9152 gene locus_tag LOCUS_03530 8952 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10093 9236 gene locus_tag LOCUS_03540 10093 9236 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence027 1085 3199 gene locus_tag LOCUS_03550 gene phuR 1085 3199 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_03550 3663 4763 gene locus_tag LOCUS_03560 gene mdh 3663 4763 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_03560 4923 5441 gene locus_tag LOCUS_03570 4923 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 6954 5566 gene locus_tag LOCUS_03580 6954 5566 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_03580 7506 6958 gene locus_tag LOCUS_03590 7506 6958 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_03590 8660 7608 gene locus_tag LOCUS_03600 8660 7608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence028 1746 604 gene locus_tag LOCUS_03610 1746 604 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_03610 1972 3879 gene locus_tag LOCUS_03620 1972 3879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_03620 3876 4406 gene locus_tag LOCUS_03630 3876 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5393 4668 gene locus_tag LOCUS_03640 gene entB2 5393 4668 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286816.1 protein_id gnl|my_center|LOCUS_03640 5582 5881 gene locus_tag LOCUS_03650 5582 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6036 7436 gene locus_tag LOCUS_03660 6036 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7523 11023 gene locus_tag LOCUS_03670 gene dnaE 7523 11023 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence029 76 1245 gene locus_tag LOCUS_03680 gene der 76 1245 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_03680 1413 2606 gene locus_tag LOCUS_03690 1413 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3143 4651 gene locus_tag LOCUS_03700 3143 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4985 5194 gene locus_tag LOCUS_03710 4985 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5257 5946 gene locus_tag LOCUS_03720 5257 5946 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_03720 6275 6030 gene locus_tag LOCUS_03730 6275 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9021 6364 gene locus_tag LOCUS_03740 gene topA 9021 6364 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_03740 9223 10167 gene locus_tag LOCUS_03750 9223 10167 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719763.1 protein_id gnl|my_center|LOCUS_03750 10974 10078 gene locus_tag LOCUS_03760 10974 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence030 2019 2888 gene locus_tag LOCUS_03770 gene speE 2019 2888 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_03770 3430 3020 gene locus_tag LOCUS_03780 3430 3020 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_03780 4278 3544 gene locus_tag LOCUS_03790 4278 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4479 4661 gene locus_tag LOCUS_03800 4479 4661 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 protein_id gnl|my_center|LOCUS_03800 4683 5000 gene locus_tag LOCUS_03810 4683 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_03810 6037 4997 gene locus_tag LOCUS_03820 6037 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6172 6651 gene locus_tag LOCUS_03830 gene coaD 6172 6651 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_03830 6676 6933 gene locus_tag LOCUS_03840 6676 6933 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_03840 7136 8884 gene locus_tag LOCUS_03850 7136 8884 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_03850 9805 8969 gene locus_tag LOCUS_03860 9805 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10730 9906 gene locus_tag LOCUS_03870 gene mutM 10730 9906 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_03870 10970 10812 gene locus_tag LOCUS_03880 gene rpmG 10970 10812 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_03880 >Feature sequence031 4535 1251 gene locus_tag LOCUS_03890 4535 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5560 4568 gene locus_tag LOCUS_03900 gene tssG 5560 4568 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_03900 7248 5524 gene locus_tag LOCUS_03910 gene tssF 7248 5524 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_03910 7679 7251 gene locus_tag LOCUS_03920 7679 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105491.1 protein_id gnl|my_center|LOCUS_03920 8170 7679 gene locus_tag LOCUS_03930 8170 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9915 8191 gene locus_tag LOCUS_03940 9915 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence032 4054 3512 gene locus_tag LOCUS_03950 4054 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4345 4914 gene locus_tag LOCUS_03960 4345 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4911 5672 gene locus_tag LOCUS_03970 4911 5672 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_03970 5659 6876 gene locus_tag LOCUS_03980 5659 6876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_03980 6886 7704 gene locus_tag LOCUS_03990 6886 7704 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481719.1 protein_id gnl|my_center|LOCUS_03990 7701 9185 gene locus_tag LOCUS_04000 7701 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9173 10411 gene locus_tag LOCUS_04010 9173 10411 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970562.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence033 453 818 gene locus_tag LOCUS_04020 453 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 725 1228 gene locus_tag LOCUS_04030 725 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2030 1242 gene locus_tag LOCUS_04040 2030 1242 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_04040 4083 2449 gene locus_tag LOCUS_04050 4083 2449 CDS product phosphodiesterase/alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601465.1 protein_id gnl|my_center|LOCUS_04050 4334 6664 gene locus_tag LOCUS_04060 4334 6664 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227650.1 protein_id gnl|my_center|LOCUS_04060 8319 6850 gene locus_tag LOCUS_04070 gene gabD 8319 6850 CDS product succinate-semialdehyde dehydrogenase [NADP(+)] GabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25526 protein_id gnl|my_center|LOCUS_04070 8642 10630 gene locus_tag LOCUS_04080 8642 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence034 1877 42 gene locus_tag LOCUS_04090 gene ilvD 1877 42 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 protein_id gnl|my_center|LOCUS_04090 2063 1905 gene locus_tag LOCUS_04100 2063 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2649 2386 gene locus_tag LOCUS_04110 2649 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2686 4371 gene locus_tag LOCUS_04120 gene argS 2686 4371 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_04120 4428 4994 gene locus_tag LOCUS_04130 4428 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_04130 5045 5929 gene locus_tag LOCUS_04140 5045 5929 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_04140 6006 6641 gene locus_tag LOCUS_04150 6006 6641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_04150 7216 6626 gene locus_tag LOCUS_04160 7216 6626 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104095.1 protein_id gnl|my_center|LOCUS_04160 7475 8824 gene locus_tag LOCUS_04170 7475 8824 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_04170 8997 9893 gene locus_tag LOCUS_04180 8997 9893 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267556.1 protein_id gnl|my_center|LOCUS_04180 9918 10601 gene locus_tag LOCUS_04190 9918 10601 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence035 1642 503 gene locus_tag LOCUS_04200 1642 503 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_04200 2856 1669 gene locus_tag LOCUS_04210 2856 1669 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_04210 3003 3779 gene locus_tag LOCUS_04220 3003 3779 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969279.1 protein_id gnl|my_center|LOCUS_04220 3835 4734 gene locus_tag LOCUS_04230 3835 4734 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_04230 4815 5357 gene locus_tag LOCUS_04240 4815 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7277 5358 gene locus_tag LOCUS_04250 7277 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7666 7274 gene locus_tag LOCUS_04260 7666 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10101 8626 gene locus_tag LOCUS_04270 10101 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence036 2367 295 gene locus_tag LOCUS_04280 2367 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2978 2394 gene locus_tag LOCUS_04290 2978 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3519 5030 gene locus_tag LOCUS_04300 3519 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5129 5389 gene locus_tag LOCUS_04310 5129 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5405 8428 gene locus_tag LOCUS_04320 5405 8428 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_04320 8431 9915 gene locus_tag LOCUS_04330 8431 9915 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE6 protein_id gnl|my_center|LOCUS_04330 >Feature sequence037 534 1124 gene locus_tag LOCUS_04340 534 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1941 2177 gene locus_tag LOCUS_04350 1941 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2174 3583 gene locus_tag LOCUS_04360 2174 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3580 5241 gene locus_tag LOCUS_04370 3580 5241 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 protein_id gnl|my_center|LOCUS_04370 5410 5976 gene locus_tag LOCUS_04380 5410 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6645 6046 gene locus_tag LOCUS_04390 6645 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6994 6569 gene locus_tag LOCUS_04400 6994 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7351 7767 gene locus_tag LOCUS_04410 7351 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 7752 8543 gene locus_tag LOCUS_04420 7752 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 8554 9237 gene locus_tag LOCUS_04430 8554 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9248 9484 gene locus_tag LOCUS_04440 9248 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 9493 10737 gene locus_tag LOCUS_04450 9493 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence038 120 3233 gene locus_tag LOCUS_04460 120 3233 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_04460 3482 3318 gene locus_tag LOCUS_04470 3482 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3550 4584 gene locus_tag LOCUS_04480 3550 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 6018 4663 gene locus_tag LOCUS_04490 gene gor 6018 4663 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_04490 6744 6232 gene locus_tag LOCUS_04500 6744 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 7958 6741 gene locus_tag LOCUS_04510 7958 6741 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TC9 protein_id gnl|my_center|LOCUS_04510 9064 8036 gene locus_tag LOCUS_04520 gene xcpX 9064 8036 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_04520 9790 9068 gene locus_tag LOCUS_04530 gene xcpW 9790 9068 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_04530 10182 9787 gene locus_tag LOCUS_04540 gene gspI 10182 9787 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820136.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence039 <1 1196 gene locus_tag LOCUS_04550 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWP5:DNA mismatch repair protein MutS 1677 2000 gene locus_tag LOCUS_04560 gene fdxA 1677 2000 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736188.1 protein_id gnl|my_center|LOCUS_04560 3085 2129 gene locus_tag LOCUS_04570 gene rpoS 3085 2129 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_04570 4107 3202 gene locus_tag LOCUS_04580 4107 3202 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_04580 5030 4164 gene locus_tag LOCUS_04590 5030 4164 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_04590 5814 5143 gene locus_tag LOCUS_04600 gene pcm 5814 5143 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_04600 6557 5814 gene locus_tag LOCUS_04610 gene surE 6557 5814 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR36 protein_id gnl|my_center|LOCUS_04610 7567 6557 gene locus_tag LOCUS_04620 gene truD 7567 6557 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_04620 8080 7607 gene locus_tag LOCUS_04630 gene ispF 8080 7607 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_04630 8811 8107 gene locus_tag LOCUS_04640 gene ispD 8811 8107 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_04640 9143 8814 gene locus_tag LOCUS_04650 9143 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10459 9164 gene locus_tag LOCUS_04660 gene eno 10459 9164 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR0 protein_id gnl|my_center|LOCUS_04660 >Feature sequence040 38 334 gene locus_tag LOCUS_04670 38 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 389 808 gene locus_tag LOCUS_04680 389 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 909 1487 gene locus_tag LOCUS_04690 909 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1487 2071 gene locus_tag LOCUS_04700 1487 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2080 2748 gene locus_tag LOCUS_04710 2080 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2789 5533 gene locus_tag LOCUS_04720 2789 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5536 6720 gene locus_tag LOCUS_04730 5536 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6813 9830 gene locus_tag LOCUS_04740 6813 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence041 1218 2417 gene locus_tag LOCUS_04750 1218 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2428 4608 gene locus_tag LOCUS_04760 2428 4608 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_04760 4630 5541 gene locus_tag LOCUS_04770 4630 5541 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 protein_id gnl|my_center|LOCUS_04770 5932 6408 gene locus_tag LOCUS_04780 5932 6408 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947530.1 protein_id gnl|my_center|LOCUS_04780 6556 7596 gene locus_tag LOCUS_04790 gene recA 6556 7596 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_04790 7577 8068 gene locus_tag LOCUS_04800 gene recX 7577 8068 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_04800 8566 8363 gene locus_tag LOCUS_04810 8566 8363 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence042 133 1584 gene locus_tag LOCUS_04820 133 1584 CDS product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868839.1 protein_id gnl|my_center|LOCUS_04820 1598 3808 gene locus_tag LOCUS_04830 1598 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4024 4671 gene locus_tag LOCUS_04840 4024 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4679 6409 gene locus_tag LOCUS_04850 4679 6409 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_04850 7166 6513 gene locus_tag LOCUS_04860 7166 6513 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_04860 7261 7815 gene locus_tag LOCUS_04870 7261 7815 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 protein_id gnl|my_center|LOCUS_04870 7812 8828 gene locus_tag LOCUS_04880 gene ansA 7812 8828 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_04880 <10437 8884 gene locus_tag LOCUS_04890 <10437 8884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705620.1:alkyl hydroperoxide reductase subunit F >Feature sequence043 2259 1249 gene locus_tag LOCUS_04900 gene hemB 2259 1249 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_04900 5166 2509 gene locus_tag LOCUS_04910 5166 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5132 5263 gene locus_tag LOCUS_04920 5132 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6013 5303 gene locus_tag LOCUS_04930 gene rpiA 6013 5303 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_04930 6103 7632 gene locus_tag LOCUS_04940 gene ilvA1 6103 7632 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_04940 7975 7655 gene locus_tag LOCUS_04950 7975 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_04950 8608 8045 gene locus_tag LOCUS_04960 8608 8045 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 protein_id gnl|my_center|LOCUS_04960 9331 8747 gene locus_tag LOCUS_04970 9331 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_04970 10171 9398 gene locus_tag LOCUS_04980 10171 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence044 678 424 gene locus_tag LOCUS_04990 678 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 885 1379 gene locus_tag LOCUS_05000 885 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1387 2085 gene locus_tag LOCUS_05010 gene modB 1387 2085 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739341.1 protein_id gnl|my_center|LOCUS_05010 2082 3182 gene locus_tag LOCUS_05020 gene modC 2082 3182 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_05020 3464 3210 gene locus_tag LOCUS_05030 3464 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3872 3465 gene locus_tag LOCUS_05040 3872 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4405 3872 gene locus_tag LOCUS_05050 4405 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4844 4392 gene locus_tag LOCUS_05060 4844 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5581 4838 gene locus_tag LOCUS_05070 5581 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5878 5612 gene locus_tag LOCUS_05080 5878 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6581 5844 gene locus_tag LOCUS_05090 6581 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6806 6585 gene locus_tag LOCUS_05100 6806 6585 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_05100 8570 6990 gene locus_tag LOCUS_05110 gene nifK 8570 6990 CDS product nitrogenase molybdenum-iron protein beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20621 protein_id gnl|my_center|LOCUS_05110 <10019 8659 gene locus_tag LOCUS_05120 <10019 8659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P06121:nitrogenase molybdenum-iron protein alpha chain >Feature sequence045 920 297 gene locus_tag LOCUS_05130 920 297 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_05130 1853 1017 gene locus_tag LOCUS_05140 1853 1017 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_05140 1921 2526 gene locus_tag LOCUS_05150 1921 2526 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V24 protein_id gnl|my_center|LOCUS_05150 2530 2829 gene locus_tag LOCUS_05160 gene yciL 2530 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_05160 2863 3534 gene locus_tag LOCUS_05170 2863 3534 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 protein_id gnl|my_center|LOCUS_05170 3573 4199 gene locus_tag LOCUS_05180 3573 4199 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XUS0 protein_id gnl|my_center|LOCUS_05180 5024 4191 gene locus_tag LOCUS_05190 5024 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_05190 5169 7262 gene locus_tag LOCUS_05200 gene mnmC 5169 7262 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_05200 7564 7304 gene locus_tag LOCUS_05210 7564 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7997 7554 gene locus_tag LOCUS_05220 7997 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_05220 <9930 8268 gene locus_tag LOCUS_05230 <9930 8268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390166.1:class I poly(R)-hydroxyalkanoic acid synthase >Feature sequence046 689 249 gene locus_tag LOCUS_05240 689 249 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_05240 967 686 gene locus_tag LOCUS_05250 967 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2257 1106 gene locus_tag LOCUS_05260 gene rnd 2257 1106 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_05260 2781 2254 gene locus_tag LOCUS_05270 2781 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3214 2888 gene locus_tag LOCUS_05280 3214 2888 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_05280 5285 3216 gene locus_tag LOCUS_05290 gene dnaX 5285 3216 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_05290 5791 5558 gene locus_tag LOCUS_05300 5791 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6660 6391 gene locus_tag LOCUS_05310 6660 6391 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 protein_id gnl|my_center|LOCUS_05310 6801 9281 gene locus_tag LOCUS_05320 6801 9281 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 protein_id gnl|my_center|LOCUS_05320 9916 9521 gene locus_tag LOCUS_05330 9916 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence047 667 368 gene locus_tag LOCUS_05340 667 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_05340 1989 853 gene locus_tag LOCUS_05350 gene cydB 1989 853 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168027.1 protein_id gnl|my_center|LOCUS_05350 3621 1999 gene locus_tag LOCUS_05360 gene cydA 3621 1999 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707370.1 protein_id gnl|my_center|LOCUS_05360 3919 3611 gene locus_tag LOCUS_05370 3919 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4077 5459 gene locus_tag LOCUS_05380 4077 5459 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_05380 5549 6394 gene locus_tag LOCUS_05390 5549 6394 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_05390 6401 7393 gene locus_tag LOCUS_05400 6401 7393 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_05400 7394 7879 gene locus_tag LOCUS_05410 7394 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7879 9156 gene locus_tag LOCUS_05420 7879 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9682 9272 gene locus_tag LOCUS_05430 gene rplQ 9682 9272 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_05430 >Feature sequence048 427 1161 gene locus_tag LOCUS_05440 gene pgl 427 1161 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_05440 1272 1922 gene locus_tag LOCUS_05450 1272 1922 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_05450 1963 3639 gene locus_tag LOCUS_05460 gene pgi 1963 3639 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44312 protein_id gnl|my_center|LOCUS_05460 3641 4105 gene locus_tag LOCUS_05470 gene mgsA 3641 4105 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ID3 protein_id gnl|my_center|LOCUS_05470 5136 4216 gene locus_tag LOCUS_05480 gene mtlR 5136 4216 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_05480 6857 5481 gene locus_tag LOCUS_05490 gene dalD 6857 5481 CDS product D-arabinitol 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526241.1 protein_id gnl|my_center|LOCUS_05490 7959 6859 gene locus_tag LOCUS_05500 7959 6859 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972797.1 protein_id gnl|my_center|LOCUS_05500 8827 7994 gene locus_tag LOCUS_05510 8827 7994 CDS product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382858.1 protein_id gnl|my_center|LOCUS_05510 <9508 8830 gene locus_tag LOCUS_05520 <9508 8830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105364.1:binding-protein-dependent maltose/mannitol transporter >Feature sequence049 389 87 gene locus_tag LOCUS_05530 389 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2230 674 gene locus_tag LOCUS_05540 2230 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3247 2324 gene locus_tag LOCUS_05550 gene btuF 3247 2324 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_05550 3843 3244 gene locus_tag LOCUS_05560 3843 3244 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_05560 5387 3918 gene locus_tag LOCUS_05570 gene cobQ 5387 3918 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLL6 protein_id gnl|my_center|LOCUS_05570 6079 5456 gene locus_tag LOCUS_05580 6079 5456 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480583.1 protein_id gnl|my_center|LOCUS_05580 6663 6079 gene locus_tag LOCUS_05590 gene cobU 6663 6079 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215857.1 protein_id gnl|my_center|LOCUS_05590 7481 6660 gene locus_tag LOCUS_05600 gene cobS 7481 6660 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q45 protein_id gnl|my_center|LOCUS_05600 8577 7474 gene locus_tag LOCUS_05610 gene cobT 8577 7474 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q46 protein_id gnl|my_center|LOCUS_05610 <9475 8747 gene locus_tag LOCUS_05620 <9475 8747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114019.1:ABC transporter permease >Feature sequence050 839 228 gene locus_tag LOCUS_05630 839 228 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_05630 2638 839 gene locus_tag LOCUS_05640 2638 839 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_05640 2615 2857 gene locus_tag LOCUS_05650 2615 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2939 6388 gene locus_tag LOCUS_05660 2939 6388 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_05660 7119 6448 gene locus_tag LOCUS_05670 7119 6448 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_05670 9292 7343 gene locus_tag LOCUS_05680 gene acsA 9292 7343 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K7 protein_id gnl|my_center|LOCUS_05680 >Feature sequence051 308 946 gene locus_tag LOCUS_05690 308 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 946 1869 gene locus_tag LOCUS_05700 946 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3353 2136 gene locus_tag LOCUS_05710 gene argG 3353 2136 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_05710 3584 8755 gene locus_tag LOCUS_05720 3584 8755 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_05720 9212 8775 gene locus_tag LOCUS_05730 9212 8775 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence052 1278 583 gene locus_tag LOCUS_05740 1278 583 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_05740 1682 1281 gene locus_tag LOCUS_05750 gene yjfI 1682 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 protein_id gnl|my_center|LOCUS_05750 1823 2110 gene locus_tag LOCUS_05760 1823 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3077 2190 gene locus_tag LOCUS_05770 gene htpX 3077 2190 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT1 protein_id gnl|my_center|LOCUS_05770 3457 3726 gene locus_tag LOCUS_05780 3457 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4693 3728 gene locus_tag LOCUS_05790 gene thrB 4693 3728 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZS7 protein_id gnl|my_center|LOCUS_05790 5078 4764 gene locus_tag LOCUS_05800 5078 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5153 7930 gene locus_tag LOCUS_05810 gene polA 5153 7930 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_05810 8864 8199 gene locus_tag LOCUS_05820 gene engB 8864 8199 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG0 protein_id gnl|my_center|LOCUS_05820 9008 9307 gene locus_tag LOCUS_05830 9008 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence053 583 1068 gene locus_tag LOCUS_05840 583 1068 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_05840 1144 2301 gene locus_tag LOCUS_05850 gene iscS 1144 2301 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_05850 2426 2851 gene locus_tag LOCUS_05860 gene ndk 2426 2851 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_05860 2936 4048 gene locus_tag LOCUS_05870 gene rlmN 2936 4048 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_05870 4077 4862 gene locus_tag LOCUS_05880 gene pilF 4077 4862 CDS product type 4 fimbrial biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_05880 4864 5973 gene locus_tag LOCUS_05890 gene ispG 4864 5973 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_05890 6030 7310 gene locus_tag LOCUS_05900 gene hisS 6030 7310 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_05900 7339 8004 gene locus_tag LOCUS_05910 7339 8004 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_05910 8001 9209 gene locus_tag LOCUS_05920 gene bamB 8001 9209 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX20 protein_id gnl|my_center|LOCUS_05920 >Feature sequence054 933 106 gene locus_tag LOCUS_05930 933 106 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 protein_id gnl|my_center|LOCUS_05930 1376 930 gene locus_tag LOCUS_05940 1376 930 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266742.1 protein_id gnl|my_center|LOCUS_05940 2992 1373 gene locus_tag LOCUS_05950 gene phrB 2992 1373 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_05950 3965 2985 gene locus_tag LOCUS_05960 3965 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4963 3962 gene locus_tag LOCUS_05970 4963 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_05970 5684 5307 gene locus_tag LOCUS_05980 5684 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6687 5701 gene locus_tag LOCUS_05990 6687 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_05990 6896 7810 gene locus_tag LOCUS_06000 6896 7810 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence055 2116 1610 gene locus_tag LOCUS_06010 2116 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2630 2127 gene locus_tag LOCUS_06020 2630 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3682 2600 gene locus_tag LOCUS_06030 3682 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4392 3664 gene locus_tag LOCUS_06040 4392 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4797 7052 gene locus_tag LOCUS_06050 gene parC 4797 7052 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SJ2 protein_id gnl|my_center|LOCUS_06050 7732 7172 gene locus_tag LOCUS_06060 7732 7172 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_06060 >Feature sequence056 1911 1180 gene locus_tag LOCUS_06070 1911 1180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_06070 2422 1886 gene locus_tag LOCUS_06080 gene lptA 2422 1886 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ13 protein_id gnl|my_center|LOCUS_06080 2963 2409 gene locus_tag LOCUS_06090 2963 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3940 2963 gene locus_tag LOCUS_06100 gene kdsD 3940 2963 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_06100 4904 3942 gene locus_tag LOCUS_06110 4904 3942 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_06110 5171 5983 gene locus_tag LOCUS_06120 gene mlaF 5171 5983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_06120 5987 6769 gene locus_tag LOCUS_06130 5987 6769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_06130 6772 7233 gene locus_tag LOCUS_06140 6772 7233 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_06140 7243 7911 gene locus_tag LOCUS_06150 7243 7911 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 protein_id gnl|my_center|LOCUS_06150 7913 8227 gene locus_tag LOCUS_06160 7913 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8395 8631 gene locus_tag LOCUS_06170 8395 8631 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence057 767 1261 gene locus_tag LOCUS_06180 767 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1243 2592 gene locus_tag LOCUS_06190 1243 2592 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_06190 2607 3593 gene locus_tag LOCUS_06200 gene folE2 2607 3593 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_06200 3608 4168 gene locus_tag LOCUS_06210 3608 4168 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262761.1 protein_id gnl|my_center|LOCUS_06210 5003 4344 gene locus_tag LOCUS_06220 5003 4344 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_06220 6391 5009 gene locus_tag LOCUS_06230 6391 5009 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128510.1 protein_id gnl|my_center|LOCUS_06230 7775 6483 gene locus_tag LOCUS_06240 7775 6483 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_06240 8302 7772 gene locus_tag LOCUS_06250 8302 7772 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_06250 <9073 8532 gene locus_tag LOCUS_06260 <9073 8532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483136.1:ABC transporter substrate-binding protein >Feature sequence058 <1 2099 gene locus_tag LOCUS_06270 <1 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44569:NAD 5'-nucleotidase 3531 2197 gene locus_tag LOCUS_06280 gene dgt2 3531 2197 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG5 protein_id gnl|my_center|LOCUS_06280 3865 4128 gene locus_tag LOCUS_06290 3865 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_06290 4143 5924 gene locus_tag LOCUS_06300 4143 5924 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_06300 6064 6315 gene locus_tag LOCUS_06310 6064 6315 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_06310 6329 7039 gene locus_tag LOCUS_06320 6329 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8598 7108 gene locus_tag LOCUS_06330 gene ilvC 8598 7108 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_06330 >Feature sequence059 88 12 gene locus_tag LOCUS_t00020 88 12 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1236 331 gene locus_tag LOCUS_06340 1236 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2165 1356 gene locus_tag LOCUS_06350 2165 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205304.1 protein_id gnl|my_center|LOCUS_06350 3017 2178 gene locus_tag LOCUS_06360 gene pheA 3017 2178 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_06360 3339 4313 gene locus_tag LOCUS_06370 3339 4313 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_06370 4343 5206 gene locus_tag LOCUS_06380 gene yedP 4343 5206 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65418 protein_id gnl|my_center|LOCUS_06380 5199 6413 gene locus_tag LOCUS_06390 5199 6413 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_06390 8287 6527 gene locus_tag LOCUS_06400 8287 6527 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence060 1223 840 gene locus_tag LOCUS_06410 gene crcB 1223 840 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_06410 2711 1278 gene locus_tag LOCUS_06420 2711 1278 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_06420 3348 2701 gene locus_tag LOCUS_06430 gene lolA 3348 2701 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_06430 6283 3464 gene locus_tag LOCUS_06440 6283 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6425 7153 gene locus_tag LOCUS_06450 gene aat 6425 7153 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_06450 7150 7857 gene locus_tag LOCUS_06460 gene ate 7150 7857 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_06460 7919 8137 gene locus_tag LOCUS_06470 gene infA 7919 8137 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_06470 8393 8175 gene locus_tag LOCUS_06480 8393 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 <8972 8448 gene locus_tag LOCUS_06490 <8972 8448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317954.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence061 1749 772 gene locus_tag LOCUS_06500 gene oppB 1749 772 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_06500 3974 1749 gene locus_tag LOCUS_06510 gene hbpA 3974 1749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_06510 4363 4193 gene locus_tag LOCUS_06520 4363 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4362 5897 gene locus_tag LOCUS_06530 4362 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5927 6670 gene locus_tag LOCUS_06540 5927 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 7596 6712 gene locus_tag LOCUS_06550 7596 6712 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_06550 7876 8745 gene locus_tag LOCUS_06560 gene menA 7876 8745 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFQ9 protein_id gnl|my_center|LOCUS_06560 >Feature sequence062 <1 781 gene locus_tag LOCUS_06570 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314166.1:inositol monophosphatase 1307 864 gene locus_tag LOCUS_06580 1307 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1589 1849 gene locus_tag LOCUS_06590 1589 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2666 1881 gene locus_tag LOCUS_06600 gene rsmJ 2666 1881 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_06600 3540 2743 gene locus_tag LOCUS_06610 gene uppP 3540 2743 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_06610 4254 3553 gene locus_tag LOCUS_06620 gene yeaZ 4254 3553 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 protein_id gnl|my_center|LOCUS_06620 5043 4390 gene locus_tag LOCUS_06630 gene adk 5043 4390 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_06630 8022 5374 gene locus_tag LOCUS_06640 gene ppc 8022 5374 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV3 protein_id gnl|my_center|LOCUS_06640 <8748 8175 gene locus_tag LOCUS_06650 <8748 8175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103676.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence063 705 2735 gene locus_tag LOCUS_06660 gene uvrB 705 2735 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C9 protein_id gnl|my_center|LOCUS_06660 4444 2837 gene locus_tag LOCUS_06670 gene cysNC 4444 2837 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_06670 5355 4444 gene locus_tag LOCUS_06680 gene cysD 5355 4444 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_06680 5583 6212 gene locus_tag LOCUS_06690 5583 6212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_06690 6372 7490 gene locus_tag LOCUS_06700 gene zapE 6372 7490 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX0 protein_id gnl|my_center|LOCUS_06700 8017 7526 gene locus_tag LOCUS_06710 8017 7526 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_06710 8143 8427 gene locus_tag LOCUS_06720 8143 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8518 8432 gene locus_tag LOCUS_t00030 8518 8432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8659 8573 gene locus_tag LOCUS_t00040 8659 8573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 2198 1512 gene locus_tag LOCUS_06730 gene gacA 2198 1512 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_06730 2555 2364 gene locus_tag LOCUS_06740 2555 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5526 2812 gene locus_tag LOCUS_06750 5526 2812 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_06750 5604 6527 gene locus_tag LOCUS_06760 5604 6527 CDS product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926822.1 protein_id gnl|my_center|LOCUS_06760 8255 6738 gene locus_tag LOCUS_06770 8255 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence065 470 778 gene locus_tag LOCUS_06780 gene arsR2 470 778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817071.1 protein_id gnl|my_center|LOCUS_06780 942 1658 gene locus_tag LOCUS_06790 gene arsH 942 1658 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_06790 1977 2576 gene locus_tag LOCUS_06800 1977 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_06800 2630 3106 gene locus_tag LOCUS_06810 2630 3106 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR1 protein_id gnl|my_center|LOCUS_06810 3410 5491 gene locus_tag LOCUS_06820 3410 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6893 5517 gene locus_tag LOCUS_06830 gene pabB 6893 5517 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261800.1 protein_id gnl|my_center|LOCUS_06830 7113 7961 gene locus_tag LOCUS_06840 7113 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 8383 8003 gene locus_tag LOCUS_06850 8383 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence066 984 1436 gene locus_tag LOCUS_06860 984 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257815.1 protein_id gnl|my_center|LOCUS_06860 1631 1365 gene locus_tag LOCUS_06870 1631 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1668 2450 gene locus_tag LOCUS_06880 1668 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2555 3694 gene locus_tag LOCUS_06890 gene dacC 2555 3694 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_06890 3708 4010 gene locus_tag LOCUS_06900 3708 4010 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_06900 4010 4660 gene locus_tag LOCUS_06910 gene lipB 4010 4660 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_06910 4788 5759 gene locus_tag LOCUS_06920 gene lipA 4788 5759 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_06920 6125 5886 gene locus_tag LOCUS_06930 6125 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_06930 6646 6215 gene locus_tag LOCUS_06940 gene trxC 6646 6215 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_06940 7285 6758 gene locus_tag LOCUS_06950 7285 6758 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_06950 <8457 7321 gene locus_tag LOCUS_06960 <8457 7321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAE0:magnesium transporter MgtE >Feature sequence067 470 1219 gene locus_tag LOCUS_06970 gene ubiE 470 1219 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_06970 1219 1842 gene locus_tag LOCUS_06980 1219 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_06980 1839 3476 gene locus_tag LOCUS_06990 gene ubiB 1839 3476 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF8 protein_id gnl|my_center|LOCUS_06990 3526 3906 gene locus_tag LOCUS_07000 gene hisI 3526 3906 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_07000 3924 4256 gene locus_tag LOCUS_07010 gene hisE 3924 4256 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_07010 4310 4651 gene locus_tag LOCUS_07020 gene hitA 4310 4651 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_07020 4684 4962 gene locus_tag LOCUS_07030 4684 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4962 5348 gene locus_tag LOCUS_07040 gene tatB 4962 5348 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG9 protein_id gnl|my_center|LOCUS_07040 5345 6088 gene locus_tag LOCUS_07050 gene tatC 5345 6088 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH0 protein_id gnl|my_center|LOCUS_07050 6153 7313 gene locus_tag LOCUS_07060 gene metX 6153 7313 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_07060 7310 7933 gene locus_tag LOCUS_07070 7310 7933 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_07070 7930 8376 gene locus_tag LOCUS_07080 7930 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence068 470 1366 gene locus_tag LOCUS_07090 gene ureD 470 1366 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU9 protein_id gnl|my_center|LOCUS_07090 1597 1899 gene locus_tag LOCUS_07100 gene ureA 1597 1899 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 protein_id gnl|my_center|LOCUS_07100 2028 4100 gene locus_tag LOCUS_07110 gene ureC 2028 4100 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42885 protein_id gnl|my_center|LOCUS_07110 4162 4671 gene locus_tag LOCUS_07120 gene ureE 4162 4671 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS2 protein_id gnl|my_center|LOCUS_07120 4580 5404 gene locus_tag LOCUS_07130 gene ureF 4580 5404 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_07130 5449 6096 gene locus_tag LOCUS_07140 gene ureG 5449 6096 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_07140 6113 6355 gene locus_tag LOCUS_07150 6113 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8081 6441 gene locus_tag LOCUS_07160 8081 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence069 1268 927 gene locus_tag LOCUS_07170 1268 927 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_07170 1638 2777 gene locus_tag LOCUS_07180 gene apbE 1638 2777 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ0 protein_id gnl|my_center|LOCUS_07180 2792 3025 gene locus_tag LOCUS_07190 2792 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3178 4569 gene locus_tag LOCUS_07200 gene sthA 3178 4569 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_07200 6129 4672 gene locus_tag LOCUS_07210 gene thiI 6129 4672 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_07210 6614 7360 gene locus_tag LOCUS_07220 gene phaB 6614 7360 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946794.1 protein_id gnl|my_center|LOCUS_07220 <8363 7403 gene locus_tag LOCUS_07230 <8363 7403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947587.1:integrase >Feature sequence070 <1 540 gene locus_tag LOCUS_07240 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MK83:dITP/XTP pyrophosphatase 634 1182 gene locus_tag LOCUS_07250 634 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1273 2412 gene locus_tag LOCUS_07260 1273 2412 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_07260 3498 2548 gene locus_tag LOCUS_07270 3498 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7079 3687 gene locus_tag LOCUS_07280 7079 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7633 7250 gene locus_tag LOCUS_07290 gene ectC 7633 7250 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 protein_id gnl|my_center|LOCUS_07290 8342 7725 gene locus_tag LOCUS_07300 8342 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence071 142 1626 gene locus_tag LOCUS_07310 gene ubiD 142 1626 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_07310 1626 2690 gene locus_tag LOCUS_07320 1626 2690 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 protein_id gnl|my_center|LOCUS_07320 3003 4247 gene locus_tag LOCUS_07330 3003 4247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_07330 4401 5666 gene locus_tag LOCUS_07340 4401 5666 CDS product branched-chain amino acid ABC transporter -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819485.1 protein_id gnl|my_center|LOCUS_07340 6856 5660 gene locus_tag LOCUS_07350 6856 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_07350 8313 6853 gene locus_tag LOCUS_07360 8313 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence072 <1 604 gene locus_tag LOCUS_07370 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXY4:outer membrane protein assembly factor BamA 678 1175 gene locus_tag LOCUS_07380 gene skp 678 1175 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_07380 1189 2211 gene locus_tag LOCUS_07390 gene lpxD 1189 2211 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_07390 2211 2675 gene locus_tag LOCUS_07400 gene fabZ 2211 2675 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_07400 2672 3442 gene locus_tag LOCUS_07410 gene lpxA 2672 3442 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_07410 3442 4578 gene locus_tag LOCUS_07420 gene lpxB 3442 4578 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N0 protein_id gnl|my_center|LOCUS_07420 4658 5278 gene locus_tag LOCUS_07430 gene rnhB 4658 5278 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_07430 6102 5275 gene locus_tag LOCUS_07440 6102 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 6308 7507 gene locus_tag LOCUS_07450 6308 7507 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762954.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence073 <1 1515 gene locus_tag LOCUS_07460 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939561.1:SAM-dependent methyltransferase 1523 1780 gene locus_tag LOCUS_07470 1523 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1947 2846 gene locus_tag LOCUS_07480 1947 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2857 3741 gene locus_tag LOCUS_07490 2857 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4463 3981 gene locus_tag LOCUS_07500 4463 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5490 4618 gene locus_tag LOCUS_07510 5490 4618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708536.1 protein_id gnl|my_center|LOCUS_07510 6011 5487 gene locus_tag LOCUS_07520 6011 5487 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 protein_id gnl|my_center|LOCUS_07520 6607 6044 gene locus_tag LOCUS_07530 6607 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence074 <1 601 gene locus_tag LOCUS_07540 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267143.1:biopolymer transporter ExbB 598 1020 gene locus_tag LOCUS_07550 598 1020 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602633.2 protein_id gnl|my_center|LOCUS_07550 1010 2767 gene locus_tag LOCUS_07560 gene msbA 1010 2767 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_07560 2770 3765 gene locus_tag LOCUS_07570 gene lpxK 2770 3765 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 protein_id gnl|my_center|LOCUS_07570 3758 3982 gene locus_tag LOCUS_07580 3758 3982 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_07580 3972 4472 gene locus_tag LOCUS_07590 gene ptpA 3972 4472 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_07590 4545 5552 gene locus_tag LOCUS_07600 gene murB 4545 5552 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDZ8 protein_id gnl|my_center|LOCUS_07600 6317 5556 gene locus_tag LOCUS_07610 gene lpxH 6317 5556 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XCU1 protein_id gnl|my_center|LOCUS_07610 6816 6319 gene locus_tag LOCUS_07620 gene ppiB 6816 6319 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_07620 >Feature sequence075 1114 716 gene locus_tag LOCUS_07630 1114 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1332 2909 gene locus_tag LOCUS_07640 1332 2909 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_07640 4154 2946 gene locus_tag LOCUS_07650 4154 2946 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_07650 4549 4322 gene locus_tag LOCUS_07660 4549 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4729 6078 gene locus_tag LOCUS_07670 4729 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6568 6059 gene locus_tag LOCUS_07680 6568 6059 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_07680 <8081 6640 gene locus_tag LOCUS_07690 <8081 6640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWG0:UvrABC system protein A >Feature sequence076 886 470 gene locus_tag LOCUS_07700 886 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1124 864 gene locus_tag LOCUS_07710 1124 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_07710 1554 2357 gene locus_tag LOCUS_07720 1554 2357 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_07720 2354 3028 gene locus_tag LOCUS_07730 2354 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3025 3441 gene locus_tag LOCUS_07740 3025 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4817 3501 gene locus_tag LOCUS_07750 4817 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5449 4817 gene locus_tag LOCUS_07760 gene tonB2 5449 4817 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_07760 5862 5452 gene locus_tag LOCUS_07770 5862 5452 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_07770 6401 5880 gene locus_tag LOCUS_07780 6401 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479627.1 protein_id gnl|my_center|LOCUS_07780 7780 6407 gene locus_tag LOCUS_07790 gene ttpC 7780 6407 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence077 3213 196 gene locus_tag LOCUS_07800 gene soxA-2 3213 196 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104013.1 protein_id gnl|my_center|LOCUS_07800 3503 3210 gene locus_tag LOCUS_07810 gene soxD-2 3503 3210 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_07810 4889 3633 gene locus_tag LOCUS_07820 4889 3633 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_07820 5774 4911 gene locus_tag LOCUS_07830 gene folD2 5774 4911 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA4 protein_id gnl|my_center|LOCUS_07830 6650 5784 gene locus_tag LOCUS_07840 gene purU 6650 5784 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA3 protein_id gnl|my_center|LOCUS_07840 <8012 6890 gene locus_tag LOCUS_07850 <8012 6890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003367224.1:FMN-binding glutamate synthase family protein >Feature sequence078 1207 755 gene locus_tag LOCUS_07860 1207 755 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171857.1 protein_id gnl|my_center|LOCUS_07860 2648 1254 gene locus_tag LOCUS_07870 gene hemN 2648 1254 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_07870 3113 3850 gene locus_tag LOCUS_07880 3113 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3943 4647 gene locus_tag LOCUS_07890 gene ccmA 3943 4647 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_07890 4644 5312 gene locus_tag LOCUS_07900 gene ccmB 4644 5312 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_07900 5325 6071 gene locus_tag LOCUS_07910 gene ccmC 5325 6071 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_07910 6071 6262 gene locus_tag LOCUS_07920 gene ccmD 6071 6262 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z06 protein_id gnl|my_center|LOCUS_07920 6264 6725 gene locus_tag LOCUS_07930 gene ccmE 6264 6725 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_07930 >Feature sequence079 1625 2248 gene locus_tag LOCUS_07940 1625 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112304.1 protein_id gnl|my_center|LOCUS_07940 3229 2330 gene locus_tag LOCUS_07950 3229 2330 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 protein_id gnl|my_center|LOCUS_07950 3358 3969 gene locus_tag LOCUS_07960 gene drga 3358 3969 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_07960 4187 4056 gene locus_tag LOCUS_07970 4187 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4434 4234 gene locus_tag LOCUS_07980 4434 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5045 4569 gene locus_tag LOCUS_07990 5045 4569 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_07990 5646 5209 gene locus_tag LOCUS_08000 5646 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_08000 7176 5929 gene locus_tag LOCUS_08010 7176 5929 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_08010 7834 7367 gene locus_tag LOCUS_08020 7834 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence080 2643 1480 gene locus_tag LOCUS_08030 gene pqqE 2643 1480 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A84 protein_id gnl|my_center|LOCUS_08030 2905 2615 gene locus_tag LOCUS_08040 gene pqqD 2905 2615 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_08040 3702 2905 gene locus_tag LOCUS_08050 gene pqqC 3702 2905 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_08050 4770 3853 gene locus_tag LOCUS_08060 gene pqqB 4770 3853 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C3 protein_id gnl|my_center|LOCUS_08060 5317 5613 gene locus_tag LOCUS_08070 5317 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5754 7820 gene locus_tag LOCUS_08080 5754 7820 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence081 3185 2517 gene locus_tag LOCUS_08090 3185 2517 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765300.1 protein_id gnl|my_center|LOCUS_08090 3999 5129 gene locus_tag LOCUS_08100 3999 5129 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_08100 5976 5152 gene locus_tag LOCUS_08110 5976 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 <7743 6135 gene locus_tag LOCUS_08120 <7743 6135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L >Feature sequence082 1280 291 gene locus_tag LOCUS_08130 gene alc 1280 291 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J8 protein_id gnl|my_center|LOCUS_08130 2236 1277 gene locus_tag LOCUS_08140 2236 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_08140 2497 3012 gene locus_tag LOCUS_08150 gene allA 2497 3012 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YX3 protein_id gnl|my_center|LOCUS_08150 3051 4061 gene locus_tag LOCUS_08160 3051 4061 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889J2 protein_id gnl|my_center|LOCUS_08160 4598 5992 gene locus_tag LOCUS_08170 4598 5992 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 protein_id gnl|my_center|LOCUS_08170 6146 6793 gene locus_tag LOCUS_08180 6146 6793 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_08180 7453 6920 gene locus_tag LOCUS_08190 7453 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence083 2635 782 gene locus_tag LOCUS_08200 gene pbpA 2635 782 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_08200 3110 2643 gene locus_tag LOCUS_08210 gene rlmH 3110 2643 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV9 protein_id gnl|my_center|LOCUS_08210 3463 3107 gene locus_tag LOCUS_08220 gene rsfS 3463 3107 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_08220 4111 3464 gene locus_tag LOCUS_08230 gene nadD 4111 3464 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN51 protein_id gnl|my_center|LOCUS_08230 5367 4111 gene locus_tag LOCUS_08240 gene proA 5367 4111 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_08240 5503 6444 gene locus_tag LOCUS_08250 5503 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6441 7418 gene locus_tag LOCUS_08260 6441 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 7684 7442 gene locus_tag LOCUS_08270 7684 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence084 898 350 gene locus_tag LOCUS_08280 898 350 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_08280 2414 1104 gene locus_tag LOCUS_08290 2414 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2616 4727 gene locus_tag LOCUS_08300 2616 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4753 5382 gene locus_tag LOCUS_08310 4753 5382 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence085 2362 1619 gene locus_tag LOCUS_08320 2362 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3118 2378 gene locus_tag LOCUS_08330 3118 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4008 3130 gene locus_tag LOCUS_08340 4008 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4847 4029 gene locus_tag LOCUS_08350 4847 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6641 4857 gene locus_tag LOCUS_08360 6641 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence086 1129 572 gene locus_tag LOCUS_08370 gene frr 1129 572 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_08370 1866 1132 gene locus_tag LOCUS_08380 gene pyrH 1866 1132 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_08380 2822 1968 gene locus_tag LOCUS_08390 gene tsf 2822 1968 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82851 protein_id gnl|my_center|LOCUS_08390 3667 2915 gene locus_tag LOCUS_08400 gene rpsB 3667 2915 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_08400 3999 4778 gene locus_tag LOCUS_08410 gene map 3999 4778 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence087 59 1225 gene locus_tag LOCUS_08420 59 1225 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_08420 1212 1796 gene locus_tag LOCUS_08430 1212 1796 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_08430 2947 1913 gene locus_tag LOCUS_08440 gene dinB 2947 1913 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_08440 3124 3492 gene locus_tag LOCUS_08450 3124 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3485 4147 gene locus_tag LOCUS_08460 gene minC 3485 4147 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE14 protein_id gnl|my_center|LOCUS_08460 4178 4984 gene locus_tag LOCUS_08470 gene minD 4178 4984 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_08470 4986 5240 gene locus_tag LOCUS_08480 gene minE 4986 5240 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_08480 6337 5354 gene locus_tag LOCUS_08490 6337 5354 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_08490 7048 6416 gene locus_tag LOCUS_08500 7048 6416 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence088 1084 347 gene locus_tag LOCUS_08510 gene tpiA 1084 347 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_08510 2530 1193 gene locus_tag LOCUS_08520 gene glmM 2530 1193 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_08520 3360 2533 gene locus_tag LOCUS_08530 gene folP 3360 2533 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_08530 5376 3451 gene locus_tag LOCUS_08540 gene ftsH 5376 3451 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_08540 6096 5479 gene locus_tag LOCUS_08550 gene rlmE 6096 5479 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_08550 6210 6509 gene locus_tag LOCUS_08560 6210 6509 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_08560 6886 6527 gene locus_tag LOCUS_08570 6886 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence089 1324 1680 gene locus_tag LOCUS_08580 1324 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1716 2045 gene locus_tag LOCUS_08590 1716 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2298 2702 gene locus_tag LOCUS_08600 2298 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3314 3009 gene locus_tag LOCUS_08610 3314 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3707 4264 gene locus_tag LOCUS_08620 3707 4264 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_08620 4495 4995 gene locus_tag LOCUS_08630 4495 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5407 6720 gene locus_tag LOCUS_08640 gene terA 5407 6720 CDS product tellurium resistance protein TerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103358.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence090 2033 765 gene locus_tag LOCUS_08650 2033 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2432 2076 gene locus_tag LOCUS_08660 2432 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3073 2561 gene locus_tag LOCUS_08670 3073 2561 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_08670 3400 4365 gene locus_tag LOCUS_08680 3400 4365 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_08680 7199 4440 gene locus_tag LOCUS_08690 gene rapA 7199 4440 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDT5 protein_id gnl|my_center|LOCUS_08690 >Feature sequence091 <1 629 gene locus_tag LOCUS_08700 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001253659.1:tellurium resistance protein TerY 661 1704 gene locus_tag LOCUS_08710 661 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253656.1 protein_id gnl|my_center|LOCUS_08710 1704 3791 gene locus_tag LOCUS_08720 1704 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3807 5312 gene locus_tag LOCUS_08730 3807 5312 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_08730 6430 5513 gene locus_tag LOCUS_08740 6430 5513 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797363.1 protein_id gnl|my_center|LOCUS_08740 7235 6432 gene locus_tag LOCUS_08750 7235 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence092 92 811 gene locus_tag LOCUS_08760 92 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1025 1384 gene locus_tag LOCUS_08770 1025 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1492 2121 gene locus_tag LOCUS_08780 1492 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_08780 2784 2140 gene locus_tag LOCUS_08790 2784 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3291 3545 gene locus_tag LOCUS_08800 3291 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4373 3645 gene locus_tag LOCUS_08810 4373 3645 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_08810 6811 4370 gene locus_tag LOCUS_08820 6811 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence093 827 45 gene locus_tag LOCUS_08830 827 45 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_08830 2188 1157 gene locus_tag LOCUS_08840 gene dapD 2188 1157 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P9 protein_id gnl|my_center|LOCUS_08840 2572 2228 gene locus_tag LOCUS_08850 2572 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3358 2666 gene locus_tag LOCUS_08860 3358 2666 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_08860 3896 3369 gene locus_tag LOCUS_08870 3896 3369 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_08870 4148 3924 gene locus_tag LOCUS_08880 4148 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4617 4258 gene locus_tag LOCUS_08890 4617 4258 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_08890 5892 4663 gene locus_tag LOCUS_08900 5892 4663 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_08900 <7232 5892 gene locus_tag LOCUS_08910 <7232 5892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958176.1:Fe-S cluster assembly protein SufD >Feature sequence094 459 1214 gene locus_tag LOCUS_08920 459 1214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_08920 1312 2520 gene locus_tag LOCUS_08930 1312 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040237.1 protein_id gnl|my_center|LOCUS_08930 2643 3527 gene locus_tag LOCUS_08940 2643 3527 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 protein_id gnl|my_center|LOCUS_08940 3529 4494 gene locus_tag LOCUS_08950 3529 4494 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_08950 4530 6176 gene locus_tag LOCUS_08960 4530 6176 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_08960 7137 6388 gene locus_tag LOCUS_08970 7137 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence095 1 882 gene locus_tag LOCUS_08980 1 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1064 1660 gene locus_tag LOCUS_08990 1064 1660 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946823.1 protein_id gnl|my_center|LOCUS_08990 1957 1730 gene locus_tag LOCUS_09000 1957 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2728 2048 gene locus_tag LOCUS_09010 2728 2048 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_09010 3301 2822 gene locus_tag LOCUS_09020 3301 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_09020 3957 3370 gene locus_tag LOCUS_09030 3957 3370 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_09030 4095 5045 gene locus_tag LOCUS_09040 4095 5045 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930749.1 protein_id gnl|my_center|LOCUS_09040 5738 6067 gene locus_tag LOCUS_09050 5738 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence096 <1 717 gene locus_tag LOCUS_09060 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVM6:putrescine-binding periplasmic protein 786 1973 gene locus_tag LOCUS_09070 786 1973 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM7 protein_id gnl|my_center|LOCUS_09070 1983 2933 gene locus_tag LOCUS_09080 1983 2933 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 protein_id gnl|my_center|LOCUS_09080 2930 3727 gene locus_tag LOCUS_09090 2930 3727 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_09090 3805 4551 gene locus_tag LOCUS_09100 3805 4551 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 protein_id gnl|my_center|LOCUS_09100 4708 5211 gene locus_tag LOCUS_09110 4708 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 6824 5325 gene locus_tag LOCUS_09120 6824 5325 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence097 156 2546 gene locus_tag LOCUS_09130 gene lon 156 2546 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_09130 2657 2935 gene locus_tag LOCUS_09140 gene hupB 2657 2935 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_09140 3078 4919 gene locus_tag LOCUS_09150 gene ppiD 3078 4919 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_09150 6704 5064 gene locus_tag LOCUS_09160 6704 5064 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_09160 >Feature sequence098 <1 974 gene locus_tag LOCUS_09170 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203961.1:phosphoesterase 2417 1044 gene locus_tag LOCUS_09180 2417 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4695 2791 gene locus_tag LOCUS_09190 4695 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5786 4692 gene locus_tag LOCUS_09200 5786 4692 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105843.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence099 475 1107 gene locus_tag LOCUS_09210 475 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1380 2285 gene locus_tag LOCUS_09220 1380 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2973 2257 gene locus_tag LOCUS_09230 2973 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3625 3137 gene locus_tag LOCUS_09240 gene lrp 3625 3137 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038732.1 protein_id gnl|my_center|LOCUS_09240 3875 5131 gene locus_tag LOCUS_09250 gene dadA 3875 5131 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q9 protein_id gnl|my_center|LOCUS_09250 5223 5612 gene locus_tag LOCUS_09260 5223 5612 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_09260 5639 6724 gene locus_tag LOCUS_09270 gene alr 5639 6724 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4R0 protein_id gnl|my_center|LOCUS_09270 >Feature sequence100 <1 1371 gene locus_tag LOCUS_09280 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8XEW9:bifunctional protein HldE 1368 2327 gene locus_tag LOCUS_09290 gene hldD 1368 2327 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_09290 2332 3246 gene locus_tag LOCUS_09300 gene lpxL 2332 3246 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_09300 4713 3268 gene locus_tag LOCUS_09310 4713 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5424 4930 gene locus_tag LOCUS_09320 5424 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 <7064 5530 gene locus_tag LOCUS_09330 <7064 5530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096276.1:secretion pathway ATPase >Feature sequence101 431 1096 gene locus_tag LOCUS_09340 431 1096 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_09340 2168 1305 gene locus_tag LOCUS_09350 2168 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_09350 3111 2437 gene locus_tag LOCUS_09360 3111 2437 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 protein_id gnl|my_center|LOCUS_09360 3184 3597 gene locus_tag LOCUS_09370 3184 3597 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_09370 4811 3606 gene locus_tag LOCUS_09380 4811 3606 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_09380 5442 4819 gene locus_tag LOCUS_09390 5442 4819 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_09390 6869 5577 gene locus_tag LOCUS_09400 6869 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence102 1546 737 gene locus_tag LOCUS_09410 gene lgt 1546 737 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_09410 2470 1637 gene locus_tag LOCUS_09420 2470 1637 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_09420 2557 3354 gene locus_tag LOCUS_09430 2557 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_09430 6136 3329 gene locus_tag LOCUS_09440 gene ptsP 6136 3329 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence103 381 1232 gene locus_tag LOCUS_09450 gene purU1 381 1232 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_09450 1819 4791 gene locus_tag LOCUS_09460 1819 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4812 6737 gene locus_tag LOCUS_09470 4812 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence104 668 120 gene locus_tag LOCUS_09480 668 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 1254 976 gene locus_tag LOCUS_09490 1254 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2269 1340 gene locus_tag LOCUS_09500 2269 1340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_09500 2377 3261 gene locus_tag LOCUS_09510 2377 3261 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 protein_id gnl|my_center|LOCUS_09510 3318 3539 gene locus_tag LOCUS_09520 3318 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3530 4687 gene locus_tag LOCUS_09530 3530 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4703 5221 gene locus_tag LOCUS_09540 4703 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5218 6291 gene locus_tag LOCUS_09550 gene apbE 5218 6291 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_09550 <7022 6288 gene locus_tag LOCUS_09560 <7022 6288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086032.1:transcriptional regulator >Feature sequence105 629 1879 gene locus_tag LOCUS_09570 629 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1867 2889 gene locus_tag LOCUS_09580 1867 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2953 3966 gene locus_tag LOCUS_09590 gene hemH 2953 3966 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL51 protein_id gnl|my_center|LOCUS_09590 4339 4614 gene locus_tag LOCUS_09600 4339 4614 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_09600 4776 5336 gene locus_tag LOCUS_09610 gene tadA 4776 5336 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX04 protein_id gnl|my_center|LOCUS_09610 6756 5317 gene locus_tag LOCUS_09620 gene mltF 6756 5317 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_09620 >Feature sequence106 377 1219 gene locus_tag LOCUS_09630 377 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1216 1464 gene locus_tag LOCUS_09640 1216 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_09640 1505 2413 gene locus_tag LOCUS_09650 1505 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368470.1 protein_id gnl|my_center|LOCUS_09650 2443 5088 gene locus_tag LOCUS_09660 gene pepN 2443 5088 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_09660 5108 6439 gene locus_tag LOCUS_09670 5108 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence107 1786 710 gene locus_tag LOCUS_09680 gene paaE 1786 710 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_09680 2358 1825 gene locus_tag LOCUS_09690 gene paaD 2358 1825 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_09690 3106 2345 gene locus_tag LOCUS_09700 3106 2345 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969776.1 protein_id gnl|my_center|LOCUS_09700 3396 3115 gene locus_tag LOCUS_09710 gene paaB 3396 3115 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_09710 4415 3426 gene locus_tag LOCUS_09720 gene paaA 4415 3426 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_09720 5935 4628 gene locus_tag LOCUS_09730 gene paaA 5935 4628 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_09730 <6976 6069 gene locus_tag LOCUS_09740 <6976 6069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931117.1:acetyl-CoA acetyltransferase >Feature sequence108 <1 607 gene locus_tag LOCUS_09750 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877484.1:metallophosphoesterase 4412 693 gene locus_tag LOCUS_09760 4412 693 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_09760 5060 4416 gene locus_tag LOCUS_09770 5060 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6628 5099 gene locus_tag LOCUS_09780 6628 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence109 <1 976 gene locus_tag LOCUS_09790 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401947.1:peptidase M23 976 2058 gene locus_tag LOCUS_09800 gene anmK 976 2058 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_09800 2462 2118 gene locus_tag LOCUS_09810 gene erpA 2462 2118 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_09810 2954 2535 gene locus_tag LOCUS_09820 2954 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3691 2954 gene locus_tag LOCUS_09830 3691 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635878.2 protein_id gnl|my_center|LOCUS_09830 4763 3732 gene locus_tag LOCUS_09840 gene argC 4763 3732 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_09840 4969 6690 gene locus_tag LOCUS_09850 4969 6690 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence110 464 658 gene locus_tag LOCUS_09860 464 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_09860 1280 873 gene locus_tag LOCUS_09870 1280 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1667 1885 gene locus_tag LOCUS_09880 1667 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2050 4260 gene locus_tag LOCUS_09890 gene fdhF 2050 4260 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_09890 4937 5353 gene locus_tag LOCUS_09900 4937 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5697 5368 gene locus_tag LOCUS_09910 5697 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 6122 5712 gene locus_tag LOCUS_09920 6122 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence111 169 2235 gene locus_tag LOCUS_09930 gene pta 169 2235 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_09930 2335 3228 gene locus_tag LOCUS_09940 2335 3228 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_09940 3349 4296 gene locus_tag LOCUS_09950 3349 4296 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ7 protein_id gnl|my_center|LOCUS_09950 4779 4402 gene locus_tag LOCUS_09960 4779 4402 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_09960 5336 4902 gene locus_tag LOCUS_09970 gene dtd 5336 4902 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE4 protein_id gnl|my_center|LOCUS_09970 >Feature sequence112 1542 2180 gene locus_tag LOCUS_09980 1542 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2453 4735 gene locus_tag LOCUS_09990 2453 4735 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_09990 4732 6141 gene locus_tag LOCUS_10000 4732 6141 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence113 <1 1221 gene locus_tag LOCUS_10010 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83BM9:glutamyl-tRNA(Gln) amidotransferase subunit A 1232 2695 gene locus_tag LOCUS_10020 gene gatB 1232 2695 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_10020 3467 2895 gene locus_tag LOCUS_10030 3467 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4713 3709 gene locus_tag LOCUS_10040 gene mauG 4713 3709 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_10040 <6711 4929 gene locus_tag LOCUS_10050 <6711 4929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P35818:type II secretion system protein D >Feature sequence114 <1 726 gene locus_tag LOCUS_10060 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198009.1:molybdopterin biosynthesis protein MoeB 995 2269 gene locus_tag LOCUS_10070 gene sqr 995 2269 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_10070 2988 2404 gene locus_tag LOCUS_10080 gene gmhA 2988 2404 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_10080 3441 3070 gene locus_tag LOCUS_10090 3441 3070 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 protein_id gnl|my_center|LOCUS_10090 5427 3589 gene locus_tag LOCUS_10100 5427 3589 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_10100 5444 6286 gene locus_tag LOCUS_10110 gene rsmI 5444 6286 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ3 protein_id gnl|my_center|LOCUS_10110 >Feature sequence115 1071 409 gene locus_tag LOCUS_10120 1071 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400369.1 protein_id gnl|my_center|LOCUS_10120 2536 1199 gene locus_tag LOCUS_10130 2536 1199 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244018.1 protein_id gnl|my_center|LOCUS_10130 2629 3954 gene locus_tag LOCUS_10140 2629 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_10140 4880 4008 gene locus_tag LOCUS_10150 gene oxyR 4880 4008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_10150 4979 5704 gene locus_tag LOCUS_10160 4979 5704 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_10160 5760 6344 gene locus_tag LOCUS_10170 5760 6344 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence116 397 1593 gene locus_tag LOCUS_10180 397 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2633 1590 gene locus_tag LOCUS_10190 2633 1590 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_10190 3031 4944 gene locus_tag LOCUS_10200 3031 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence117 <1 1191 gene locus_tag LOCUS_10210 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706760.1:copper transporter 1172 4327 gene locus_tag LOCUS_10220 gene cusA 1172 4327 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_10220 4364 4978 gene locus_tag LOCUS_10230 4364 4978 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261123.1 protein_id gnl|my_center|LOCUS_10230 5814 6374 gene locus_tag LOCUS_10240 5814 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence118 1381 554 gene locus_tag LOCUS_10250 1381 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2126 1464 gene locus_tag LOCUS_10260 2126 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4012 2624 gene locus_tag LOCUS_10270 gene dctM 4012 2624 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_10270 4554 4012 gene locus_tag LOCUS_10280 gene dctQ 4554 4012 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS0 protein_id gnl|my_center|LOCUS_10280 5125 5742 gene locus_tag LOCUS_10290 5125 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 <6631 5921 gene locus_tag LOCUS_10300 <6631 5921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000332950.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence119 <1 1521 gene locus_tag LOCUS_10310 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87V04:primosomal protein N' 1544 2008 gene locus_tag LOCUS_10320 gene pgpA 1544 2008 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_10320 2184 2828 gene locus_tag LOCUS_10330 gene ribA 2184 2828 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY6 protein_id gnl|my_center|LOCUS_10330 4715 2829 gene locus_tag LOCUS_10340 gene dxs 4715 2829 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q1 protein_id gnl|my_center|LOCUS_10340 5781 4900 gene locus_tag LOCUS_10350 gene ispA 5781 4900 CDS product farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45204 protein_id gnl|my_center|LOCUS_10350 6155 5781 gene locus_tag LOCUS_10360 6155 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6528 6298 gene locus_tag LOCUS_10370 6528 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence120 1441 191 gene locus_tag LOCUS_10380 gene lysA 1441 191 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_10380 2989 1733 gene locus_tag LOCUS_10390 gene pyrC' 2989 1733 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_10390 3984 2986 gene locus_tag LOCUS_10400 gene pyrB 3984 2986 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ70 protein_id gnl|my_center|LOCUS_10400 4522 4010 gene locus_tag LOCUS_10410 gene pyrR 4522 4010 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_10410 4989 4519 gene locus_tag LOCUS_10420 4989 4519 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ68 protein_id gnl|my_center|LOCUS_10420 5549 4992 gene locus_tag LOCUS_10430 5549 4992 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ9 protein_id gnl|my_center|LOCUS_10430 6433 5549 gene locus_tag LOCUS_10440 6433 5549 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence121 909 289 gene locus_tag LOCUS_10450 gene yceF 909 289 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58628 protein_id gnl|my_center|LOCUS_10450 1579 995 gene locus_tag LOCUS_10460 1579 995 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_10460 1926 2639 gene locus_tag LOCUS_10470 1926 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2973 4487 gene locus_tag LOCUS_10480 2973 4487 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_10480 >Feature sequence122 915 1385 gene locus_tag LOCUS_10490 915 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1976 2362 gene locus_tag LOCUS_10500 1976 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 2274 2567 gene locus_tag LOCUS_10510 2274 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10510 2567 2731 gene locus_tag LOCUS_10520 2567 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4025 2844 gene locus_tag LOCUS_10530 4025 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483628.1 protein_id gnl|my_center|LOCUS_10530 4649 4026 gene locus_tag LOCUS_10540 4649 4026 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098745.1 protein_id gnl|my_center|LOCUS_10540 5064 4663 gene locus_tag LOCUS_10550 5064 4663 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_10550 5732 5088 gene locus_tag LOCUS_10560 5732 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037961.1 protein_id gnl|my_center|LOCUS_10560 6427 5735 gene locus_tag LOCUS_10570 6427 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence123 2889 1954 gene locus_tag LOCUS_10580 2889 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_10580 4349 2889 gene locus_tag LOCUS_10590 4349 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_10590 4950 6281 gene locus_tag LOCUS_10600 4950 6281 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390266.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence124 268 495 gene locus_tag LOCUS_10610 268 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1308 733 gene locus_tag LOCUS_10620 1308 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112773.1 protein_id gnl|my_center|LOCUS_10620 1809 1324 gene locus_tag LOCUS_10630 1809 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3805 2105 gene locus_tag LOCUS_10640 3805 2105 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_10640 4109 3792 gene locus_tag LOCUS_10650 4109 3792 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 protein_id gnl|my_center|LOCUS_10650 4246 5109 gene locus_tag LOCUS_10660 4246 5109 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_10660 6129 5191 gene locus_tag LOCUS_10670 gene rbgA 6129 5191 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_10670 >Feature sequence125 520 1317 gene locus_tag LOCUS_10680 520 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1922 1671 gene locus_tag LOCUS_10690 1922 1671 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_10690 2163 2387 gene locus_tag LOCUS_10700 2163 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3456 2425 gene locus_tag LOCUS_10710 gene oruR 3456 2425 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_10710 3818 4996 gene locus_tag LOCUS_10720 3818 4996 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence126 1794 358 gene locus_tag LOCUS_10730 gene cpeA 1794 358 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74V83 protein_id gnl|my_center|LOCUS_10730 2085 4793 gene locus_tag LOCUS_10740 2085 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4987 6183 gene locus_tag LOCUS_10750 4987 6183 CDS product aldose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172946.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence127 1906 500 gene locus_tag LOCUS_10760 1906 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2776 2009 gene locus_tag LOCUS_10770 2776 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2986 3741 gene locus_tag LOCUS_10780 2986 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405233.1 protein_id gnl|my_center|LOCUS_10780 5169 3871 gene locus_tag LOCUS_10790 gene hom 5169 3871 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_10790 <6328 5268 gene locus_tag LOCUS_10800 <6328 5268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404530.1:aminotransferase >Feature sequence128 63 587 gene locus_tag LOCUS_10810 63 587 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_10810 572 1639 gene locus_tag LOCUS_10820 gene nagZ 572 1639 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEW2 protein_id gnl|my_center|LOCUS_10820 1662 2411 gene locus_tag LOCUS_10830 1662 2411 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_10830 3290 2493 gene locus_tag LOCUS_10840 3290 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881637.1 protein_id gnl|my_center|LOCUS_10840 <6291 3321 gene locus_tag LOCUS_10850 <6291 3321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK3:transcription-repair-coupling factor >Feature sequence129 259 2895 gene locus_tag LOCUS_10860 259 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_10860 2897 3790 gene locus_tag LOCUS_10870 2897 3790 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_10870 3854 4192 gene locus_tag LOCUS_10880 3854 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5363 4272 gene locus_tag LOCUS_10890 5363 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 <6291 5568 gene locus_tag LOCUS_10900 <6291 5568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073256.1:GGDEF domain-containing protein >Feature sequence130 1554 3059 gene locus_tag LOCUS_10910 gene nifB 1554 3059 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06770 protein_id gnl|my_center|LOCUS_10910 3072 3350 gene locus_tag LOCUS_10920 3072 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3360 3806 gene locus_tag LOCUS_10930 3360 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_10930 3803 4444 gene locus_tag LOCUS_10940 3803 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4454 5236 gene locus_tag LOCUS_10950 4454 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5250 5585 gene locus_tag LOCUS_10960 5250 5585 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL7 protein_id gnl|my_center|LOCUS_10960 5582 5845 gene locus_tag LOCUS_10970 5582 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence131 <1 1480 gene locus_tag LOCUS_10980 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107154.1:lytic transglycosylase F 1603 2628 gene locus_tag LOCUS_10990 1603 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3063 2845 gene locus_tag LOCUS_11000 3063 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4291 3128 gene locus_tag LOCUS_11010 4291 3128 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_11010 4586 5734 gene locus_tag LOCUS_11020 4586 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence132 1065 1856 gene locus_tag LOCUS_11030 1065 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2562 1858 gene locus_tag LOCUS_11040 2562 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3372 2677 gene locus_tag LOCUS_11050 3372 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4588 3362 gene locus_tag LOCUS_11060 4588 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4802 4653 gene locus_tag LOCUS_11070 4802 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4956 5657 gene locus_tag LOCUS_11080 4956 5657 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence133 1095 595 gene locus_tag LOCUS_11090 gene ccoH 1095 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_11090 2629 1223 gene locus_tag LOCUS_11100 2629 1223 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_11100 3837 2914 gene locus_tag LOCUS_11110 gene ccoP1 3837 2914 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_11110 4016 3840 gene locus_tag LOCUS_11120 4016 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4629 4021 gene locus_tag LOCUS_11130 gene ccoO1 4629 4021 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_11130 6040 4643 gene locus_tag LOCUS_11140 gene ccoN2 6040 4643 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence134 1123 566 gene locus_tag LOCUS_11150 gene hslV 1123 566 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_11150 1424 2008 gene locus_tag LOCUS_11160 1424 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2130 3662 gene locus_tag LOCUS_11170 2130 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202021.1 protein_id gnl|my_center|LOCUS_11170 4221 3733 gene locus_tag LOCUS_11180 4221 3733 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_11180 5718 4240 gene locus_tag LOCUS_11190 gene Ada 5718 4240 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence135 <1 762 gene locus_tag LOCUS_11200 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529454.1:transporter 1156 2196 gene locus_tag LOCUS_11210 1156 2196 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_11210 2315 3136 gene locus_tag LOCUS_11220 2315 3136 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413041.1 protein_id gnl|my_center|LOCUS_11220 3133 3960 gene locus_tag LOCUS_11230 3133 3960 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_11230 4038 4754 gene locus_tag LOCUS_11240 4038 4754 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_11240 4757 5455 gene locus_tag LOCUS_11250 4757 5455 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence136 874 1338 gene locus_tag LOCUS_11260 874 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1755 1679 gene locus_tag LOCUS_t00050 1755 1679 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2191 1826 gene locus_tag LOCUS_11270 2191 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_11270 2474 2166 gene locus_tag LOCUS_11280 gene ihfA 2474 2166 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_11280 4852 2477 gene locus_tag LOCUS_11290 gene pheT 4852 2477 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_11290 5870 4866 gene locus_tag LOCUS_11300 gene pheS 5870 4866 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_11300 >Feature sequence137 806 2467 gene locus_tag LOCUS_11310 806 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_11310 2464 3033 gene locus_tag LOCUS_11320 gene lolB 2464 3033 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_11320 3026 3892 gene locus_tag LOCUS_11330 gene ispE 3026 3892 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 protein_id gnl|my_center|LOCUS_11330 3896 3970 gene locus_tag LOCUS_t00060 3896 3970 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4020 4961 gene locus_tag LOCUS_11340 gene prs 4020 4961 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX2 protein_id gnl|my_center|LOCUS_11340 5058 5675 gene locus_tag LOCUS_11350 gene rplY 5058 5675 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_11350 >Feature sequence138 <1 2223 gene locus_tag LOCUS_11360 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105204.1:penicillin-binding protein 1C 2506 3543 gene locus_tag LOCUS_11370 gene pyrC 2506 3543 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_11370 3602 4237 gene locus_tag LOCUS_11380 gene rnt 3602 4237 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP36 protein_id gnl|my_center|LOCUS_11380 4242 4607 gene locus_tag LOCUS_11390 4242 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 protein_id gnl|my_center|LOCUS_11390 5012 4689 gene locus_tag LOCUS_11400 gene nirD-2 5012 4689 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_11400 <5900 5023 gene locus_tag LOCUS_11410 <5900 5023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104464.1:nitrite reductase large subunit >Feature sequence139 1 1857 gene locus_tag LOCUS_11420 1 1857 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_11420 1875 2126 gene locus_tag LOCUS_11430 1875 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_11430 2123 2803 gene locus_tag LOCUS_11440 2123 2803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_11440 3018 3671 gene locus_tag LOCUS_11450 gene anr 3018 3671 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_11450 4110 3787 gene locus_tag LOCUS_11460 4110 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence140 2112 4106 gene locus_tag LOCUS_11470 gene tktA 2112 4106 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_11470 4297 4740 gene locus_tag LOCUS_11480 4297 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5367 4822 gene locus_tag LOCUS_11490 5367 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence141 425 916 gene locus_tag LOCUS_11500 425 916 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_11500 1404 2072 gene locus_tag LOCUS_11510 1404 2072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103931.1 protein_id gnl|my_center|LOCUS_11510 2069 2950 gene locus_tag LOCUS_11520 gene prpB 2069 2950 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P70 protein_id gnl|my_center|LOCUS_11520 3060 4193 gene locus_tag LOCUS_11530 gene prpC 3060 4193 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_11530 >Feature sequence142 758 267 gene locus_tag LOCUS_11540 gene paaI 758 267 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_11540 2295 748 gene locus_tag LOCUS_11550 2295 748 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_11550 3089 2298 gene locus_tag LOCUS_11560 gene paaG 3089 2298 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_11560 3914 3129 gene locus_tag LOCUS_11570 3914 3129 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096757.1 protein_id gnl|my_center|LOCUS_11570 4366 4953 gene locus_tag LOCUS_11580 4366 4953 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence143 447 1946 gene locus_tag LOCUS_11590 447 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1939 3522 gene locus_tag LOCUS_11600 1939 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3536 4069 gene locus_tag LOCUS_11610 3536 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence144 892 497 gene locus_tag LOCUS_11620 892 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1607 906 gene locus_tag LOCUS_11630 1607 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_11630 2282 1635 gene locus_tag LOCUS_11640 2282 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 protein_id gnl|my_center|LOCUS_11640 2564 3388 gene locus_tag LOCUS_11650 2564 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3419 4087 gene locus_tag LOCUS_11660 3419 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4406 4149 gene locus_tag LOCUS_11670 4406 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 4517 4891 gene locus_tag LOCUS_11680 4517 4891 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 protein_id gnl|my_center|LOCUS_11680 4908 5120 gene locus_tag LOCUS_11690 4908 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence145 1791 1087 gene locus_tag LOCUS_11700 1791 1087 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_11700 2460 1948 gene locus_tag LOCUS_11710 2460 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_11710 2584 3531 gene locus_tag LOCUS_11720 2584 3531 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_11720 4102 3713 gene locus_tag LOCUS_11730 4102 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 5109 4174 gene locus_tag LOCUS_11740 gene nahR 5109 4174 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_11740 <5790 5161 gene locus_tag LOCUS_11750 <5790 5161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269166.1:peptidase S9 >Feature sequence146 944 306 gene locus_tag LOCUS_11760 944 306 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_11760 1072 2292 gene locus_tag LOCUS_11770 1072 2292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_11770 3044 2313 gene locus_tag LOCUS_11780 3044 2313 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_11780 4178 3144 gene locus_tag LOCUS_11790 4178 3144 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_11790 4635 5135 gene locus_tag LOCUS_11800 4635 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence147 972 427 gene locus_tag LOCUS_11810 972 427 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_11810 1145 2611 gene locus_tag LOCUS_11820 gene cyaB 1145 2611 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_11820 3310 2720 gene locus_tag LOCUS_11830 gene nfuA 3310 2720 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_11830 >Feature sequence148 3839 2649 gene locus_tag LOCUS_11840 gene mexE 3839 2649 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_11840 5356 4346 gene locus_tag LOCUS_11850 5356 4346 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence149 <1 3858 gene locus_tag LOCUS_11860 <1 3858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZE0:NAD-specific glutamate dehydrogenase 3970 4806 gene locus_tag LOCUS_11870 3970 4806 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_11870 <5706 4810 gene locus_tag LOCUS_11880 <5706 4810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769324.1:GntR family transcriptional regulator >Feature sequence150 934 56 gene locus_tag LOCUS_11890 934 56 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_11890 1107 3275 gene locus_tag LOCUS_11900 gene uvrD 1107 3275 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_11900 3891 3481 gene locus_tag LOCUS_11910 3891 3481 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535335.1 protein_id gnl|my_center|LOCUS_11910 4323 5168 gene locus_tag LOCUS_11920 4323 5168 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence151 2265 430 gene locus_tag LOCUS_11930 2265 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2660 3130 gene locus_tag LOCUS_11940 2660 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3140 4177 gene locus_tag LOCUS_11950 3140 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4180 4677 gene locus_tag LOCUS_11960 4180 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4945 5388 gene locus_tag LOCUS_11970 gene ytoQ 4945 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_11970 >Feature sequence152 131 2953 gene locus_tag LOCUS_11980 gene sucA 131 2953 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_11980 2986 4179 gene locus_tag LOCUS_11990 gene sucB 2986 4179 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_11990 4203 5648 gene locus_tag LOCUS_12000 gene lpdG 4203 5648 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence153 <1 1545 gene locus_tag LOCUS_12010 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2Q2:methionine synthase 1631 2938 gene locus_tag LOCUS_12020 gene norM 1631 2938 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_12020 2999 3808 gene locus_tag LOCUS_12030 gene ugpQ 2999 3808 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947983.1 protein_id gnl|my_center|LOCUS_12030 3912 4703 gene locus_tag LOCUS_12040 3912 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5224 5574 gene locus_tag LOCUS_12050 5224 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence154 <1 945 gene locus_tag LOCUS_12060 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44224:Mu-like prophage FluMu protein gp28 945 2522 gene locus_tag LOCUS_12070 945 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070990.1 protein_id gnl|my_center|LOCUS_12070 2509 3411 gene locus_tag LOCUS_12080 2509 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3404 3856 gene locus_tag LOCUS_12090 gene gpG 3404 3856 CDS product phage morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070993.1 protein_id gnl|my_center|LOCUS_12090 3898 4611 gene locus_tag LOCUS_12100 3898 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence155 307 2184 gene locus_tag LOCUS_12110 307 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2698 2240 gene locus_tag LOCUS_12120 2698 2240 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_12120 3200 2991 gene locus_tag LOCUS_12130 3200 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3219 3413 gene locus_tag LOCUS_12140 3219 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3630 4760 gene locus_tag LOCUS_12150 3630 4760 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 protein_id gnl|my_center|LOCUS_12150 5588 5298 gene locus_tag LOCUS_12160 5588 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence156 <1 1298 gene locus_tag LOCUS_12170 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118484.1:peptidase M50 1298 3244 gene locus_tag LOCUS_12180 1298 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3343 4809 gene locus_tag LOCUS_12190 3343 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence157 2109 1657 gene locus_tag LOCUS_12200 2109 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_12200 3476 2289 gene locus_tag LOCUS_12210 3476 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433346.1 protein_id gnl|my_center|LOCUS_12210 4134 3736 gene locus_tag LOCUS_12220 4134 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence158 106 1185 gene locus_tag LOCUS_12230 gene purK 106 1185 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_12230 1218 1772 gene locus_tag LOCUS_12240 1218 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_12240 3094 1889 gene locus_tag LOCUS_12250 3094 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_12250 3903 3097 gene locus_tag LOCUS_12260 3903 3097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_12260 <5605 3878 gene locus_tag LOCUS_12270 <5605 3878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105802.1:RND transporter >Feature sequence159 3571 1487 gene locus_tag LOCUS_12280 3571 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4468 3932 gene locus_tag LOCUS_12290 4468 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5123 4698 gene locus_tag LOCUS_12300 5123 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence160 164 940 gene locus_tag LOCUS_12310 gene pdhR 164 940 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331318.1 protein_id gnl|my_center|LOCUS_12310 2668 944 gene locus_tag LOCUS_12320 2668 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3967 2969 gene locus_tag LOCUS_12330 3967 2969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561204.1 protein_id gnl|my_center|LOCUS_12330 5291 4257 gene locus_tag LOCUS_12340 5291 4257 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706261.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence161 <1 885 gene locus_tag LOCUS_12350 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708178.1:AraC family transcriptional regulator 1800 895 gene locus_tag LOCUS_12360 gene yadB 1800 895 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN59 protein_id gnl|my_center|LOCUS_12360 2293 1859 gene locus_tag LOCUS_12370 gene dksA 2293 1859 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_12370 2850 3983 gene locus_tag LOCUS_12380 2850 3983 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_12380 3965 4729 gene locus_tag LOCUS_12390 gene sfsA 3965 4729 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P6 protein_id gnl|my_center|LOCUS_12390 5248 4697 gene locus_tag LOCUS_12400 5248 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence162 2295 307 gene locus_tag LOCUS_12410 2295 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3373 2321 gene locus_tag LOCUS_12420 gene rsmC 3373 2321 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Y4 protein_id gnl|my_center|LOCUS_12420 4287 3370 gene locus_tag LOCUS_12430 4287 3370 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_12430 4818 5294 gene locus_tag LOCUS_12440 4818 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence163 <1 870 gene locus_tag LOCUS_12450 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706923.1:membrane protein 870 1934 gene locus_tag LOCUS_12460 870 1934 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_12460 2591 1947 gene locus_tag LOCUS_12470 gene slmA 2591 1947 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_12470 3493 2591 gene locus_tag LOCUS_12480 gene argB 3493 2591 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_12480 <5518 3610 gene locus_tag LOCUS_12490 <5518 3610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P26276:phosphomannomutase/phosphoglucomutase >Feature sequence164 297 1886 gene locus_tag LOCUS_12500 297 1886 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_12500 2131 1919 gene locus_tag LOCUS_12510 2131 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3384 2155 gene locus_tag LOCUS_12520 3384 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_12520 3532 3990 gene locus_tag LOCUS_12530 3532 3990 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_12530 4078 4872 gene locus_tag LOCUS_12540 gene gloB 4078 4872 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_12540 5333 4902 gene locus_tag LOCUS_12550 5333 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence165 80 298 gene locus_tag LOCUS_12560 80 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 860 531 gene locus_tag LOCUS_12570 860 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1494 2081 gene locus_tag LOCUS_12580 gene trpG 1494 2081 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_12580 2095 3141 gene locus_tag LOCUS_12590 gene trpD 2095 3141 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_12590 3197 3901 gene locus_tag LOCUS_12600 gene trpC 3197 3901 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 4794 4156 gene locus_tag LOCUS_12610 gene vfr 4794 4156 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_12610 >Feature sequence166 1033 623 gene locus_tag LOCUS_12620 1033 623 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_12620 1673 1218 gene locus_tag LOCUS_12630 1673 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2055 1687 gene locus_tag LOCUS_12640 2055 1687 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_12640 4310 2052 gene locus_tag LOCUS_12650 4310 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5401 4322 gene locus_tag LOCUS_12660 5401 4322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence167 477 1286 gene locus_tag LOCUS_12670 477 1286 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_12670 1467 2669 gene locus_tag LOCUS_12680 1467 2669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_12680 2776 4887 gene locus_tag LOCUS_12690 gene metG 2776 4887 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK6 protein_id gnl|my_center|LOCUS_12690 >Feature sequence168 1169 507 gene locus_tag LOCUS_12700 1169 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2090 1227 gene locus_tag LOCUS_12710 2090 1227 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_12710 3441 2101 gene locus_tag LOCUS_12720 3441 2101 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_12720 3605 4147 gene locus_tag LOCUS_12730 3605 4147 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_12730 4293 4132 gene locus_tag LOCUS_12740 4293 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4254 5021 gene locus_tag LOCUS_12750 gene ampE 4254 5021 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209326.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence169 120 1241 gene locus_tag LOCUS_12760 120 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_12760 1390 2403 gene locus_tag LOCUS_12770 1390 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3678 2470 gene locus_tag LOCUS_12780 gene cycH 3678 2470 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_12780 4158 3682 gene locus_tag LOCUS_12790 gene ccmH 4158 3682 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_12790 4679 4158 gene locus_tag LOCUS_12800 gene ccmG 4679 4158 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 protein_id gnl|my_center|LOCUS_12800 5368 4676 gene locus_tag LOCUS_12810 5368 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12810 >Feature sequence170 289 1803 gene locus_tag LOCUS_12820 289 1803 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 protein_id gnl|my_center|LOCUS_12820 2147 5254 gene locus_tag LOCUS_12830 2147 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence171 <1 846 gene locus_tag LOCUS_12840 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42378:RNA polymerase sigma factor RpoH 2196 931 gene locus_tag LOCUS_12850 gene rho 2196 931 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_12850 2832 2425 gene locus_tag LOCUS_12860 gene trxA 2832 2425 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818650.1 protein_id gnl|my_center|LOCUS_12860 2986 4488 gene locus_tag LOCUS_12870 gene ppx 2986 4488 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_12870 <5382 4518 gene locus_tag LOCUS_12880 <5382 4518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S646:polyphosphate kinase >Feature sequence172 <1 651 gene locus_tag LOCUS_12890 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PD35:pyruvate kinase 949 1482 gene locus_tag LOCUS_12900 gene hnoX 949 1482 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_12900 1615 2595 gene locus_tag LOCUS_12910 1615 2595 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_12910 2672 3832 gene locus_tag LOCUS_12920 gene metK 2672 3832 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_12920 3941 5320 gene locus_tag LOCUS_12930 gene ahcY 3941 5320 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_12930 >Feature sequence173 704 87 gene locus_tag LOCUS_12940 704 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1171 722 gene locus_tag LOCUS_12950 1171 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4713 1258 gene locus_tag LOCUS_12960 4713 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4758 4851 gene locus_tag LOCUS_t00070 4758 4851 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 206 1744 gene locus_tag LOCUS_12970 gene icmP 206 1744 CDS product insulin-cleaving metalloproteinase outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 protein_id gnl|my_center|LOCUS_12970 2252 3358 gene locus_tag LOCUS_12980 2252 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3382 4560 gene locus_tag LOCUS_12990 3382 4560 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930428.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence175 1707 1177 gene locus_tag LOCUS_13000 1707 1177 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_13000 2321 1716 gene locus_tag LOCUS_13010 2321 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2327 2521 gene locus_tag LOCUS_13020 2327 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5196 3493 gene locus_tag LOCUS_13030 gene fabY 5196 3493 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_13030 >Feature sequence176 1069 200 gene locus_tag LOCUS_13040 1069 200 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967912.1 protein_id gnl|my_center|LOCUS_13040 2816 1242 gene locus_tag LOCUS_13050 2816 1242 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence177 260 2308 gene locus_tag LOCUS_13060 gene oprC 260 2308 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_13060 2454 2984 gene locus_tag LOCUS_13070 2454 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_13070 4129 3305 gene locus_tag LOCUS_13080 4129 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4737 4411 gene locus_tag LOCUS_13090 4737 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence178 1651 326 gene locus_tag LOCUS_13100 1651 326 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 protein_id gnl|my_center|LOCUS_13100 1811 2509 gene locus_tag LOCUS_13110 1811 2509 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_13110 2750 4120 gene locus_tag LOCUS_13120 2750 4120 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389009.1 protein_id gnl|my_center|LOCUS_13120 4117 4917 gene locus_tag LOCUS_13130 4117 4917 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883283.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence179 1342 2484 gene locus_tag LOCUS_13140 1342 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2486 3589 gene locus_tag LOCUS_13150 gene hmuS 2486 3589 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_13150 3586 4440 gene locus_tag LOCUS_13160 3586 4440 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence180 <1 755 gene locus_tag LOCUS_13170 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001247696.1:transcriptional regulator 1411 797 gene locus_tag LOCUS_13180 1411 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1975 2331 gene locus_tag LOCUS_13190 1975 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2361 4268 gene locus_tag LOCUS_13200 2361 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 <5267 4337 gene locus_tag LOCUS_13210 <5267 4337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113273.1:ATP-dependent RNA helicase >Feature sequence181 1291 65 gene locus_tag LOCUS_13220 1291 65 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479444.1 protein_id gnl|my_center|LOCUS_13220 2493 1738 gene locus_tag LOCUS_13230 2493 1738 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_13230 2619 2861 gene locus_tag LOCUS_13240 2619 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3561 2929 gene locus_tag LOCUS_13250 3561 2929 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_13250 3706 4866 gene locus_tag LOCUS_13260 3706 4866 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence182 2039 573 gene locus_tag LOCUS_13270 gene murC 2039 573 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_13270 3114 2029 gene locus_tag LOCUS_13280 gene murG 3114 2029 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GS7 protein_id gnl|my_center|LOCUS_13280 4261 3107 gene locus_tag LOCUS_13290 gene ftsW 4261 3107 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_13290 <5243 4258 gene locus_tag LOCUS_13300 <5243 4258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KK56:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence183 91 786 gene locus_tag LOCUS_13310 91 786 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_13310 1744 887 gene locus_tag LOCUS_13320 1744 887 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_13320 1842 2741 gene locus_tag LOCUS_13330 1842 2741 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 protein_id gnl|my_center|LOCUS_13330 2900 3685 gene locus_tag LOCUS_13340 2900 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3778 4539 gene locus_tag LOCUS_13350 3778 4539 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_13350 5043 4576 gene locus_tag LOCUS_13360 5043 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence184 <1 521 gene locus_tag LOCUS_13370 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084544.1:hydrogenase maturation protease note possible pseudo, internal stop codon 537 791 gene locus_tag LOCUS_13380 gene hypC 537 791 CDS product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_13380 778 1965 gene locus_tag LOCUS_13390 gene hypD2 778 1965 CDS product hydrogenase expression/formation protein hypD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31904 protein_id gnl|my_center|LOCUS_13390 1962 2993 gene locus_tag LOCUS_13400 gene hypE 1962 2993 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_13400 3223 3711 gene locus_tag LOCUS_13410 3223 3711 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_13410 3841 4158 gene locus_tag LOCUS_13420 3841 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4766 4320 gene locus_tag LOCUS_13430 4766 4320 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_13430 >Feature sequence185 <1 936 gene locus_tag LOCUS_13440 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388764.1:NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase 1176 2771 gene locus_tag LOCUS_13450 gene ybiT 1176 2771 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_13450 2874 3554 gene locus_tag LOCUS_13460 2874 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3989 3579 gene locus_tag LOCUS_13470 3989 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4376 4041 gene locus_tag LOCUS_13480 4376 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence186 659 2389 gene locus_tag LOCUS_13490 gene proS 659 2389 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_13490 2410 2979 gene locus_tag LOCUS_13500 2410 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3158 3697 gene locus_tag LOCUS_13510 3158 3697 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173810.1 protein_id gnl|my_center|LOCUS_13510 3916 3716 gene locus_tag LOCUS_13520 3916 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4189 5028 gene locus_tag LOCUS_13530 4189 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence187 1628 744 gene locus_tag LOCUS_13540 gene pilK 1628 744 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_13540 3706 1652 gene locus_tag LOCUS_13550 gene pilJ 3706 1652 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_13550 4296 3772 gene locus_tag LOCUS_13560 gene pilI 4296 3772 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_13560 4661 4299 gene locus_tag LOCUS_13570 gene pilH 4661 4299 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_13570 5077 4694 gene locus_tag LOCUS_13580 gene pilG 5077 4694 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_13580 >Feature sequence188 <1 624 gene locus_tag LOCUS_13590 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87XG1:ribonuclease 3 621 1514 gene locus_tag LOCUS_13600 gene era 621 1514 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_13600 1530 2192 gene locus_tag LOCUS_13610 1530 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2189 2914 gene locus_tag LOCUS_13620 gene pdxJ 2189 2914 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_13620 2986 3369 gene locus_tag LOCUS_13630 gene acpS 2986 3369 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKK7 protein_id gnl|my_center|LOCUS_13630 <5171 3322 gene locus_tag LOCUS_13640 <5171 3322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQ42:histidine kinase >Feature sequence189 969 343 gene locus_tag LOCUS_13650 969 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1047 1229 gene locus_tag LOCUS_13660 1047 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1566 1192 gene locus_tag LOCUS_13670 1566 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1802 1563 gene locus_tag LOCUS_13680 1802 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2206 1895 gene locus_tag LOCUS_13690 2206 1895 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_13690 2532 2311 gene locus_tag LOCUS_13700 2532 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3021 2563 gene locus_tag LOCUS_13710 3021 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_13710 3515 3042 gene locus_tag LOCUS_13720 3515 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4939 3551 gene locus_tag LOCUS_13730 4939 3551 CDS product nitrogenase molybdenum-cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence190 1710 823 gene locus_tag LOCUS_13740 1710 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_13740 2191 4776 gene locus_tag LOCUS_13750 gene clpB 2191 4776 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_13750 >Feature sequence191 154 1431 gene locus_tag LOCUS_13760 gene kdtA 154 1431 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175941.1 protein_id gnl|my_center|LOCUS_13760 2828 1497 gene locus_tag LOCUS_13770 2828 1497 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_13770 2991 3641 gene locus_tag LOCUS_13780 2991 3641 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707476.1 protein_id gnl|my_center|LOCUS_13780 3638 4105 gene locus_tag LOCUS_13790 3638 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence192 1668 577 gene locus_tag LOCUS_13800 1668 577 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 protein_id gnl|my_center|LOCUS_13800 3064 2327 gene locus_tag LOCUS_13810 gene tsx 3064 2327 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_13810 4036 3533 gene locus_tag LOCUS_13820 gene gpt 4036 3533 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 protein_id gnl|my_center|LOCUS_13820 <5147 4246 gene locus_tag LOCUS_13830 <5147 4246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I6Z0:8-oxoguanine deaminase >Feature sequence193 328 1242 gene locus_tag LOCUS_13840 328 1242 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_13840 1232 1978 gene locus_tag LOCUS_13850 1232 1978 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_13850 2073 2831 gene locus_tag LOCUS_13860 2073 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_13860 3286 2855 gene locus_tag LOCUS_13870 gene yqaA 3286 2855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_13870 4559 3345 gene locus_tag LOCUS_13880 4559 3345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence194 249 788 gene locus_tag LOCUS_13890 gene folA 249 788 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_13890 826 1905 gene locus_tag LOCUS_13900 826 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_13900 2740 1931 gene locus_tag LOCUS_13910 2740 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3987 2740 gene locus_tag LOCUS_13920 gene argA 3987 2740 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_13920 <5138 4229 gene locus_tag LOCUS_13930 <5138 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88AR3:acetylornithine deacetylase >Feature sequence195 1831 923 gene locus_tag LOCUS_13940 1831 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_13940 2255 1818 gene locus_tag LOCUS_13950 2255 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_13950 4276 2252 gene locus_tag LOCUS_13960 4276 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 <5109 4362 gene locus_tag LOCUS_13970 <5109 4362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXP8:signal recognition particle protein >Feature sequence196 542 2074 gene locus_tag LOCUS_13980 gene nnr 542 2074 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_13980 2074 2589 gene locus_tag LOCUS_13990 2074 2589 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_13990 2586 3893 gene locus_tag LOCUS_14000 gene amiB 2586 3893 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence197 1943 663 gene locus_tag LOCUS_14010 gene surA 1943 663 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_14010 4395 1933 gene locus_tag LOCUS_14020 gene lptD 4395 1933 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_14020 >Feature sequence198 846 73 gene locus_tag LOCUS_14030 846 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2411 843 gene locus_tag LOCUS_14040 2411 843 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_14040 3487 2408 gene locus_tag LOCUS_14050 3487 2408 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969005.1 protein_id gnl|my_center|LOCUS_14050 4563 3631 gene locus_tag LOCUS_14060 4563 3631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707380.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence199 1042 374 gene locus_tag LOCUS_14070 1042 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2317 1745 gene locus_tag LOCUS_14080 2317 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2657 3100 gene locus_tag LOCUS_14090 2657 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3225 3698 gene locus_tag LOCUS_14100 3225 3698 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_14100 4702 3713 gene locus_tag LOCUS_14110 4702 3713 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708857.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence200 693 229 gene locus_tag LOCUS_14120 693 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4808 906 gene locus_tag LOCUS_14130 gene purL 4808 906 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_14130 >Feature sequence201 945 3428 gene locus_tag LOCUS_14140 945 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_14140 3523 4332 gene locus_tag LOCUS_14150 3523 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4643 4524 gene locus_tag LOCUS_14160 4643 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence202 <1 1461 gene locus_tag LOCUS_14170 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000526322.1:DEAD/DEAH box helicase 1583 3178 gene locus_tag LOCUS_14180 gene hsdM 1583 3178 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_14180 3175 4260 gene locus_tag LOCUS_14190 3175 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence203 66 455 gene locus_tag LOCUS_14200 66 455 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086370.1 protein_id gnl|my_center|LOCUS_14200 484 1230 gene locus_tag LOCUS_14210 gene trmB 484 1230 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_14210 1435 1728 gene locus_tag LOCUS_14220 1435 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1795 2718 gene locus_tag LOCUS_14230 1795 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2929 3861 gene locus_tag LOCUS_14240 2929 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3858 4418 gene locus_tag LOCUS_14250 3858 4418 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_14250 4408 4827 gene locus_tag LOCUS_14260 4408 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence204 1774 701 gene locus_tag LOCUS_14270 1774 701 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_14270 1944 2837 gene locus_tag LOCUS_14280 1944 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639278.1 protein_id gnl|my_center|LOCUS_14280 3658 2888 gene locus_tag LOCUS_14290 3658 2888 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_14290 3782 4756 gene locus_tag LOCUS_14300 gene cysB 3782 4756 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence205 <1 1325 gene locus_tag LOCUS_14310 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268765.1:urea carboxylase 1393 3204 gene locus_tag LOCUS_14320 1393 3204 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 protein_id gnl|my_center|LOCUS_14320 <4946 3802 gene locus_tag LOCUS_14330 <4946 3802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104475.1:lipoprotein >Feature sequence206 686 225 gene locus_tag LOCUS_14340 686 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 988 683 gene locus_tag LOCUS_14350 988 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2392 1088 gene locus_tag LOCUS_14360 2392 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3575 2379 gene locus_tag LOCUS_14370 3575 2379 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218900.1 protein_id gnl|my_center|LOCUS_14370 3827 3752 gene locus_tag LOCUS_t00080 3827 3752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4102 4884 gene locus_tag LOCUS_14380 gene cheR-2 4102 4884 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244386.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence207 53 649 gene locus_tag LOCUS_14390 53 649 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_14390 649 1875 gene locus_tag LOCUS_14400 649 1875 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_14400 1875 2636 gene locus_tag LOCUS_14410 1875 2636 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_14410 2732 3361 gene locus_tag LOCUS_14420 gene sspA 2732 3361 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_14420 3384 3812 gene locus_tag LOCUS_14430 3384 3812 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_14430 4608 3913 gene locus_tag LOCUS_14440 4608 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence208 983 138 gene locus_tag LOCUS_14450 983 138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_14450 2191 980 gene locus_tag LOCUS_14460 2191 980 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972306.1 protein_id gnl|my_center|LOCUS_14460 3885 2188 gene locus_tag LOCUS_14470 3885 2188 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_14470 <4912 4077 gene locus_tag LOCUS_14480 <4912 4077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888240.1:ABC transporter substrate-binding protein >Feature sequence209 86 4033 gene locus_tag LOCUS_14490 86 4033 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_14490 4030 4839 gene locus_tag LOCUS_14500 4030 4839 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence210 320 991 gene locus_tag LOCUS_14510 320 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1775 1095 gene locus_tag LOCUS_14520 gene ung 1775 1095 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_14520 2466 2930 gene locus_tag LOCUS_14530 gene brf2 2466 2930 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_14530 2941 3408 gene locus_tag LOCUS_14540 gene brf1 2941 3408 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_14540 <4899 3564 gene locus_tag LOCUS_14550 <4899 3564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406170.1:electron-transferring-flavoprotein dehydrogenase >Feature sequence211 2499 3743 gene locus_tag LOCUS_14560 2499 3743 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence212 1188 769 gene locus_tag LOCUS_14570 1188 769 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_14570 1531 2037 gene locus_tag LOCUS_14580 1531 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2071 2580 gene locus_tag LOCUS_14590 2071 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_14590 3207 2716 gene locus_tag LOCUS_14600 3207 2716 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064305.1 protein_id gnl|my_center|LOCUS_14600 4015 3233 gene locus_tag LOCUS_14610 4015 3233 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_14610 4752 4054 gene locus_tag LOCUS_14620 4752 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence213 211 696 gene locus_tag LOCUS_14630 211 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2025 787 gene locus_tag LOCUS_14640 2025 787 CDS product hemin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972049.1 protein_id gnl|my_center|LOCUS_14640 3334 2156 gene locus_tag LOCUS_14650 3334 2156 CDS product heme transporter CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_14650 3624 3337 gene locus_tag LOCUS_14660 3624 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence214 1470 562 gene locus_tag LOCUS_14670 gene lpxC 1470 562 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_14670 2764 1562 gene locus_tag LOCUS_14680 gene ftsZ 2764 1562 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_14680 4043 2808 gene locus_tag LOCUS_14690 gene ftsA 4043 2808 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_14690 <4859 4043 gene locus_tag LOCUS_14700 <4859 4043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCJ7:cell division protein FtsQ >Feature sequence215 109 2358 gene locus_tag LOCUS_14710 gene aroA 109 2358 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_14710 2351 3031 gene locus_tag LOCUS_14720 gene cmk 2351 3031 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_14720 >Feature sequence216 772 419 gene locus_tag LOCUS_14730 gene folB 772 419 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V5 protein_id gnl|my_center|LOCUS_14730 1878 772 gene locus_tag LOCUS_14740 gene ygjD 1878 772 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_14740 1992 2207 gene locus_tag LOCUS_14750 gene rpsU 1992 2207 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_14750 2235 2681 gene locus_tag LOCUS_14760 2235 2681 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_14760 2794 4674 gene locus_tag LOCUS_14770 gene dnaG 2794 4674 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_14770 >Feature sequence217 98 1543 gene locus_tag LOCUS_14780 98 1543 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 protein_id gnl|my_center|LOCUS_14780 1556 2557 gene locus_tag LOCUS_14790 1556 2557 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_14790 2696 4270 gene locus_tag LOCUS_14800 2696 4270 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106258.1 protein_id gnl|my_center|LOCUS_14800 4408 4788 gene locus_tag LOCUS_14810 4408 4788 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence218 <1 935 gene locus_tag LOCUS_14820 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104453.1:3-phytase 1651 1241 gene locus_tag LOCUS_14830 1651 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2432 4276 gene locus_tag LOCUS_14840 2432 4276 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 protein_id gnl|my_center|LOCUS_14840 4783 4346 gene locus_tag LOCUS_14850 4783 4346 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence219 <1 772 gene locus_tag LOCUS_14860 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPC2:UPF0246 protein 765 1388 gene locus_tag LOCUS_14870 765 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3762 1519 gene locus_tag LOCUS_14880 3762 1519 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267119.1 protein_id gnl|my_center|LOCUS_14880 4136 4627 gene locus_tag LOCUS_14890 4136 4627 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence220 573 1931 gene locus_tag LOCUS_14900 gene trpB 573 1931 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH6 protein_id gnl|my_center|LOCUS_14900 2786 1977 gene locus_tag LOCUS_14910 2786 1977 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_14910 3483 2872 gene locus_tag LOCUS_14920 3483 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence221 1903 239 gene locus_tag LOCUS_14930 1903 239 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707636.1 protein_id gnl|my_center|LOCUS_14930 2243 2055 gene locus_tag LOCUS_14940 2243 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3093 2266 gene locus_tag LOCUS_14950 gene eutC 3093 2266 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M3 protein_id gnl|my_center|LOCUS_14950 4484 3093 gene locus_tag LOCUS_14960 gene eutB 4484 3093 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence222 <1 1112 gene locus_tag LOCUS_14970 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096246.1:transcriptional regulator 1235 2302 gene locus_tag LOCUS_14980 gene selD 1235 2302 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKE7 protein_id gnl|my_center|LOCUS_14980 2302 3405 gene locus_tag LOCUS_14990 gene selU 2302 3405 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F6 protein_id gnl|my_center|LOCUS_14990 3649 3464 gene locus_tag LOCUS_15000 3649 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4098 3805 gene locus_tag LOCUS_15010 4098 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4364 4134 gene locus_tag LOCUS_15020 4364 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 >Feature sequence223 1296 439 gene locus_tag LOCUS_15030 1296 439 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_15030 2940 1381 gene locus_tag LOCUS_15040 2940 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3100 3852 gene locus_tag LOCUS_15050 3100 3852 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070850.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence224 1596 121 gene locus_tag LOCUS_15060 1596 121 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_15060 1706 2371 gene locus_tag LOCUS_15070 gene coq7 1706 2371 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_15070 2379 2606 gene locus_tag LOCUS_15080 2379 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3242 2748 gene locus_tag LOCUS_15090 gene ilvH 3242 2748 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_15090 <4715 3245 gene locus_tag LOCUS_15100 <4715 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q888N6:acetolactate synthase >Feature sequence225 76 1134 gene locus_tag LOCUS_15110 76 1134 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 protein_id gnl|my_center|LOCUS_15110 1335 2270 gene locus_tag LOCUS_15120 1335 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2357 4381 gene locus_tag LOCUS_15130 2357 4381 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence226 1841 2434 gene locus_tag LOCUS_15140 gene grpE 1841 2434 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS0 protein_id gnl|my_center|LOCUS_15140 2577 4499 gene locus_tag LOCUS_15150 gene dnaK 2577 4499 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_15150 >Feature sequence227 <1 926 gene locus_tag LOCUS_15160 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:potassium transporter inner membrane associated protein 950 2398 gene locus_tag LOCUS_15170 gene trkH 950 2398 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_15170 3294 2395 gene locus_tag LOCUS_15180 3294 2395 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_15180 3564 4202 gene locus_tag LOCUS_15190 3564 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence228 <1 1844 gene locus_tag LOCUS_15200 <1 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VK1:ribonuclease R 1907 2641 gene locus_tag LOCUS_15210 gene rlmB 1907 2641 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L11 protein_id gnl|my_center|LOCUS_15210 2679 3761 gene locus_tag LOCUS_15220 2679 3761 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence229 2800 38 gene locus_tag LOCUS_15230 2800 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4186 3095 gene locus_tag LOCUS_15240 gene ychF 4186 3095 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_15240 >Feature sequence230 <1 1071 gene locus_tag LOCUS_15250 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208227.1:type IV-A pilus assembly ATPase PilB 1171 2394 gene locus_tag LOCUS_15260 gene pilC 1171 2394 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_15260 2398 3273 gene locus_tag LOCUS_15270 gene pilD 2398 3273 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 protein_id gnl|my_center|LOCUS_15270 3270 3872 gene locus_tag LOCUS_15280 gene coaE 3270 3872 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_15280 3908 4111 gene locus_tag LOCUS_15290 gene yacG 3908 4111 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_15290 4570 4124 gene locus_tag LOCUS_15300 4570 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence231 101 598 gene locus_tag LOCUS_15310 101 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_15310 894 685 gene locus_tag LOCUS_15320 894 685 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_15320 1323 934 gene locus_tag LOCUS_15330 1323 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1648 1310 gene locus_tag LOCUS_15340 1648 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1647 1808 gene locus_tag LOCUS_15350 1647 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2108 1845 gene locus_tag LOCUS_15360 2108 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3142 2216 gene locus_tag LOCUS_15370 3142 2216 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057776.1 protein_id gnl|my_center|LOCUS_15370 3272 4234 gene locus_tag LOCUS_15380 3272 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4268 4522 gene locus_tag LOCUS_15390 4268 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence232 2147 1059 gene locus_tag LOCUS_15400 2147 1059 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_15400 3309 2227 gene locus_tag LOCUS_15410 gene serC 3309 2227 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_15410 <4666 3366 gene locus_tag LOCUS_15420 <4666 3366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JLA2:DNA gyrase subunit A >Feature sequence233 1769 537 gene locus_tag LOCUS_15430 gene carA 1769 537 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_15430 2224 2832 gene locus_tag LOCUS_15440 2224 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3749 2946 gene locus_tag LOCUS_15450 gene dapB 3749 2946 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38103 protein_id gnl|my_center|LOCUS_15450 <4656 3836 gene locus_tag LOCUS_15460 <4656 3836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV44:chaperone protein DnaJ >Feature sequence234 133 369 gene locus_tag LOCUS_15470 133 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 958 395 gene locus_tag LOCUS_15480 958 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_15480 1216 1776 gene locus_tag LOCUS_15490 1216 1776 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_15490 4262 1800 gene locus_tag LOCUS_15500 gene polB 4262 1800 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGA1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence235 <1 566 gene locus_tag LOCUS_15510 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E0E9:3-deoxy-manno-octulosonate cytidylyltransferase 1380 727 gene locus_tag LOCUS_15520 1380 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence236 351 1508 gene locus_tag LOCUS_15530 351 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1538 2401 gene locus_tag LOCUS_15540 gene fieF 1538 2401 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPK2 protein_id gnl|my_center|LOCUS_15540 2417 3382 gene locus_tag LOCUS_15550 2417 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4004 3405 gene locus_tag LOCUS_15560 gene alkB 4004 3405 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_15560 4501 4001 gene locus_tag LOCUS_15570 gene trmL 4501 4001 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 protein_id gnl|my_center|LOCUS_15570 >Feature sequence237 156 1541 gene locus_tag LOCUS_15580 gene dnaB 156 1541 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 protein_id gnl|my_center|LOCUS_15580 1574 2149 gene locus_tag LOCUS_15590 1574 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2146 2676 gene locus_tag LOCUS_15600 2146 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2819 3406 gene locus_tag LOCUS_15610 2819 3406 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_15610 3418 3636 gene locus_tag LOCUS_15620 3418 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4183 4569 gene locus_tag LOCUS_15630 4183 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence238 472 1140 gene locus_tag LOCUS_15640 gene phoB 472 1140 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_15640 1149 2435 gene locus_tag LOCUS_15650 gene phoR 1149 2435 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_15650 3251 2499 gene locus_tag LOCUS_15660 gene cysZ 3251 2499 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTD3 protein_id gnl|my_center|LOCUS_15660 3324 4016 gene locus_tag LOCUS_15670 gene trmH 3324 4016 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence239 77 1015 gene locus_tag LOCUS_15680 77 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1216 1785 gene locus_tag LOCUS_15690 1216 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2733 1861 gene locus_tag LOCUS_15700 gene queD 2733 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence240 442 1413 gene locus_tag LOCUS_15710 442 1413 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_15710 1410 2180 gene locus_tag LOCUS_15720 gene rlpA 1410 2180 CDS product minor lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261453.1 protein_id gnl|my_center|LOCUS_15720 2833 2714 gene locus_tag LOCUS_15730 2833 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence241 1582 779 gene locus_tag LOCUS_15740 1582 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1937 3460 gene locus_tag LOCUS_15750 gene gltX 1937 3460 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C8 protein_id gnl|my_center|LOCUS_15750 >Feature sequence242 493 921 gene locus_tag LOCUS_15760 gene msrB1 493 921 CDS product peptide methionine sulfoxide reductase MsrB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RA4 protein_id gnl|my_center|LOCUS_15760 922 1173 gene locus_tag LOCUS_15770 922 1173 CDS product UPF0153 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT48 protein_id gnl|my_center|LOCUS_15770 1233 1544 gene locus_tag LOCUS_15780 1233 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_15780 2152 1589 gene locus_tag LOCUS_15790 2152 1589 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_15790 2473 3048 gene locus_tag LOCUS_15800 2473 3048 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_15800 3086 3286 gene locus_tag LOCUS_15810 3086 3286 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_15810 <4539 3313 gene locus_tag LOCUS_15820 <4539 3313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104099.1:sensor domain-containing diguanylate cyclase >Feature sequence243 <1 563 gene locus_tag LOCUS_15830 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903217.1:aminobenzoyl-glutamate transporter 1907 654 gene locus_tag LOCUS_15840 gene dadA 1907 654 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTV1 protein_id gnl|my_center|LOCUS_15840 2148 3218 gene locus_tag LOCUS_15850 gene bioB 2148 3218 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_15850 3897 3253 gene locus_tag LOCUS_15860 3897 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence244 798 229 gene locus_tag LOCUS_15870 gene greB 798 229 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_15870 960 1226 gene locus_tag LOCUS_15880 960 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1503 2111 gene locus_tag LOCUS_15890 1503 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_15890 2779 2108 gene locus_tag LOCUS_15900 2779 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_15900 2920 3495 gene locus_tag LOCUS_15910 2920 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence245 215 745 gene locus_tag LOCUS_15920 215 745 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 protein_id gnl|my_center|LOCUS_15920 915 3173 gene locus_tag LOCUS_15930 915 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4012 3659 gene locus_tag LOCUS_15940 gene yhaI 4012 3659 CDS product inner membrane protein YhaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64593 protein_id gnl|my_center|LOCUS_15940 >Feature sequence246 <1 663 gene locus_tag LOCUS_15950 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:radical SAM/Cys-rich domain protein 692 2878 gene locus_tag LOCUS_15960 692 2878 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_15960 2982 3683 gene locus_tag LOCUS_15970 2982 3683 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_15970 3640 4446 gene locus_tag LOCUS_15980 3640 4446 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence247 132 1169 gene locus_tag LOCUS_15990 132 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3154 2219 gene locus_tag LOCUS_16000 3154 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3935 3186 gene locus_tag LOCUS_16010 3935 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4408 3932 gene locus_tag LOCUS_16020 gene chpC 4408 3932 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence248 <1 531 gene locus_tag LOCUS_16030 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYY6:epoxyqueuosine reductase 976 4275 gene locus_tag LOCUS_16040 976 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence249 830 636 gene locus_tag LOCUS_16050 830 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1858 1181 gene locus_tag LOCUS_16060 1858 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2367 1855 gene locus_tag LOCUS_16070 2367 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3008 2364 gene locus_tag LOCUS_16080 3008 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3859 3011 gene locus_tag LOCUS_16090 3859 3011 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_16090 4135 3866 gene locus_tag LOCUS_16100 4135 3866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence250 2598 1123 gene locus_tag LOCUS_16110 gene hoxA 2598 1123 CDS product hydrogenase transcriptional regulatory protein HoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31908 protein_id gnl|my_center|LOCUS_16110 3616 2600 gene locus_tag LOCUS_16120 3616 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3959 3618 gene locus_tag LOCUS_16130 gene hypA1 3959 3618 CDS product putative hydrogenase nickel incorporation protein HypA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ANP8 protein_id gnl|my_center|LOCUS_16130 >Feature sequence251 2640 1204 gene locus_tag LOCUS_16140 gene cpsB 2640 1204 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_16140 3119 2637 gene locus_tag LOCUS_16150 gene gmm 3119 2637 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32056 protein_id gnl|my_center|LOCUS_16150 4085 3126 gene locus_tag LOCUS_16160 gene wbcJ 4085 3126 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN61 protein_id gnl|my_center|LOCUS_16160 >Feature sequence252 1420 2418 gene locus_tag LOCUS_16170 1420 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence253 2648 198 gene locus_tag LOCUS_16180 2648 198 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088923.1 protein_id gnl|my_center|LOCUS_16180 2947 3729 gene locus_tag LOCUS_16190 gene agmR 2947 3729 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_16190 <4345 3823 gene locus_tag LOCUS_16200 <4345 3823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ED71:pyridoxine/pyridoxamine 5'-phosphate oxidase >Feature sequence254 98 2335 gene locus_tag LOCUS_16210 gene mrcB 98 2335 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_16210 2369 2776 gene locus_tag LOCUS_16220 2369 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3550 2864 gene locus_tag LOCUS_16230 3550 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 <4345 3563 gene locus_tag LOCUS_16240 <4345 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CHB0:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence255 293 856 gene locus_tag LOCUS_16250 293 856 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_16250 1190 1822 gene locus_tag LOCUS_16260 1190 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2348 2770 gene locus_tag LOCUS_16270 2348 2770 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881580.1 protein_id gnl|my_center|LOCUS_16270 2792 4165 gene locus_tag LOCUS_16280 gene cry 2792 4165 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence256 3460 1424 gene locus_tag LOCUS_16290 3460 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <4342 3521 gene locus_tag LOCUS_16300 <4342 3521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787585.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence257 525 1394 gene locus_tag LOCUS_16310 gene phnD 525 1394 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_16310 1422 2273 gene locus_tag LOCUS_16320 1422 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2275 3831 gene locus_tag LOCUS_16330 gene phnE 2275 3831 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence258 <1 552 gene locus_tag LOCUS_16340 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104467.1:nuclease 655 1590 gene locus_tag LOCUS_16350 655 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 3396 1699 gene locus_tag LOCUS_16360 gene leuA-2 3396 1699 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_16360 3627 4115 gene locus_tag LOCUS_16370 3627 4115 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence259 <4323 835 gene locus_tag LOCUS_16380 <4323 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266380.1:glutamate synthase large subunit >Feature sequence260 3 896 gene locus_tag LOCUS_16390 3 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1685 981 gene locus_tag LOCUS_16400 1685 981 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105985.1 protein_id gnl|my_center|LOCUS_16400 3566 1686 gene locus_tag LOCUS_16410 3566 1686 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_16410 4050 3691 gene locus_tag LOCUS_16420 4050 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112757.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence261 1851 3275 gene locus_tag LOCUS_16430 1851 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 <4304 3276 gene locus_tag LOCUS_16440 <4304 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWN5:bifunctional protein PutA >Feature sequence262 20 95 gene locus_tag LOCUS_t00090 20 95 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1674 493 gene locus_tag LOCUS_16450 1674 493 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_16450 2411 1713 gene locus_tag LOCUS_16460 gene pyrF 2411 1713 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N49 protein_id gnl|my_center|LOCUS_16460 3589 2408 gene locus_tag LOCUS_16470 gene lapB 3589 2408 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_16470 3877 3599 gene locus_tag LOCUS_16480 3877 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4302 3952 gene locus_tag LOCUS_16490 gene ihfB 4302 3952 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_16490 >Feature sequence263 1610 3109 gene locus_tag LOCUS_16500 1610 3109 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence264 611 153 gene locus_tag LOCUS_16510 611 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1606 608 gene locus_tag LOCUS_16520 gene mucB 1606 608 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_16520 2322 1606 gene locus_tag LOCUS_16530 gene mucA 2322 1606 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38107 protein_id gnl|my_center|LOCUS_16530 2931 2344 gene locus_tag LOCUS_16540 gene algU 2931 2344 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_16540 >Feature sequence265 146 859 gene locus_tag LOCUS_16550 146 859 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104835.1 protein_id gnl|my_center|LOCUS_16550 1820 1152 gene locus_tag LOCUS_16560 gene tpm 1820 1152 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_16560 2222 4150 gene locus_tag LOCUS_16570 gene nirB 2222 4150 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence266 <1 1762 gene locus_tag LOCUS_16580 <1 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941555.1:serine protease 2415 1909 gene locus_tag LOCUS_16590 2415 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2605 3651 gene locus_tag LOCUS_16600 2605 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3740 4075 gene locus_tag LOCUS_16610 3740 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence267 161 2653 gene locus_tag LOCUS_16620 gene mrcA 161 2653 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_16620 <4276 2732 gene locus_tag LOCUS_16630 <4276 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112948.1:FAD-binding oxidoreductase >Feature sequence268 461 1375 gene locus_tag LOCUS_16640 gene pagO 461 1375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_16640 2988 1489 gene locus_tag LOCUS_16650 2988 1489 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_16650 <4265 2985 gene locus_tag LOCUS_16660 <4265 2985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5V0:UPF0229 protein >Feature sequence269 1174 233 gene locus_tag LOCUS_16670 1174 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_16670 1732 1529 gene locus_tag LOCUS_16680 1732 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence270 2412 3077 gene locus_tag LOCUS_16690 gene rluE 2412 3077 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_16690 3493 3945 gene locus_tag LOCUS_16700 3493 3945 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence271 813 1862 gene locus_tag LOCUS_16710 813 1862 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED2 protein_id gnl|my_center|LOCUS_16710 1864 2556 gene locus_tag LOCUS_16720 1864 2556 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_16720 2560 3261 gene locus_tag LOCUS_16730 2560 3261 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_16730 <4190 3406 gene locus_tag LOCUS_16740 <4190 3406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073651.1:outer membrane protein >Feature sequence272 510 241 gene locus_tag LOCUS_16750 gene rpsO 510 241 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 protein_id gnl|my_center|LOCUS_16750 1565 627 gene locus_tag LOCUS_16760 gene truB 1565 627 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU78 protein_id gnl|my_center|LOCUS_16760 1981 1565 gene locus_tag LOCUS_16770 gene rbfA 1981 1565 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_16770 <4174 2105 gene locus_tag LOCUS_16780 <4174 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV55:translation initiation factor IF-2 >Feature sequence273 392 1282 gene locus_tag LOCUS_16790 392 1282 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_16790 2176 1394 gene locus_tag LOCUS_16800 2176 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence274 2 208 gene locus_tag LOCUS_16810 2 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 211 453 gene locus_tag LOCUS_16820 211 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 455 946 gene locus_tag LOCUS_16830 455 946 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_16830 977 1438 gene locus_tag LOCUS_16840 977 1438 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_16840 2661 1546 gene locus_tag LOCUS_16850 gene pilU 2661 1546 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_16850 3711 2668 gene locus_tag LOCUS_16860 gene pilT 3711 2668 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_16860 >Feature sequence275 1153 314 gene locus_tag LOCUS_16870 1153 314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_16870 2061 1552 gene locus_tag LOCUS_16880 2061 1552 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_16880 2474 2058 gene locus_tag LOCUS_16890 2474 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3614 2499 gene locus_tag LOCUS_16900 3614 2499 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence276 <1 1202 gene locus_tag LOCUS_16910 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088928.1:ABC transporter substrate-binding protein 1203 2186 gene locus_tag LOCUS_16920 1203 2186 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_16920 2186 2947 gene locus_tag LOCUS_16930 2186 2947 CDS product 2-phenylethanol ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532047.1 protein_id gnl|my_center|LOCUS_16930 2944 3732 gene locus_tag LOCUS_16940 2944 3732 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H04 protein_id gnl|my_center|LOCUS_16940 >Feature sequence277 1855 1361 gene locus_tag LOCUS_16950 1855 1361 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770588.1 protein_id gnl|my_center|LOCUS_16950 2723 1974 gene locus_tag LOCUS_16960 gene dedD 2723 1974 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072964.1 protein_id gnl|my_center|LOCUS_16960 4018 2708 gene locus_tag LOCUS_16970 4018 2708 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVH2 protein_id gnl|my_center|LOCUS_16970 >Feature sequence278 2508 685 gene locus_tag LOCUS_16980 gene edd 2508 685 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_16980 2779 3780 gene locus_tag LOCUS_16990 gene gap 2779 3780 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27726 protein_id gnl|my_center|LOCUS_16990 >Feature sequence279 451 113 gene locus_tag LOCUS_17000 gene rnpA 451 113 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z7 protein_id gnl|my_center|LOCUS_17000 681 547 gene locus_tag LOCUS_17010 gene rpmH 681 547 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66244 protein_id gnl|my_center|LOCUS_17010 769 930 gene locus_tag LOCUS_17020 769 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1150 2637 gene locus_tag LOCUS_17030 gene dnaA 1150 2637 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U7 protein_id gnl|my_center|LOCUS_17030 2655 3755 gene locus_tag LOCUS_17040 gene dnaN 2655 3755 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_17040 >Feature sequence280 334 1314 gene locus_tag LOCUS_17050 334 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1848 1297 gene locus_tag LOCUS_17060 1848 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2183 1845 gene locus_tag LOCUS_17070 2183 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2832 2467 gene locus_tag LOCUS_17080 2832 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3805 3029 gene locus_tag LOCUS_17090 gene lepB 3805 3029 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF9 protein_id gnl|my_center|LOCUS_17090 >Feature sequence281 1137 265 gene locus_tag LOCUS_17100 1137 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2693 1143 gene locus_tag LOCUS_17110 gene leuA 2693 1143 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_17110 2960 3712 gene locus_tag LOCUS_17120 gene etfB 2960 3712 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_17120 >Feature sequence282 <1 1521 gene locus_tag LOCUS_17130 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941100.1:type VI secretion system protein ImpG 1485 2477 gene locus_tag LOCUS_17140 gene tssG 1485 2477 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence283 42 632 gene locus_tag LOCUS_17150 gene hisB 42 632 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_17150 647 1294 gene locus_tag LOCUS_17160 gene hisH1 647 1294 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_17160 1327 2067 gene locus_tag LOCUS_17170 gene hisA 1327 2067 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_17170 2070 2834 gene locus_tag LOCUS_17180 gene hisF1 2070 2834 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_17180 <4070 2905 gene locus_tag LOCUS_17190 <4070 2905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112947.1:D-3-phosphoglycerate dehydrogenase >Feature sequence284 692 1321 gene locus_tag LOCUS_17200 692 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_17200 3504 1465 gene locus_tag LOCUS_17210 gene tgpA 3504 1465 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_17210 >Feature sequence285 1079 1840 gene locus_tag LOCUS_17220 1079 1840 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 protein_id gnl|my_center|LOCUS_17220 2831 1992 gene locus_tag LOCUS_17230 2831 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3022 3573 gene locus_tag LOCUS_17240 gene fldB 3022 3573 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7Q4 protein_id gnl|my_center|LOCUS_17240 >Feature sequence286 3309 877 gene locus_tag LOCUS_17250 gene xdhB 3309 877 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_17250 4036 3302 gene locus_tag LOCUS_17260 4036 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence287 555 1316 gene locus_tag LOCUS_17270 555 1316 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 protein_id gnl|my_center|LOCUS_17270 1505 2200 gene locus_tag LOCUS_17280 1505 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_17280 2211 2975 gene locus_tag LOCUS_17290 2211 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_17290 3065 3874 gene locus_tag LOCUS_17300 gene drrA 3065 3874 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence288 179 1900 gene locus_tag LOCUS_17310 179 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_17310 4020 1963 gene locus_tag LOCUS_17320 gene ligA 4020 1963 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF3 protein_id gnl|my_center|LOCUS_17320 >Feature sequence289 <1 708 gene locus_tag LOCUS_17330 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705753.1:PSP operon transcriptional activator 844 1992 gene locus_tag LOCUS_17340 844 1992 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_17340 2129 3157 gene locus_tag LOCUS_17350 2129 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence290 154 507 gene locus_tag LOCUS_17360 154 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 504 776 gene locus_tag LOCUS_17370 504 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 773 1480 gene locus_tag LOCUS_17380 773 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1572 2195 gene locus_tag LOCUS_17390 1572 2195 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_17390 2203 2688 gene locus_tag LOCUS_17400 2203 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 protein_id gnl|my_center|LOCUS_17400 2679 3128 gene locus_tag LOCUS_17410 2679 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44215 protein_id gnl|my_center|LOCUS_17410 3136 3564 gene locus_tag LOCUS_17420 3136 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence291 >Feature sequence292 251 1162 gene locus_tag LOCUS_17430 251 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1418 2797 gene locus_tag LOCUS_17440 1418 2797 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376021.1 protein_id gnl|my_center|LOCUS_17440 2966 3505 gene locus_tag LOCUS_17450 2966 3505 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_17450 3824 3513 gene locus_tag LOCUS_17460 3824 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence293 >Feature sequence294 3 533 gene locus_tag LOCUS_17470 3 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1877 534 gene locus_tag LOCUS_17480 1877 534 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_17480 2693 1929 gene locus_tag LOCUS_17490 2693 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 <3979 2738 gene locus_tag LOCUS_17500 <3979 2738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972567.1:methylamine utilization protein MauG >Feature sequence295 1037 456 gene locus_tag LOCUS_17510 gene ubiC 1037 456 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F94 protein_id gnl|my_center|LOCUS_17510 1156 1323 gene locus_tag LOCUS_17520 gene rubA2 1156 1323 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_17520 1364 2545 gene locus_tag LOCUS_17530 gene alkT 1364 2545 CDS product Rubredoxin-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK9 protein_id gnl|my_center|LOCUS_17530 2590 2868 gene locus_tag LOCUS_17540 gene hupB 2590 2868 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_17540 2874 3428 gene locus_tag LOCUS_17550 2874 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102804.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence296 2 964 gene locus_tag LOCUS_17560 2 964 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_17560 1672 1019 gene locus_tag LOCUS_17570 1672 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3219 2140 gene locus_tag LOCUS_17580 3219 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <3952 3356 gene locus_tag LOCUS_17590 <3952 3356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208316.1:alkaline phosphatase >Feature sequence297 1770 454 gene locus_tag LOCUS_17600 gene rsmB 1770 454 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KD3 protein_id gnl|my_center|LOCUS_17600 2729 1767 gene locus_tag LOCUS_17610 gene fmt 2729 1767 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_17610 3250 2729 gene locus_tag LOCUS_17620 gene def 3250 2729 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_17620 >Feature sequence298 3383 2001 gene locus_tag LOCUS_17630 gene rimO 3383 2001 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM9 protein_id gnl|my_center|LOCUS_17630 3770 3651 gene locus_tag LOCUS_17640 3770 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence299 952 41 gene locus_tag LOCUS_17650 gene aguB 952 41 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_17650 1955 936 gene locus_tag LOCUS_17660 gene aguA 1955 936 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_17660 2281 3432 gene locus_tag LOCUS_17670 2281 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence300 1433 468 gene locus_tag LOCUS_17680 gene hemF 1433 468 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_17680 2004 1453 gene locus_tag LOCUS_17690 gene tsaC 2004 1453 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_17690 3281 2133 gene locus_tag LOCUS_17700 3281 2133 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817316.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence301 1645 950 gene locus_tag LOCUS_17710 gene dsbA 1645 950 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52376 protein_id gnl|my_center|LOCUS_17710 2232 1660 gene locus_tag LOCUS_17720 2232 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3570 2383 gene locus_tag LOCUS_17730 3570 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence302 1 963 gene locus_tag LOCUS_17740 1 963 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence303 440 1588 gene locus_tag LOCUS_17750 440 1588 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_17750 2730 1612 gene locus_tag LOCUS_17760 gene hisC1 2730 1612 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE0 protein_id gnl|my_center|LOCUS_17760 <3888 2945 gene locus_tag LOCUS_17770 <3888 2945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVW9:histidinol dehydrogenase >Feature sequence304 <1 1056 gene locus_tag LOCUS_17780 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEZ6:ATP-dependent DNA helicase RecG 1798 1097 gene locus_tag LOCUS_17790 1798 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2174 1800 gene locus_tag LOCUS_17800 2174 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3346 2183 gene locus_tag LOCUS_17810 3346 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence305 <1 873 gene locus_tag LOCUS_17820 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUW3:ribosomal protein L11 methyltransferase 909 2504 gene locus_tag LOCUS_17830 909 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2622 3611 gene locus_tag LOCUS_17840 gene dusB 2622 3611 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_17840 >Feature sequence306 544 3111 gene locus_tag LOCUS_17850 gene nasA 544 3111 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973413.1 protein_id gnl|my_center|LOCUS_17850 3335 3697 gene locus_tag LOCUS_17860 3335 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence307 724 11 gene locus_tag LOCUS_17870 724 11 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_17870 1524 721 gene locus_tag LOCUS_17880 1524 721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_17880 1814 2233 gene locus_tag LOCUS_17890 gene liuR 1814 2233 CDS product liu genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_17890 2298 3464 gene locus_tag LOCUS_17900 2298 3464 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477243.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence308 1167 1242 gene locus_tag LOCUS_t00100 1167 1242 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1292 1660 gene locus_tag LOCUS_17910 gene secE 1292 1660 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y4 protein_id gnl|my_center|LOCUS_17910 1674 2204 gene locus_tag LOCUS_17920 gene nusG 1674 2204 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_17920 2278 2712 gene locus_tag LOCUS_17930 gene rplK 2278 2712 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_17930 2712 3407 gene locus_tag LOCUS_17940 gene rplA 2712 3407 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN4 protein_id gnl|my_center|LOCUS_17940 >Feature sequence309 <1 607 gene locus_tag LOCUS_17950 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P43930:putative RNA pseudouridine synthase 859 623 gene locus_tag LOCUS_17960 gene grxA 859 623 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 protein_id gnl|my_center|LOCUS_17960 1245 2300 gene locus_tag LOCUS_17970 1245 2300 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence310 404 1816 gene locus_tag LOCUS_17980 404 1816 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976107.1 protein_id gnl|my_center|LOCUS_17980 1835 2623 gene locus_tag LOCUS_17990 1835 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_17990 2827 3777 gene locus_tag LOCUS_18000 2827 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence311 <1 1048 gene locus_tag LOCUS_18010 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082362.1:two-component sensor histidine kinase 2000 1050 gene locus_tag LOCUS_18020 gene metR 2000 1050 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_18020 2980 2126 gene locus_tag LOCUS_18030 gene argF 2980 2126 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_18030 <3802 3057 gene locus_tag LOCUS_18040 <3802 3057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFT7:acetylornithine aminotransferase >Feature sequence312 347 874 gene locus_tag LOCUS_18050 gene lspA 347 874 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_18050 898 1350 gene locus_tag LOCUS_18060 898 1350 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_18060 1331 2278 gene locus_tag LOCUS_18070 gene ispH 1331 2278 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_18070 2908 2486 gene locus_tag LOCUS_18080 2908 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence313 102 1298 gene locus_tag LOCUS_18090 gene obg 102 1298 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_18090 1307 2443 gene locus_tag LOCUS_18100 gene proB 1307 2443 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_18100 2531 3370 gene locus_tag LOCUS_18110 gene kdsA 2531 3370 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_18110 3480 3746 gene locus_tag LOCUS_18120 gene rpsT 3480 3746 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence314 1365 1970 gene locus_tag LOCUS_18130 1365 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_18130 2964 1963 gene locus_tag LOCUS_18140 gene srkA 2964 1963 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_18140 3458 2985 gene locus_tag LOCUS_18150 3458 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence315 371 1285 gene locus_tag LOCUS_18160 371 1285 CDS product nitrogen fixation protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EB3 protein_id gnl|my_center|LOCUS_18160 1288 2496 gene locus_tag LOCUS_18170 1288 2496 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence316 <1 591 gene locus_tag LOCUS_18180 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224931.1:Fe/S-dependent 2-methylisocitrate dehydratase AcnD 750 1946 gene locus_tag LOCUS_18190 750 1946 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_18190 2767 2261 gene locus_tag LOCUS_18200 2767 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_18200 2994 3653 gene locus_tag LOCUS_18210 2994 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence317 492 1439 gene locus_tag LOCUS_18220 gene rrmA 492 1439 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 protein_id gnl|my_center|LOCUS_18220 1436 1876 gene locus_tag LOCUS_18230 gene holC 1436 1876 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_18230 1873 2886 gene locus_tag LOCUS_18240 1873 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence318 104 694 gene locus_tag LOCUS_18250 104 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1856 675 gene locus_tag LOCUS_18260 1856 675 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_18260 2366 1884 gene locus_tag LOCUS_18270 2366 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3735 2524 gene locus_tag LOCUS_18280 3735 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence319 2149 827 gene locus_tag LOCUS_18290 gene clpX 2149 827 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_18290 3030 2146 gene locus_tag LOCUS_18300 3030 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3476 3027 gene locus_tag LOCUS_18310 3476 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence320 522 1367 gene locus_tag LOCUS_18320 gene truC 522 1367 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_18320 3147 2284 gene locus_tag LOCUS_18330 3147 2284 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115055.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence321 <3712 231 gene locus_tag LOCUS_18340 <3712 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112799.1:motility regulator >Feature sequence322 >Feature sequence323 1864 3009 gene locus_tag LOCUS_18350 1864 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3466 3146 gene locus_tag LOCUS_18360 3466 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence324 2885 906 gene locus_tag LOCUS_18370 2885 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence325 1325 375 gene locus_tag LOCUS_18380 1325 375 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_18380 1915 1412 gene locus_tag LOCUS_18390 1915 1412 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 protein_id gnl|my_center|LOCUS_18390 2110 3039 gene locus_tag LOCUS_18400 2110 3039 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_18400 <3666 3062 gene locus_tag LOCUS_18410 <3666 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804759.1:threonine transporter RhtB >Feature sequence326 <1 863 gene locus_tag LOCUS_18420 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104661.1:sigma-54-dependent Fis family transcriptional regulator 1676 2479 gene locus_tag LOCUS_18430 1676 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2489 3004 gene locus_tag LOCUS_18440 2489 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence327 2828 1470 gene locus_tag LOCUS_18450 gene rkpK 2828 1470 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_18450 <3647 2928 gene locus_tag LOCUS_18460 <3647 2928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZP7:electron transfer flavoprotein subunit alpha >Feature sequence328 685 1179 gene locus_tag LOCUS_18470 685 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1251 1553 gene locus_tag LOCUS_18480 1251 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1628 1948 gene locus_tag LOCUS_18490 1628 1948 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_18490 1951 2454 gene locus_tag LOCUS_18500 1951 2454 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_18500 2451 3365 gene locus_tag LOCUS_18510 2451 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence329 210 515 gene locus_tag LOCUS_18520 210 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 937 1974 gene locus_tag LOCUS_18530 937 1974 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_18530 3373 2054 gene locus_tag LOCUS_18540 gene norM 3373 2054 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_18540 >Feature sequence330 2201 336 gene locus_tag LOCUS_18550 2201 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18550 3194 2238 gene locus_tag LOCUS_18560 3194 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18560 >Feature sequence331 1495 467 gene locus_tag LOCUS_18570 gene ribD 1495 467 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_18570 2112 1819 gene locus_tag LOCUS_18580 2112 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 <3599 2533 gene locus_tag LOCUS_18590 <3599 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ59:serine hydroxymethyltransferase >Feature sequence332 3056 333 gene locus_tag LOCUS_18600 3056 333 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303634.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence333 <1 999 gene locus_tag LOCUS_18610 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918343.1:alkaline phosphatase 1355 2701 gene locus_tag LOCUS_18620 1355 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_18620 2952 3236 gene locus_tag LOCUS_18630 gene rpsP 2952 3236 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_18630 >Feature sequence334 248 1018 gene locus_tag LOCUS_18640 gene hbdH1 248 1018 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037308.1 protein_id gnl|my_center|LOCUS_18640 2097 1078 gene locus_tag LOCUS_18650 2097 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_18650 3075 2116 gene locus_tag LOCUS_18660 3075 2116 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067516.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence335 5 1426 gene locus_tag LOCUS_18670 gene yhxA 5 1426 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 protein_id gnl|my_center|LOCUS_18670 2574 1549 gene locus_tag LOCUS_18680 2574 1549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061784.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence336 <1 1234 gene locus_tag LOCUS_18690 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073938.1:type I restriction-modification system deoxyribonuclease 1315 2913 gene locus_tag LOCUS_18700 1315 2913 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence337 3394 1301 gene locus_tag LOCUS_18710 3394 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence338 278 90 gene locus_tag LOCUS_18720 278 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 261 1424 gene locus_tag LOCUS_18730 261 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1417 2121 gene locus_tag LOCUS_18740 1417 2121 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_18740 2329 3444 gene locus_tag LOCUS_18750 2329 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence339 1518 685 gene locus_tag LOCUS_18760 1518 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2311 1529 gene locus_tag LOCUS_18770 2311 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 <3501 2311 gene locus_tag LOCUS_18780 <3501 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104339.1:peptide ABC transporter ATP-binding protein >Feature sequence340 2846 789 gene locus_tag LOCUS_18790 2846 789 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_18790 <3496 2980 gene locus_tag LOCUS_18800 <3496 2980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816342.1:two-component sensor histidine kinase >Feature sequence341 1180 632 gene locus_tag LOCUS_18810 gene pilP 1180 632 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_18810 1817 1167 gene locus_tag LOCUS_18820 gene pilO 1817 1167 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_18820 2376 1819 gene locus_tag LOCUS_18830 gene pilN 2376 1819 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_18830 <3487 2376 gene locus_tag LOCUS_18840 <3487 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110888.1:type 4 fimbrial biogenesis protein PilM >Feature sequence342 729 301 gene locus_tag LOCUS_18850 gene csdE 729 301 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261341.1 protein_id gnl|my_center|LOCUS_18850 1960 740 gene locus_tag LOCUS_18860 1960 740 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_18860 <3482 2038 gene locus_tag LOCUS_18870 <3482 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070895.1:D-glycero-D-manno-heptose 1-phosphate guanosyltransferase >Feature sequence343 2290 665 gene locus_tag LOCUS_18880 2290 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 <3460 2706 gene locus_tag LOCUS_18890 <3460 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895466.1:proton/glutamate symporter >Feature sequence344 <1 1608 gene locus_tag LOCUS_18900 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116501.1:GTP-binding protein >Feature sequence345 2487 181 gene locus_tag LOCUS_18910 2487 181 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_18910 2705 3286 gene locus_tag LOCUS_18920 2705 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence346 1052 2248 gene locus_tag LOCUS_18930 1052 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2261 3094 gene locus_tag LOCUS_18940 2261 3094 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705094.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence347 261 1604 gene locus_tag LOCUS_18950 261 1604 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_18950 >Feature sequence348 <3446 1111 gene locus_tag LOCUS_18960 <3446 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104454.1:TonB-dependent receptor >Feature sequence349 150 281 gene locus_tag LOCUS_18970 150 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 363 770 gene locus_tag LOCUS_18980 363 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 892 1290 gene locus_tag LOCUS_18990 892 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1392 1673 gene locus_tag LOCUS_19000 1392 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1894 2358 gene locus_tag LOCUS_19010 1894 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2904 2365 gene locus_tag LOCUS_19020 2904 2365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence350 <1 1009 gene locus_tag LOCUS_19030 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87V15:3-dehydroquinate synthase 1017 2318 gene locus_tag LOCUS_19040 1017 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence351 <1 636 gene locus_tag LOCUS_19050 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263841.1:acetyltransferase 633 1778 gene locus_tag LOCUS_19060 gene sypN 633 1778 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 protein_id gnl|my_center|LOCUS_19060 1775 3274 gene locus_tag LOCUS_19070 gene sypO 1775 3274 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence352 1763 2443 gene locus_tag LOCUS_19080 1763 2443 CDS product sporulation-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 protein_id gnl|my_center|LOCUS_19080 <3416 2469 gene locus_tag LOCUS_19090 <3416 2469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089681.1:HupV protein >Feature sequence353 135 872 gene locus_tag LOCUS_19100 135 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 987 1508 gene locus_tag LOCUS_19110 987 1508 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_19110 1895 1584 gene locus_tag LOCUS_19120 1895 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2457 1936 gene locus_tag LOCUS_19130 2457 1936 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 protein_id gnl|my_center|LOCUS_19130 3152 2772 gene locus_tag LOCUS_19140 3152 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence354 822 70 gene locus_tag LOCUS_19150 gene paaG 822 70 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence355 1366 848 gene locus_tag LOCUS_19160 1366 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_19160 2538 1363 gene locus_tag LOCUS_19170 2538 1363 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_19170 <3408 2723 gene locus_tag LOCUS_19180 <3408 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P0J1:NADPH-dependent 7-cyano-7-deazaguanine reductase >Feature sequence356 1846 473 gene locus_tag LOCUS_19190 gene astB 1846 473 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJE9 protein_id gnl|my_center|LOCUS_19190 3381 1849 gene locus_tag LOCUS_19200 gene astD 3381 1849 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQH8 protein_id gnl|my_center|LOCUS_19200 >Feature sequence357 1094 2053 gene locus_tag LOCUS_19210 1094 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2056 2985 gene locus_tag LOCUS_19220 2056 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705473.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence358 <1 918 gene locus_tag LOCUS_19230 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529310.1:membrane protein 2012 981 gene locus_tag LOCUS_19240 2012 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_19240 2329 2009 gene locus_tag LOCUS_19250 2329 2009 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT3 protein_id gnl|my_center|LOCUS_19250 2648 2331 gene locus_tag LOCUS_19260 2648 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3015 2650 gene locus_tag LOCUS_19270 3015 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence359 674 102 gene locus_tag LOCUS_19280 674 102 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_19280 1147 671 gene locus_tag LOCUS_19290 gene mreD 1147 671 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BN4 protein_id gnl|my_center|LOCUS_19290 1989 1144 gene locus_tag LOCUS_19300 gene mreC 1989 1144 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_19300 3129 2092 gene locus_tag LOCUS_19310 3129 2092 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence360 209 574 gene locus_tag LOCUS_19320 gene phaG 209 574 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_19320 2069 696 gene locus_tag LOCUS_19330 gene radA 2069 696 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24554 protein_id gnl|my_center|LOCUS_19330 >Feature sequence361 1942 8 gene locus_tag LOCUS_19340 gene thrS 1942 8 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP9 protein_id gnl|my_center|LOCUS_19340 2186 2743 gene locus_tag LOCUS_19350 gene yajL 2186 2743 CDS product oxidative-stress-resistance chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418115.1 protein_id gnl|my_center|LOCUS_19350 <3376 2838 gene locus_tag LOCUS_19360 <3376 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919935.1:VWA domain-containing protein >Feature sequence362 <3358 2160 gene locus_tag LOCUS_19370 <3358 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBQ3:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence363 1802 933 gene locus_tag LOCUS_19380 1802 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3325 1880 gene locus_tag LOCUS_19390 3325 1880 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence364 2560 1628 gene locus_tag LOCUS_19400 2560 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3338 2700 gene locus_tag LOCUS_19410 3338 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence365 405 824 gene locus_tag LOCUS_19420 405 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1168 821 gene locus_tag LOCUS_19430 1168 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2693 1161 gene locus_tag LOCUS_19440 gene lnt 2693 1161 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_19440 <3328 2729 gene locus_tag LOCUS_19450 <3328 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003368790.1:transporter >Feature sequence366 1049 267 gene locus_tag LOCUS_19460 1049 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1685 1101 gene locus_tag LOCUS_19470 1685 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1948 2424 gene locus_tag LOCUS_19480 1948 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2439 3134 gene locus_tag LOCUS_19490 gene dsbA 2439 3134 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_19490 >Feature sequence367 408 324 gene locus_tag LOCUS_t00110 408 324 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 640 1656 gene locus_tag LOCUS_19500 gene tqsA 640 1656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_19500 1901 3163 gene locus_tag LOCUS_19510 1901 3163 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence368 103 501 gene locus_tag LOCUS_19520 103 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 504 821 gene locus_tag LOCUS_19530 504 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 814 1215 gene locus_tag LOCUS_19540 814 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2951 1254 gene locus_tag LOCUS_19550 2951 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3303 3151 gene locus_tag LOCUS_19560 3303 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence369 262 720 gene locus_tag LOCUS_19570 262 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2257 800 gene locus_tag LOCUS_19580 2257 800 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_19580 <3289 2324 gene locus_tag LOCUS_19590 <3289 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528286.1:tetratricopeptide repeat protein 38 family protein >Feature sequence370 1704 1060 gene locus_tag LOCUS_19600 gene leuD 1704 1060 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_19600 3141 1720 gene locus_tag LOCUS_19610 gene leuC 3141 1720 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58949 protein_id gnl|my_center|LOCUS_19610 >Feature sequence371 >Feature sequence372 <1 547 gene locus_tag LOCUS_19620 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704174.1:transcriptional regulator IlvY 593 1393 gene locus_tag LOCUS_19630 gene pssA 593 1393 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_19630 1445 2446 gene locus_tag LOCUS_19640 gene msrP 1445 2446 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_19640 2446 3048 gene locus_tag LOCUS_19650 gene msrQ 2446 3048 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_19650 >Feature sequence373 245 169 gene locus_tag LOCUS_t00120 245 169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 513 1271 gene locus_tag LOCUS_19660 513 1271 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_19660 1986 1363 gene locus_tag LOCUS_19670 1986 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2449 2373 gene locus_tag LOCUS_t00130 2449 2373 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2534 2459 gene locus_tag LOCUS_t00140 2534 2459 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence374 445 1008 gene locus_tag LOCUS_19680 445 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1590 1066 gene locus_tag LOCUS_19690 1590 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2220 2840 gene locus_tag LOCUS_19700 2220 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence375 <1 619 gene locus_tag LOCUS_19710 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889U1:single-stranded DNA-binding protein 697 1008 gene locus_tag LOCUS_19720 gene ydzA 697 1008 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_19720 2323 1088 gene locus_tag LOCUS_19730 2323 1088 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_19730 2987 2310 gene locus_tag LOCUS_19740 2987 2310 CDS product isomerase/hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence376 340 621 gene locus_tag LOCUS_19750 gene cas2-1 340 621 CDS product CRISPR-associated endoribonuclease Cas2 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS1 protein_id gnl|my_center|LOCUS_19750 627 1571 gene locus_tag LOCUS_19760 gene cas1-1 627 1571 CDS product CRISPR-associated endonuclease Cas1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS2 protein_id gnl|my_center|LOCUS_19760 1561 2340 gene locus_tag LOCUS_19770 1561 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2357 2623 gene locus_tag LOCUS_19780 gene cas2-2 2357 2623 CDS product CRISPR-associated endoribonuclease Cas2 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS4 protein_id gnl|my_center|LOCUS_19780 2983 2678 gene locus_tag LOCUS_19790 2983 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence377 <1 1447 gene locus_tag LOCUS_19800 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P31961:phosphogluconate dehydratase 1463 2446 gene locus_tag LOCUS_19810 gene glk 1463 2446 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64254 protein_id gnl|my_center|LOCUS_19810 3006 2680 gene locus_tag LOCUS_19820 3006 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence378 1763 1137 gene locus_tag LOCUS_19830 gene upp 1763 1137 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI9 protein_id gnl|my_center|LOCUS_19830 >Feature sequence379 917 264 gene locus_tag LOCUS_19840 917 264 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_19840 1875 892 gene locus_tag LOCUS_19850 1875 892 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_19850 2564 2698 gene locus_tag LOCUS_19860 2564 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence380 252 1646 gene locus_tag LOCUS_19870 252 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1840 2190 gene locus_tag LOCUS_19880 1840 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479981.1 protein_id gnl|my_center|LOCUS_19880 2302 3015 gene locus_tag LOCUS_19890 2302 3015 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence381 <1 565 gene locus_tag LOCUS_19900 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P00106:cytochrome c4 812 1453 gene locus_tag LOCUS_19910 gene dsbA 812 1453 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_19910 >Feature sequence382 <1 956 gene locus_tag LOCUS_19920 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989571.1:2-hydroxyglutaryl-CoA dehydratase note possible pseudo, internal stop codon >Feature sequence383 1819 764 gene locus_tag LOCUS_19930 1819 764 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 protein_id gnl|my_center|LOCUS_19930 3105 1816 gene locus_tag LOCUS_19940 3105 1816 CDS product DNA circularization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309364.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence384 690 1997 gene locus_tag LOCUS_19950 gene pcnB 690 1997 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_19950 1994 2488 gene locus_tag LOCUS_19960 gene folK 1994 2488 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_19960 >Feature sequence385 1183 710 gene locus_tag LOCUS_19970 1183 710 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_19970 2994 1201 gene locus_tag LOCUS_19980 2994 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence386 441 79 gene locus_tag LOCUS_19990 441 79 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_19990 1650 511 gene locus_tag LOCUS_20000 gene tgt 1650 511 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_20000 2808 1768 gene locus_tag LOCUS_20010 gene queA 2808 1768 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_20010 3000 3086 gene locus_tag LOCUS_t00150 3000 3086 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence387 1956 298 gene locus_tag LOCUS_20020 1956 298 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_20020 <3160 2015 gene locus_tag LOCUS_20030 <3160 2015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082450.1:CoA transferase >Feature sequence388 363 288 gene locus_tag LOCUS_t00160 363 288 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 723 451 gene locus_tag LOCUS_20040 723 451 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_20040 1817 720 gene locus_tag LOCUS_20050 1817 720 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 protein_id gnl|my_center|LOCUS_20050 2561 1911 gene locus_tag LOCUS_20060 2561 1911 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence389 19 1296 gene locus_tag LOCUS_20070 19 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1562 2062 gene locus_tag LOCUS_20080 1562 2062 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104071.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence390 <1 776 gene locus_tag LOCUS_20090 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902866.1:permease 1432 854 gene locus_tag LOCUS_20100 1432 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2990 1554 gene locus_tag LOCUS_20110 2990 1554 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence391 <1 665 gene locus_tag LOCUS_20120 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P95458:uroporphyrinogen decarboxylase >Feature sequence392 <1 1444 gene locus_tag LOCUS_20130 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZS84:putative lipid II flippase MurJ 1547 2482 gene locus_tag LOCUS_20140 gene ribF 1547 2482 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_20140 >Feature sequence393 306 1322 gene locus_tag LOCUS_20150 gene epd 306 1322 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPR1 protein_id gnl|my_center|LOCUS_20150 1382 2545 gene locus_tag LOCUS_20160 gene pgk 1382 2545 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65703 protein_id gnl|my_center|LOCUS_20160 >Feature sequence394 <1 802 gene locus_tag LOCUS_20170 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040284.1:AraC family transcriptional regulator 967 812 gene locus_tag LOCUS_20180 967 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1686 2642 gene locus_tag LOCUS_20190 1686 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3005 2667 gene locus_tag LOCUS_20200 3005 2667 CDS product glycolate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence395 2902 959 gene locus_tag LOCUS_20210 2902 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence396 810 1706 gene locus_tag LOCUS_20220 810 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1719 2738 gene locus_tag LOCUS_20230 1719 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence397 786 310 gene locus_tag LOCUS_20240 786 310 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_20240 1758 829 gene locus_tag LOCUS_20250 1758 829 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 protein_id gnl|my_center|LOCUS_20250 1955 3049 gene locus_tag LOCUS_20260 1955 3049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence398 685 610 gene locus_tag LOCUS_t00170 685 610 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 855 780 gene locus_tag LOCUS_t00180 855 780 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1703 915 gene locus_tag LOCUS_20270 1703 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2293 1706 gene locus_tag LOCUS_20280 2293 1706 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 protein_id gnl|my_center|LOCUS_20280 <3100 2334 gene locus_tag LOCUS_20290 <3100 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83F59:protein TolB >Feature sequence399 678 845 gene locus_tag LOCUS_20300 678 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1455 922 gene locus_tag LOCUS_20310 1455 922 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_20310 1725 1456 gene locus_tag LOCUS_20320 1725 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2035 1787 gene locus_tag LOCUS_20330 2035 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3061 2153 gene locus_tag LOCUS_20340 3061 2153 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490513.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence400 <1 1140 gene locus_tag LOCUS_20350 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891989.1:radical SAM protein 1137 1751 gene locus_tag LOCUS_20360 1137 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1748 2800 gene locus_tag LOCUS_20370 1748 2800 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_20370 2802 3089 gene locus_tag LOCUS_20380 2802 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence401 <1 526 gene locus_tag LOCUS_20390 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZV02:glutamate--tRNA ligase 529 1365 gene locus_tag LOCUS_20400 529 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence402 639 103 gene locus_tag LOCUS_20410 639 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1390 710 gene locus_tag LOCUS_20420 1390 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2450 1380 gene locus_tag LOCUS_20430 2450 1380 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LI4 protein_id gnl|my_center|LOCUS_20430 >Feature sequence403 826 1776 gene locus_tag LOCUS_20440 826 1776 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_20440 1826 2350 gene locus_tag LOCUS_20450 1826 2350 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_20450 2382 2609 gene locus_tag LOCUS_20460 2382 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence404 519 1613 gene locus_tag LOCUS_20470 519 1613 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_20470 2640 1696 gene locus_tag LOCUS_20480 2640 1696 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence405 1374 175 gene locus_tag LOCUS_20490 gene cca 1374 175 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZI64 protein_id gnl|my_center|LOCUS_20490 <3081 1507 gene locus_tag LOCUS_20500 <3081 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095059.1:conjugative transfer protein >Feature sequence406 551 1693 gene locus_tag LOCUS_20510 gene pdxB 551 1693 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_20510 2203 1781 gene locus_tag LOCUS_20520 2203 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 <3058 2248 gene locus_tag LOCUS_20530 <3058 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000074540.1:aminotransferase >Feature sequence407 205 1062 gene locus_tag LOCUS_20540 gene folD 205 1062 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 protein_id gnl|my_center|LOCUS_20540 2541 1171 gene locus_tag LOCUS_20550 gene cysS 2541 1171 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_20550 <3054 2554 gene locus_tag LOCUS_20560 <3054 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6P2:glutamine--tRNA ligase >Feature sequence408 1952 1200 gene locus_tag LOCUS_20570 1952 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2079 2702 gene locus_tag LOCUS_20580 gene acpD 2079 2702 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D981 protein_id gnl|my_center|LOCUS_20580 >Feature sequence409 <1 567 gene locus_tag LOCUS_20590 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082059.1:monovalent cation/H+ antiporter subunit A 567 944 gene locus_tag LOCUS_20600 567 944 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_20600 941 2449 gene locus_tag LOCUS_20610 941 2449 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_20610 2446 2931 gene locus_tag LOCUS_20620 2446 2931 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence410 515 1435 gene locus_tag LOCUS_20630 515 1435 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_20630 2984 1518 gene locus_tag LOCUS_20640 gene sypG 2984 1518 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263835.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence411 2951 999 gene locus_tag LOCUS_20650 2951 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence412 1752 541 gene locus_tag LOCUS_20660 1752 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_20660 2316 2897 gene locus_tag LOCUS_20670 gene rnfA 2316 2897 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_20670 >Feature sequence413 <3043 1618 gene locus_tag LOCUS_20680 <3043 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZV81:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence414 <1 610 gene locus_tag LOCUS_20690 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704658.1:NAD+ synthase 1483 659 gene locus_tag LOCUS_20700 gene bamD 1483 659 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH9 protein_id gnl|my_center|LOCUS_20700 1632 2597 gene locus_tag LOCUS_20710 gene rluD 1632 2597 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_20710 >Feature sequence415 1084 107 gene locus_tag LOCUS_20720 1084 107 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_20720 1760 1362 gene locus_tag LOCUS_20730 1760 1362 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_20730 2224 2745 gene locus_tag LOCUS_20740 2224 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence416 602 1879 gene locus_tag LOCUS_20750 602 1879 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_20750 1861 2937 gene locus_tag LOCUS_20760 1861 2937 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX89 protein_id gnl|my_center|LOCUS_20760 >Feature sequence417 539 1120 gene locus_tag LOCUS_20770 539 1120 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 protein_id gnl|my_center|LOCUS_20770 1207 2910 gene locus_tag LOCUS_20780 1207 2910 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence418 504 1085 gene locus_tag LOCUS_20790 504 1085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence419 1429 563 gene locus_tag LOCUS_20800 1429 563 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_20800 1533 2642 gene locus_tag LOCUS_20810 1533 2642 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTA6 protein_id gnl|my_center|LOCUS_20810 >Feature sequence420 240 575 gene locus_tag LOCUS_20820 240 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 575 1666 gene locus_tag LOCUS_20830 gene rlmG 575 1666 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE2 protein_id gnl|my_center|LOCUS_20830 1669 2178 gene locus_tag LOCUS_20840 1669 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence421 <2997 851 gene locus_tag LOCUS_20850 <2997 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895594.1:hybrid sensor histidine kinase/response regulator >Feature sequence422 1297 1830 gene locus_tag LOCUS_20860 1297 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2288 1788 gene locus_tag LOCUS_20870 2288 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence423 1180 461 gene locus_tag LOCUS_20880 1180 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969951.1 protein_id gnl|my_center|LOCUS_20880 1464 2387 gene locus_tag LOCUS_20890 1464 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence424 650 405 gene locus_tag LOCUS_20900 650 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 893 666 gene locus_tag LOCUS_20910 893 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1342 890 gene locus_tag LOCUS_20920 1342 890 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389196.1 protein_id gnl|my_center|LOCUS_20920 1794 1354 gene locus_tag LOCUS_20930 1794 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261531.1 protein_id gnl|my_center|LOCUS_20930 1971 2570 gene locus_tag LOCUS_20940 1971 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence425 283 828 gene locus_tag LOCUS_20950 283 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1069 1659 gene locus_tag LOCUS_20960 1069 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence426 2332 200 gene locus_tag LOCUS_20970 gene recD 2332 200 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPB7 protein_id gnl|my_center|LOCUS_20970 <2971 2329 gene locus_tag LOCUS_20980 <2971 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0WI24:RecBCD enzyme subunit RecB >Feature sequence427 880 242 gene locus_tag LOCUS_20990 880 242 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187892.1 protein_id gnl|my_center|LOCUS_20990 1956 889 gene locus_tag LOCUS_21000 1956 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556233.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence428 <1 793 gene locus_tag LOCUS_21010 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUM1:GTPase HflX 901 2094 gene locus_tag LOCUS_21020 gene hflK 901 2094 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence429 161 1867 gene locus_tag LOCUS_21030 161 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence430 <1 590 gene locus_tag LOCUS_21040 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813860.1:branched-chain amino acid ABC transporter permease 602 1528 gene locus_tag LOCUS_21050 602 1528 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 protein_id gnl|my_center|LOCUS_21050 1649 2830 gene locus_tag LOCUS_21060 gene ivdA 1649 2830 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence431 <1 549 gene locus_tag LOCUS_21070 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP08:quinolinate synthase A 1995 553 gene locus_tag LOCUS_21080 1995 553 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_21080 2237 2602 gene locus_tag LOCUS_21090 2237 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence432 95 556 gene locus_tag LOCUS_21100 95 556 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 protein_id gnl|my_center|LOCUS_21100 939 1481 gene locus_tag LOCUS_21110 939 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1478 1666 gene locus_tag LOCUS_21120 1478 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence433 737 1090 gene locus_tag LOCUS_21130 737 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1378 1109 gene locus_tag LOCUS_21140 1378 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2175 1396 gene locus_tag LOCUS_21150 2175 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 <2931 2150 gene locus_tag LOCUS_21160 <2931 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJS2:CRISPR-associated endonuclease Cas1 1 >Feature sequence434 >Feature sequence435 <1 1988 gene locus_tag LOCUS_21170 <1 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV59:polyribonucleotide nucleotidyltransferase <2921 2068 gene locus_tag LOCUS_21180 <2921 2068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071740.1:tRNA/rRNA cytosine-C5-methylase RsmB >Feature sequence436 1685 543 gene locus_tag LOCUS_21190 1685 543 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_21190 2776 1685 gene locus_tag LOCUS_21200 2776 1685 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence437 81 1133 gene locus_tag LOCUS_21210 gene purM 81 1133 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H3 protein_id gnl|my_center|LOCUS_21210 1130 1798 gene locus_tag LOCUS_21220 gene purN 1130 1798 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ50 protein_id gnl|my_center|LOCUS_21220 1821 2642 gene locus_tag LOCUS_21230 1821 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence438 62 247 gene locus_tag LOCUS_21240 gene rpmF 62 247 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_21240 249 1262 gene locus_tag LOCUS_21250 gene plsX 249 1262 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_21250 1446 2333 gene locus_tag LOCUS_21260 1446 2333 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_21260 >Feature sequence439 29 1213 gene locus_tag LOCUS_21270 29 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1307 1840 gene locus_tag LOCUS_21280 1307 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence440 1616 996 gene locus_tag LOCUS_21290 1616 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2386 1640 gene locus_tag LOCUS_21300 gene gph-2 2386 1640 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN24 protein_id gnl|my_center|LOCUS_21300 >Feature sequence441 1684 296 gene locus_tag LOCUS_21310 1684 296 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence442 <1 1166 gene locus_tag LOCUS_21320 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK7:Na(+)-translocating NADH-quinone reductase subunit B 1156 1953 gene locus_tag LOCUS_21330 gene nqrC 1156 1953 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_21330 1955 2617 gene locus_tag LOCUS_21340 gene nqrD 1955 2617 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_21340 >Feature sequence443 1601 21 gene locus_tag LOCUS_21350 1601 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 <2868 1618 gene locus_tag LOCUS_21360 <2868 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_296367.1:serine/threonine protein kinase, putative >Feature sequence444 2589 2714 gene locus_tag LOCUS_21370 2589 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence445 1341 472 gene locus_tag LOCUS_21380 gene hdtR 1341 472 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_21380 1493 1843 gene locus_tag LOCUS_21390 1493 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1844 2269 gene locus_tag LOCUS_21400 1844 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401758.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence446 >Feature sequence447 >Feature sequence448 368 1057 gene locus_tag LOCUS_21410 368 1057 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 protein_id gnl|my_center|LOCUS_21410 1061 2308 gene locus_tag LOCUS_21420 1061 2308 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_21420 2640 2425 gene locus_tag LOCUS_21430 2640 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence449 <1 590 gene locus_tag LOCUS_21440 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102980.1:NAD(P)-dependent oxidoreductase <2848 682 gene locus_tag LOCUS_21450 <2848 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096603.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence450 485 2005 gene locus_tag LOCUS_21460 485 2005 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence451 149 1534 gene locus_tag LOCUS_21470 149 1534 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_21470 1728 2732 gene locus_tag LOCUS_21480 1728 2732 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence452 1706 2179 gene locus_tag LOCUS_21490 1706 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence453 1032 358 gene locus_tag LOCUS_21500 1032 358 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_21500 1091 2344 gene locus_tag LOCUS_21510 gene coaBC 1091 2344 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_21510 2347 2802 gene locus_tag LOCUS_21520 gene dut 2347 2802 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD3 protein_id gnl|my_center|LOCUS_21520 >Feature sequence454 1298 507 gene locus_tag LOCUS_21530 1298 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1531 1295 gene locus_tag LOCUS_21540 1531 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 2472 1528 gene locus_tag LOCUS_21550 gene hupH 2472 1528 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence455 176 829 gene locus_tag LOCUS_21560 176 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1392 856 gene locus_tag LOCUS_21570 gene roxR 1392 856 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_21570 2696 1425 gene locus_tag LOCUS_21580 gene roxS 2696 1425 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence456 952 176 gene locus_tag LOCUS_21590 gene modA 952 176 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104307.1 protein_id gnl|my_center|LOCUS_21590 <2787 1944 gene locus_tag LOCUS_21600 <2787 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206956.1:adenosine kinase >Feature sequence457 899 351 gene locus_tag LOCUS_21610 899 351 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947683.1 protein_id gnl|my_center|LOCUS_21610 1198 1950 gene locus_tag LOCUS_21620 1198 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence458 2119 1628 gene locus_tag LOCUS_21630 2119 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence459 1625 1413 gene locus_tag LOCUS_21640 1625 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2148 1609 gene locus_tag LOCUS_21650 2148 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2253 2606 gene locus_tag LOCUS_21660 2253 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2603 2752 gene locus_tag LOCUS_21670 2603 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence460 730 176 gene locus_tag LOCUS_21680 730 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 847 2301 gene locus_tag LOCUS_21690 gene ycf24 847 2301 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence461 <1 1472 gene locus_tag LOCUS_21700 <1 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072003.1:methylcrotonoyl-CoA carboxylase 1483 2292 gene locus_tag LOCUS_21710 1483 2292 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106425.1 protein_id gnl|my_center|LOCUS_21710 2300 2716 gene locus_tag LOCUS_21720 2300 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence462 1164 154 gene locus_tag LOCUS_21730 1164 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1718 1203 gene locus_tag LOCUS_21740 1718 1203 CDS product glyoxalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474277.1 protein_id gnl|my_center|LOCUS_21740 1976 1743 gene locus_tag LOCUS_21750 1976 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence463 589 155 gene locus_tag LOCUS_21760 gene yaeJ 589 155 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_21760 744 1052 gene locus_tag LOCUS_21770 gene yhbQ 744 1052 CDS product UPF0213 protein YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67350 protein_id gnl|my_center|LOCUS_21770 1151 1912 gene locus_tag LOCUS_21780 1151 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence464 628 392 gene locus_tag LOCUS_21790 gene cspD 628 392 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_21790 825 1148 gene locus_tag LOCUS_21800 gene clpS 825 1148 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_21800 >Feature sequence465 125 757 gene locus_tag LOCUS_21810 125 757 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_21810 865 1719 gene locus_tag LOCUS_21820 865 1719 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_21820 2440 1880 gene locus_tag LOCUS_21830 2440 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence466 369 1232 gene locus_tag LOCUS_21840 gene pabC 369 1232 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478679.1 protein_id gnl|my_center|LOCUS_21840 1324 2337 gene locus_tag LOCUS_21850 1324 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence467 155 80 gene locus_tag LOCUS_t00190 155 80 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <2709 233 gene locus_tag LOCUS_21860 <2709 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262580.1:acriflavin resistance protein >Feature sequence468 310 1044 gene locus_tag LOCUS_21870 310 1044 CDS product SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence469 <1 1702 gene locus_tag LOCUS_21880 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072999.1:multidrug transporter AcrB 1779 2279 gene locus_tag LOCUS_21890 1779 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence470 936 2018 gene locus_tag LOCUS_21900 936 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2008 2364 gene locus_tag LOCUS_21910 2008 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence471 583 68 gene locus_tag LOCUS_21920 583 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210930.1 protein_id gnl|my_center|LOCUS_21920 1834 767 gene locus_tag LOCUS_21930 1834 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_21930 2136 1831 gene locus_tag LOCUS_21940 2136 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence472 1744 353 gene locus_tag LOCUS_21950 1744 353 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_21950 1859 1984 gene locus_tag LOCUS_21960 1859 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2044 2259 gene locus_tag LOCUS_21970 2044 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence473 1428 145 gene locus_tag LOCUS_21980 1428 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence474 406 140 gene locus_tag LOCUS_21990 406 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 956 387 gene locus_tag LOCUS_22000 956 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1437 934 gene locus_tag LOCUS_22010 gene rpoE 1437 934 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence475 1720 404 gene locus_tag LOCUS_22020 1720 404 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence476 850 668 gene locus_tag LOCUS_22030 850 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 992 1915 gene locus_tag LOCUS_22040 gene gcvA 992 1915 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_22040 2262 1900 gene locus_tag LOCUS_22050 2262 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2372 2530 gene locus_tag LOCUS_22060 2372 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence477 <2658 895 gene locus_tag LOCUS_22070 <2658 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083787.1:hybrid sensor histidine kinase/response regulator >Feature sequence478 382 1977 gene locus_tag LOCUS_22080 382 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence479 2237 1152 gene locus_tag LOCUS_22090 2237 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence480 1641 367 gene locus_tag LOCUS_22100 1641 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence481 1256 954 gene locus_tag LOCUS_22110 1256 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2542 1400 gene locus_tag LOCUS_22120 gene gtrB 2542 1400 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence482 294 1121 gene locus_tag LOCUS_22130 gene rsmA 294 1121 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST6 protein_id gnl|my_center|LOCUS_22130 1108 1485 gene locus_tag LOCUS_22140 gene apaG 1108 1485 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG4 protein_id gnl|my_center|LOCUS_22140 1506 2327 gene locus_tag LOCUS_22150 gene apaH 1506 2327 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF6 protein_id gnl|my_center|LOCUS_22150 >Feature sequence483 1231 2586 gene locus_tag LOCUS_22160 1231 2586 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence484 >Feature sequence485 362 2134 gene locus_tag LOCUS_22170 gene aspS 362 2134 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_22170 2407 2213 gene locus_tag LOCUS_22180 2407 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence486 <2611 1841 gene locus_tag LOCUS_22190 <2611 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I6J0:spermidine-binding periplasmic protein SpuE >Feature sequence487 >Feature sequence488 <1 1054 gene locus_tag LOCUS_22200 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105092.1:GGDEF domain-containing protein 1121 2587 gene locus_tag LOCUS_22210 1121 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence489 24 680 gene locus_tag LOCUS_22220 24 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 protein_id gnl|my_center|LOCUS_22220 719 1261 gene locus_tag LOCUS_22230 719 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123046.1 protein_id gnl|my_center|LOCUS_22230 1276 2145 gene locus_tag LOCUS_22240 1276 2145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123045.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence490 <1 2457 gene locus_tag LOCUS_22250 <1 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P38100:carbamoyl-phosphate synthase large chain >Feature sequence491 108 1007 gene locus_tag LOCUS_22260 108 1007 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704110.1 protein_id gnl|my_center|LOCUS_22260 1909 1052 gene locus_tag LOCUS_22270 gene rlmJ 1909 1052 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF9 protein_id gnl|my_center|LOCUS_22270 <2595 2032 gene locus_tag LOCUS_22280 <2595 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E3D5:protein-export membrane protein SecF >Feature sequence492 1953 85 gene locus_tag LOCUS_22290 1953 85 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence493 1872 763 gene locus_tag LOCUS_22300 gene wecB 1872 763 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE3 protein_id gnl|my_center|LOCUS_22300 >Feature sequence494 <1 1636 gene locus_tag LOCUS_22310 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I7B8:glycine--tRNA ligase beta subunit 1699 2253 gene locus_tag LOCUS_22320 1699 2253 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B34 protein_id gnl|my_center|LOCUS_22320 >Feature sequence495 242 84 gene locus_tag LOCUS_22330 242 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 448 233 gene locus_tag LOCUS_22340 448 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1479 598 gene locus_tag LOCUS_22350 1479 598 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769653.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence496 785 567 gene locus_tag LOCUS_22360 785 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2533 872 gene locus_tag LOCUS_22370 2533 872 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence497 814 188 gene locus_tag LOCUS_22380 814 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1460 945 gene locus_tag LOCUS_22390 1460 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2083 1457 gene locus_tag LOCUS_22400 2083 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence498 102 731 gene locus_tag LOCUS_22410 gene gst 102 731 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_22410 828 1802 gene locus_tag LOCUS_22420 gene bsn 828 1802 CDS product extracellular ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32150 protein_id gnl|my_center|LOCUS_22420 2259 1939 gene locus_tag LOCUS_22430 2259 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence499 14 1843 gene locus_tag LOCUS_22440 gene deaD 14 1843 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK4 protein_id gnl|my_center|LOCUS_22440 >Feature sequence500 294 902 gene locus_tag LOCUS_22450 294 902 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937529.1 protein_id gnl|my_center|LOCUS_22450 927 1232 gene locus_tag LOCUS_22460 927 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1229 2188 gene locus_tag LOCUS_22470 1229 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence501 1047 382 gene locus_tag LOCUS_22480 1047 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1769 1044 gene locus_tag LOCUS_22490 1769 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2478 1828 gene locus_tag LOCUS_22500 2478 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence502 1032 151 gene locus_tag LOCUS_22510 gene poxA 1032 151 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_22510 1257 1436 gene locus_tag LOCUS_22520 1257 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2059 1433 gene locus_tag LOCUS_22530 2059 1433 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_22530 2475 2056 gene locus_tag LOCUS_22540 2475 2056 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208636.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence503 >Feature sequence504 268 885 gene locus_tag LOCUS_22550 268 885 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704887.1 protein_id gnl|my_center|LOCUS_22550 1033 1407 gene locus_tag LOCUS_22560 1033 1407 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462158.1 protein_id gnl|my_center|LOCUS_22560 1572 2150 gene locus_tag LOCUS_22570 1572 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence505 2199 1261 gene locus_tag LOCUS_22580 2199 1261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence506 563 970 gene locus_tag LOCUS_22590 563 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1145 1220 gene locus_tag LOCUS_t00200 1145 1220 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1240 1315 gene locus_tag LOCUS_t00210 1240 1315 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1766 1452 gene locus_tag LOCUS_22600 1766 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence507 <1 903 gene locus_tag LOCUS_22610 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RSR2:histidine kinase 2466 937 gene locus_tag LOCUS_22620 2466 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence508 <2468 92 gene locus_tag LOCUS_22630 <2468 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545463.1:type III-A CRISPR-associated protein Cas10/Csm1 >Feature sequence509 126 608 gene locus_tag LOCUS_22640 126 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22640 1335 640 gene locus_tag LOCUS_22650 1335 640 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_22650 2351 1344 gene locus_tag LOCUS_22660 2351 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence510 699 1892 gene locus_tag LOCUS_22670 699 1892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence511 <1 847 gene locus_tag LOCUS_22680 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZJ2:fatty acid oxidation complex subunit alpha >Feature sequence512 1474 344 gene locus_tag LOCUS_22690 1474 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence513 <1 674 gene locus_tag LOCUS_22700 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263839.1:sugar translocase 665 2056 gene locus_tag LOCUS_22710 gene sypL 665 2056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence514 1886 846 gene locus_tag LOCUS_22720 1886 846 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence515 <2431 849 gene locus_tag LOCUS_22730 <2431 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence516 >Feature sequence517 907 428 gene locus_tag LOCUS_22740 907 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_22740 <2424 1190 gene locus_tag LOCUS_22750 <2424 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071065.1:ammonium transporter channel family protein >Feature sequence518 359 1216 gene locus_tag LOCUS_22760 359 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1238 1531 gene locus_tag LOCUS_22770 1238 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1852 1679 gene locus_tag LOCUS_22780 1852 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence519 1842 868 gene locus_tag LOCUS_22790 1842 868 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence520 >Feature sequence521 1886 1203 gene locus_tag LOCUS_22800 1886 1203 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence522 1077 370 gene locus_tag LOCUS_22810 1077 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2258 1185 gene locus_tag LOCUS_22820 2258 1185 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence523 <1 949 gene locus_tag LOCUS_22830 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQB4:bifunctional ligase/repressor BirA 930 1640 gene locus_tag LOCUS_22840 gene coaX 930 1640 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y6 protein_id gnl|my_center|LOCUS_22840 1616 2287 gene locus_tag LOCUS_22850 1616 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence524 143 853 gene locus_tag LOCUS_22860 143 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1502 951 gene locus_tag LOCUS_22870 1502 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2267 1653 gene locus_tag LOCUS_22880 2267 1653 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence525 1292 480 gene locus_tag LOCUS_22890 gene crc 1292 480 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_22890 1394 2041 gene locus_tag LOCUS_22900 gene pyrE 1394 2041 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD7 protein_id gnl|my_center|LOCUS_22900 >Feature sequence526 <2364 1133 gene locus_tag LOCUS_22910 <2364 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33639:sensor protein PilS >Feature sequence527 923 522 gene locus_tag LOCUS_22920 923 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence528 334 1530 gene locus_tag LOCUS_22930 334 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1778 2263 gene locus_tag LOCUS_22940 gene slyD 1778 2263 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_22940 >Feature sequence529 2213 441 gene locus_tag LOCUS_22950 2213 441 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence530 <1 1626 gene locus_tag LOCUS_22960 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I7C2:DNA gyrase subunit B >Feature sequence531 1505 2131 gene locus_tag LOCUS_22970 1505 2131 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence532 >Feature sequence533 <1 715 gene locus_tag LOCUS_22980 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTU5:putative oxaloacetate decarboxylase beta chain 2300 819 gene locus_tag LOCUS_22990 gene mqo1 2300 819 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_22990 >Feature sequence534 55 900 gene locus_tag LOCUS_23000 gene smtA 55 900 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LN6 protein_id gnl|my_center|LOCUS_23000 897 1418 gene locus_tag LOCUS_23010 897 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_23010 1981 1905 gene locus_tag LOCUS_t00220 1981 1905 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2104 2028 gene locus_tag LOCUS_t00230 2104 2028 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2268 2179 gene locus_tag LOCUS_t00240 2268 2179 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence535 2191 1805 gene locus_tag LOCUS_23020 gene gcvH 2191 1805 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJE8 protein_id gnl|my_center|LOCUS_23020 >Feature sequence536 372 779 gene locus_tag LOCUS_23030 372 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence537 <1 1882 gene locus_tag LOCUS_23040 <1 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550684.1:exported alkaline phosphatase >Feature sequence538 1160 516 gene locus_tag LOCUS_23050 1160 516 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_23050 <2325 1288 gene locus_tag LOCUS_23060 <2325 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0K4:isocitrate lyase >Feature sequence539 604 1545 gene locus_tag LOCUS_23070 gene hemC 604 1545 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_23070 1547 2287 gene locus_tag LOCUS_23080 gene hemD 1547 2287 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence540 <2307 757 gene locus_tag LOCUS_23090 <2307 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9LCT3:protein translocase subunit SecA >Feature sequence541 298 1350 gene locus_tag LOCUS_23100 298 1350 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence542 816 370 gene locus_tag LOCUS_23110 816 370 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_23110 1271 837 gene locus_tag LOCUS_23120 1271 837 CDS product cytochrome c-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_23120 1891 1292 gene locus_tag LOCUS_23130 1891 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence543 975 13 gene locus_tag LOCUS_23140 975 13 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE45 protein_id gnl|my_center|LOCUS_23140 >Feature sequence544 2057 1614 gene locus_tag LOCUS_23150 2057 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence545 469 987 gene locus_tag LOCUS_23160 gene ruvC 469 987 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A1 protein_id gnl|my_center|LOCUS_23160 1061 1684 gene locus_tag LOCUS_23170 gene ruvA 1061 1684 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_23170 >Feature sequence546 1236 880 gene locus_tag LOCUS_23180 1236 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence547 <1 1239 gene locus_tag LOCUS_23190 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405008.1:ABC transporter ATP-binding protein 1232 1948 gene locus_tag LOCUS_23200 1232 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence548 1053 142 gene locus_tag LOCUS_23210 gene cysM 1053 142 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_23210 >Feature sequence549 20 727 gene locus_tag LOCUS_23220 gene csm3_2 20 727 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_23220 749 1801 gene locus_tag LOCUS_23230 749 1801 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence550 99 704 gene locus_tag LOCUS_23240 99 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 685 1095 gene locus_tag LOCUS_23250 685 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1880 1176 gene locus_tag LOCUS_23260 1880 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence551 1941 850 gene locus_tag LOCUS_23270 gene prfA 1941 850 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN4 protein_id gnl|my_center|LOCUS_23270 >Feature sequence552 43 228 gene locus_tag LOCUS_23280 gene rpmD 43 228 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF39 protein_id gnl|my_center|LOCUS_23280 230 664 gene locus_tag LOCUS_23290 gene rplO 230 664 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 protein_id gnl|my_center|LOCUS_23290 664 1989 gene locus_tag LOCUS_23300 gene secY 664 1989 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_23300 >Feature sequence553 291 959 gene locus_tag LOCUS_23310 291 959 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_23310 952 1683 gene locus_tag LOCUS_23320 gene queE 952 1683 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_23320 <2277 1734 gene locus_tag LOCUS_23330 <2277 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000647231.1:quinone oxidoreductase >Feature sequence554 1496 993 gene locus_tag LOCUS_23340 1496 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 <2276 1727 gene locus_tag LOCUS_23350 <2276 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037803.1:LysR family transcriptional regulator >Feature sequence555 430 71 gene locus_tag LOCUS_23360 430 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23360 1862 552 gene locus_tag LOCUS_23370 gene tig 1862 552 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_23370 >Feature sequence556 867 403 gene locus_tag LOCUS_23380 867 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1760 906 gene locus_tag LOCUS_23390 1760 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence557 993 394 gene locus_tag LOCUS_23400 993 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence558 1509 1033 gene locus_tag LOCUS_23410 1509 1033 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence559 1549 1232 gene locus_tag LOCUS_23420 1549 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1817 1527 gene locus_tag LOCUS_23430 1817 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence560 <1 562 gene locus_tag LOCUS_23440 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114045.1:Xaa-Pro aminopeptidase 687 1916 gene locus_tag LOCUS_23450 687 1916 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266319.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence561 2235 1966 gene locus_tag LOCUS_23460 2235 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence562 <1 614 gene locus_tag LOCUS_23470 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104871.1:ATP-dependent helicase 1370 744 gene locus_tag LOCUS_23480 gene hflD 1370 744 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 protein_id gnl|my_center|LOCUS_23480 <2232 1363 gene locus_tag LOCUS_23490 <2232 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87ZR6:tRNA-specific 2-thiouridylase MnmA >Feature sequence563 1821 478 gene locus_tag LOCUS_23500 gene cysJ 1821 478 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence564 1751 822 gene locus_tag LOCUS_23510 gene ilvE 1751 822 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_23510 >Feature sequence565 >Feature sequence566 2216 357 gene locus_tag LOCUS_23520 gene secD 2216 357 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A8 protein_id gnl|my_center|LOCUS_23520 >Feature sequence567 941 240 gene locus_tag LOCUS_23530 gene dhcA 941 240 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_23530 1159 2070 gene locus_tag LOCUS_23540 gene dhcR 1159 2070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence568 1646 729 gene locus_tag LOCUS_23550 1646 729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_23550 1675 1989 gene locus_tag LOCUS_23560 1675 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence569 548 1477 gene locus_tag LOCUS_23570 548 1477 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence570 2 736 gene locus_tag LOCUS_23580 2 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1311 745 gene locus_tag LOCUS_23590 1311 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1566 1970 gene locus_tag LOCUS_23600 1566 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence571 201 335 gene locus_tag LOCUS_23610 201 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 451 2040 gene locus_tag LOCUS_23620 gene prfC 451 2040 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_23620 >Feature sequence572 257 715 gene locus_tag LOCUS_23630 257 715 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_23630 726 1595 gene locus_tag LOCUS_23640 gene rapZ 726 1595 CDS product RNase adapter protein RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB41 protein_id gnl|my_center|LOCUS_23640 1634 1903 gene locus_tag LOCUS_23650 gene ptsH 1634 1903 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_23650 >Feature sequence573 <1 525 gene locus_tag LOCUS_23660 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100240.1:chromosome partitioning protein 803 1111 gene locus_tag LOCUS_23670 803 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1133 2044 gene locus_tag LOCUS_23680 gene atpB 1133 2044 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_23680 >Feature sequence574 <1 1697 gene locus_tag LOCUS_23690 <1 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072001.1:3-methylcrotonyl-CoA carboxylase subunit alpha 1697 2065 gene locus_tag LOCUS_23700 1697 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence575 >Feature sequence576 2 874 gene locus_tag LOCUS_23710 2 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence577 506 252 gene locus_tag LOCUS_23720 506 252 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NP7 protein_id gnl|my_center|LOCUS_23720 1064 1378 gene locus_tag LOCUS_23730 1064 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1356 1637 gene locus_tag LOCUS_23740 1356 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1848 2075 gene locus_tag LOCUS_23750 1848 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence578 <1 1406 gene locus_tag LOCUS_23760 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34750:fimbrial assembly protein PilQ 1546 2061 gene locus_tag LOCUS_23770 gene aroK 1546 2061 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_23770 >Feature sequence579 1 678 gene locus_tag LOCUS_23780 1 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 897 1772 gene locus_tag LOCUS_23790 gene dapA 897 1772 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_23790 >Feature sequence580 >Feature sequence581 1666 365 gene locus_tag LOCUS_23800 gene tyrS 1666 365 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_23800 >Feature sequence582 >Feature sequence583 670 1500 gene locus_tag LOCUS_23810 670 1500 CDS product biotin synthesis protein BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230759.2 protein_id gnl|my_center|LOCUS_23810 >Feature sequence584 485 189 gene locus_tag LOCUS_23820 485 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1408 482 gene locus_tag LOCUS_23830 1408 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence585 797 1891 gene locus_tag LOCUS_23840 797 1891 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_23840 >Feature sequence586 <1 623 gene locus_tag LOCUS_23850 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073938.1:type I restriction-modification system deoxyribonuclease >Feature sequence587 650 363 gene locus_tag LOCUS_23860 650 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 995 1651 gene locus_tag LOCUS_23870 995 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1732 2070 gene locus_tag LOCUS_23880 gene glnK 1732 2070 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence588 >Feature sequence589 925 1125 gene locus_tag LOCUS_23890 925 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1254 1742 gene locus_tag LOCUS_23900 1254 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence590 <2097 1297 gene locus_tag LOCUS_23910 <2097 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463767.1:nitrate ABC transporter ATP-binding protein >Feature sequence591 428 1495 gene locus_tag LOCUS_23920 gene rsgA2 428 1495 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_23920 >Feature sequence592 1850 525 gene locus_tag LOCUS_23930 1850 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence593 >Feature sequence594 678 154 gene locus_tag LOCUS_23940 678 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1466 870 gene locus_tag LOCUS_23950 1466 870 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_23950 1991 1563 gene locus_tag LOCUS_23960 1991 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence595 543 1214 gene locus_tag LOCUS_23970 gene pspA 543 1214 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_23970 1291 1557 gene locus_tag LOCUS_23980 gene pspB 1291 1557 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 protein_id gnl|my_center|LOCUS_23980 1554 2003 gene locus_tag LOCUS_23990 1554 2003 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705755.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence596 >Feature sequence597 <2071 1486 gene locus_tag LOCUS_24000 <2071 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098741.1:esterase YqiA >Feature sequence598 343 981 gene locus_tag LOCUS_24010 343 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 <2069 1122 gene locus_tag LOCUS_24020 <2069 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXM6:GMP synthase [glutamine-hydrolyzing] >Feature sequence599 <1 858 gene locus_tag LOCUS_24030 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXG4:ribosomal RNA large subunit methyltransferase F 1005 1886 gene locus_tag LOCUS_24040 1005 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence600 679 1080 gene locus_tag LOCUS_24050 679 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1084 1788 gene locus_tag LOCUS_24060 1084 1788 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence601 245 583 gene locus_tag LOCUS_24070 245 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_24070 703 1314 gene locus_tag LOCUS_24080 703 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 <2048 1533 gene locus_tag LOCUS_24090 <2048 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943336.1:TetR family transcriptional regulator >Feature sequence602 1640 759 gene locus_tag LOCUS_24100 gene cheR1 1640 759 CDS product chemotaxis protein methyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87131 protein_id gnl|my_center|LOCUS_24100 1873 1948 gene locus_tag LOCUS_t00250 1873 1948 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence603 600 1586 gene locus_tag LOCUS_24110 gene dctP 600 1586 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence604 >Feature sequence605 372 1094 gene locus_tag LOCUS_24120 gene phoU 372 1094 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_24120 1203 1278 gene locus_tag LOCUS_t00260 1203 1278 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence606 <2022 704 gene locus_tag LOCUS_24130 <2022 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104717.1:membrane protein >Feature sequence607 1154 1618 gene locus_tag LOCUS_24140 1154 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence608 1719 280 gene locus_tag LOCUS_24150 1719 280 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence609 2014 212 gene locus_tag LOCUS_24160 gene nosR 2014 212 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL3 protein_id gnl|my_center|LOCUS_24160 >Feature sequence610 1786 941 gene locus_tag LOCUS_24170 gene cdsA 1786 941 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_24170 >Feature sequence611 1063 893 gene locus_tag LOCUS_24180 1063 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24180 >Feature sequence612 248 1063 gene locus_tag LOCUS_24190 248 1063 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_24190 1628 1068 gene locus_tag LOCUS_24200 1628 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence613 288 1196 gene locus_tag LOCUS_24210 288 1196 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_24210 1321 1908 gene locus_tag LOCUS_24220 1321 1908 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_24220 >Feature sequence614 >Feature sequence615 >Feature sequence616 655 1755 gene locus_tag LOCUS_24230 gene hupS 655 1755 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence617 1343 432 gene locus_tag LOCUS_24240 1343 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence618 <1983 1141 gene locus_tag LOCUS_24250 <1983 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097764.1:LysR family transcriptional regulator >Feature sequence619 110 553 gene locus_tag LOCUS_24260 110 553 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_24260 1649 585 gene locus_tag LOCUS_24270 1649 585 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_24270 1969 1646 gene locus_tag LOCUS_24280 1969 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence620 >Feature sequence621 494 1168 gene locus_tag LOCUS_24290 494 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_24290 1171 1884 gene locus_tag LOCUS_24300 1171 1884 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence622 228 557 gene locus_tag LOCUS_24310 228 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 669 1886 gene locus_tag LOCUS_24320 669 1886 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence623 372 992 gene locus_tag LOCUS_24330 gene rluA 372 992 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_24330 1073 1231 gene locus_tag LOCUS_24340 1073 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence624 1100 255 gene locus_tag LOCUS_24350 1100 255 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 protein_id gnl|my_center|LOCUS_24350 <1965 1128 gene locus_tag LOCUS_24360 <1965 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462594.1:transporter NadC family protein >Feature sequence625 444 935 gene locus_tag LOCUS_24370 444 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence626 713 291 gene locus_tag LOCUS_24380 713 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_24380 821 1354 gene locus_tag LOCUS_24390 821 1354 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence627 >Feature sequence628 859 68 gene locus_tag LOCUS_24400 859 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1944 856 gene locus_tag LOCUS_24410 1944 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence629 <1 794 gene locus_tag LOCUS_24420 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266320.1:2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase >Feature sequence630 1774 113 gene locus_tag LOCUS_24430 gene yidC 1774 113 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_24430 >Feature sequence631 >Feature sequence632 323 1066 gene locus_tag LOCUS_24440 323 1066 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence633 <1930 903 gene locus_tag LOCUS_24450 <1930 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141971.1:TonB-dependent receptor >Feature sequence634 <1 1342 gene locus_tag LOCUS_24460 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947465.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence635 >Feature sequence636 487 777 gene locus_tag LOCUS_24470 487 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 833 1282 gene locus_tag LOCUS_24480 833 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 <1922 1318 gene locus_tag LOCUS_24490 <1922 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897643.1:TetR family transcriptional regulator >Feature sequence637 >Feature sequence638 1157 1312 gene locus_tag LOCUS_24500 1157 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1333 1581 gene locus_tag LOCUS_24510 1333 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence639 >Feature sequence640 >Feature sequence641 >Feature sequence642 147 695 gene locus_tag LOCUS_24520 147 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence643 420 1133 gene locus_tag LOCUS_24530 420 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence644 946 1686 gene locus_tag LOCUS_24540 946 1686 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence645 >Feature sequence646 >Feature sequence647 1890 292 gene locus_tag LOCUS_24550 gene purH 1890 292 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_24550 >Feature sequence648 362 1768 gene locus_tag LOCUS_24560 362 1768 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence649 1339 797 gene locus_tag LOCUS_24570 1339 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence650 5 1390 gene locus_tag LOCUS_24580 5 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence651 1300 392 gene locus_tag LOCUS_24590 1300 392 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence652 64 378 gene locus_tag LOCUS_24600 64 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 403 1452 gene locus_tag LOCUS_24610 403 1452 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence653 207 332 gene locus_tag LOCUS_24620 207 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence654 >Feature sequence655 <1 762 gene locus_tag LOCUS_24630 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87WV2:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 820 1476 gene locus_tag LOCUS_24640 gene hisG 820 1476 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_24640 >Feature sequence656 >Feature sequence657 1136 483 gene locus_tag LOCUS_24650 1136 483 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence658 174 1103 gene locus_tag LOCUS_24660 174 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence659 <1 943 gene locus_tag LOCUS_24670 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267250.1:membrane protein <1832 1322 gene locus_tag LOCUS_24680 <1832 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267519.1:sarcosine oxidase >Feature sequence660 >Feature sequence661 1744 467 gene locus_tag LOCUS_24690 1744 467 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence662 <1 813 gene locus_tag LOCUS_24700 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721316.1:sodium:proton antiporter <1797 880 gene locus_tag LOCUS_24710 <1797 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44689:tRNA(Ile)-lysidine synthase >Feature sequence663 <1792 170 gene locus_tag LOCUS_24720 <1792 170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037274.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence664 >Feature sequence665 76 1293 gene locus_tag LOCUS_24730 gene xcpS 76 1293 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_24730 1306 1734 gene locus_tag LOCUS_24740 gene xcpT 1306 1734 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_24740 >Feature sequence666 705 1166 gene locus_tag LOCUS_24750 705 1166 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_24750 1485 1144 gene locus_tag LOCUS_24760 1485 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence667 816 271 gene locus_tag LOCUS_24770 gene moaB2 816 271 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_24770 1414 809 gene locus_tag LOCUS_24780 gene mobA 1414 809 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence668 238 978 gene locus_tag LOCUS_24790 238 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1511 1086 gene locus_tag LOCUS_24800 1511 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence669 509 27 gene locus_tag LOCUS_24810 509 27 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_24810 1265 699 gene locus_tag LOCUS_24820 gene btuE 1265 699 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPQ6 protein_id gnl|my_center|LOCUS_24820 >Feature sequence670 >Feature sequence671 <1747 27 gene locus_tag LOCUS_24830 <1747 27 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence672 235 1107 gene locus_tag LOCUS_24840 235 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence673 <1737 770 gene locus_tag LOCUS_24850 <1737 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263838.1:glycosyl transferase >Feature sequence674 1125 148 gene locus_tag LOCUS_24860 1125 148 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_24860 1631 1191 gene locus_tag LOCUS_24870 1631 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence675 <1 1179 gene locus_tag LOCUS_24880 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q885I9:aspartokinase 1371 1562 gene locus_tag LOCUS_24890 gene csrA 1371 1562 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_24890 >Feature sequence676 >Feature sequence677 >Feature sequence678 1709 1089 gene locus_tag LOCUS_24900 1709 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence679 1480 257 gene locus_tag LOCUS_24910 gene metZ 1480 257 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_24910 >Feature sequence680 821 1252 gene locus_tag LOCUS_24920 821 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1689 1258 gene locus_tag LOCUS_24930 1689 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468055.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence681 >Feature sequence682 >Feature sequence683 <1 576 gene locus_tag LOCUS_24940 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074183.1:cell division ATP-binding protein FtsE 569 1546 gene locus_tag LOCUS_24950 gene ftsX 569 1546 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence684 875 462 gene locus_tag LOCUS_24960 875 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 <1709 878 gene locus_tag LOCUS_24970 <1709 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545463.1:type III-A CRISPR-associated protein Cas10/Csm1 >Feature sequence685 >Feature sequence686 801 550 gene locus_tag LOCUS_24980 gene hfq 801 550 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_24980 <1697 934 gene locus_tag LOCUS_24990 <1697 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYY1:tRNA dimethylallyltransferase >Feature sequence687 1002 106 gene locus_tag LOCUS_25000 1002 106 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence688 <1667 835 gene locus_tag LOCUS_25010 <1667 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVX6:tryptophan--tRNA ligase >Feature sequence689 >Feature sequence690 >Feature sequence691 >Feature sequence692 1653 853 gene locus_tag LOCUS_25020 1653 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence693 180 473 gene locus_tag LOCUS_25030 gene gp26 180 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_25030 476 1057 gene locus_tag LOCUS_25040 gene gpD 476 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070988.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence694 356 1642 gene locus_tag LOCUS_25050 gene clpX 356 1642 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM6 protein_id gnl|my_center|LOCUS_25050 >Feature sequence695 >Feature sequence696 >Feature sequence697 >Feature sequence698 376 1248 gene locus_tag LOCUS_25060 376 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence699 298 83 gene locus_tag LOCUS_25070 298 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 554 754 gene locus_tag LOCUS_25080 554 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 854 1465 gene locus_tag LOCUS_25090 854 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence700 <1 661 gene locus_tag LOCUS_25100 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112813.1:transcriptional regulator 1557 703 gene locus_tag LOCUS_25110 1557 703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence701 <1 1493 gene locus_tag LOCUS_25120 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87YY5:cell division protein ZipA >Feature sequence702 <1595 178 gene locus_tag LOCUS_25130 <1595 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003122185.1:ATP-dependent RNA helicase >Feature sequence703 1 222 gene locus_tag LOCUS_25140 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1403 402 gene locus_tag LOCUS_25150 1403 402 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence704 309 1373 gene locus_tag LOCUS_25160 gene holB 309 1373 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_25160 >Feature sequence705 <1582 556 gene locus_tag LOCUS_25170 <1582 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263836.1:glycosyl transferase >Feature sequence706 1540 794 gene locus_tag LOCUS_25180 1540 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence707 223 53 gene locus_tag LOCUS_25190 223 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1568 303 gene locus_tag LOCUS_25200 1568 303 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence708 1012 125 gene locus_tag LOCUS_25210 1012 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1194 1009 gene locus_tag LOCUS_25220 1194 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1421 1191 gene locus_tag LOCUS_25230 1421 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence709 928 647 gene locus_tag LOCUS_25240 928 647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence710 <1 1362 gene locus_tag LOCUS_25250 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036267.1:restriction endonuclease >Feature sequence711 338 1138 gene locus_tag LOCUS_25260 338 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence712 <1 957 gene locus_tag LOCUS_25270 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114083.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence713 615 337 gene locus_tag LOCUS_25280 615 337 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 protein_id gnl|my_center|LOCUS_25280 798 1121 gene locus_tag LOCUS_25290 798 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence714 1055 516 gene locus_tag LOCUS_25300 1055 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence715 <1514 891 gene locus_tag LOCUS_25310 <1514 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206221.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence716 <1 1200 gene locus_tag LOCUS_25320 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268469.1:LOG family protein