>Feature sequence001 1347 319 gene locus_tag LOCUS_00010 1347 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4249 1358 gene locus_tag LOCUS_00020 4249 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5119 4580 gene locus_tag LOCUS_00030 5119 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6025 5219 gene locus_tag LOCUS_00040 6025 5219 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_00040 6995 6045 gene locus_tag LOCUS_00050 6995 6045 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_00050 7583 7086 gene locus_tag LOCUS_00060 7583 7086 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_00060 7750 8658 gene locus_tag LOCUS_00070 7750 8658 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_00070 9289 8663 gene locus_tag LOCUS_00080 9289 8663 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 protein_id gnl|my_center|LOCUS_00080 9752 9330 gene locus_tag LOCUS_00090 9752 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9837 10223 gene locus_tag LOCUS_00100 9837 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_00100 10390 11733 gene locus_tag LOCUS_00110 10390 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11832 13922 gene locus_tag LOCUS_00120 gene phuR 11832 13922 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_00120 14094 14489 gene locus_tag LOCUS_00130 14094 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14482 15807 gene locus_tag LOCUS_00140 14482 15807 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_00140 16170 17270 gene locus_tag LOCUS_00150 gene mdh 16170 17270 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_00150 17462 17992 gene locus_tag LOCUS_00160 17462 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18370 19674 gene locus_tag LOCUS_00170 gene amt 18370 19674 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_00170 19707 20366 gene locus_tag LOCUS_00180 19707 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21871 20483 gene locus_tag LOCUS_00190 21871 20483 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_00190 22422 21874 gene locus_tag LOCUS_00200 22422 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23574 22522 gene locus_tag LOCUS_00210 23574 22522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_00210 23919 27404 gene locus_tag LOCUS_00220 23919 27404 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_00220 28065 27454 gene locus_tag LOCUS_00230 28065 27454 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_00230 28744 29838 gene locus_tag LOCUS_00240 28744 29838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30293 31984 gene locus_tag LOCUS_00250 30293 31984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32543 33394 gene locus_tag LOCUS_00260 32543 33394 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_00260 33634 33401 gene locus_tag LOCUS_00270 33634 33401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34470 33631 gene locus_tag LOCUS_00280 34470 33631 CDS product polyamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107781.1 protein_id gnl|my_center|LOCUS_00280 35513 34611 gene locus_tag LOCUS_00290 35513 34611 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 protein_id gnl|my_center|LOCUS_00290 35650 36171 gene locus_tag LOCUS_00300 35650 36171 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_00300 37288 36278 gene locus_tag LOCUS_00310 37288 36278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_00310 37563 39662 gene locus_tag LOCUS_00320 37563 39662 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I60 protein_id gnl|my_center|LOCUS_00320 40386 40730 gene locus_tag LOCUS_00330 40386 40730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40727 41389 gene locus_tag LOCUS_00340 gene kpsT 40727 41389 CDS product polysialic acid transport ATP-binding protein KpsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590258.1 protein_id gnl|my_center|LOCUS_00340 41376 42578 gene locus_tag LOCUS_00350 41376 42578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42580 44211 gene locus_tag LOCUS_00360 gene kpsD 42580 44211 CDS product polysialic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976921.1 protein_id gnl|my_center|LOCUS_00360 44212 45165 gene locus_tag LOCUS_00370 44212 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45183 46805 gene locus_tag LOCUS_00380 45183 46805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46814 47455 gene locus_tag LOCUS_00390 46814 47455 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105028.1 protein_id gnl|my_center|LOCUS_00390 47612 47890 gene locus_tag LOCUS_00400 47612 47890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50355 48346 gene locus_tag LOCUS_00410 gene kpsC 50355 48346 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579517.1 protein_id gnl|my_center|LOCUS_00410 50477 51541 gene locus_tag LOCUS_00420 gene rfbB 50477 51541 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_00420 51729 51917 gene locus_tag LOCUS_00430 51729 51917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52002 52241 gene locus_tag LOCUS_00440 52002 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53599 52292 gene locus_tag LOCUS_00450 53599 52292 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_00450 54821 53691 gene locus_tag LOCUS_00460 54821 53691 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_00460 56407 54839 gene locus_tag LOCUS_00470 gene gpmI 56407 54839 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF05 protein_id gnl|my_center|LOCUS_00470 56829 57242 gene locus_tag LOCUS_00480 56829 57242 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_00480 57282 57767 gene locus_tag LOCUS_00490 gene secB 57282 57767 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR3 protein_id gnl|my_center|LOCUS_00490 58046 59086 gene locus_tag LOCUS_00500 gene ldh 58046 59086 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_00500 59096 60184 gene locus_tag LOCUS_00510 59096 60184 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_00510 60177 61160 gene locus_tag LOCUS_00520 60177 61160 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_00520 61157 62293 gene locus_tag LOCUS_00530 61157 62293 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYJ0 protein_id gnl|my_center|LOCUS_00530 62470 62727 gene locus_tag LOCUS_00540 gene xseB 62470 62727 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU6 protein_id gnl|my_center|LOCUS_00540 62727 63608 gene locus_tag LOCUS_00550 gene ispA 62727 63608 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_00550 63819 65708 gene locus_tag LOCUS_00560 gene dxs 63819 65708 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_00560 66356 65715 gene locus_tag LOCUS_00570 gene ribA 66356 65715 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_00570 67027 66557 gene locus_tag LOCUS_00580 gene pgpA 67027 66557 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_00580 69314 67050 gene locus_tag LOCUS_00590 gene priA 69314 67050 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_00590 69495 69707 gene locus_tag LOCUS_00600 gene rpmE 69495 69707 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44367 protein_id gnl|my_center|LOCUS_00600 70335 69811 gene locus_tag LOCUS_00610 70335 69811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71116 70520 gene locus_tag LOCUS_00620 71116 70520 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_00620 71632 71180 gene locus_tag LOCUS_00630 71632 71180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71751 72671 gene locus_tag LOCUS_00640 71751 72671 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_00640 73300 72713 gene locus_tag LOCUS_00650 73300 72713 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_00650 73503 75113 gene locus_tag LOCUS_00660 gene Ada 73503 75113 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_00660 75074 75592 gene locus_tag LOCUS_00670 75074 75592 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_00670 77224 75689 gene locus_tag LOCUS_00680 77224 75689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202021.1 protein_id gnl|my_center|LOCUS_00680 77932 77348 gene locus_tag LOCUS_00690 77932 77348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 78235 78792 gene locus_tag LOCUS_00700 gene hslV 78235 78792 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_00700 78789 80138 gene locus_tag LOCUS_00710 gene hslU 78789 80138 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_00710 80208 80579 gene locus_tag LOCUS_00720 80208 80579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 protein_id gnl|my_center|LOCUS_00720 80712 83324 gene locus_tag LOCUS_00730 gene rnr 80712 83324 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_00730 83370 84104 gene locus_tag LOCUS_00740 gene rlmB 83370 84104 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_00740 84187 85494 gene locus_tag LOCUS_00750 84187 85494 CDS product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 protein_id gnl|my_center|LOCUS_00750 85589 86671 gene locus_tag LOCUS_00760 85589 86671 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_00760 87986 86901 gene locus_tag LOCUS_00770 87986 86901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 88198 88755 gene locus_tag LOCUS_00780 88198 88755 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 2163 1444 gene locus_tag LOCUS_00790 2163 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3026 2160 gene locus_tag LOCUS_00800 3026 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 3703 3023 gene locus_tag LOCUS_00810 3703 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6856 3728 gene locus_tag LOCUS_00820 6856 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7596 6853 gene locus_tag LOCUS_00830 7596 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8216 8001 gene locus_tag LOCUS_00840 8216 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 8391 9089 gene locus_tag LOCUS_00850 gene dhlB 8391 9089 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 protein_id gnl|my_center|LOCUS_00850 9508 9170 gene locus_tag LOCUS_00860 9508 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 9661 10191 gene locus_tag LOCUS_00870 9661 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 10702 10208 gene locus_tag LOCUS_00880 10702 10208 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W1 protein_id gnl|my_center|LOCUS_00880 10944 11861 gene locus_tag LOCUS_00890 gene lipA 10944 11861 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_00890 11865 12932 gene locus_tag LOCUS_00900 11865 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 13828 12983 gene locus_tag LOCUS_00910 13828 12983 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 protein_id gnl|my_center|LOCUS_00910 14529 13855 gene locus_tag LOCUS_00920 gene tesA 14529 13855 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 protein_id gnl|my_center|LOCUS_00920 14591 15283 gene locus_tag LOCUS_00930 14591 15283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110598.1 protein_id gnl|my_center|LOCUS_00930 15280 17820 gene locus_tag LOCUS_00940 15280 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_00940 18772 17834 gene locus_tag LOCUS_00950 18772 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 18947 20101 gene locus_tag LOCUS_00960 18947 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208819.1 protein_id gnl|my_center|LOCUS_00960 20420 22645 gene locus_tag LOCUS_00970 20420 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 22942 25059 gene locus_tag LOCUS_00980 22942 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 25059 25433 gene locus_tag LOCUS_00990 25059 25433 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869283.1 protein_id gnl|my_center|LOCUS_00990 25455 25901 gene locus_tag LOCUS_01000 25455 25901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 26461 25922 gene locus_tag LOCUS_01010 26461 25922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 27009 26575 gene locus_tag LOCUS_01020 27009 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 27481 27089 gene locus_tag LOCUS_01030 27481 27089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765957.1 protein_id gnl|my_center|LOCUS_01030 28073 28510 gene locus_tag LOCUS_01040 gene rpsF 28073 28510 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG67 protein_id gnl|my_center|LOCUS_01040 28524 28754 gene locus_tag LOCUS_01050 gene rpsR 28524 28754 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_01050 28799 29662 gene locus_tag LOCUS_01060 28799 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_01060 29692 30138 gene locus_tag LOCUS_01070 gene rplI 29692 30138 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_01070 30266 31651 gene locus_tag LOCUS_01080 gene dnaB 30266 31651 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 protein_id gnl|my_center|LOCUS_01080 31684 32256 gene locus_tag LOCUS_01090 31684 32256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 32253 32783 gene locus_tag LOCUS_01100 32253 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 32923 33510 gene locus_tag LOCUS_01110 32923 33510 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_01110 33522 33764 gene locus_tag LOCUS_01120 33522 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 34141 34569 gene locus_tag LOCUS_01130 34141 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 34653 35267 gene locus_tag LOCUS_01140 34653 35267 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_01140 35391 35942 gene locus_tag LOCUS_01150 35391 35942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 36738 36028 gene locus_tag LOCUS_01160 36738 36028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 37521 37093 gene locus_tag LOCUS_01170 37521 37093 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_01170 38730 37531 gene locus_tag LOCUS_01180 38730 37531 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_01180 39202 38831 gene locus_tag LOCUS_01190 39202 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 40601 39177 gene locus_tag LOCUS_01200 40601 39177 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 41612 40761 gene locus_tag LOCUS_01210 41612 40761 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 protein_id gnl|my_center|LOCUS_01210 43025 41655 gene locus_tag LOCUS_01220 43025 41655 CDS product transporter NadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_01220 44569 43286 gene locus_tag LOCUS_01230 44569 43286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_01230 44887 45357 gene locus_tag LOCUS_01240 44887 45357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 45887 45459 gene locus_tag LOCUS_01250 45887 45459 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_01250 46306 45884 gene locus_tag LOCUS_01260 46306 45884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_01260 46825 48069 gene locus_tag LOCUS_01270 46825 48069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 50233 48113 gene locus_tag LOCUS_01280 gene metG 50233 48113 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK6 protein_id gnl|my_center|LOCUS_01280 51556 50354 gene locus_tag LOCUS_01290 51556 50354 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_01290 52547 51738 gene locus_tag LOCUS_01300 52547 51738 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_01300 52614 54119 gene locus_tag LOCUS_01310 gene ffh 52614 54119 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP8 protein_id gnl|my_center|LOCUS_01310 54203 56236 gene locus_tag LOCUS_01320 54203 56236 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_01320 56236 56670 gene locus_tag LOCUS_01330 56236 56670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_01330 56657 57565 gene locus_tag LOCUS_01340 56657 57565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_01340 57673 59175 gene locus_tag LOCUS_01350 57673 59175 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951251.1 protein_id gnl|my_center|LOCUS_01350 60436 59180 gene locus_tag LOCUS_01360 60436 59180 CDS product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483093.1 protein_id gnl|my_center|LOCUS_01360 60743 61804 gene locus_tag LOCUS_01370 gene bioB 60743 61804 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_01370 62492 61848 gene locus_tag LOCUS_01380 62492 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 63663 62416 gene locus_tag LOCUS_01390 63663 62416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 63804 64346 gene locus_tag LOCUS_01400 63804 64346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 64866 64423 gene locus_tag LOCUS_01410 64866 64423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 67063 65069 gene locus_tag LOCUS_01420 gene tktA 67063 65069 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_01420 67525 69333 gene locus_tag LOCUS_01430 67525 69333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 70053 69322 gene locus_tag LOCUS_01440 70053 69322 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_01440 <72371 70117 gene locus_tag LOCUS_01450 <72371 70117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388790.1:GGDEF-domain containing protein >Feature sequence003 887 1558 gene locus_tag LOCUS_01460 887 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 1873 1559 gene locus_tag LOCUS_01470 1873 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2763 1870 gene locus_tag LOCUS_01480 2763 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_01480 3675 2785 gene locus_tag LOCUS_01490 3675 2785 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_01490 3788 4921 gene locus_tag LOCUS_01500 gene frmA 3788 4921 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_01500 5062 5907 gene locus_tag LOCUS_01510 gene frmB 5062 5907 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_01510 6115 6777 gene locus_tag LOCUS_01520 6115 6777 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_01520 7876 6767 gene locus_tag LOCUS_01530 7876 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8055 8924 gene locus_tag LOCUS_01540 8055 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_01540 9684 8968 gene locus_tag LOCUS_01550 gene mtnC 9684 8968 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_01550 10280 9690 gene locus_tag LOCUS_01560 gene mtnD 10280 9690 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB9 protein_id gnl|my_center|LOCUS_01560 10994 10341 gene locus_tag LOCUS_01570 gene mtnB 10994 10341 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P3 protein_id gnl|my_center|LOCUS_01570 12004 10991 gene locus_tag LOCUS_01580 gene mtnA 12004 10991 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_01580 13787 12129 gene locus_tag LOCUS_01590 gene pgi 13787 12129 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_01590 14414 14034 gene locus_tag LOCUS_01600 gene panD 14414 14034 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_01600 15466 14573 gene locus_tag LOCUS_01610 gene panC 15466 14573 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_01610 16272 15463 gene locus_tag LOCUS_01620 gene panB 16272 15463 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_01620 16904 16410 gene locus_tag LOCUS_01630 gene folK 16904 16410 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_01630 18202 16901 gene locus_tag LOCUS_01640 gene pcnB 18202 16901 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_01640 20950 19544 gene locus_tag LOCUS_01650 20950 19544 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103371.1 protein_id gnl|my_center|LOCUS_01650 23883 20947 gene locus_tag LOCUS_01660 23883 20947 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246100.1 protein_id gnl|my_center|LOCUS_01660 24038 24937 gene locus_tag LOCUS_01670 24038 24937 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708178.1 protein_id gnl|my_center|LOCUS_01670 25858 24953 gene locus_tag LOCUS_01680 gene yadB 25858 24953 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN59 protein_id gnl|my_center|LOCUS_01680 26423 25932 gene locus_tag LOCUS_01690 gene dksA 26423 25932 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY79 protein_id gnl|my_center|LOCUS_01690 26818 28041 gene locus_tag LOCUS_01700 26818 28041 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_01700 28038 28790 gene locus_tag LOCUS_01710 gene sfsA 28038 28790 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUC5 protein_id gnl|my_center|LOCUS_01710 29130 28771 gene locus_tag LOCUS_01720 29130 28771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266663.1 protein_id gnl|my_center|LOCUS_01720 29176 29931 gene locus_tag LOCUS_01730 29176 29931 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064825.1 protein_id gnl|my_center|LOCUS_01730 30007 30975 gene locus_tag LOCUS_01740 30007 30975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_01740 32395 31613 gene locus_tag LOCUS_01750 gene cbpA 32395 31613 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_01750 32502 34934 gene locus_tag LOCUS_01760 gene polB 32502 34934 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGA1 protein_id gnl|my_center|LOCUS_01760 35437 36969 gene locus_tag LOCUS_01770 35437 36969 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_01770 36979 37965 gene locus_tag LOCUS_01780 36979 37965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01780 38046 38480 gene locus_tag LOCUS_01790 38046 38480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 39329 38769 gene locus_tag LOCUS_01800 39329 38769 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_01800 39589 40152 gene locus_tag LOCUS_01810 39589 40152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_01810 40424 40224 gene locus_tag LOCUS_01820 40424 40224 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE84 protein_id gnl|my_center|LOCUS_01820 40859 40488 gene locus_tag LOCUS_01830 40859 40488 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_01830 41681 40902 gene locus_tag LOCUS_01840 41681 40902 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU51 protein_id gnl|my_center|LOCUS_01840 43013 41757 gene locus_tag LOCUS_01850 43013 41757 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972567.1 protein_id gnl|my_center|LOCUS_01850 43221 44729 gene locus_tag LOCUS_01860 43221 44729 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246223.1 protein_id gnl|my_center|LOCUS_01860 44887 46359 gene locus_tag LOCUS_01870 44887 46359 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_01870 46373 47569 gene locus_tag LOCUS_01880 46373 47569 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930428.1 protein_id gnl|my_center|LOCUS_01880 47623 48744 gene locus_tag LOCUS_01890 47623 48744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 48763 49971 gene locus_tag LOCUS_01900 48763 49971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 50107 50349 gene locus_tag LOCUS_01910 50107 50349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 50343 50582 gene locus_tag LOCUS_01920 50343 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 50579 51214 gene locus_tag LOCUS_01930 50579 51214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 51314 51718 gene locus_tag LOCUS_01940 51314 51718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 52069 52245 gene locus_tag LOCUS_01950 52069 52245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 54179 52323 gene locus_tag LOCUS_01960 54179 52323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_01960 54293 57067 gene locus_tag LOCUS_01970 54293 57067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 57243 57836 gene locus_tag LOCUS_01980 57243 57836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 57873 58124 gene locus_tag LOCUS_01990 57873 58124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 58121 59101 gene locus_tag LOCUS_02000 58121 59101 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_02000 60221 59115 gene locus_tag LOCUS_02010 60221 59115 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_02010 61033 60389 gene locus_tag LOCUS_02020 61033 60389 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_02020 61097 61954 gene locus_tag LOCUS_02030 61097 61954 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_02030 62039 64054 gene locus_tag LOCUS_02040 gene fadH1 62039 64054 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_02040 66800 64137 gene locus_tag LOCUS_02050 66800 64137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 67280 68686 gene locus_tag LOCUS_02060 67280 68686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 68813 70336 gene locus_tag LOCUS_02070 68813 70336 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_02070 >Feature sequence004 1592 51 gene locus_tag LOCUS_02080 1592 51 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_02080 2387 1596 gene locus_tag LOCUS_02090 gene paaG 2387 1596 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_02090 3212 2427 gene locus_tag LOCUS_02100 gene paaF 3212 2427 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76082 protein_id gnl|my_center|LOCUS_02100 3688 5373 gene locus_tag LOCUS_02110 3688 5373 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_02110 5466 6056 gene locus_tag LOCUS_02120 5466 6056 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 protein_id gnl|my_center|LOCUS_02120 6172 7095 gene locus_tag LOCUS_02130 6172 7095 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096751.1 protein_id gnl|my_center|LOCUS_02130 10328 7092 gene locus_tag LOCUS_02140 10328 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 12044 10557 gene locus_tag LOCUS_02150 12044 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12146 13615 gene locus_tag LOCUS_02160 12146 13615 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705531.1 protein_id gnl|my_center|LOCUS_02160 13916 14416 gene locus_tag LOCUS_02170 13916 14416 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104071.1 protein_id gnl|my_center|LOCUS_02170 14434 15888 gene locus_tag LOCUS_02180 14434 15888 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261636.1 protein_id gnl|my_center|LOCUS_02180 16017 16562 gene locus_tag LOCUS_02190 16017 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 16700 17398 gene locus_tag LOCUS_02200 16700 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 17477 18868 gene locus_tag LOCUS_02210 gene tssK 17477 18868 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_02210 18880 19536 gene locus_tag LOCUS_02220 18880 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 19563 23051 gene locus_tag LOCUS_02230 gene tssM 19563 23051 CDS product type VI secretion system protein ImpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_02230 23062 24786 gene locus_tag LOCUS_02240 gene tssC 23062 24786 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943793.1 protein_id gnl|my_center|LOCUS_02240 24806 25297 gene locus_tag LOCUS_02250 gene tssD 24806 25297 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_02250 25297 25725 gene locus_tag LOCUS_02260 25297 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 25728 27452 gene locus_tag LOCUS_02270 gene tssF 25728 27452 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_02270 27416 28408 gene locus_tag LOCUS_02280 gene tssG 27416 28408 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_02280 28514 31504 gene locus_tag LOCUS_02290 28514 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 31587 34463 gene locus_tag LOCUS_02300 31587 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064515.1 protein_id gnl|my_center|LOCUS_02300 34460 35527 gene locus_tag LOCUS_02310 34460 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02310 35524 36180 gene locus_tag LOCUS_02320 35524 36180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 36187 36597 gene locus_tag LOCUS_02330 36187 36597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 36645 37970 gene locus_tag LOCUS_02340 36645 37970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 38232 39494 gene locus_tag LOCUS_02350 38232 39494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 39536 49801 gene locus_tag LOCUS_02360 39536 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 49801 50757 gene locus_tag LOCUS_02370 49801 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 50802 52184 gene locus_tag LOCUS_02380 50802 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 53347 52448 gene locus_tag LOCUS_02390 53347 52448 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_02390 54426 53494 gene locus_tag LOCUS_02400 54426 53494 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_02400 56030 54507 gene locus_tag LOCUS_02410 gene hpaB 56030 54507 CDS product 4-hydroxyphenylacetate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211077.1 protein_id gnl|my_center|LOCUS_02410 56976 56218 gene locus_tag LOCUS_02420 56976 56218 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 protein_id gnl|my_center|LOCUS_02420 58359 57094 gene locus_tag LOCUS_02430 58359 57094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_02430 58811 58521 gene locus_tag LOCUS_02440 58811 58521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 58729 59151 gene locus_tag LOCUS_02450 58729 59151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 59182 59655 gene locus_tag LOCUS_02460 59182 59655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 59913 61004 gene locus_tag LOCUS_02470 59913 61004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 61273 61749 gene locus_tag LOCUS_02480 61273 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02480 61786 62457 gene locus_tag LOCUS_02490 61786 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02490 62527 63465 gene locus_tag LOCUS_02500 62527 63465 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403317.1 protein_id gnl|my_center|LOCUS_02500 63570 66098 gene locus_tag LOCUS_02510 63570 66098 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_02510 66265 67752 gene locus_tag LOCUS_02520 66265 67752 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_02520 67749 69866 gene locus_tag LOCUS_02530 67749 69866 CDS product type I restriction endonuclease EcoAI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110082.1 protein_id gnl|my_center|LOCUS_02530 69878 70462 gene locus_tag LOCUS_02540 69878 70462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence005 633 46 gene locus_tag LOCUS_02550 633 46 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_02550 1963 674 gene locus_tag LOCUS_02560 gene tolB 1963 674 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_02560 2775 1957 gene locus_tag LOCUS_02570 2775 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3226 2765 gene locus_tag LOCUS_02580 gene tolR 3226 2765 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_02580 3921 3226 gene locus_tag LOCUS_02590 3921 3226 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_02590 4346 3948 gene locus_tag LOCUS_02600 4346 3948 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_02600 5362 4346 gene locus_tag LOCUS_02610 gene ruvB 5362 4346 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G2S4 protein_id gnl|my_center|LOCUS_02610 5982 5359 gene locus_tag LOCUS_02620 gene ruvA 5982 5359 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_02620 6583 6056 gene locus_tag LOCUS_02630 gene ruvC 6583 6056 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A1 protein_id gnl|my_center|LOCUS_02630 6973 6671 gene locus_tag LOCUS_02640 6973 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9941 7356 gene locus_tag LOCUS_02650 gene clpB 9941 7356 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_02650 10250 11128 gene locus_tag LOCUS_02660 10250 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_02660 11209 12117 gene locus_tag LOCUS_02670 11209 12117 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_02670 12616 12128 gene locus_tag LOCUS_02680 12616 12128 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_02680 13015 15225 gene locus_tag LOCUS_02690 gene prc 13015 15225 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_02690 15971 15354 gene locus_tag LOCUS_02700 15971 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 16746 15958 gene locus_tag LOCUS_02710 16746 15958 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_02710 17111 17605 gene locus_tag LOCUS_02720 gene purE 17111 17605 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_02720 17666 18745 gene locus_tag LOCUS_02730 gene purK 17666 18745 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_02730 18781 19335 gene locus_tag LOCUS_02740 18781 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_02740 20683 19478 gene locus_tag LOCUS_02750 20683 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_02750 21492 20686 gene locus_tag LOCUS_02760 21492 20686 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_02760 23827 21467 gene locus_tag LOCUS_02770 23827 21467 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_02770 24631 23918 gene locus_tag LOCUS_02780 24631 23918 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105801.1 protein_id gnl|my_center|LOCUS_02780 26829 25186 gene locus_tag LOCUS_02790 gene groL 26829 25186 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_02790 27175 26882 gene locus_tag LOCUS_02800 gene groS 27175 26882 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP19 protein_id gnl|my_center|LOCUS_02800 27823 27314 gene locus_tag LOCUS_02810 gene fxsA 27823 27314 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_02810 28160 28918 gene locus_tag LOCUS_02820 gene fabG 28160 28918 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268829.1 protein_id gnl|my_center|LOCUS_02820 29163 30287 gene locus_tag LOCUS_02830 29163 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 30459 30818 gene locus_tag LOCUS_02840 30459 30818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 30885 32756 gene locus_tag LOCUS_02850 30885 32756 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_02850 32770 33495 gene locus_tag LOCUS_02860 32770 33495 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881056.1 protein_id gnl|my_center|LOCUS_02860 35115 33544 gene locus_tag LOCUS_02870 gene betT 35115 33544 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 protein_id gnl|my_center|LOCUS_02870 36706 35270 gene locus_tag LOCUS_02880 36706 35270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_02880 37191 36706 gene locus_tag LOCUS_02890 37191 36706 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_02890 37327 38274 gene locus_tag LOCUS_02900 gene panE 37327 38274 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHB8 protein_id gnl|my_center|LOCUS_02900 38883 40949 gene locus_tag LOCUS_02910 38883 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 40989 42218 gene locus_tag LOCUS_02920 40989 42218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 42319 42897 gene locus_tag LOCUS_02930 42319 42897 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_02930 43131 43844 gene locus_tag LOCUS_02940 43131 43844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_02940 43866 45419 gene locus_tag LOCUS_02950 43866 45419 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_02950 45426 47030 gene locus_tag LOCUS_02960 45426 47030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 46997 48574 gene locus_tag LOCUS_02970 46997 48574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 48811 49140 gene locus_tag LOCUS_02980 48811 49140 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_02980 49161 50552 gene locus_tag LOCUS_02990 gene cry 49161 50552 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_02990 50952 51350 gene locus_tag LOCUS_03000 50952 51350 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_03000 52260 51394 gene locus_tag LOCUS_03010 52260 51394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 52811 52257 gene locus_tag LOCUS_03020 52811 52257 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_03020 52956 53207 gene locus_tag LOCUS_03030 52956 53207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 53153 54016 gene locus_tag LOCUS_03040 53153 54016 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_03040 54074 54721 gene locus_tag LOCUS_03050 54074 54721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 55020 55556 gene locus_tag LOCUS_03060 55020 55556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 55692 57395 gene locus_tag LOCUS_03070 gene pilB 55692 57395 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_03070 57500 58723 gene locus_tag LOCUS_03080 57500 58723 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_03080 58727 59602 gene locus_tag LOCUS_03090 58727 59602 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_03090 59584 60201 gene locus_tag LOCUS_03100 gene coaE 59584 60201 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_03100 60918 60466 gene locus_tag LOCUS_03110 60918 60466 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_03110 61035 61490 gene locus_tag LOCUS_03120 gene aroQ 61035 61490 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNI3 protein_id gnl|my_center|LOCUS_03120 61487 62383 gene locus_tag LOCUS_03130 gene prmA 61487 62383 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_03130 62421 64082 gene locus_tag LOCUS_03140 62421 64082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 64201 65190 gene locus_tag LOCUS_03150 gene dusB 64201 65190 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_03150 65187 65501 gene locus_tag LOCUS_03160 65187 65501 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_03160 >Feature sequence006 342 1433 gene locus_tag LOCUS_03170 gene aroB 342 1433 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZE3 protein_id gnl|my_center|LOCUS_03170 1441 2694 gene locus_tag LOCUS_03180 1441 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2915 7363 gene locus_tag LOCUS_03190 gene gltB 2915 7363 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_03190 7405 8823 gene locus_tag LOCUS_03200 gene gltD 7405 8823 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 protein_id gnl|my_center|LOCUS_03200 8960 14077 gene locus_tag LOCUS_03210 8960 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 14202 15266 gene locus_tag LOCUS_03220 gene hemE 14202 15266 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V23 protein_id gnl|my_center|LOCUS_03220 15672 18296 gene locus_tag LOCUS_03230 15672 18296 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_03230 18296 18673 gene locus_tag LOCUS_03240 18296 18673 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_03240 18670 20178 gene locus_tag LOCUS_03250 18670 20178 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_03250 20175 20663 gene locus_tag LOCUS_03260 20175 20663 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_03260 20657 20926 gene locus_tag LOCUS_03270 20657 20926 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_03270 20936 21310 gene locus_tag LOCUS_03280 20936 21310 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_03280 24470 21366 gene locus_tag LOCUS_03290 gene acrF 24470 21366 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976147.1 protein_id gnl|my_center|LOCUS_03290 25547 24474 gene locus_tag LOCUS_03300 25547 24474 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967877.1 protein_id gnl|my_center|LOCUS_03300 26455 25583 gene locus_tag LOCUS_03310 26455 25583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 27920 26547 gene locus_tag LOCUS_03320 gene radA 27920 26547 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_03320 28134 29411 gene locus_tag LOCUS_03330 gene metY 28134 29411 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_03330 29474 30124 gene locus_tag LOCUS_03340 29474 30124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 30173 30898 gene locus_tag LOCUS_03350 30173 30898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 30895 31599 gene locus_tag LOCUS_03360 30895 31599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 32333 31608 gene locus_tag LOCUS_03370 32333 31608 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_03370 33239 32382 gene locus_tag LOCUS_03380 33239 32382 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_03380 34841 33306 gene locus_tag LOCUS_03390 34841 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 35006 35803 gene locus_tag LOCUS_03400 35006 35803 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070850.1 protein_id gnl|my_center|LOCUS_03400 35907 37226 gene locus_tag LOCUS_03410 35907 37226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 37348 39420 gene locus_tag LOCUS_03420 37348 39420 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_03420 40165 39536 gene locus_tag LOCUS_03430 40165 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 40751 41995 gene locus_tag LOCUS_03440 40751 41995 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_03440 42887 41997 gene locus_tag LOCUS_03450 42887 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44381 42900 gene locus_tag LOCUS_03460 44381 42900 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE6 protein_id gnl|my_center|LOCUS_03460 47410 44384 gene locus_tag LOCUS_03470 47410 44384 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_03470 47686 47426 gene locus_tag LOCUS_03480 47686 47426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 49633 47777 gene locus_tag LOCUS_03490 49633 47777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 49740 50429 gene locus_tag LOCUS_03500 49740 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 50528 52600 gene locus_tag LOCUS_03510 50528 52600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 53063 52668 gene locus_tag LOCUS_03520 53063 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 53187 54329 gene locus_tag LOCUS_03530 53187 54329 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 protein_id gnl|my_center|LOCUS_03530 54333 55496 gene locus_tag LOCUS_03540 54333 55496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 55493 56392 gene locus_tag LOCUS_03550 gene fieF 55493 56392 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTL0 protein_id gnl|my_center|LOCUS_03550 56405 57385 gene locus_tag LOCUS_03560 56405 57385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 57989 57393 gene locus_tag LOCUS_03570 gene alkB 57989 57393 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_03570 58486 57986 gene locus_tag LOCUS_03580 gene trmL 58486 57986 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 protein_id gnl|my_center|LOCUS_03580 58918 59199 gene locus_tag LOCUS_03590 58918 59199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 59326 59712 gene locus_tag LOCUS_03600 59326 59712 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_03600 60259 59765 gene locus_tag LOCUS_03610 60259 59765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 61651 60323 gene locus_tag LOCUS_03620 61651 60323 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_03620 62368 61853 gene locus_tag LOCUS_03630 62368 61853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 63403 62378 gene locus_tag LOCUS_03640 63403 62378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_03640 <65183 64234 gene locus_tag LOCUS_03650 <65183 64234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104661.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence007 1848 2186 gene locus_tag LOCUS_03660 1848 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479981.1 protein_id gnl|my_center|LOCUS_03660 2277 2987 gene locus_tag LOCUS_03670 2277 2987 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_03670 3553 2984 gene locus_tag LOCUS_03680 3553 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3765 4472 gene locus_tag LOCUS_03690 3765 4472 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 protein_id gnl|my_center|LOCUS_03690 4930 4430 gene locus_tag LOCUS_03700 4930 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 5153 5872 gene locus_tag LOCUS_03710 5153 5872 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_03710 6384 5941 gene locus_tag LOCUS_03720 gene ytoQ 6384 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_03720 7022 6525 gene locus_tag LOCUS_03730 7022 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8067 7024 gene locus_tag LOCUS_03740 8067 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8548 8078 gene locus_tag LOCUS_03750 8548 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 8949 10718 gene locus_tag LOCUS_03760 8949 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11606 10785 gene locus_tag LOCUS_03770 gene aroE 11606 10785 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE4 protein_id gnl|my_center|LOCUS_03770 12592 11621 gene locus_tag LOCUS_03780 gene hemF 12592 11621 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_03780 13161 12610 gene locus_tag LOCUS_03790 gene tsaC 13161 12610 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_03790 14449 13298 gene locus_tag LOCUS_03800 14449 13298 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654772.1 protein_id gnl|my_center|LOCUS_03800 15569 14514 gene locus_tag LOCUS_03810 15569 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_03810 15763 16284 gene locus_tag LOCUS_03820 gene def 15763 16284 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_03820 16284 17246 gene locus_tag LOCUS_03830 gene fmt 16284 17246 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_03830 17243 18586 gene locus_tag LOCUS_03840 gene rsmB 17243 18586 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU5 protein_id gnl|my_center|LOCUS_03840 18621 19994 gene locus_tag LOCUS_03850 gene trkA 18621 19994 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_03850 20018 21466 gene locus_tag LOCUS_03860 gene trkH 20018 21466 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_03860 24970 21527 gene locus_tag LOCUS_03870 24970 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 26403 24970 gene locus_tag LOCUS_03880 26403 24970 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055826.1 protein_id gnl|my_center|LOCUS_03880 27161 26400 gene locus_tag LOCUS_03890 27161 26400 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_03890 29167 27161 gene locus_tag LOCUS_03900 29167 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_03900 30451 29438 gene locus_tag LOCUS_03910 30451 29438 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_03910 31421 30540 gene locus_tag LOCUS_03920 31421 30540 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_03920 31771 32421 gene locus_tag LOCUS_03930 31771 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 32563 33567 gene locus_tag LOCUS_03940 gene glyQ 32563 33567 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_03940 33567 35681 gene locus_tag LOCUS_03950 gene glyS 33567 35681 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_03950 35742 36296 gene locus_tag LOCUS_03960 gene gmhB 35742 36296 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_03960 36483 37307 gene locus_tag LOCUS_03970 gene lptA 36483 37307 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_03970 38310 37372 gene locus_tag LOCUS_03980 38310 37372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 38444 38914 gene locus_tag LOCUS_03990 38444 38914 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_03990 41198 40008 gene locus_tag LOCUS_04000 gene fabV 41198 40008 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9U1 protein_id gnl|my_center|LOCUS_04000 43936 41522 gene locus_tag LOCUS_04010 gene gyrB 43936 41522 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_04010 45081 43996 gene locus_tag LOCUS_04020 gene recF 45081 43996 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_04020 46197 45097 gene locus_tag LOCUS_04030 46197 45097 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_04030 47696 46215 gene locus_tag LOCUS_04040 gene dnaA 47696 46215 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C5 protein_id gnl|my_center|LOCUS_04040 48183 48317 gene locus_tag LOCUS_04050 gene rpmH 48183 48317 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66244 protein_id gnl|my_center|LOCUS_04050 48347 48745 gene locus_tag LOCUS_04060 gene rnpA 48347 48745 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY2 protein_id gnl|my_center|LOCUS_04060 48998 50659 gene locus_tag LOCUS_04070 gene yidC 48998 50659 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_04070 50759 52153 gene locus_tag LOCUS_04080 gene mnmE 50759 52153 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_04080 52717 52169 gene locus_tag LOCUS_04090 52717 52169 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947683.1 protein_id gnl|my_center|LOCUS_04090 53019 53768 gene locus_tag LOCUS_04100 53019 53768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 54406 56292 gene locus_tag LOCUS_04110 gene mnmG 54406 56292 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F5X1 protein_id gnl|my_center|LOCUS_04110 56350 57057 gene locus_tag LOCUS_04120 gene rsmG 56350 57057 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 protein_id gnl|my_center|LOCUS_04120 57130 57894 gene locus_tag LOCUS_04130 57130 57894 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 protein_id gnl|my_center|LOCUS_04130 57914 58825 gene locus_tag LOCUS_04140 gene spoOJ 57914 58825 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_04140 59046 59414 gene locus_tag LOCUS_04150 gene atpI 59046 59414 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948673.1 protein_id gnl|my_center|LOCUS_04150 59436 60347 gene locus_tag LOCUS_04160 gene atpB 59436 60347 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_04160 60406 60633 gene locus_tag LOCUS_04170 gene atpE 60406 60633 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_04170 60686 61156 gene locus_tag LOCUS_04180 gene atpF 60686 61156 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_04180 61168 61704 gene locus_tag LOCUS_04190 gene atpH 61168 61704 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_04190 61720 63258 gene locus_tag LOCUS_04200 gene atpA 61720 63258 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_04200 63321 64181 gene locus_tag LOCUS_04210 gene atpG 63321 64181 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_04210 >Feature sequence008 119 940 gene locus_tag LOCUS_04220 gene rhdA 119 940 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_04220 1023 1925 gene locus_tag LOCUS_04230 1023 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04230 2889 1963 gene locus_tag LOCUS_04240 gene epmA 2889 1963 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPZ4 protein_id gnl|my_center|LOCUS_04240 3573 3007 gene locus_tag LOCUS_04250 gene efp 3573 3007 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_04250 3872 3672 gene locus_tag LOCUS_04260 3872 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3867 4634 gene locus_tag LOCUS_04270 3867 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4933 6627 gene locus_tag LOCUS_04280 4933 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_04280 6959 9061 gene locus_tag LOCUS_04290 gene fimX 6959 9061 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_04290 10745 9123 gene locus_tag LOCUS_04300 10745 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11319 10735 gene locus_tag LOCUS_04310 11319 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 13510 11366 gene locus_tag LOCUS_04320 13510 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13876 13514 gene locus_tag LOCUS_04330 13876 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14174 15730 gene locus_tag LOCUS_04340 gene pilR 14174 15730 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_04340 17090 15882 gene locus_tag LOCUS_04350 17090 15882 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_04350 17487 17263 gene locus_tag LOCUS_04360 17487 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 17671 19023 gene locus_tag LOCUS_04370 17671 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 19582 19004 gene locus_tag LOCUS_04380 19582 19004 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 protein_id gnl|my_center|LOCUS_04380 22413 19585 gene locus_tag LOCUS_04390 gene uvrA 22413 19585 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_04390 23270 22539 gene locus_tag LOCUS_04400 23270 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23503 24891 gene locus_tag LOCUS_04410 23503 24891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_04410 24881 25660 gene locus_tag LOCUS_04420 24881 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 27132 25735 gene locus_tag LOCUS_04430 27132 25735 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106446.1 protein_id gnl|my_center|LOCUS_04430 27316 27627 gene locus_tag LOCUS_04440 gene ydzA 27316 27627 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_04440 28952 27717 gene locus_tag LOCUS_04450 gene bisB 28952 27717 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816750.1 protein_id gnl|my_center|LOCUS_04450 29616 28939 gene locus_tag LOCUS_04460 gene ycgM 29616 28939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76004 protein_id gnl|my_center|LOCUS_04460 30079 29687 gene locus_tag LOCUS_04470 30079 29687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 30280 30678 gene locus_tag LOCUS_04480 30280 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 30681 31001 gene locus_tag LOCUS_04490 30681 31001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 30994 31398 gene locus_tag LOCUS_04500 30994 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 33139 31442 gene locus_tag LOCUS_04510 33139 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 34414 33311 gene locus_tag LOCUS_04520 34414 33311 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_04520 34659 34868 gene locus_tag LOCUS_04530 34659 34868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 34865 35593 gene locus_tag LOCUS_04540 34865 35593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 35863 35645 gene locus_tag LOCUS_04550 35863 35645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 36066 36980 gene locus_tag LOCUS_04560 36066 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 38797 37136 gene locus_tag LOCUS_04570 38797 37136 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 protein_id gnl|my_center|LOCUS_04570 39043 42621 gene locus_tag LOCUS_04580 gene morA 39043 42621 CDS product motility regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_04580 42734 43996 gene locus_tag LOCUS_04590 gene glyA 42734 43996 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_04590 44395 44688 gene locus_tag LOCUS_04600 44395 44688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 44903 46045 gene locus_tag LOCUS_04610 gene ribD 44903 46045 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_04610 46045 46698 gene locus_tag LOCUS_04620 gene ribC 46045 46698 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_04620 46709 47824 gene locus_tag LOCUS_04630 gene ribB 46709 47824 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTT1 protein_id gnl|my_center|LOCUS_04630 47910 48386 gene locus_tag LOCUS_04640 gene ribH 47910 48386 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_04640 48392 48892 gene locus_tag LOCUS_04650 gene nusB 48392 48892 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_04650 48889 49899 gene locus_tag LOCUS_04660 gene thiL 48889 49899 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_04660 50009 50728 gene locus_tag LOCUS_04670 50009 50728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_04670 50733 51074 gene locus_tag LOCUS_04680 50733 51074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 51071 51544 gene locus_tag LOCUS_04690 gene ybaK 51071 51544 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT9 protein_id gnl|my_center|LOCUS_04690 53220 51841 gene locus_tag LOCUS_04700 gene fumC1 53220 51841 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51404 protein_id gnl|my_center|LOCUS_04700 55212 53383 gene locus_tag LOCUS_04710 55212 53383 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_04710 55722 55222 gene locus_tag LOCUS_04720 55722 55222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 56246 55815 gene locus_tag LOCUS_04730 56246 55815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 57998 56274 gene locus_tag LOCUS_04740 gene recJ 57998 56274 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_04740 58891 58049 gene locus_tag LOCUS_04750 58891 58049 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_04750 59145 59564 gene locus_tag LOCUS_04760 59145 59564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 60374 59592 gene locus_tag LOCUS_04770 60374 59592 CDS product pteridine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_04770 60735 60349 gene locus_tag LOCUS_04780 gene pcaC 60735 60349 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_04780 61078 61002 gene locus_tag LOCUS_t00010 61078 61002 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 38 235 gene locus_tag LOCUS_04790 38 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1777 410 gene locus_tag LOCUS_04800 1777 410 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_04800 1980 2834 gene locus_tag LOCUS_04810 gene purU1 1980 2834 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_04810 3232 6201 gene locus_tag LOCUS_04820 3232 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6222 8150 gene locus_tag LOCUS_04830 6222 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_04830 8150 9553 gene locus_tag LOCUS_04840 8150 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_04840 9704 10414 gene locus_tag LOCUS_04850 9704 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_04850 11424 10435 gene locus_tag LOCUS_04860 gene srkA 11424 10435 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_04860 12211 11447 gene locus_tag LOCUS_04870 12211 11447 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_04870 12465 14276 gene locus_tag LOCUS_04880 12465 14276 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_04880 14729 14370 gene locus_tag LOCUS_04890 14729 14370 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_04890 15150 15836 gene locus_tag LOCUS_04900 15150 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_04900 16021 17505 gene locus_tag LOCUS_04910 gene trpE 16021 17505 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244435.1 protein_id gnl|my_center|LOCUS_04910 17630 18217 gene locus_tag LOCUS_04920 gene trpG 17630 18217 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_04920 18230 19276 gene locus_tag LOCUS_04930 gene trpD 18230 19276 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_04930 19335 20138 gene locus_tag LOCUS_04940 gene trpC 19335 20138 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML3 protein_id gnl|my_center|LOCUS_04940 20888 20250 gene locus_tag LOCUS_04950 gene vfr 20888 20250 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_04950 21174 21605 gene locus_tag LOCUS_04960 21174 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_04960 21651 22442 gene locus_tag LOCUS_04970 gene speD 21651 22442 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_04970 24507 22534 gene locus_tag LOCUS_04980 24507 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 25597 24539 gene locus_tag LOCUS_04990 gene rsmC 25597 24539 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Y4 protein_id gnl|my_center|LOCUS_04990 26514 25594 gene locus_tag LOCUS_05000 26514 25594 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_05000 26730 27209 gene locus_tag LOCUS_05010 26730 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 27886 27356 gene locus_tag LOCUS_05020 gene ppa 27886 27356 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_05020 28047 30368 gene locus_tag LOCUS_05030 28047 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_05030 30389 31264 gene locus_tag LOCUS_05040 30389 31264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 31261 33147 gene locus_tag LOCUS_05050 31261 33147 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_05050 34214 33243 gene locus_tag LOCUS_05060 gene fbp 34214 33243 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 protein_id gnl|my_center|LOCUS_05060 34495 35871 gene locus_tag LOCUS_05070 gene mpl 34495 35871 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_05070 35868 36551 gene locus_tag LOCUS_05080 gene ubiX 35868 36551 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_05080 36544 36966 gene locus_tag LOCUS_05090 36544 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 37734 36985 gene locus_tag LOCUS_05100 37734 36985 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_05100 37855 38235 gene locus_tag LOCUS_05110 37855 38235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 38279 39118 gene locus_tag LOCUS_05120 38279 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 39846 39253 gene locus_tag LOCUS_05130 39846 39253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_05130 41288 40284 gene locus_tag LOCUS_05140 gene holA 41288 40284 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_05140 41806 41285 gene locus_tag LOCUS_05150 41806 41285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 44444 41856 gene locus_tag LOCUS_05160 gene leuS 44444 41856 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE6 protein_id gnl|my_center|LOCUS_05160 44824 45462 gene locus_tag LOCUS_05170 44824 45462 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481612.1 protein_id gnl|my_center|LOCUS_05170 45661 49368 gene locus_tag LOCUS_05180 gene oplaH 45661 49368 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_05180 49458 49781 gene locus_tag LOCUS_05190 49458 49781 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_05190 50104 51213 gene locus_tag LOCUS_05200 50104 51213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_05200 51291 51815 gene locus_tag LOCUS_05210 51291 51815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 51812 52570 gene locus_tag LOCUS_05220 51812 52570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 52712 55333 gene locus_tag LOCUS_05230 52712 55333 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257792.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence010 555 358 gene locus_tag LOCUS_05240 555 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 706 2913 gene locus_tag LOCUS_05250 gene rlmL 706 2913 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_05250 3069 3893 gene locus_tag LOCUS_05260 3069 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 5050 3920 gene locus_tag LOCUS_05270 5050 3920 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_05270 5145 5324 gene locus_tag LOCUS_05280 5145 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5808 6476 gene locus_tag LOCUS_05290 5808 6476 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765300.1 protein_id gnl|my_center|LOCUS_05290 6569 10078 gene locus_tag LOCUS_05300 gene smc 6569 10078 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YY4 protein_id gnl|my_center|LOCUS_05300 10455 12041 gene locus_tag LOCUS_05310 10455 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12138 14180 gene locus_tag LOCUS_05320 gene ligA 12138 14180 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLA4 protein_id gnl|my_center|LOCUS_05320 16031 14217 gene locus_tag LOCUS_05330 16031 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_05330 17971 16025 gene locus_tag LOCUS_05340 17971 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_05340 19061 17982 gene locus_tag LOCUS_05350 19061 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_05350 19726 19061 gene locus_tag LOCUS_05360 19726 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 20733 19723 gene locus_tag LOCUS_05370 20733 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_05370 21692 20733 gene locus_tag LOCUS_05380 21692 20733 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_05380 21914 26746 gene locus_tag LOCUS_05390 gene gdhB 21914 26746 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_05390 26850 27686 gene locus_tag LOCUS_05400 26850 27686 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_05400 28859 27741 gene locus_tag LOCUS_05410 28859 27741 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_05410 29252 28974 gene locus_tag LOCUS_05420 29252 28974 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 protein_id gnl|my_center|LOCUS_05420 29392 29712 gene locus_tag LOCUS_05430 29392 29712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 29863 30408 gene locus_tag LOCUS_05440 29863 30408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 30798 30517 gene locus_tag LOCUS_05450 30798 30517 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_05450 31109 32926 gene locus_tag LOCUS_05460 gene deaD 31109 32926 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK4 protein_id gnl|my_center|LOCUS_05460 33075 33659 gene locus_tag LOCUS_05470 33075 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 33857 34459 gene locus_tag LOCUS_05480 33857 34459 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_05480 34687 35064 gene locus_tag LOCUS_05490 34687 35064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 35215 35012 gene locus_tag LOCUS_05500 35215 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 35354 35590 gene locus_tag LOCUS_05510 35354 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 36171 35701 gene locus_tag LOCUS_05520 gene bcp 36171 35701 CDS product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44411 protein_id gnl|my_center|LOCUS_05520 38383 36683 gene locus_tag LOCUS_05530 38383 36683 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_05530 38687 38370 gene locus_tag LOCUS_05540 gene hlyU 38687 38370 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261241.1 protein_id gnl|my_center|LOCUS_05540 38801 39664 gene locus_tag LOCUS_05550 38801 39664 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 protein_id gnl|my_center|LOCUS_05550 40695 39721 gene locus_tag LOCUS_05560 gene rbgA 40695 39721 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_05560 40768 41055 gene locus_tag LOCUS_05570 40768 41055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 41438 41734 gene locus_tag LOCUS_05580 41438 41734 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_05580 41840 43201 gene locus_tag LOCUS_05590 41840 43201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_05590 43861 43286 gene locus_tag LOCUS_05600 43861 43286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 43748 44008 gene locus_tag LOCUS_05610 43748 44008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 44005 44703 gene locus_tag LOCUS_05620 44005 44703 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_05620 45339 44731 gene locus_tag LOCUS_05630 45339 44731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_05630 45640 45374 gene locus_tag LOCUS_05640 45640 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 45778 45984 gene locus_tag LOCUS_05650 45778 45984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 46773 46219 gene locus_tag LOCUS_05660 46773 46219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 47525 48118 gene locus_tag LOCUS_05670 47525 48118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938998.1 protein_id gnl|my_center|LOCUS_05670 48172 49719 gene locus_tag LOCUS_05680 gene hsdM 48172 49719 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_05680 49712 49852 gene locus_tag LOCUS_05690 49712 49852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 49836 50618 gene locus_tag LOCUS_05700 49836 50618 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939322.1 protein_id gnl|my_center|LOCUS_05700 50608 51864 gene locus_tag LOCUS_05710 50608 51864 CDS product type I restriction-modification enzyme, S subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867419.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence011 1589 183 gene locus_tag LOCUS_05720 gene glnA 1589 183 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_05720 2133 3950 gene locus_tag LOCUS_05730 gene typA 2133 3950 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_05730 4587 4093 gene locus_tag LOCUS_05740 4587 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5750 4773 gene locus_tag LOCUS_05750 5750 4773 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040477.1 protein_id gnl|my_center|LOCUS_05750 5896 6636 gene locus_tag LOCUS_05760 5896 6636 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 protein_id gnl|my_center|LOCUS_05760 6921 7616 gene locus_tag LOCUS_05770 6921 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_05770 7627 8367 gene locus_tag LOCUS_05780 7627 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_05780 8457 9278 gene locus_tag LOCUS_05790 gene drrA 8457 9278 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_05790 9283 10827 gene locus_tag LOCUS_05800 9283 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05800 11028 12527 gene locus_tag LOCUS_05810 11028 12527 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_05810 12735 13709 gene locus_tag LOCUS_05820 12735 13709 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_05820 15732 13774 gene locus_tag LOCUS_05830 gene nicT 15732 13774 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_05830 16041 16475 gene locus_tag LOCUS_05840 16041 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16475 17410 gene locus_tag LOCUS_05850 16475 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17932 19530 gene locus_tag LOCUS_05860 17932 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19603 21045 gene locus_tag LOCUS_05870 19603 21045 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_05870 21047 21373 gene locus_tag LOCUS_05880 21047 21373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 21389 22552 gene locus_tag LOCUS_05890 21389 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 22610 23926 gene locus_tag LOCUS_05900 22610 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206904.1 protein_id gnl|my_center|LOCUS_05900 24337 26280 gene locus_tag LOCUS_05910 24337 26280 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_05910 26296 28020 gene locus_tag LOCUS_05920 26296 28020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886809.1 protein_id gnl|my_center|LOCUS_05920 28013 28720 gene locus_tag LOCUS_05930 28013 28720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 28713 30041 gene locus_tag LOCUS_05940 28713 30041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_05940 30157 30597 gene locus_tag LOCUS_05950 30157 30597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 30551 31057 gene locus_tag LOCUS_05960 30551 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 31444 31085 gene locus_tag LOCUS_05970 31444 31085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229623.1 protein_id gnl|my_center|LOCUS_05970 31882 31463 gene locus_tag LOCUS_05980 31882 31463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 32432 31872 gene locus_tag LOCUS_05990 32432 31872 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_05990 33348 32425 gene locus_tag LOCUS_06000 33348 32425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 34513 33581 gene locus_tag LOCUS_06010 34513 33581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 34948 34655 gene locus_tag LOCUS_06020 34948 34655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 35825 35067 gene locus_tag LOCUS_06030 gene trmB 35825 35067 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_06030 36228 35854 gene locus_tag LOCUS_06040 36228 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_06040 36457 37932 gene locus_tag LOCUS_06050 gene ubiD 36457 37932 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_06050 37925 38980 gene locus_tag LOCUS_06060 37925 38980 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 protein_id gnl|my_center|LOCUS_06060 39343 40587 gene locus_tag LOCUS_06070 39343 40587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_06070 40744 42009 gene locus_tag LOCUS_06080 40744 42009 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_06080 43199 42003 gene locus_tag LOCUS_06090 43199 42003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_06090 44626 43196 gene locus_tag LOCUS_06100 44626 43196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 45422 44679 gene locus_tag LOCUS_06110 gene hemD 45422 44679 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_06110 46364 45423 gene locus_tag LOCUS_06120 gene hemC 46364 45423 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_06120 47268 46537 gene locus_tag LOCUS_06130 gene algR 47268 46537 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_06130 48341 47265 gene locus_tag LOCUS_06140 gene algZ 48341 47265 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_06140 48519 49922 gene locus_tag LOCUS_06150 gene argH 48519 49922 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_06150 >Feature sequence012 1291 260 gene locus_tag LOCUS_06160 1291 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1838 1311 gene locus_tag LOCUS_06170 gene ectA 1838 1311 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 protein_id gnl|my_center|LOCUS_06170 2057 2557 gene locus_tag LOCUS_06180 2057 2557 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_06180 2703 3884 gene locus_tag LOCUS_06190 2703 3884 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_06190 5403 4012 gene locus_tag LOCUS_06200 5403 4012 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_06200 5705 5920 gene locus_tag LOCUS_06210 5705 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6072 7700 gene locus_tag LOCUS_06220 6072 7700 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_06220 7853 8602 gene locus_tag LOCUS_06230 7853 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_06230 8674 9258 gene locus_tag LOCUS_06240 8674 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_06240 9495 10058 gene locus_tag LOCUS_06250 9495 10058 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 protein_id gnl|my_center|LOCUS_06250 10150 10458 gene locus_tag LOCUS_06260 10150 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_06260 12006 10477 gene locus_tag LOCUS_06270 gene ilvA1 12006 10477 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_06270 12108 12806 gene locus_tag LOCUS_06280 gene rpiA 12108 12806 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_06280 12819 15641 gene locus_tag LOCUS_06290 12819 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15828 16838 gene locus_tag LOCUS_06300 gene hemB 15828 16838 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_06300 16849 18951 gene locus_tag LOCUS_06310 gene ppk 16849 18951 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_06310 20483 18981 gene locus_tag LOCUS_06320 gene ppx 20483 18981 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_06320 20714 21040 gene locus_tag LOCUS_06330 gene trxA 20714 21040 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_06330 21265 22530 gene locus_tag LOCUS_06340 gene rho 21265 22530 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_06340 23518 22649 gene locus_tag LOCUS_06350 gene rpoH 23518 22649 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_06350 24629 23649 gene locus_tag LOCUS_06360 gene ftsX 24629 23649 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG1 protein_id gnl|my_center|LOCUS_06360 25299 24619 gene locus_tag LOCUS_06370 gene ftsE 25299 24619 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_06370 26604 25306 gene locus_tag LOCUS_06380 gene ftsY 26604 25306 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 protein_id gnl|my_center|LOCUS_06380 26822 27409 gene locus_tag LOCUS_06390 26822 27409 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKW9 protein_id gnl|my_center|LOCUS_06390 29705 27450 gene locus_tag LOCUS_06400 gene parC 29705 27450 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M4 protein_id gnl|my_center|LOCUS_06400 30100 30828 gene locus_tag LOCUS_06410 30100 30828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 30903 31979 gene locus_tag LOCUS_06420 30903 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 31949 32452 gene locus_tag LOCUS_06430 31949 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 32463 32969 gene locus_tag LOCUS_06440 32463 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 32973 34913 gene locus_tag LOCUS_06450 32973 34913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 34906 37725 gene locus_tag LOCUS_06460 34906 37725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 37706 38581 gene locus_tag LOCUS_06470 37706 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 38578 38874 gene locus_tag LOCUS_06480 38578 38874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 39018 39668 gene locus_tag LOCUS_06490 39018 39668 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_06490 39684 40226 gene locus_tag LOCUS_06500 39684 40226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 40223 40753 gene locus_tag LOCUS_06510 40223 40753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 40750 41691 gene locus_tag LOCUS_06520 40750 41691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 43709 41787 gene locus_tag LOCUS_06530 gene parE 43709 41787 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_06530 44362 43754 gene locus_tag LOCUS_06540 44362 43754 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 protein_id gnl|my_center|LOCUS_06540 45171 44365 gene locus_tag LOCUS_06550 gene cpdA 45171 44365 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ6 protein_id gnl|my_center|LOCUS_06550 45824 45435 gene locus_tag LOCUS_06560 gene yqiB 45824 45435 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 protein_id gnl|my_center|LOCUS_06560 46546 45899 gene locus_tag LOCUS_06570 46546 45899 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_06570 46706 48037 gene locus_tag LOCUS_06580 46706 48037 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_06580 <48880 48157 gene locus_tag LOCUS_06590 <48880 48157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175941.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence013 <1 1196 gene locus_tag LOCUS_06600 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTY6:glutamate--cysteine ligase 1351 1872 gene locus_tag LOCUS_06610 gene dsbB1 1351 1872 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_06610 1988 2467 gene locus_tag LOCUS_06620 1988 2467 CDS product anti-RNA polymerase sigma 70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_233168.2 protein_id gnl|my_center|LOCUS_06620 2939 2505 gene locus_tag LOCUS_06630 2939 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3558 3007 gene locus_tag LOCUS_06640 3558 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3594 5492 gene locus_tag LOCUS_06650 3594 5492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_06650 6967 5588 gene locus_tag LOCUS_06660 gene glmU 6967 5588 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTT2 protein_id gnl|my_center|LOCUS_06660 7947 7093 gene locus_tag LOCUS_06670 7947 7093 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 protein_id gnl|my_center|LOCUS_06670 8003 8482 gene locus_tag LOCUS_06680 8003 8482 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_06680 8479 9222 gene locus_tag LOCUS_06690 gene znuC 8479 9222 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_06690 9219 10013 gene locus_tag LOCUS_06700 gene znuB 9219 10013 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_06700 11318 10053 gene locus_tag LOCUS_06710 11318 10053 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_06710 11665 11315 gene locus_tag LOCUS_06720 11665 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 12632 11832 gene locus_tag LOCUS_06730 12632 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_06730 13358 12723 gene locus_tag LOCUS_06740 13358 12723 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_06740 13401 14723 gene locus_tag LOCUS_06750 gene dinF 13401 14723 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 protein_id gnl|my_center|LOCUS_06750 15020 15658 gene locus_tag LOCUS_06760 15020 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 16535 15621 gene locus_tag LOCUS_06770 16535 15621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337872.1 protein_id gnl|my_center|LOCUS_06770 16434 16640 gene locus_tag LOCUS_06780 16434 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 16693 17232 gene locus_tag LOCUS_06790 16693 17232 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_06790 17280 17855 gene locus_tag LOCUS_06800 17280 17855 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_06800 18030 18614 gene locus_tag LOCUS_06810 18030 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19715 18642 gene locus_tag LOCUS_06820 19715 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 20327 19719 gene locus_tag LOCUS_06830 20327 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 22064 20364 gene locus_tag LOCUS_06840 22064 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 22434 22168 gene locus_tag LOCUS_06850 22434 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 24512 22434 gene locus_tag LOCUS_06860 gene prlC 24512 22434 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_06860 25084 25563 gene locus_tag LOCUS_06870 25084 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 25829 26119 gene locus_tag LOCUS_06880 25829 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 26806 26177 gene locus_tag LOCUS_06890 26806 26177 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 protein_id gnl|my_center|LOCUS_06890 29020 26861 gene locus_tag LOCUS_06900 29020 26861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 29262 30608 gene locus_tag LOCUS_06910 29262 30608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 30807 31355 gene locus_tag LOCUS_06920 30807 31355 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_06920 31544 32494 gene locus_tag LOCUS_06930 31544 32494 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_06930 32518 34758 gene locus_tag LOCUS_06940 32518 34758 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_06940 34751 35581 gene locus_tag LOCUS_06950 34751 35581 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_06950 35556 36326 gene locus_tag LOCUS_06960 35556 36326 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_06960 36323 36949 gene locus_tag LOCUS_06970 36323 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_06970 37452 36952 gene locus_tag LOCUS_06980 37452 36952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 37771 38799 gene locus_tag LOCUS_06990 37771 38799 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_06990 38835 39641 gene locus_tag LOCUS_07000 38835 39641 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_07000 40392 39667 gene locus_tag LOCUS_07010 40392 39667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 41646 40438 gene locus_tag LOCUS_07020 41646 40438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_07020 41761 42399 gene locus_tag LOCUS_07030 41761 42399 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_07030 42553 42876 gene locus_tag LOCUS_07040 42553 42876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 43026 43346 gene locus_tag LOCUS_07050 43026 43346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 44448 43456 gene locus_tag LOCUS_07060 gene bsn 44448 43456 CDS product extracellular ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32150 protein_id gnl|my_center|LOCUS_07060 45171 44545 gene locus_tag LOCUS_07070 gene gsT 45171 44545 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103353.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence014 86 511 gene locus_tag LOCUS_07080 86 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 676 3321 gene locus_tag LOCUS_07090 gene ppc 676 3321 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV3 protein_id gnl|my_center|LOCUS_07090 3651 4301 gene locus_tag LOCUS_07100 gene adk 3651 4301 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_07100 4429 5136 gene locus_tag LOCUS_07110 gene yeaZ 4429 5136 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 protein_id gnl|my_center|LOCUS_07110 5149 5946 gene locus_tag LOCUS_07120 gene uppP 5149 5946 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_07120 5985 6773 gene locus_tag LOCUS_07130 gene rsmJ 5985 6773 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU6 protein_id gnl|my_center|LOCUS_07130 9286 6788 gene locus_tag LOCUS_07140 gene plsB 9286 6788 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU3 protein_id gnl|my_center|LOCUS_07140 9646 9389 gene locus_tag LOCUS_07150 9646 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9930 10394 gene locus_tag LOCUS_07160 9930 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11280 10501 gene locus_tag LOCUS_07170 11280 10501 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_07170 11447 12283 gene locus_tag LOCUS_07180 gene trmJ 11447 12283 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_07180 12280 13083 gene locus_tag LOCUS_07190 gene cysE 12280 13083 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_07190 13197 13682 gene locus_tag LOCUS_07200 13197 13682 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_07200 13757 14914 gene locus_tag LOCUS_07210 gene iscS 13757 14914 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_07210 15019 15444 gene locus_tag LOCUS_07220 gene ndk 15019 15444 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_07220 15534 16646 gene locus_tag LOCUS_07230 gene rlmN 15534 16646 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_07230 16675 17460 gene locus_tag LOCUS_07240 gene pilF 16675 17460 CDS product type 4 fimbrial biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_07240 17462 18571 gene locus_tag LOCUS_07250 gene ispG 17462 18571 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_07250 18631 19911 gene locus_tag LOCUS_07260 gene hisS 18631 19911 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ45 protein_id gnl|my_center|LOCUS_07260 19939 20604 gene locus_tag LOCUS_07270 19939 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_07270 20601 21809 gene locus_tag LOCUS_07280 gene bamB 20601 21809 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX20 protein_id gnl|my_center|LOCUS_07280 21903 23414 gene locus_tag LOCUS_07290 gene der 21903 23414 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_07290 23569 24843 gene locus_tag LOCUS_07300 23569 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 25352 26869 gene locus_tag LOCUS_07310 25352 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 27001 27411 gene locus_tag LOCUS_07320 27001 27411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941585.1 protein_id gnl|my_center|LOCUS_07320 27531 28160 gene locus_tag LOCUS_07330 27531 28160 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_07330 28527 28210 gene locus_tag LOCUS_07340 28527 28210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 31311 28654 gene locus_tag LOCUS_07350 gene topA 31311 28654 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_07350 31515 32480 gene locus_tag LOCUS_07360 31515 32480 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267167.1 protein_id gnl|my_center|LOCUS_07360 33281 32391 gene locus_tag LOCUS_07370 33281 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_07370 33658 34542 gene locus_tag LOCUS_07380 gene nadK 33658 34542 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 protein_id gnl|my_center|LOCUS_07380 34545 35501 gene locus_tag LOCUS_07390 34545 35501 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104727.1 protein_id gnl|my_center|LOCUS_07390 35501 36343 gene locus_tag LOCUS_07400 35501 36343 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406491.1 protein_id gnl|my_center|LOCUS_07400 36340 36588 gene locus_tag LOCUS_07410 36340 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 36638 37483 gene locus_tag LOCUS_07420 36638 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245163.1 protein_id gnl|my_center|LOCUS_07420 37519 40161 gene locus_tag LOCUS_07430 gene pepN 37519 40161 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_07430 40182 41531 gene locus_tag LOCUS_07440 40182 41531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_07440 41969 42991 gene locus_tag LOCUS_07450 41969 42991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_07450 42996 45479 gene locus_tag LOCUS_07460 42996 45479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_07460 45580 46398 gene locus_tag LOCUS_07470 45580 46398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 47075 46999 gene locus_tag LOCUS_t00020 47075 46999 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 47185 47110 gene locus_tag LOCUS_t00030 47185 47110 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 <1 2305 gene locus_tag LOCUS_07480 <1 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071130.1:carbamoyl phosphate synthase large subunit 2527 3198 gene locus_tag LOCUS_07490 2527 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4017 3340 gene locus_tag LOCUS_07500 gene ung 4017 3340 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_07500 4784 5248 gene locus_tag LOCUS_07510 gene brf2 4784 5248 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_07510 5259 5726 gene locus_tag LOCUS_07520 gene brf1 5259 5726 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_07520 7553 5868 gene locus_tag LOCUS_07530 7553 5868 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_07530 9547 7778 gene locus_tag LOCUS_07540 9547 7778 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_07540 11722 9584 gene locus_tag LOCUS_07550 gene fadB 11722 9584 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_07550 13037 11859 gene locus_tag LOCUS_07560 13037 11859 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_07560 13399 14430 gene locus_tag LOCUS_07570 gene oruR 13399 14430 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_07570 15097 14816 gene locus_tag LOCUS_07580 15097 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 15276 15527 gene locus_tag LOCUS_07590 15276 15527 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_07590 16539 15661 gene locus_tag LOCUS_07600 16539 15661 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 protein_id gnl|my_center|LOCUS_07600 16658 17266 gene locus_tag LOCUS_07610 gene gst 16658 17266 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811542.1 protein_id gnl|my_center|LOCUS_07610 17271 17651 gene locus_tag LOCUS_07620 17271 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 17689 17895 gene locus_tag LOCUS_07630 17689 17895 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_07630 18482 17985 gene locus_tag LOCUS_07640 18482 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_07640 19256 18555 gene locus_tag LOCUS_07650 19256 18555 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_07650 22068 19249 gene locus_tag LOCUS_07660 22068 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 22256 23458 gene locus_tag LOCUS_07670 22256 23458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566398.1 protein_id gnl|my_center|LOCUS_07670 23471 25126 gene locus_tag LOCUS_07680 23471 25126 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_07680 25741 25277 gene locus_tag LOCUS_07690 25741 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 25929 25708 gene locus_tag LOCUS_07700 25929 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 26898 25942 gene locus_tag LOCUS_07710 26898 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_07710 28598 27081 gene locus_tag LOCUS_07720 28598 27081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 29013 28684 gene locus_tag LOCUS_07730 29013 28684 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219522.1 protein_id gnl|my_center|LOCUS_07730 29444 29599 gene locus_tag LOCUS_07740 29444 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 30579 29617 gene locus_tag LOCUS_07750 30579 29617 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886753.1 protein_id gnl|my_center|LOCUS_07750 30684 31283 gene locus_tag LOCUS_07760 30684 31283 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_07760 31276 31788 gene locus_tag LOCUS_07770 31276 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_07770 31842 32504 gene locus_tag LOCUS_07780 31842 32504 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_07780 32605 32832 gene locus_tag LOCUS_07790 32605 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 33517 32903 gene locus_tag LOCUS_07800 33517 32903 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946823.1 protein_id gnl|my_center|LOCUS_07800 33856 33572 gene locus_tag LOCUS_07810 33856 33572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 35166 33988 gene locus_tag LOCUS_07820 gene fadA 35166 33988 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ3 protein_id gnl|my_center|LOCUS_07820 37349 35190 gene locus_tag LOCUS_07830 gene fadB 37349 35190 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_07830 37859 38641 gene locus_tag LOCUS_07840 37859 38641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 39613 38726 gene locus_tag LOCUS_07850 39613 38726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_07850 39745 40782 gene locus_tag LOCUS_07860 39745 40782 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_07860 41264 42304 gene locus_tag LOCUS_07870 41264 42304 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_07870 42472 43290 gene locus_tag LOCUS_07880 42472 43290 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413041.1 protein_id gnl|my_center|LOCUS_07880 43290 44099 gene locus_tag LOCUS_07890 43290 44099 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_07890 44172 44888 gene locus_tag LOCUS_07900 44172 44888 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_07900 44891 45592 gene locus_tag LOCUS_07910 44891 45592 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence016 1312 1082 gene locus_tag LOCUS_07920 1312 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1551 3164 gene locus_tag LOCUS_07930 1551 3164 CDS product regulatory protein LuxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155015.1 protein_id gnl|my_center|LOCUS_07930 4068 3172 gene locus_tag LOCUS_07940 4068 3172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648586.1 protein_id gnl|my_center|LOCUS_07940 4207 4638 gene locus_tag LOCUS_07950 4207 4638 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG90 protein_id gnl|my_center|LOCUS_07950 5944 4754 gene locus_tag LOCUS_07960 5944 4754 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_07960 6706 6080 gene locus_tag LOCUS_07970 6706 6080 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887766.1 protein_id gnl|my_center|LOCUS_07970 7038 6757 gene locus_tag LOCUS_07980 7038 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7527 7069 gene locus_tag LOCUS_07990 7527 7069 CDS product hydroxycinnamic acid degradation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401022.1 protein_id gnl|my_center|LOCUS_07990 7926 10484 gene locus_tag LOCUS_08000 gene mutS 7926 10484 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_08000 10615 10938 gene locus_tag LOCUS_08010 gene fdxA 10615 10938 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736188.1 protein_id gnl|my_center|LOCUS_08010 12054 11101 gene locus_tag LOCUS_08020 gene rpoS 12054 11101 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_08020 13103 12183 gene locus_tag LOCUS_08030 13103 12183 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_08030 14062 13160 gene locus_tag LOCUS_08040 14062 13160 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_08040 14771 14100 gene locus_tag LOCUS_08050 gene pcm 14771 14100 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_08050 15514 14771 gene locus_tag LOCUS_08060 gene surE 15514 14771 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR36 protein_id gnl|my_center|LOCUS_08060 16524 15514 gene locus_tag LOCUS_08070 gene truD 16524 15514 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_08070 17031 16546 gene locus_tag LOCUS_08080 gene ispF 17031 16546 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_08080 17760 17056 gene locus_tag LOCUS_08090 gene ispD 17760 17056 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_08090 18056 17757 gene locus_tag LOCUS_08100 18056 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 19409 18114 gene locus_tag LOCUS_08110 gene eno 19409 18114 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_08110 21046 19460 gene locus_tag LOCUS_08120 gene pyrG 21046 19460 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_08120 21273 22184 gene locus_tag LOCUS_08130 21273 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 22181 22819 gene locus_tag LOCUS_08140 22181 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23085 24029 gene locus_tag LOCUS_08150 23085 24029 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 protein_id gnl|my_center|LOCUS_08150 25190 24096 gene locus_tag LOCUS_08160 25190 24096 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_08160 26108 25320 gene locus_tag LOCUS_08170 gene ybgI 26108 25320 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_08170 26296 27444 gene locus_tag LOCUS_08180 26296 27444 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_08180 28594 27470 gene locus_tag LOCUS_08190 gene hisC1 28594 27470 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE0 protein_id gnl|my_center|LOCUS_08190 30051 28753 gene locus_tag LOCUS_08200 gene hisD 30051 28753 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_08200 30723 30067 gene locus_tag LOCUS_08210 gene hisG 30723 30067 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_08210 32048 30780 gene locus_tag LOCUS_08220 gene murA 32048 30780 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV7 protein_id gnl|my_center|LOCUS_08220 32302 32066 gene locus_tag LOCUS_08230 gene ligA 32302 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_08230 32760 32446 gene locus_tag LOCUS_08240 32760 32446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 33427 32762 gene locus_tag LOCUS_08250 33427 32762 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 protein_id gnl|my_center|LOCUS_08250 33898 33437 gene locus_tag LOCUS_08260 33898 33437 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_08260 34683 33901 gene locus_tag LOCUS_08270 34683 33901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_08270 35499 34687 gene locus_tag LOCUS_08280 gene mlaF 35499 34687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_08280 35774 36736 gene locus_tag LOCUS_08290 35774 36736 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_08290 36738 37715 gene locus_tag LOCUS_08300 gene kdsD 36738 37715 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_08300 37715 38269 gene locus_tag LOCUS_08310 37715 38269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 38256 38795 gene locus_tag LOCUS_08320 gene lptA 38256 38795 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ13 protein_id gnl|my_center|LOCUS_08320 38770 39501 gene locus_tag LOCUS_08330 38770 39501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_08330 39598 41073 gene locus_tag LOCUS_08340 gene rpoN 39598 41073 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_08340 41097 41555 gene locus_tag LOCUS_08350 41097 41555 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_08350 41568 42437 gene locus_tag LOCUS_08360 gene rapZ 41568 42437 CDS product RNase adapter protein RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB41 protein_id gnl|my_center|LOCUS_08360 42475 42744 gene locus_tag LOCUS_08370 gene ptsH 42475 42744 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_08370 42875 44230 gene locus_tag LOCUS_08380 42875 44230 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_08380 44265 44792 gene locus_tag LOCUS_08390 44265 44792 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_08390 44886 45317 gene locus_tag LOCUS_08400 gene trxC 44886 45317 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_08400 45417 45656 gene locus_tag LOCUS_08410 45417 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence017 103 27 gene locus_tag LOCUS_t00040 103 27 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 282 1337 gene locus_tag LOCUS_08420 gene rrp12 282 1337 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_08420 1877 1422 gene locus_tag LOCUS_08430 1877 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2531 1995 gene locus_tag LOCUS_08440 2531 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3276 2611 gene locus_tag LOCUS_08450 3276 2611 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_08450 4333 3266 gene locus_tag LOCUS_08460 4333 3266 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN6 protein_id gnl|my_center|LOCUS_08460 5764 4406 gene locus_tag LOCUS_08470 5764 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_08470 6803 5955 gene locus_tag LOCUS_08480 6803 5955 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_08480 7546 6809 gene locus_tag LOCUS_08490 7546 6809 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_08490 8291 7638 gene locus_tag LOCUS_08500 gene msrA 8291 7638 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_08500 8332 9081 gene locus_tag LOCUS_08510 8332 9081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_08510 9650 9318 gene locus_tag LOCUS_08520 9650 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 11728 9875 gene locus_tag LOCUS_08530 gene phoD 11728 9875 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_08530 11973 13898 gene locus_tag LOCUS_08540 gene rnb 11973 13898 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL65 protein_id gnl|my_center|LOCUS_08540 14772 14251 gene locus_tag LOCUS_08550 14772 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 15294 15533 gene locus_tag LOCUS_08560 15294 15533 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_08560 15530 17821 gene locus_tag LOCUS_08570 gene feoB 15530 17821 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G9 protein_id gnl|my_center|LOCUS_08570 18456 17842 gene locus_tag LOCUS_08580 18456 17842 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_08580 18587 18931 gene locus_tag LOCUS_08590 18587 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19032 19982 gene locus_tag LOCUS_08600 19032 19982 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_08600 20860 19964 gene locus_tag LOCUS_08610 20860 19964 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104060.1 protein_id gnl|my_center|LOCUS_08610 21160 21369 gene locus_tag LOCUS_08620 gene cspA 21160 21369 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_08620 21571 21891 gene locus_tag LOCUS_08630 21571 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 22679 21885 gene locus_tag LOCUS_08640 22679 21885 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EG30 protein_id gnl|my_center|LOCUS_08640 23283 22669 gene locus_tag LOCUS_08650 23283 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 24140 23658 gene locus_tag LOCUS_08660 24140 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 protein_id gnl|my_center|LOCUS_08660 25681 24269 gene locus_tag LOCUS_08670 gene thrC 25681 24269 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_08670 27008 25716 gene locus_tag LOCUS_08680 gene purA 27008 25716 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ9 protein_id gnl|my_center|LOCUS_08680 28201 27023 gene locus_tag LOCUS_08690 gene hisZ 28201 27023 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX6 protein_id gnl|my_center|LOCUS_08690 28406 28215 gene locus_tag LOCUS_08700 28406 28215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 29432 28563 gene locus_tag LOCUS_08710 gene hflC 29432 28563 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_08710 30625 29432 gene locus_tag LOCUS_08720 gene hflK 30625 29432 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_08720 32049 30733 gene locus_tag LOCUS_08730 gene hflX 32049 30733 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_08730 32309 32061 gene locus_tag LOCUS_08740 gene hfq 32309 32061 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_08740 33395 32442 gene locus_tag LOCUS_08750 gene miaA 33395 32442 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY1 protein_id gnl|my_center|LOCUS_08750 35363 33447 gene locus_tag LOCUS_08760 gene mutL 35363 33447 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_08760 36711 35404 gene locus_tag LOCUS_08770 gene amiB 36711 35404 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_08770 37235 36708 gene locus_tag LOCUS_08780 37235 36708 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_08780 38785 37235 gene locus_tag LOCUS_08790 gene nnr 38785 37235 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_08790 38888 39979 gene locus_tag LOCUS_08800 gene queG 38888 39979 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI8 protein_id gnl|my_center|LOCUS_08800 40205 41479 gene locus_tag LOCUS_08810 40205 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence018 859 1323 gene locus_tag LOCUS_08820 859 1323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_08820 1588 2787 gene locus_tag LOCUS_08830 1588 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2885 3496 gene locus_tag LOCUS_08840 2885 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3590 4399 gene locus_tag LOCUS_08850 3590 4399 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_08850 5820 4462 gene locus_tag LOCUS_08860 gene trpB 5820 4462 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH6 protein_id gnl|my_center|LOCUS_08860 6164 6409 gene locus_tag LOCUS_08870 6164 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6312 8102 gene locus_tag LOCUS_08880 6312 8102 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_08880 8207 8935 gene locus_tag LOCUS_08890 gene eraR 8207 8935 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_08890 9610 8939 gene locus_tag LOCUS_08900 9610 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_08900 11537 9678 gene locus_tag LOCUS_08910 gene exaA 11537 9678 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4J7 protein_id gnl|my_center|LOCUS_08910 11928 12218 gene locus_tag LOCUS_08920 11928 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12992 12339 gene locus_tag LOCUS_08930 gene anr 12992 12339 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_08930 13887 13207 gene locus_tag LOCUS_08940 13887 13207 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_08940 14116 13880 gene locus_tag LOCUS_08950 14116 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_08950 16569 14134 gene locus_tag LOCUS_08960 16569 14134 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_08960 17066 16566 gene locus_tag LOCUS_08970 17066 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457371.1 protein_id gnl|my_center|LOCUS_08970 18600 17194 gene locus_tag LOCUS_08980 18600 17194 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_08980 19806 18883 gene locus_tag LOCUS_08990 gene ccoP1 19806 18883 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_08990 19985 19809 gene locus_tag LOCUS_09000 19985 19809 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396487.1 protein_id gnl|my_center|LOCUS_09000 20598 19990 gene locus_tag LOCUS_09010 gene ccoO1 20598 19990 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_09010 22048 20612 gene locus_tag LOCUS_09020 gene ccoN2 22048 20612 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_09020 23029 22721 gene locus_tag LOCUS_09030 23029 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 23505 23041 gene locus_tag LOCUS_09040 23505 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 24009 23728 gene locus_tag LOCUS_09050 24009 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 24508 24110 gene locus_tag LOCUS_09060 24508 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 25019 24612 gene locus_tag LOCUS_09070 25019 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 26573 25230 gene locus_tag LOCUS_09080 26573 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 27108 26578 gene locus_tag LOCUS_09090 27108 26578 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_09090 28542 27907 gene locus_tag LOCUS_09100 28542 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 28741 29478 gene locus_tag LOCUS_09110 28741 29478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 protein_id gnl|my_center|LOCUS_09110 31319 29616 gene locus_tag LOCUS_09120 gene fabY 31319 29616 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_09120 31435 32433 gene locus_tag LOCUS_09130 31435 32433 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_09130 32880 35534 gene locus_tag LOCUS_09140 gene aceE 32880 35534 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_09140 35549 37519 gene locus_tag LOCUS_09150 gene aceF 35549 37519 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPV0 protein_id gnl|my_center|LOCUS_09150 37823 38128 gene locus_tag LOCUS_09160 37823 38128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 38327 39364 gene locus_tag LOCUS_09170 38327 39364 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_09170 40828 39434 gene locus_tag LOCUS_09180 gene norM 40828 39434 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_09180 >Feature sequence019 642 1220 gene locus_tag LOCUS_09190 642 1220 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_09190 1566 1970 gene locus_tag LOCUS_09200 1566 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2010 2333 gene locus_tag LOCUS_09210 2010 2333 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 protein_id gnl|my_center|LOCUS_09210 2496 3500 gene locus_tag LOCUS_09220 2496 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3714 4724 gene locus_tag LOCUS_09230 3714 4724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_09230 4814 5443 gene locus_tag LOCUS_09240 4814 5443 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728997.1 protein_id gnl|my_center|LOCUS_09240 5445 6851 gene locus_tag LOCUS_09250 5445 6851 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_09250 6895 9156 gene locus_tag LOCUS_09260 6895 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9137 10516 gene locus_tag LOCUS_09270 9137 10516 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445762.1 protein_id gnl|my_center|LOCUS_09270 12711 10501 gene locus_tag LOCUS_09280 gene fdhF 12711 10501 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_09280 13058 12834 gene locus_tag LOCUS_09290 13058 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13438 13845 gene locus_tag LOCUS_09300 13438 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 14198 14004 gene locus_tag LOCUS_09310 14198 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_09310 14461 15540 gene locus_tag LOCUS_09320 gene prfB 14461 15540 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_09320 15686 17209 gene locus_tag LOCUS_09330 gene lysS 15686 17209 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB1 protein_id gnl|my_center|LOCUS_09330 18706 17372 gene locus_tag LOCUS_09340 18706 17372 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390266.1 protein_id gnl|my_center|LOCUS_09340 19203 20663 gene locus_tag LOCUS_09350 19203 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_09350 20663 21598 gene locus_tag LOCUS_09360 20663 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_09360 21724 25119 gene locus_tag LOCUS_09370 21724 25119 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_09370 25346 27985 gene locus_tag LOCUS_09380 25346 27985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_09380 27987 28880 gene locus_tag LOCUS_09390 27987 28880 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_09390 28944 29279 gene locus_tag LOCUS_09400 28944 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 30510 29410 gene locus_tag LOCUS_09410 30510 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 36721 30662 gene locus_tag LOCUS_09420 36721 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 37510 38964 gene locus_tag LOCUS_09430 37510 38964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence020 2043 115 gene locus_tag LOCUS_09440 gene nirB 2043 115 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 protein_id gnl|my_center|LOCUS_09440 2462 3130 gene locus_tag LOCUS_09450 gene tpm 2462 3130 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_09450 3919 3200 gene locus_tag LOCUS_09460 3919 3200 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104835.1 protein_id gnl|my_center|LOCUS_09460 4036 5088 gene locus_tag LOCUS_09470 4036 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_09470 5396 8470 gene locus_tag LOCUS_09480 5396 8470 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_09480 8557 10083 gene locus_tag LOCUS_09490 8557 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 10311 11075 gene locus_tag LOCUS_09500 10311 11075 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_09500 11075 12448 gene locus_tag LOCUS_09510 gene ttpC 11075 12448 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_09510 12454 12975 gene locus_tag LOCUS_09520 12454 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479627.1 protein_id gnl|my_center|LOCUS_09520 12993 13403 gene locus_tag LOCUS_09530 12993 13403 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09530 13406 14038 gene locus_tag LOCUS_09540 gene tonB2 13406 14038 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_09540 14045 15355 gene locus_tag LOCUS_09550 14045 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707895.1 protein_id gnl|my_center|LOCUS_09550 15855 15367 gene locus_tag LOCUS_09560 15855 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 16550 15885 gene locus_tag LOCUS_09570 16550 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 17380 16547 gene locus_tag LOCUS_09580 17380 16547 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_09580 17550 17810 gene locus_tag LOCUS_09590 17550 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_09590 17788 18228 gene locus_tag LOCUS_09600 17788 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 19833 18241 gene locus_tag LOCUS_09610 19833 18241 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD3 protein_id gnl|my_center|LOCUS_09610 20051 20638 gene locus_tag LOCUS_09620 gene algU 20051 20638 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_09620 20659 21375 gene locus_tag LOCUS_09630 gene mucA 20659 21375 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38107 protein_id gnl|my_center|LOCUS_09630 21402 22379 gene locus_tag LOCUS_09640 gene mucB 21402 22379 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_09640 22376 22834 gene locus_tag LOCUS_09650 22376 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 23163 24443 gene locus_tag LOCUS_09660 gene mucD 23163 24443 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_09660 24582 26381 gene locus_tag LOCUS_09670 gene lepA 24582 26381 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH83 protein_id gnl|my_center|LOCUS_09670 26374 26742 gene locus_tag LOCUS_09680 26374 26742 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_09680 26742 27431 gene locus_tag LOCUS_09690 gene rnc 26742 27431 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG1 protein_id gnl|my_center|LOCUS_09690 27428 28321 gene locus_tag LOCUS_09700 gene era 27428 28321 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_09700 28334 28993 gene locus_tag LOCUS_09710 28334 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 28986 29714 gene locus_tag LOCUS_09720 gene pdxJ 28986 29714 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_09720 29722 30156 gene locus_tag LOCUS_09730 gene acpS 29722 30156 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_09730 33042 30103 gene locus_tag LOCUS_09740 gene barA 33042 30103 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJQ9 protein_id gnl|my_center|LOCUS_09740 33335 34243 gene locus_tag LOCUS_09750 gene cysM 33335 34243 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_09750 34326 35645 gene locus_tag LOCUS_09760 gene rlmD 34326 35645 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI4 protein_id gnl|my_center|LOCUS_09760 35638 37887 gene locus_tag LOCUS_09770 gene relA 35638 37887 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_09770 37888 38364 gene locus_tag LOCUS_09780 37888 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence021 185 1360 gene locus_tag LOCUS_09790 185 1360 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_09790 1449 1982 gene locus_tag LOCUS_09800 1449 1982 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_09800 2661 2005 gene locus_tag LOCUS_09810 2661 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3101 2658 gene locus_tag LOCUS_09820 gene rimI 3101 2658 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_09820 3939 3106 gene locus_tag LOCUS_09830 3939 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5495 3945 gene locus_tag LOCUS_09840 gene leuA 5495 3945 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_09840 5843 6592 gene locus_tag LOCUS_09850 gene etfB 5843 6592 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_09850 6605 7534 gene locus_tag LOCUS_09860 gene etfA-2 6605 7534 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_09860 8234 7680 gene locus_tag LOCUS_09870 8234 7680 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232050.2 protein_id gnl|my_center|LOCUS_09870 8459 9298 gene locus_tag LOCUS_09880 8459 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9365 9694 gene locus_tag LOCUS_09890 9365 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10563 9802 gene locus_tag LOCUS_09900 10563 9802 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 protein_id gnl|my_center|LOCUS_09900 12513 10621 gene locus_tag LOCUS_09910 12513 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28812 protein_id gnl|my_center|LOCUS_09910 13615 12722 gene locus_tag LOCUS_09920 gene mmsB 13615 12722 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZP3 protein_id gnl|my_center|LOCUS_09920 14852 13743 gene locus_tag LOCUS_09930 gene ivdE 14852 13743 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_09930 15659 14871 gene locus_tag LOCUS_09940 15659 14871 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483360.1 protein_id gnl|my_center|LOCUS_09940 16876 15719 gene locus_tag LOCUS_09950 16876 15719 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 protein_id gnl|my_center|LOCUS_09950 18524 17031 gene locus_tag LOCUS_09960 18524 17031 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477189.1 protein_id gnl|my_center|LOCUS_09960 18791 19705 gene locus_tag LOCUS_09970 gene mmsR 18791 19705 CDS product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 protein_id gnl|my_center|LOCUS_09970 19939 21330 gene locus_tag LOCUS_09980 19939 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 23424 21421 gene locus_tag LOCUS_09990 23424 21421 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_09990 23651 24388 gene locus_tag LOCUS_10000 23651 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388355.1 protein_id gnl|my_center|LOCUS_10000 27027 24511 gene locus_tag LOCUS_10010 gene glgP 27027 24511 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_10010 28514 27048 gene locus_tag LOCUS_10020 gene glgA 28514 27048 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZA78 protein_id gnl|my_center|LOCUS_10020 30724 28511 gene locus_tag LOCUS_10030 gene glgB 30724 28511 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_10030 32111 30711 gene locus_tag LOCUS_10040 gene malQ 32111 30711 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY3 protein_id gnl|my_center|LOCUS_10040 33866 32139 gene locus_tag LOCUS_10050 33866 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 35170 33902 gene locus_tag LOCUS_10060 gene glgC 35170 33902 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_10060 35846 35328 gene locus_tag LOCUS_10070 35846 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106223.1 protein_id gnl|my_center|LOCUS_10070 37068 35887 gene locus_tag LOCUS_10080 37068 35887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708895.1 protein_id gnl|my_center|LOCUS_10080 37176 38030 gene locus_tag LOCUS_10090 37176 38030 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087853.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence022 23 98 gene locus_tag LOCUS_t00050 23 98 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 514 239 gene locus_tag LOCUS_10100 514 239 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_10100 888 1319 gene locus_tag LOCUS_10110 888 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1564 2481 gene locus_tag LOCUS_10120 1564 2481 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_10120 2471 3217 gene locus_tag LOCUS_10130 2471 3217 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_10130 3312 4076 gene locus_tag LOCUS_10140 3312 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_10140 4295 4921 gene locus_tag LOCUS_10150 gene upp 4295 4921 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI9 protein_id gnl|my_center|LOCUS_10150 4938 6239 gene locus_tag LOCUS_10160 4938 6239 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_10160 6584 6255 gene locus_tag LOCUS_10170 6584 6255 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_10170 8623 9000 gene locus_tag LOCUS_10180 8623 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9655 9038 gene locus_tag LOCUS_10190 9655 9038 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_10190 9908 10402 gene locus_tag LOCUS_10200 gene nlpC 9908 10402 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 protein_id gnl|my_center|LOCUS_10200 11122 10439 gene locus_tag LOCUS_10210 11122 10439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227538.1 protein_id gnl|my_center|LOCUS_10210 11270 11554 gene locus_tag LOCUS_10220 11270 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12782 11748 gene locus_tag LOCUS_10230 gene rlmF 12782 11748 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_10230 13358 12864 gene locus_tag LOCUS_10240 13358 12864 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976336.1 protein_id gnl|my_center|LOCUS_10240 14250 13351 gene locus_tag LOCUS_10250 14250 13351 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_10250 14433 15251 gene locus_tag LOCUS_10260 14433 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 15365 15937 gene locus_tag LOCUS_10270 15365 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102977.1 protein_id gnl|my_center|LOCUS_10270 15934 17814 gene locus_tag LOCUS_10280 15934 17814 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102976.1 protein_id gnl|my_center|LOCUS_10280 17811 18707 gene locus_tag LOCUS_10290 17811 18707 CDS product transposition protein TniB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 protein_id gnl|my_center|LOCUS_10290 20329 19994 gene locus_tag LOCUS_10300 20329 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 22508 20577 gene locus_tag LOCUS_10310 22508 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 24898 22505 gene locus_tag LOCUS_10320 24898 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 25767 24931 gene locus_tag LOCUS_10330 25767 24931 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_10330 29163 25771 gene locus_tag LOCUS_10340 29163 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 30113 29163 gene locus_tag LOCUS_10350 30113 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_10350 30267 31436 gene locus_tag LOCUS_10360 gene iscS 30267 31436 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_10360 33178 31460 gene locus_tag LOCUS_10370 33178 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 33264 33593 gene locus_tag LOCUS_10380 33264 33593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 33919 34860 gene locus_tag LOCUS_10390 33919 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 35038 35514 gene locus_tag LOCUS_10400 35038 35514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_10400 35667 36023 gene locus_tag LOCUS_10410 35667 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence023 1153 599 gene locus_tag LOCUS_10420 1153 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3700 1697 gene locus_tag LOCUS_10430 gene topB 3700 1697 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 protein_id gnl|my_center|LOCUS_10430 3988 4965 gene locus_tag LOCUS_10440 3988 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_10440 5057 6085 gene locus_tag LOCUS_10450 5057 6085 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_10450 6164 7651 gene locus_tag LOCUS_10460 gene oprM 6164 7651 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207235.1 protein_id gnl|my_center|LOCUS_10460 7648 8973 gene locus_tag LOCUS_10470 7648 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8966 12127 gene locus_tag LOCUS_10480 8966 12127 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_10480 12124 12798 gene locus_tag LOCUS_10490 12124 12798 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_10490 12822 14105 gene locus_tag LOCUS_10500 12822 14105 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105000.1 protein_id gnl|my_center|LOCUS_10500 15282 14191 gene locus_tag LOCUS_10510 gene modC 15282 14191 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_10510 15971 15273 gene locus_tag LOCUS_10520 15971 15273 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267944.1 protein_id gnl|my_center|LOCUS_10520 16459 15980 gene locus_tag LOCUS_10530 16459 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 16681 16935 gene locus_tag LOCUS_10540 16681 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 16940 18604 gene locus_tag LOCUS_10550 16940 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_10550 18976 19545 gene locus_tag LOCUS_10560 18976 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 19738 20475 gene locus_tag LOCUS_10570 19738 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 20667 20482 gene locus_tag LOCUS_10580 20667 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 21013 20618 gene locus_tag LOCUS_10590 21013 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 21332 22771 gene locus_tag LOCUS_10600 gene nifE 21332 22771 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55673 protein_id gnl|my_center|LOCUS_10600 22768 24180 gene locus_tag LOCUS_10610 22768 24180 CDS product nitrogenase molybdenum-cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_10610 24237 24710 gene locus_tag LOCUS_10620 24237 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 24729 25187 gene locus_tag LOCUS_10630 24729 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_10630 25213 25434 gene locus_tag LOCUS_10640 25213 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 25584 25895 gene locus_tag LOCUS_10650 25584 25895 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_10650 25988 26245 gene locus_tag LOCUS_10660 25988 26245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 26245 26634 gene locus_tag LOCUS_10670 26245 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 26819 27445 gene locus_tag LOCUS_10680 26819 27445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 28111 28434 gene locus_tag LOCUS_10690 28111 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 protein_id gnl|my_center|LOCUS_10690 28502 29413 gene locus_tag LOCUS_10700 gene nifU 28502 29413 CDS product nitrogen fixation protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BM9 protein_id gnl|my_center|LOCUS_10700 29416 30624 gene locus_tag LOCUS_10710 29416 30624 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_10710 30646 31869 gene locus_tag LOCUS_10720 30646 31869 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_10720 31842 32642 gene locus_tag LOCUS_10730 gene cysE 31842 32642 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_10730 32649 33179 gene locus_tag LOCUS_10740 32649 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 33195 33527 gene locus_tag LOCUS_10750 gene nifW 33195 33527 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS27 protein_id gnl|my_center|LOCUS_10750 33544 34035 gene locus_tag LOCUS_10760 33544 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 34032 34979 gene locus_tag LOCUS_10770 34032 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 34976 36289 gene locus_tag LOCUS_10780 gene clpX 34976 36289 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_10780 >Feature sequence024 420 1382 gene locus_tag LOCUS_10790 gene dusA 420 1382 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E844 protein_id gnl|my_center|LOCUS_10790 1773 1447 gene locus_tag LOCUS_10800 1773 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1942 2109 gene locus_tag LOCUS_10810 1942 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10810 2173 2907 gene locus_tag LOCUS_10820 2173 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10820 3017 3877 gene locus_tag LOCUS_10830 3017 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5775 3943 gene locus_tag LOCUS_10840 gene btuB 5775 3943 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVI9 protein_id gnl|my_center|LOCUS_10840 6012 6827 gene locus_tag LOCUS_10850 gene xthA 6012 6827 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_10850 7280 7627 gene locus_tag LOCUS_10860 gene sypA 7280 7627 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263829.1 protein_id gnl|my_center|LOCUS_10860 7788 8576 gene locus_tag LOCUS_10870 7788 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8582 10690 gene locus_tag LOCUS_10880 gene sypC 8582 10690 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_10880 10690 11397 gene locus_tag LOCUS_10890 gene sypD 10690 11397 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263832.1 protein_id gnl|my_center|LOCUS_10890 11405 12934 gene locus_tag LOCUS_10900 gene sypE 11405 12934 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263833.1 protein_id gnl|my_center|LOCUS_10900 13538 16717 gene locus_tag LOCUS_10910 13538 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 16864 18273 gene locus_tag LOCUS_10920 gene sypG 16864 18273 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263835.1 protein_id gnl|my_center|LOCUS_10920 19274 18354 gene locus_tag LOCUS_10930 19274 18354 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_10930 19742 20761 gene locus_tag LOCUS_10940 gene sypH 19742 20761 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_10940 20970 20836 gene locus_tag LOCUS_10950 20970 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 21477 21223 gene locus_tag LOCUS_10960 21477 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 21385 23151 gene locus_tag LOCUS_10970 21385 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 23154 24593 gene locus_tag LOCUS_10980 gene sypK 23154 24593 CDS product sugar translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263839.1 protein_id gnl|my_center|LOCUS_10980 24584 25966 gene locus_tag LOCUS_10990 gene sypL 24584 25966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_10990 26255 27073 gene locus_tag LOCUS_11000 gene sypM 26255 27073 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 protein_id gnl|my_center|LOCUS_11000 27070 28215 gene locus_tag LOCUS_11010 gene sypN 27070 28215 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 protein_id gnl|my_center|LOCUS_11010 28383 29711 gene locus_tag LOCUS_11020 gene sypO 28383 29711 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_11020 29704 32160 gene locus_tag LOCUS_11030 29704 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 32368 33453 gene locus_tag LOCUS_11040 32368 33453 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105843.1 protein_id gnl|my_center|LOCUS_11040 33450 35336 gene locus_tag LOCUS_11050 33450 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence025 231 1373 gene locus_tag LOCUS_11060 gene pdxB 231 1373 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R9 protein_id gnl|my_center|LOCUS_11060 1813 1385 gene locus_tag LOCUS_11070 1813 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3131 1851 gene locus_tag LOCUS_11080 3131 1851 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 protein_id gnl|my_center|LOCUS_11080 3168 3569 gene locus_tag LOCUS_11090 gene msrB 3168 3569 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_11090 3559 3843 gene locus_tag LOCUS_11100 3559 3843 CDS product UPF0153 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT48 protein_id gnl|my_center|LOCUS_11100 3933 4247 gene locus_tag LOCUS_11110 3933 4247 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 protein_id gnl|my_center|LOCUS_11110 4819 4262 gene locus_tag LOCUS_11120 4819 4262 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_11120 5067 5582 gene locus_tag LOCUS_11130 5067 5582 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_11130 5596 5802 gene locus_tag LOCUS_11140 5596 5802 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_11140 7481 5853 gene locus_tag LOCUS_11150 7481 5853 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052610.1 protein_id gnl|my_center|LOCUS_11150 7834 7658 gene locus_tag LOCUS_11160 7834 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 7962 8948 gene locus_tag LOCUS_11170 7962 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9505 8966 gene locus_tag LOCUS_11180 9505 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706014.1 protein_id gnl|my_center|LOCUS_11180 10508 14455 gene locus_tag LOCUS_11190 10508 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 15091 14423 gene locus_tag LOCUS_11200 15091 14423 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229251.1 protein_id gnl|my_center|LOCUS_11200 15455 16762 gene locus_tag LOCUS_11210 15455 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 16874 18913 gene locus_tag LOCUS_11220 gene oprC 16874 18913 CDS product copper transporter porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_11220 19001 19516 gene locus_tag LOCUS_11230 19001 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_11230 19592 20008 gene locus_tag LOCUS_11240 19592 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 21686 20076 gene locus_tag LOCUS_11250 21686 20076 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_11250 21783 22580 gene locus_tag LOCUS_11260 21783 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 22570 23004 gene locus_tag LOCUS_11270 gene rnhA 22570 23004 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYE5 protein_id gnl|my_center|LOCUS_11270 23001 23702 gene locus_tag LOCUS_11280 gene dnaQ 23001 23702 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_11280 25337 23826 gene locus_tag LOCUS_11290 gene nhaB 25337 23826 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU7 protein_id gnl|my_center|LOCUS_11290 25823 27454 gene locus_tag LOCUS_11300 gene fimL 25823 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_11300 27467 28108 gene locus_tag LOCUS_11310 27467 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064807.1 protein_id gnl|my_center|LOCUS_11310 28493 28179 gene locus_tag LOCUS_11320 28493 28179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_11320 28774 29838 gene locus_tag LOCUS_11330 28774 29838 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402788.1 protein_id gnl|my_center|LOCUS_11330 31313 30153 gene locus_tag LOCUS_11340 31313 30153 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_11340 32065 31571 gene locus_tag LOCUS_11350 32065 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_11350 33710 32049 gene locus_tag LOCUS_11360 gene cysI 33710 32049 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_11360 34646 33837 gene locus_tag LOCUS_11370 gene ugpQ 34646 33837 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947983.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence026 2756 1872 gene locus_tag LOCUS_11380 gene pilK 2756 1872 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_11380 4832 2778 gene locus_tag LOCUS_11390 gene pilJ 4832 2778 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_11390 5424 4900 gene locus_tag LOCUS_11400 gene pilI 5424 4900 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_11400 5789 5427 gene locus_tag LOCUS_11410 gene pilH 5789 5427 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_11410 6202 5819 gene locus_tag LOCUS_11420 gene pilG 6202 5819 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_11420 6396 7346 gene locus_tag LOCUS_11430 gene gshB 6396 7346 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_11430 7468 8352 gene locus_tag LOCUS_11440 7468 8352 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_11440 8352 8909 gene locus_tag LOCUS_11450 8352 8909 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP8 protein_id gnl|my_center|LOCUS_11450 8912 9370 gene locus_tag LOCUS_11460 8912 9370 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA1 protein_id gnl|my_center|LOCUS_11460 9381 9893 gene locus_tag LOCUS_11470 gene pyrR 9381 9893 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_11470 9917 10912 gene locus_tag LOCUS_11480 gene pyrB 9917 10912 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ70 protein_id gnl|my_center|LOCUS_11480 10909 12165 gene locus_tag LOCUS_11490 gene pyrC' 10909 12165 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_11490 12450 13700 gene locus_tag LOCUS_11500 gene lysA 12450 13700 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_11500 13705 14535 gene locus_tag LOCUS_11510 gene dapF 13705 14535 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_11510 14562 15236 gene locus_tag LOCUS_11520 14562 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_11520 15236 15952 gene locus_tag LOCUS_11530 15236 15952 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_11530 17908 15974 gene locus_tag LOCUS_11540 gene speA 17908 15974 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRH3 protein_id gnl|my_center|LOCUS_11540 18019 18888 gene locus_tag LOCUS_11550 gene speE 18019 18888 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_11550 19433 19029 gene locus_tag LOCUS_11560 19433 19029 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_11560 20280 19546 gene locus_tag LOCUS_11570 20280 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 20425 20607 gene locus_tag LOCUS_11580 20425 20607 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816350.1 protein_id gnl|my_center|LOCUS_11580 20629 20946 gene locus_tag LOCUS_11590 20629 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_11590 21989 20943 gene locus_tag LOCUS_11600 21989 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 22088 22561 gene locus_tag LOCUS_11610 gene coaD 22088 22561 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_11610 22593 22850 gene locus_tag LOCUS_11620 22593 22850 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_11620 23088 24833 gene locus_tag LOCUS_11630 23088 24833 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_11630 25797 24961 gene locus_tag LOCUS_11640 25797 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 26734 25910 gene locus_tag LOCUS_11650 gene mutM 26734 25910 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_11650 26963 26805 gene locus_tag LOCUS_11660 gene rpmG 26963 26805 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_11660 27211 26975 gene locus_tag LOCUS_11670 gene rpmB 27211 26975 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_11670 28120 27446 gene locus_tag LOCUS_11680 28120 27446 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_11680 28254 29528 gene locus_tag LOCUS_11690 gene dfp 28254 29528 CDS product bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_11690 29531 29986 gene locus_tag LOCUS_11700 gene dut 29531 29986 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN3 protein_id gnl|my_center|LOCUS_11700 >Feature sequence027 678 364 gene locus_tag LOCUS_11710 678 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1022 675 gene locus_tag LOCUS_11720 1022 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_11720 1178 2596 gene locus_tag LOCUS_11730 1178 2596 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886801.1 protein_id gnl|my_center|LOCUS_11730 3046 2588 gene locus_tag LOCUS_11740 3046 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_11740 3513 3046 gene locus_tag LOCUS_11750 3513 3046 CDS product TIGR02293 family toxin-antitoxin system antitoxin component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169556.1 protein_id gnl|my_center|LOCUS_11750 3698 4225 gene locus_tag LOCUS_11760 3698 4225 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083072.1 protein_id gnl|my_center|LOCUS_11760 4477 4259 gene locus_tag LOCUS_11770 4477 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462097.1 protein_id gnl|my_center|LOCUS_11770 5363 4467 gene locus_tag LOCUS_11780 5363 4467 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_11780 5472 6260 gene locus_tag LOCUS_11790 5472 6260 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_11790 6572 8347 gene locus_tag LOCUS_11800 6572 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_11800 8725 9432 gene locus_tag LOCUS_11810 8725 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10590 9499 gene locus_tag LOCUS_11820 10590 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 10663 12222 gene locus_tag LOCUS_11830 10663 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 12451 16035 gene locus_tag LOCUS_11840 12451 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 16056 17696 gene locus_tag LOCUS_11850 16056 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_11850 18002 17781 gene locus_tag LOCUS_11860 18002 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 18700 18053 gene locus_tag LOCUS_11870 gene ureG 18700 18053 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_11870 19461 18745 gene locus_tag LOCUS_11880 gene ureF 19461 18745 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_11880 20014 19454 gene locus_tag LOCUS_11890 20014 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 22188 20116 gene locus_tag LOCUS_11900 gene ureC 22188 20116 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42885 protein_id gnl|my_center|LOCUS_11900 22700 22398 gene locus_tag LOCUS_11910 gene ureA 22700 22398 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 protein_id gnl|my_center|LOCUS_11910 23641 22757 gene locus_tag LOCUS_11920 gene ureD 23641 22757 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU9 protein_id gnl|my_center|LOCUS_11920 24392 23685 gene locus_tag LOCUS_11930 24392 23685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_11930 25234 24389 gene locus_tag LOCUS_11940 25234 24389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_11940 26466 25231 gene locus_tag LOCUS_11950 26466 25231 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972306.1 protein_id gnl|my_center|LOCUS_11950 28196 26463 gene locus_tag LOCUS_11960 28196 26463 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_11960 29665 28379 gene locus_tag LOCUS_11970 29665 28379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888240.1 protein_id gnl|my_center|LOCUS_11970 31057 30113 gene locus_tag LOCUS_11980 31057 30113 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_11980 <32440 31060 gene locus_tag LOCUS_11990 <32440 31060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888246.1:hybrid sensor histidine kinase/response regulator >Feature sequence028 600 5729 gene locus_tag LOCUS_12000 600 5729 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_12000 7430 6189 gene locus_tag LOCUS_12010 7430 6189 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 protein_id gnl|my_center|LOCUS_12010 7637 8494 gene locus_tag LOCUS_12020 7637 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 9086 8601 gene locus_tag LOCUS_12030 gene slyD 9086 8601 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_12030 10509 9295 gene locus_tag LOCUS_12040 10509 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 13039 10547 gene locus_tag LOCUS_12050 13039 10547 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M5 protein_id gnl|my_center|LOCUS_12050 13197 13949 gene locus_tag LOCUS_12060 gene paaG 13197 13949 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_12060 15905 13956 gene locus_tag LOCUS_12070 15905 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 17879 16284 gene locus_tag LOCUS_12080 17879 16284 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_12080 19250 18051 gene locus_tag LOCUS_12090 19250 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_12090 19455 20276 gene locus_tag LOCUS_12100 19455 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 20877 20251 gene locus_tag LOCUS_12110 gene rnhB 20877 20251 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_12110 22022 20886 gene locus_tag LOCUS_12120 gene lpxB 22022 20886 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N0 protein_id gnl|my_center|LOCUS_12120 22792 22022 gene locus_tag LOCUS_12130 gene lpxA 22792 22022 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_12130 23253 22789 gene locus_tag LOCUS_12140 gene fabZ 23253 22789 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_12140 24275 23253 gene locus_tag LOCUS_12150 gene lpxD 24275 23253 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR8 protein_id gnl|my_center|LOCUS_12150 24786 24289 gene locus_tag LOCUS_12160 gene skp 24786 24289 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_12160 27415 24860 gene locus_tag LOCUS_12170 gene opr86 27415 24860 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_12170 28789 27446 gene locus_tag LOCUS_12180 28789 27446 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_12180 29998 28793 gene locus_tag LOCUS_12190 gene dxr 29998 28793 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 protein_id gnl|my_center|LOCUS_12190 30852 29995 gene locus_tag LOCUS_12200 gene cdsA 30852 29995 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_12200 31600 30833 gene locus_tag LOCUS_12210 gene uppS 31600 30833 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY2 protein_id gnl|my_center|LOCUS_12210 <32115 31608 gene locus_tag LOCUS_12220 <32115 31608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O82853:ribosome-recycling factor >Feature sequence029 754 1632 gene locus_tag LOCUS_12230 754 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1632 2297 gene locus_tag LOCUS_12240 1632 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2337 3425 gene locus_tag LOCUS_12250 2337 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3565 3975 gene locus_tag LOCUS_12260 3565 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3972 5207 gene locus_tag LOCUS_12270 3972 5207 CDS product colanic acid biosynthesis glycosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 protein_id gnl|my_center|LOCUS_12270 5233 6360 gene locus_tag LOCUS_12280 gene gmd 5233 6360 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA5 protein_id gnl|my_center|LOCUS_12280 6370 7329 gene locus_tag LOCUS_12290 gene wbcJ 6370 7329 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN61 protein_id gnl|my_center|LOCUS_12290 7359 8381 gene locus_tag LOCUS_12300 7359 8381 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866948.1 protein_id gnl|my_center|LOCUS_12300 8384 8848 gene locus_tag LOCUS_12310 gene nudD 8384 8848 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NC85 protein_id gnl|my_center|LOCUS_12310 8845 10296 gene locus_tag LOCUS_12320 gene cpsB 8845 10296 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_12320 10383 11804 gene locus_tag LOCUS_12330 gene manB 10383 11804 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602823.1 protein_id gnl|my_center|LOCUS_12330 12411 13376 gene locus_tag LOCUS_12340 12411 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 13637 14821 gene locus_tag LOCUS_12350 13637 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 14915 15448 gene locus_tag LOCUS_12360 14915 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_12360 15448 17676 gene locus_tag LOCUS_12370 15448 17676 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_12370 17679 18296 gene locus_tag LOCUS_12380 17679 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 18886 18371 gene locus_tag LOCUS_12390 gene fabA 18886 18371 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_12390 20201 19092 gene locus_tag LOCUS_12400 20201 19092 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072810.1 protein_id gnl|my_center|LOCUS_12400 21004 20705 gene locus_tag LOCUS_12410 21004 20705 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_12410 21137 21724 gene locus_tag LOCUS_12420 gene rlmE 21137 21724 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_12420 21827 23755 gene locus_tag LOCUS_12430 gene ftsH 21827 23755 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_12430 23970 24662 gene locus_tag LOCUS_12440 gene folP 23970 24662 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XU33 protein_id gnl|my_center|LOCUS_12440 24664 26001 gene locus_tag LOCUS_12450 gene glmM 24664 26001 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_12450 26064 26801 gene locus_tag LOCUS_12460 gene tpiA 26064 26801 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_12460 26809 27198 gene locus_tag LOCUS_12470 gene secG 26809 27198 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_12470 27215 27300 gene locus_tag LOCUS_t00060 27215 27300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27506 27961 gene locus_tag LOCUS_12480 gene rimP 27506 27961 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_12480 27989 29485 gene locus_tag LOCUS_12490 gene nusA 27989 29485 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_12490 >Feature sequence030 1011 457 gene locus_tag LOCUS_12500 1011 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1603 1025 gene locus_tag LOCUS_12510 1603 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1986 1600 gene locus_tag LOCUS_12520 1986 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3152 2097 gene locus_tag LOCUS_12530 3152 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4678 3164 gene locus_tag LOCUS_12540 4678 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5061 5249 gene locus_tag LOCUS_12550 5061 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5777 5980 gene locus_tag LOCUS_12560 5777 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6037 6282 gene locus_tag LOCUS_12570 6037 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6456 6701 gene locus_tag LOCUS_12580 6456 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7275 6730 gene locus_tag LOCUS_12590 7275 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_12590 7416 8564 gene locus_tag LOCUS_12600 7416 8564 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_12600 8702 9703 gene locus_tag LOCUS_12610 8702 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9733 14589 gene locus_tag LOCUS_12620 9733 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 15120 14650 gene locus_tag LOCUS_12630 15120 14650 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084065.1 protein_id gnl|my_center|LOCUS_12630 16529 15186 gene locus_tag LOCUS_12640 gene cysJ 16529 15186 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_12640 18875 16566 gene locus_tag LOCUS_12650 18875 16566 CDS product siderophore receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_12650 19217 20278 gene locus_tag LOCUS_12660 gene rsgA2 19217 20278 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_12660 21701 20331 gene locus_tag LOCUS_12670 gene cysG 21701 20331 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_12670 22981 21698 gene locus_tag LOCUS_12680 gene serS 22981 21698 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 protein_id gnl|my_center|LOCUS_12680 23449 23066 gene locus_tag LOCUS_12690 gene crcB 23449 23066 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_12690 24835 23459 gene locus_tag LOCUS_12700 24835 23459 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_12700 25475 24828 gene locus_tag LOCUS_12710 gene lolA 25475 24828 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_12710 28347 25600 gene locus_tag LOCUS_12720 28347 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 28488 29216 gene locus_tag LOCUS_12730 gene aat 28488 29216 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJE0 protein_id gnl|my_center|LOCUS_12730 >Feature sequence031 <1 686 gene locus_tag LOCUS_12740 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P43715:ATP synthase subunit beta 743 1171 gene locus_tag LOCUS_12750 gene atpC 743 1171 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_12750 1420 2430 gene locus_tag LOCUS_12760 gene moaA 1420 2430 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 protein_id gnl|my_center|LOCUS_12760 2444 3049 gene locus_tag LOCUS_12770 gene mobA 2444 3049 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_12770 3042 3590 gene locus_tag LOCUS_12780 gene moaB2 3042 3590 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_12780 3587 4063 gene locus_tag LOCUS_12790 gene moaC 3587 4063 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT94 protein_id gnl|my_center|LOCUS_12790 4060 4302 gene locus_tag LOCUS_12800 4060 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4302 4796 gene locus_tag LOCUS_12810 gene moaE 4302 4796 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418591.1 protein_id gnl|my_center|LOCUS_12810 4828 5289 gene locus_tag LOCUS_12820 4828 5289 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_12820 6401 5286 gene locus_tag LOCUS_12830 gene pilU 6401 5286 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_12830 7451 6408 gene locus_tag LOCUS_12840 gene pilT 7451 6408 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_12840 7562 8290 gene locus_tag LOCUS_12850 7562 8290 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44506 protein_id gnl|my_center|LOCUS_12850 8287 9111 gene locus_tag LOCUS_12860 gene proC 8287 9111 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_12860 9206 9796 gene locus_tag LOCUS_12870 9206 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_12870 9928 10677 gene locus_tag LOCUS_12880 gene ubiE 9928 10677 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_12880 10677 11300 gene locus_tag LOCUS_12890 10677 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_12890 11297 12934 gene locus_tag LOCUS_12900 gene ubiB 11297 12934 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_12900 12987 13367 gene locus_tag LOCUS_12910 gene hisI 12987 13367 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_12910 13385 13717 gene locus_tag LOCUS_12920 gene hisE 13385 13717 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_12920 13762 14103 gene locus_tag LOCUS_12930 gene hitA 13762 14103 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_12930 14137 14406 gene locus_tag LOCUS_12940 gene tatA 14137 14406 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_12940 14406 14783 gene locus_tag LOCUS_12950 gene tatB 14406 14783 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG9 protein_id gnl|my_center|LOCUS_12950 14780 15523 gene locus_tag LOCUS_12960 gene tatC 14780 15523 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_12960 15589 16749 gene locus_tag LOCUS_12970 gene metX 15589 16749 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_12970 16746 17369 gene locus_tag LOCUS_12980 16746 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_12980 17366 17812 gene locus_tag LOCUS_12990 17366 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_12990 17838 18437 gene locus_tag LOCUS_13000 gene yggV 17838 18437 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK83 protein_id gnl|my_center|LOCUS_13000 18562 19101 gene locus_tag LOCUS_13010 18562 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 19187 20326 gene locus_tag LOCUS_13020 19187 20326 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_13020 21371 20328 gene locus_tag LOCUS_13030 21371 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 24923 21474 gene locus_tag LOCUS_13040 24923 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 25996 25076 gene locus_tag LOCUS_13050 25996 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_13050 27453 25993 gene locus_tag LOCUS_13060 27453 25993 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_13060 27949 27566 gene locus_tag LOCUS_13070 gene ectC 27949 27566 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 protein_id gnl|my_center|LOCUS_13070 <28893 28056 gene locus_tag LOCUS_13080 <28893 28056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263924.1:diaminobutyrate--2-oxoglutarate transaminase >Feature sequence032 3850 1064 gene locus_tag LOCUS_13090 3850 1064 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124782.1 protein_id gnl|my_center|LOCUS_13090 4083 3847 gene locus_tag LOCUS_13100 4083 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4214 4429 gene locus_tag LOCUS_13110 4214 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4441 5661 gene locus_tag LOCUS_13120 4441 5661 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479712.1 protein_id gnl|my_center|LOCUS_13120 5662 5919 gene locus_tag LOCUS_13130 5662 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5916 6152 gene locus_tag LOCUS_13140 5916 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6587 6790 gene locus_tag LOCUS_13150 6587 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6796 8973 gene locus_tag LOCUS_13160 6796 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263389.1 protein_id gnl|my_center|LOCUS_13160 9809 9138 gene locus_tag LOCUS_13170 9809 9138 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_13170 10045 9806 gene locus_tag LOCUS_13180 10045 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11303 10227 gene locus_tag LOCUS_13190 11303 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11548 11366 gene locus_tag LOCUS_13200 11548 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 15125 12135 gene locus_tag LOCUS_13210 15125 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 15627 15295 gene locus_tag LOCUS_13220 15627 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 22243 15620 gene locus_tag LOCUS_13230 22243 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <28423 22167 gene locus_tag LOCUS_13240 <28423 22167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:sugar-binding protein >Feature sequence033 2658 607 gene locus_tag LOCUS_13250 2658 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3069 4685 gene locus_tag LOCUS_13260 3069 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4724 5434 gene locus_tag LOCUS_13270 4724 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5438 9139 gene locus_tag LOCUS_13280 5438 9139 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_13280 12639 9229 gene locus_tag LOCUS_13290 12639 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 13035 13958 gene locus_tag LOCUS_13300 13035 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14154 14597 gene locus_tag LOCUS_13310 14154 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 14597 15952 gene locus_tag LOCUS_13320 14597 15952 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_13320 15984 16958 gene locus_tag LOCUS_13330 gene folE2 15984 16958 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882P7 protein_id gnl|my_center|LOCUS_13330 16981 17541 gene locus_tag LOCUS_13340 16981 17541 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262761.1 protein_id gnl|my_center|LOCUS_13340 18260 17592 gene locus_tag LOCUS_13350 18260 17592 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_13350 19648 18266 gene locus_tag LOCUS_13360 19648 18266 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458065.1 protein_id gnl|my_center|LOCUS_13360 21039 19747 gene locus_tag LOCUS_13370 21039 19747 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_13370 21566 21036 gene locus_tag LOCUS_13380 21566 21036 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_13380 22872 21796 gene locus_tag LOCUS_13390 22872 21796 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_13390 23409 27131 gene locus_tag LOCUS_13400 23409 27131 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJB4 protein_id gnl|my_center|LOCUS_13400 >Feature sequence034 744 97 gene locus_tag LOCUS_13410 gene hisH1 744 97 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_13410 1349 759 gene locus_tag LOCUS_13420 gene hisB 1349 759 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_13420 1436 1834 gene locus_tag LOCUS_13430 1436 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2154 2798 gene locus_tag LOCUS_13440 2154 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_13440 2890 3966 gene locus_tag LOCUS_13450 gene mutY 2890 3966 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_13450 3963 4241 gene locus_tag LOCUS_13460 3963 4241 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_13460 4318 4393 gene locus_tag LOCUS_t00070 4318 4393 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4608 5870 gene locus_tag LOCUS_13470 4608 5870 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_13470 5871 6698 gene locus_tag LOCUS_13480 5871 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6797 7009 gene locus_tag LOCUS_13490 6797 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7022 7321 gene locus_tag LOCUS_13500 7022 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7682 8356 gene locus_tag LOCUS_13510 7682 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8349 8576 gene locus_tag LOCUS_13520 8349 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 8555 11194 gene locus_tag LOCUS_13530 8555 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11194 11586 gene locus_tag LOCUS_13540 11194 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 12352 13764 gene locus_tag LOCUS_13550 12352 13764 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_13550 13812 14693 gene locus_tag LOCUS_13560 13812 14693 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213466.1 protein_id gnl|my_center|LOCUS_13560 14736 16049 gene locus_tag LOCUS_13570 gene hfsF 14736 16049 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_13570 16057 17100 gene locus_tag LOCUS_13580 16057 17100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 17923 17168 gene locus_tag LOCUS_13590 gene paaG 17923 17168 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_13590 19725 18052 gene locus_tag LOCUS_13600 19725 18052 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707636.1 protein_id gnl|my_center|LOCUS_13600 20062 19874 gene locus_tag LOCUS_13610 20062 19874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 20912 20088 gene locus_tag LOCUS_13620 gene eutC 20912 20088 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M3 protein_id gnl|my_center|LOCUS_13620 22303 20909 gene locus_tag LOCUS_13630 gene eutB 22303 20909 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_13630 22551 22381 gene locus_tag LOCUS_13640 22551 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 23989 22631 gene locus_tag LOCUS_13650 23989 22631 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_13650 24469 25905 gene locus_tag LOCUS_13660 gene pykA 24469 25905 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 protein_id gnl|my_center|LOCUS_13660 26914 25898 gene locus_tag LOCUS_13670 gene glk 26914 25898 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64254 protein_id gnl|my_center|LOCUS_13670 27099 27632 gene locus_tag LOCUS_13680 gene hnoX 27099 27632 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence035 4536 3040 gene locus_tag LOCUS_13690 gene hupV 4536 3040 CDS product HupV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_13690 5531 4533 gene locus_tag LOCUS_13700 gene hupU 5531 4533 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_13700 6933 5524 gene locus_tag LOCUS_13710 6933 5524 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_13710 7523 8128 gene locus_tag LOCUS_13720 7523 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 9085 8186 gene locus_tag LOCUS_13730 9085 8186 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_13730 9222 9827 gene locus_tag LOCUS_13740 gene drga 9222 9827 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_13740 10642 9947 gene locus_tag LOCUS_13750 10642 9947 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 protein_id gnl|my_center|LOCUS_13750 11260 10664 gene locus_tag LOCUS_13760 11260 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 11716 11303 gene locus_tag LOCUS_13770 11716 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12293 11763 gene locus_tag LOCUS_13780 12293 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 13207 12416 gene locus_tag LOCUS_13790 13207 12416 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 protein_id gnl|my_center|LOCUS_13790 13637 13506 gene locus_tag LOCUS_13800 13637 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 13886 13686 gene locus_tag LOCUS_13810 13886 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14500 14024 gene locus_tag LOCUS_13820 14500 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037494.1 protein_id gnl|my_center|LOCUS_13820 14843 15439 gene locus_tag LOCUS_13830 14843 15439 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537867.1 protein_id gnl|my_center|LOCUS_13830 15583 17085 gene locus_tag LOCUS_13840 15583 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 17076 18650 gene locus_tag LOCUS_13850 17076 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 19568 18738 gene locus_tag LOCUS_13860 19568 18738 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUP6 protein_id gnl|my_center|LOCUS_13860 20686 20252 gene locus_tag LOCUS_13870 20686 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 20854 22278 gene locus_tag LOCUS_13880 20854 22278 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JK3 protein_id gnl|my_center|LOCUS_13880 22275 22925 gene locus_tag LOCUS_13890 22275 22925 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_13890 23515 22931 gene locus_tag LOCUS_13900 23515 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 23715 24395 gene locus_tag LOCUS_13910 23715 24395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114342.1 protein_id gnl|my_center|LOCUS_13910 24463 27324 gene locus_tag LOCUS_13920 24463 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence036 91 16 gene locus_tag LOCUS_t00080 91 16 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 745 200 gene locus_tag LOCUS_13930 gene pgsA 745 200 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_13930 2684 858 gene locus_tag LOCUS_13940 gene uvrC 2684 858 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_13940 3331 2684 gene locus_tag LOCUS_13950 gene gacA 3331 2684 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51373 protein_id gnl|my_center|LOCUS_13950 6182 3468 gene locus_tag LOCUS_13960 6182 3468 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_13960 6260 7183 gene locus_tag LOCUS_13970 6260 7183 CDS product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926822.1 protein_id gnl|my_center|LOCUS_13970 7456 10050 gene locus_tag LOCUS_13980 7456 10050 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LW3 protein_id gnl|my_center|LOCUS_13980 10748 10212 gene locus_tag LOCUS_13990 10748 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 12553 10748 gene locus_tag LOCUS_14000 12553 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 13083 12550 gene locus_tag LOCUS_14010 13083 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 14438 13080 gene locus_tag LOCUS_14020 14438 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 15315 14623 gene locus_tag LOCUS_14030 15315 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16746 15448 gene locus_tag LOCUS_14040 gene hom 16746 15448 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_14040 18073 16877 gene locus_tag LOCUS_14050 18073 16877 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404530.1 protein_id gnl|my_center|LOCUS_14050 18447 18827 gene locus_tag LOCUS_14060 18447 18827 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 protein_id gnl|my_center|LOCUS_14060 19017 19529 gene locus_tag LOCUS_14070 19017 19529 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_14070 19739 20836 gene locus_tag LOCUS_14080 gene gcvT 19739 20836 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_14080 20927 21313 gene locus_tag LOCUS_14090 gene gcvH 20927 21313 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJE8 protein_id gnl|my_center|LOCUS_14090 21450 24380 gene locus_tag LOCUS_14100 gene gcvP 21450 24380 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ6 protein_id gnl|my_center|LOCUS_14100 24425 26662 gene locus_tag LOCUS_14110 24425 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence037 2337 91 gene locus_tag LOCUS_14120 2337 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2575 2799 gene locus_tag LOCUS_14130 2575 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2824 3129 gene locus_tag LOCUS_14140 2824 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3186 3446 gene locus_tag LOCUS_14150 3186 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4504 3767 gene locus_tag LOCUS_14160 4504 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7520 4506 gene locus_tag LOCUS_14170 gene soxA-2 7520 4506 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104013.1 protein_id gnl|my_center|LOCUS_14170 7810 7517 gene locus_tag LOCUS_14180 gene soxD-2 7810 7517 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_14180 9350 8076 gene locus_tag LOCUS_14190 9350 8076 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_14190 10241 9372 gene locus_tag LOCUS_14200 gene folD2 10241 9372 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA4 protein_id gnl|my_center|LOCUS_14200 11117 10251 gene locus_tag LOCUS_14210 gene purU 11117 10251 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA3 protein_id gnl|my_center|LOCUS_14210 12810 11476 gene locus_tag LOCUS_14220 12810 11476 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_14220 13520 12837 gene locus_tag LOCUS_14230 13520 12837 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_14230 14458 13562 gene locus_tag LOCUS_14240 14458 13562 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 protein_id gnl|my_center|LOCUS_14240 14522 14743 gene locus_tag LOCUS_14250 14522 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16140 14791 gene locus_tag LOCUS_14260 16140 14791 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_14260 16416 17006 gene locus_tag LOCUS_14270 16416 17006 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_14270 17698 16991 gene locus_tag LOCUS_14280 17698 16991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_14280 18587 17703 gene locus_tag LOCUS_14290 18587 17703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_14290 19217 18654 gene locus_tag LOCUS_14300 19217 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 20963 19278 gene locus_tag LOCUS_14310 gene argS 20963 19278 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_14310 21516 21262 gene locus_tag LOCUS_14320 21516 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 21681 23516 gene locus_tag LOCUS_14330 gene ilvD 21681 23516 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_14330 23604 24839 gene locus_tag LOCUS_14340 23604 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 26288 24849 gene locus_tag LOCUS_14350 gene modF 26288 24849 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence038 <1 590 gene locus_tag LOCUS_14360 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339122.1:AraC family transcriptional regulator 905 3076 gene locus_tag LOCUS_14370 gene glnN 905 3076 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_14370 3351 3827 gene locus_tag LOCUS_14380 3351 3827 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_14380 4021 4821 gene locus_tag LOCUS_14390 4021 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5339 4989 gene locus_tag LOCUS_14400 5339 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529346.1 protein_id gnl|my_center|LOCUS_14400 6934 5555 gene locus_tag LOCUS_14410 6934 5555 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_14410 7993 7130 gene locus_tag LOCUS_14420 7993 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 8832 7990 gene locus_tag LOCUS_14430 8832 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 10072 8849 gene locus_tag LOCUS_14440 10072 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10416 12740 gene locus_tag LOCUS_14450 10416 12740 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_14450 12774 13094 gene locus_tag LOCUS_14460 12774 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 13188 13745 gene locus_tag LOCUS_14470 13188 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 13745 14707 gene locus_tag LOCUS_14480 13745 14707 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067516.1 protein_id gnl|my_center|LOCUS_14480 14725 15744 gene locus_tag LOCUS_14490 14725 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_14490 16629 15862 gene locus_tag LOCUS_14500 gene hbdH1 16629 15862 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037308.1 protein_id gnl|my_center|LOCUS_14500 16913 17515 gene locus_tag LOCUS_14510 16913 17515 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647911.1 protein_id gnl|my_center|LOCUS_14510 17544 17939 gene locus_tag LOCUS_14520 17544 17939 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_14520 18322 19899 gene locus_tag LOCUS_14530 18322 19899 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_14530 20170 19961 gene locus_tag LOCUS_14540 20170 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 21342 20167 gene locus_tag LOCUS_14550 21342 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_14550 21476 21934 gene locus_tag LOCUS_14560 21476 21934 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_14560 22037 22831 gene locus_tag LOCUS_14570 gene gloB 22037 22831 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_14570 23290 22868 gene locus_tag LOCUS_14580 23290 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 23835 23386 gene locus_tag LOCUS_14590 23835 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 24097 24528 gene locus_tag LOCUS_14600 24097 24528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence039 <1 762 gene locus_tag LOCUS_14610 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003382014.1:GntR family transcriptional regulator 978 2276 gene locus_tag LOCUS_14620 978 2276 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_14620 2967 2365 gene locus_tag LOCUS_14630 2967 2365 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730226.1 protein_id gnl|my_center|LOCUS_14630 3110 4093 gene locus_tag LOCUS_14640 3110 4093 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074187.1 protein_id gnl|my_center|LOCUS_14640 5000 4122 gene locus_tag LOCUS_14650 5000 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5482 4997 gene locus_tag LOCUS_14660 5482 4997 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_14660 5805 5485 gene locus_tag LOCUS_14670 5805 5485 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_14670 6220 9756 gene locus_tag LOCUS_14680 6220 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9869 10009 gene locus_tag LOCUS_14690 9869 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10028 10603 gene locus_tag LOCUS_14700 10028 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 10673 11248 gene locus_tag LOCUS_14710 10673 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 11563 11261 gene locus_tag LOCUS_14720 11563 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 11833 12000 gene locus_tag LOCUS_14730 11833 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12322 14028 gene locus_tag LOCUS_14740 12322 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_14740 14059 14940 gene locus_tag LOCUS_14750 14059 14940 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_14750 15114 15039 gene locus_tag LOCUS_t00090 15114 15039 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15389 16171 gene locus_tag LOCUS_14760 gene cheR-2 15389 16171 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244386.1 protein_id gnl|my_center|LOCUS_14760 16383 17477 gene locus_tag LOCUS_14770 16383 17477 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_14770 18816 17491 gene locus_tag LOCUS_14780 18816 17491 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_14780 19105 18806 gene locus_tag LOCUS_14790 19105 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 19711 19199 gene locus_tag LOCUS_14800 19711 19199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072759.1 protein_id gnl|my_center|LOCUS_14800 19872 21149 gene locus_tag LOCUS_14810 gene sbcD 19872 21149 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5N4 protein_id gnl|my_center|LOCUS_14810 21146 24913 gene locus_tag LOCUS_14820 gene sbcC 21146 24913 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5N3 protein_id gnl|my_center|LOCUS_14820 25509 26138 gene locus_tag LOCUS_14830 25509 26138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence040 117 42 gene locus_tag LOCUS_t00100 117 42 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3296 195 gene locus_tag LOCUS_14840 3296 195 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_14840 4426 3299 gene locus_tag LOCUS_14850 4426 3299 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_14850 4658 6565 gene locus_tag LOCUS_14860 4658 6565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_14860 6562 7089 gene locus_tag LOCUS_14870 6562 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 10247 7053 gene locus_tag LOCUS_14880 10247 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 11128 10403 gene locus_tag LOCUS_14890 gene entB2 11128 10403 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286816.1 protein_id gnl|my_center|LOCUS_14890 11360 11671 gene locus_tag LOCUS_14900 11360 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 11775 12992 gene locus_tag LOCUS_14910 gene cpx 11775 12992 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_14910 13075 16587 gene locus_tag LOCUS_14920 gene dnaE 13075 16587 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_14920 16580 17923 gene locus_tag LOCUS_14930 gene tilS 16580 17923 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ3 protein_id gnl|my_center|LOCUS_14930 19183 17936 gene locus_tag LOCUS_14940 gene nhaD 19183 17936 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_14940 19610 19942 gene locus_tag LOCUS_14950 19610 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20590 19955 gene locus_tag LOCUS_14960 20590 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 20873 21553 gene locus_tag LOCUS_14970 gene rpe 20873 21553 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_14970 21601 22350 gene locus_tag LOCUS_14980 gene gph-2 21601 22350 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN24 protein_id gnl|my_center|LOCUS_14980 22376 22978 gene locus_tag LOCUS_14990 22376 22978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 23018 24520 gene locus_tag LOCUS_15000 23018 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence041 254 697 gene locus_tag LOCUS_15010 254 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_15010 687 947 gene locus_tag LOCUS_15020 687 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3024 967 gene locus_tag LOCUS_15030 gene mnmC 3024 967 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_15030 3132 3989 gene locus_tag LOCUS_15040 3132 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_15040 4598 3981 gene locus_tag LOCUS_15050 gene ppiA 4598 3981 CDS product peptidyl-prolyl cis-trans isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59641 protein_id gnl|my_center|LOCUS_15050 5308 4637 gene locus_tag LOCUS_15060 5308 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5644 5345 gene locus_tag LOCUS_15070 gene yciL 5644 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_15070 6253 5648 gene locus_tag LOCUS_15080 6253 5648 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V24 protein_id gnl|my_center|LOCUS_15080 6321 7160 gene locus_tag LOCUS_15090 6321 7160 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_15090 7200 7823 gene locus_tag LOCUS_15100 7200 7823 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_15100 8015 9031 gene locus_tag LOCUS_15110 8015 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 9134 10321 gene locus_tag LOCUS_15120 gene trpS-1 9134 10321 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WES9 protein_id gnl|my_center|LOCUS_15120 10385 11221 gene locus_tag LOCUS_15130 10385 11221 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_15130 11208 12047 gene locus_tag LOCUS_15140 11208 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 12044 12892 gene locus_tag LOCUS_15150 12044 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 13522 12896 gene locus_tag LOCUS_15160 13522 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 13743 13459 gene locus_tag LOCUS_15170 13743 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13792 14121 gene locus_tag LOCUS_15180 13792 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 14237 15019 gene locus_tag LOCUS_15190 14237 15019 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_15190 15826 15062 gene locus_tag LOCUS_15200 15826 15062 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_15200 16502 15849 gene locus_tag LOCUS_15210 gene gph-2 16502 15849 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103692.1 protein_id gnl|my_center|LOCUS_15210 17218 16499 gene locus_tag LOCUS_15220 gene ubiG 17218 16499 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_15220 18572 17256 gene locus_tag LOCUS_15230 18572 17256 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_15230 18903 21503 gene locus_tag LOCUS_15240 gene gyrA 18903 21503 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ND6 protein_id gnl|my_center|LOCUS_15240 21621 22628 gene locus_tag LOCUS_15250 gene serC 21621 22628 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_15250 22708 23796 gene locus_tag LOCUS_15260 22708 23796 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_15260 23884 24987 gene locus_tag LOCUS_15270 gene hisC2 23884 24987 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_15270 >Feature sequence042 2285 1284 gene locus_tag LOCUS_15280 2285 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2338 3510 gene locus_tag LOCUS_15290 gene argE 2338 3510 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_15290 3575 4918 gene locus_tag LOCUS_15300 gene argA 3575 4918 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_15300 4918 5727 gene locus_tag LOCUS_15310 4918 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119872.1 protein_id gnl|my_center|LOCUS_15310 6837 5752 gene locus_tag LOCUS_15320 6837 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_15320 7431 6868 gene locus_tag LOCUS_15330 gene folA 7431 6868 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_15330 8252 7458 gene locus_tag LOCUS_15340 gene thyA 8252 7458 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_15340 9117 8305 gene locus_tag LOCUS_15350 gene lgt 9117 8305 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_15350 9994 9206 gene locus_tag LOCUS_15360 9994 9206 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_15360 10118 10894 gene locus_tag LOCUS_15370 10118 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_15370 13226 10926 gene locus_tag LOCUS_15380 gene ptsP 13226 10926 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_15380 13731 13228 gene locus_tag LOCUS_15390 gene rppH 13731 13228 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_15390 14043 14708 gene locus_tag LOCUS_15400 14043 14708 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_15400 14797 15978 gene locus_tag LOCUS_15410 14797 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 17232 16030 gene locus_tag LOCUS_15420 17232 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_15420 18636 17401 gene locus_tag LOCUS_15430 18636 17401 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_15430 19862 18633 gene locus_tag LOCUS_15440 gene ubiH 19862 18633 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_15440 21297 19963 gene locus_tag LOCUS_15450 gene pepP 21297 19963 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_15450 21904 21353 gene locus_tag LOCUS_15460 21904 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 22059 22274 gene locus_tag LOCUS_15470 22059 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 22264 22578 gene locus_tag LOCUS_15480 22264 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 22749 22483 gene locus_tag LOCUS_15490 22749 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 22832 23413 gene locus_tag LOCUS_15500 22832 23413 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP94 protein_id gnl|my_center|LOCUS_15500 24982 24005 gene locus_tag LOCUS_15510 24982 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence043 3018 433 gene locus_tag LOCUS_15520 3018 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5115 3124 gene locus_tag LOCUS_15530 5115 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8329 5132 gene locus_tag LOCUS_15540 8329 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 9413 8736 gene locus_tag LOCUS_15550 9413 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 9768 9415 gene locus_tag LOCUS_15560 9768 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 10940 9777 gene locus_tag LOCUS_15570 10940 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12318 10951 gene locus_tag LOCUS_15580 12318 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 13969 12344 gene locus_tag LOCUS_15590 13969 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 15648 14392 gene locus_tag LOCUS_15600 15648 14392 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_15600 16413 15859 gene locus_tag LOCUS_15610 16413 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527819.1 protein_id gnl|my_center|LOCUS_15610 16691 16413 gene locus_tag LOCUS_15620 gene hupB 16691 16413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_15620 17905 16736 gene locus_tag LOCUS_15630 17905 16736 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_15630 18115 17945 gene locus_tag LOCUS_15640 18115 17945 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 protein_id gnl|my_center|LOCUS_15640 18342 18815 gene locus_tag LOCUS_15650 gene ubiC 18342 18815 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F94 protein_id gnl|my_center|LOCUS_15650 18869 19753 gene locus_tag LOCUS_15660 gene ubiA 18869 19753 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 protein_id gnl|my_center|LOCUS_15660 19897 20595 gene locus_tag LOCUS_15670 gene phoB 19897 20595 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_15670 20604 21950 gene locus_tag LOCUS_15680 gene phoR 20604 21950 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_15680 22699 21947 gene locus_tag LOCUS_15690 gene cysZ 22699 21947 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL6 protein_id gnl|my_center|LOCUS_15690 22772 23464 gene locus_tag LOCUS_15700 gene trmH 22772 23464 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_15700 24022 24303 gene locus_tag LOCUS_15710 24022 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 24768 24693 gene locus_tag LOCUS_t00110 24768 24693 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 1424 912 gene locus_tag LOCUS_15720 1424 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2638 1421 gene locus_tag LOCUS_15730 2638 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3713 2706 gene locus_tag LOCUS_15740 gene xcpX 3713 2706 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_15740 4427 3714 gene locus_tag LOCUS_15750 gene xcpW 4427 3714 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_15750 4822 4427 gene locus_tag LOCUS_15760 gene xcpV 4822 4427 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_15760 5435 4812 gene locus_tag LOCUS_15770 5435 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5873 5445 gene locus_tag LOCUS_15780 gene gspG 5873 5445 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_15780 7100 5886 gene locus_tag LOCUS_15790 gene xcpS 7100 5886 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_15790 8633 7104 gene locus_tag LOCUS_15800 gene xcpR 8633 7104 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_15800 9994 8636 gene locus_tag LOCUS_15810 gene rkpK 9994 8636 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_15810 11019 10093 gene locus_tag LOCUS_15820 gene etfA 11019 10093 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_15820 11785 11036 gene locus_tag LOCUS_15830 11785 11036 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 protein_id gnl|my_center|LOCUS_15830 12106 13746 gene locus_tag LOCUS_15840 12106 13746 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_15840 15675 13828 gene locus_tag LOCUS_15850 gene ppiD 15675 13828 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_15850 16090 15812 gene locus_tag LOCUS_15860 gene hupB 16090 15812 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_15860 18591 16201 gene locus_tag LOCUS_15870 gene lon 18591 16201 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_15870 20060 18774 gene locus_tag LOCUS_15880 gene clpX 20060 18774 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_15880 20829 20203 gene locus_tag LOCUS_15890 gene clpP 20829 20203 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS6 protein_id gnl|my_center|LOCUS_15890 22262 20952 gene locus_tag LOCUS_15900 gene tig 22262 20952 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_15900 22562 22487 gene locus_tag LOCUS_t00120 22562 22487 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22678 22602 gene locus_tag LOCUS_t00130 22678 22602 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22777 22701 gene locus_tag LOCUS_t00140 22777 22701 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23019 23873 gene locus_tag LOCUS_15910 gene folD 23019 23873 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 protein_id gnl|my_center|LOCUS_15910 <24531 23943 gene locus_tag LOCUS_15920 <24531 23943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2U7:cysteine--tRNA ligase >Feature sequence045 637 888 gene locus_tag LOCUS_15930 gene yefM 637 888 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_15930 885 1145 gene locus_tag LOCUS_15940 885 1145 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_15940 1524 1174 gene locus_tag LOCUS_15950 1524 1174 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 protein_id gnl|my_center|LOCUS_15950 2172 1690 gene locus_tag LOCUS_15960 2172 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2810 2169 gene locus_tag LOCUS_15970 2810 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3814 3125 gene locus_tag LOCUS_15980 3814 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7697 4029 gene locus_tag LOCUS_15990 7697 4029 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJB4 protein_id gnl|my_center|LOCUS_15990 9504 8038 gene locus_tag LOCUS_16000 gene putP 9504 8038 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_16000 13828 10139 gene locus_tag LOCUS_16010 13828 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 14007 14468 gene locus_tag LOCUS_16020 gene putR 14007 14468 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313921.1 protein_id gnl|my_center|LOCUS_16020 14806 15399 gene locus_tag LOCUS_16030 14806 15399 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_16030 15399 15704 gene locus_tag LOCUS_16040 15399 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_16040 15701 16318 gene locus_tag LOCUS_16050 15701 16318 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_16050 16779 16369 gene locus_tag LOCUS_16060 16779 16369 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_16060 16899 17387 gene locus_tag LOCUS_16070 16899 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 18583 17486 gene locus_tag LOCUS_16080 gene pslL 18583 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160261.1 protein_id gnl|my_center|LOCUS_16080 19350 18910 gene locus_tag LOCUS_16090 19350 18910 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101319.1 protein_id gnl|my_center|LOCUS_16090 19599 20453 gene locus_tag LOCUS_16100 19599 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 20518 21714 gene locus_tag LOCUS_16110 20518 21714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 protein_id gnl|my_center|LOCUS_16110 21852 22721 gene locus_tag LOCUS_16120 gene phnD 21852 22721 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_16120 22726 23490 gene locus_tag LOCUS_16130 gene phnC1 22726 23490 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889G0 protein_id gnl|my_center|LOCUS_16130 >Feature sequence046 1564 599 gene locus_tag LOCUS_16140 1564 599 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_16140 2450 1566 gene locus_tag LOCUS_16150 2450 1566 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 protein_id gnl|my_center|LOCUS_16150 3771 2563 gene locus_tag LOCUS_16160 3771 2563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566398.1 protein_id gnl|my_center|LOCUS_16160 4583 3825 gene locus_tag LOCUS_16170 4583 3825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_16170 5506 4580 gene locus_tag LOCUS_16180 5506 4580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065077.1 protein_id gnl|my_center|LOCUS_16180 5811 8252 gene locus_tag LOCUS_16190 5811 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8249 8977 gene locus_tag LOCUS_16200 8249 8977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_16200 9807 10340 gene locus_tag LOCUS_16210 9807 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10990 10349 gene locus_tag LOCUS_16220 10990 10349 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 protein_id gnl|my_center|LOCUS_16220 11859 11140 gene locus_tag LOCUS_16230 11859 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 12100 12918 gene locus_tag LOCUS_16240 12100 12918 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590336.1 protein_id gnl|my_center|LOCUS_16240 12982 13311 gene locus_tag LOCUS_16250 12982 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13390 14601 gene locus_tag LOCUS_16260 13390 14601 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_16260 15886 14591 gene locus_tag LOCUS_16270 15886 14591 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267685.1 protein_id gnl|my_center|LOCUS_16270 15980 17302 gene locus_tag LOCUS_16280 15980 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_16280 18238 17318 gene locus_tag LOCUS_16290 gene oxyR 18238 17318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_16290 18336 19061 gene locus_tag LOCUS_16300 18336 19061 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_16300 19119 19703 gene locus_tag LOCUS_16310 19119 19703 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_16310 20607 19807 gene locus_tag LOCUS_16320 20607 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 21371 20670 gene locus_tag LOCUS_16330 21371 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141282.1 protein_id gnl|my_center|LOCUS_16330 21500 22123 gene locus_tag LOCUS_16340 gene acpD 21500 22123 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D981 protein_id gnl|my_center|LOCUS_16340 22145 22579 gene locus_tag LOCUS_16350 22145 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 22660 22875 gene locus_tag LOCUS_16360 22660 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence047 2070 1069 gene locus_tag LOCUS_16370 2070 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_16370 2808 2422 gene locus_tag LOCUS_16380 2808 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3814 2828 gene locus_tag LOCUS_16390 3814 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_16390 4030 4944 gene locus_tag LOCUS_16400 4030 4944 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_16400 5091 6617 gene locus_tag LOCUS_16410 gene glsF 5091 6617 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_16410 7590 6970 gene locus_tag LOCUS_16420 7590 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 8182 7847 gene locus_tag LOCUS_16430 8182 7847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_16430 8470 9864 gene locus_tag LOCUS_16440 gene atpB 8470 9864 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51120 protein_id gnl|my_center|LOCUS_16440 9864 10472 gene locus_tag LOCUS_16450 gene atpD 9864 10472 CDS product ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_16450 10469 12382 gene locus_tag LOCUS_16460 gene atpI 10469 12382 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z990 protein_id gnl|my_center|LOCUS_16460 12375 12827 gene locus_tag LOCUS_16470 12375 12827 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583857.1 protein_id gnl|my_center|LOCUS_16470 12830 13540 gene locus_tag LOCUS_16480 12830 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 13553 14332 gene locus_tag LOCUS_16490 13553 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 14329 16236 gene locus_tag LOCUS_16500 gene atpA 14329 16236 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_16500 16478 17158 gene locus_tag LOCUS_16510 16478 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 17785 17219 gene locus_tag LOCUS_16520 17785 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 18019 19962 gene locus_tag LOCUS_16530 18019 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 20140 20643 gene locus_tag LOCUS_16540 gene rpoE 20140 20643 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_16540 20621 21166 gene locus_tag LOCUS_16550 20621 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 21192 21428 gene locus_tag LOCUS_16560 21192 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 21418 21918 gene locus_tag LOCUS_16570 21418 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 22598 21939 gene locus_tag LOCUS_16580 22598 21939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence048 <1 747 gene locus_tag LOCUS_16590 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943188.1:lipoprotein 823 898 gene locus_tag LOCUS_t00150 823 898 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1079 2116 gene locus_tag LOCUS_16600 gene nadA 1079 2116 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_16600 3583 2129 gene locus_tag LOCUS_16610 3583 2129 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_16610 3898 4140 gene locus_tag LOCUS_16620 gene tusA 3898 4140 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_16620 4142 5194 gene locus_tag LOCUS_16630 4142 5194 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_16630 5387 6262 gene locus_tag LOCUS_16640 gene dapA 5387 6262 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_16640 6265 6924 gene locus_tag LOCUS_16650 6265 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7035 7685 gene locus_tag LOCUS_16660 7035 7685 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_16660 7804 8514 gene locus_tag LOCUS_16670 gene purC 7804 8514 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_16670 8656 9405 gene locus_tag LOCUS_16680 8656 9405 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 protein_id gnl|my_center|LOCUS_16680 10197 9496 gene locus_tag LOCUS_16690 10197 9496 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_16690 10914 10201 gene locus_tag LOCUS_16700 10914 10201 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_16700 11965 10916 gene locus_tag LOCUS_16710 11965 10916 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED2 protein_id gnl|my_center|LOCUS_16710 14199 11965 gene locus_tag LOCUS_16720 14199 11965 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT88 protein_id gnl|my_center|LOCUS_16720 14804 14196 gene locus_tag LOCUS_16730 14804 14196 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX3 protein_id gnl|my_center|LOCUS_16730 15396 14815 gene locus_tag LOCUS_16740 gene rnfA 15396 14815 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_16740 15848 17107 gene locus_tag LOCUS_16750 15848 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_16750 17134 18894 gene locus_tag LOCUS_16760 17134 18894 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457375.1 protein_id gnl|my_center|LOCUS_16760 19132 19680 gene locus_tag LOCUS_16770 19132 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 19691 21457 gene locus_tag LOCUS_16780 19691 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 21454 21948 gene locus_tag LOCUS_16790 21454 21948 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence049 579 226 gene locus_tag LOCUS_16800 579 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 887 576 gene locus_tag LOCUS_16810 887 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1368 892 gene locus_tag LOCUS_16820 1368 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1559 2446 gene locus_tag LOCUS_16830 gene htpX 1559 2446 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_16830 2821 2480 gene locus_tag LOCUS_16840 2821 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2908 3309 gene locus_tag LOCUS_16850 gene yjfI 2908 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 protein_id gnl|my_center|LOCUS_16850 3312 4007 gene locus_tag LOCUS_16860 3312 4007 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_16860 4106 5155 gene locus_tag LOCUS_16870 4106 5155 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_16870 5145 5789 gene locus_tag LOCUS_16880 5145 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037961.1 protein_id gnl|my_center|LOCUS_16880 5808 6209 gene locus_tag LOCUS_16890 5808 6209 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_16890 6223 6846 gene locus_tag LOCUS_16900 6223 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6847 8028 gene locus_tag LOCUS_16910 6847 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 protein_id gnl|my_center|LOCUS_16910 9407 8145 gene locus_tag LOCUS_16920 9407 8145 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_16920 10668 9652 gene locus_tag LOCUS_16930 gene tqsA 10668 9652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_16930 10837 10921 gene locus_tag LOCUS_t00160 10837 10921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10966 11292 gene locus_tag LOCUS_16940 10966 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 11294 11989 gene locus_tag LOCUS_16950 11294 11989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_16950 12593 12024 gene locus_tag LOCUS_16960 gene nudE 12593 12024 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 protein_id gnl|my_center|LOCUS_16960 12640 13305 gene locus_tag LOCUS_16970 12640 13305 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_16970 13302 13709 gene locus_tag LOCUS_16980 gene hslR 13302 13709 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_16980 13724 14581 gene locus_tag LOCUS_16990 gene hslO 13724 14581 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_16990 14814 16349 gene locus_tag LOCUS_17000 gene pckA 14814 16349 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_17000 17014 16535 gene locus_tag LOCUS_17010 17014 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 19134 17029 gene locus_tag LOCUS_17020 19134 17029 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263020.1 protein_id gnl|my_center|LOCUS_17020 19537 21885 gene locus_tag LOCUS_17030 19537 21885 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence050 855 295 gene locus_tag LOCUS_17040 855 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1617 886 gene locus_tag LOCUS_17050 1617 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1908 1645 gene locus_tag LOCUS_17060 1908 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2240 1905 gene locus_tag LOCUS_17070 2240 1905 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL7 protein_id gnl|my_center|LOCUS_17070 3030 2254 gene locus_tag LOCUS_17080 3030 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3702 3046 gene locus_tag LOCUS_17090 3702 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4145 3699 gene locus_tag LOCUS_17100 4145 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4433 4155 gene locus_tag LOCUS_17110 4433 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5951 4446 gene locus_tag LOCUS_17120 gene nifB 5951 4446 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06770 protein_id gnl|my_center|LOCUS_17120 6075 6290 gene locus_tag LOCUS_17130 6075 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 6634 8493 gene locus_tag LOCUS_17140 6634 8493 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_17140 10446 8854 gene locus_tag LOCUS_17150 gene nifA-2 10446 8854 CDS product Nif-specific regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_17150 12035 10464 gene locus_tag LOCUS_17160 12035 10464 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083089.1 protein_id gnl|my_center|LOCUS_17160 12487 13059 gene locus_tag LOCUS_17170 gene rnfA 12487 13059 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ2 protein_id gnl|my_center|LOCUS_17170 13082 13609 gene locus_tag LOCUS_17180 gene rnfB 13082 13609 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_17180 13611 15089 gene locus_tag LOCUS_17190 gene rnfC 13611 15089 CDS product electron transport complex subunit RnfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC4 protein_id gnl|my_center|LOCUS_17190 15086 16177 gene locus_tag LOCUS_17200 gene rnfD 15086 16177 CDS product electron transport complex subunit RnfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC3 protein_id gnl|my_center|LOCUS_17200 16189 16833 gene locus_tag LOCUS_17210 16189 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 16830 17498 gene locus_tag LOCUS_17220 gene rnfE 16830 17498 CDS product electron transport complex subunit RnfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC1 protein_id gnl|my_center|LOCUS_17220 17509 17772 gene locus_tag LOCUS_17230 gene rnfH 17509 17772 CDS product protein RnfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC0 protein_id gnl|my_center|LOCUS_17230 17772 17963 gene locus_tag LOCUS_17240 17772 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 18069 18145 gene locus_tag LOCUS_t00170 18069 18145 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19619 18426 gene locus_tag LOCUS_17250 19619 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_17250 21687 19606 gene locus_tag LOCUS_17260 21687 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_17260 <22425 21824 gene locus_tag LOCUS_17270 <22425 21824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228379.1:ATPase AAA >Feature sequence051 1512 379 gene locus_tag LOCUS_17280 1512 379 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_17280 2631 1525 gene locus_tag LOCUS_17290 2631 1525 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_17290 3567 2794 gene locus_tag LOCUS_17300 gene fpr 3567 2794 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_17300 3774 4658 gene locus_tag LOCUS_17310 3774 4658 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339525.1 protein_id gnl|my_center|LOCUS_17310 5621 4659 gene locus_tag LOCUS_17320 5621 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6183 5770 gene locus_tag LOCUS_17330 6183 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083895.1 protein_id gnl|my_center|LOCUS_17330 6411 6731 gene locus_tag LOCUS_17340 6411 6731 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749F2 protein_id gnl|my_center|LOCUS_17340 6836 7363 gene locus_tag LOCUS_17350 6836 7363 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_17350 7417 8718 gene locus_tag LOCUS_17360 7417 8718 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_17360 8715 9188 gene locus_tag LOCUS_17370 8715 9188 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_17370 9252 9491 gene locus_tag LOCUS_17380 9252 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 10105 9563 gene locus_tag LOCUS_17390 10105 9563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_17390 10560 10171 gene locus_tag LOCUS_17400 10560 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_17400 11189 10557 gene locus_tag LOCUS_17410 11189 10557 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_17410 11542 11186 gene locus_tag LOCUS_17420 gene yfgD 11542 11186 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 protein_id gnl|my_center|LOCUS_17420 11596 12804 gene locus_tag LOCUS_17430 11596 12804 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_17430 12841 14280 gene locus_tag LOCUS_17440 12841 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 14367 15707 gene locus_tag LOCUS_17450 14367 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_17450 15865 16617 gene locus_tag LOCUS_17460 15865 16617 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_17460 16901 18823 gene locus_tag LOCUS_17470 16901 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 20242 18794 gene locus_tag LOCUS_17480 20242 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 21017 20139 gene locus_tag LOCUS_17490 21017 20139 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528101.1 protein_id gnl|my_center|LOCUS_17490 22212 21019 gene locus_tag LOCUS_17500 22212 21019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence052 <1 1419 gene locus_tag LOCUS_17510 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ26:3-phosphoshikimate 1-carboxyvinyltransferase 1412 2092 gene locus_tag LOCUS_17520 gene cmk 1412 2092 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_17520 2171 3922 gene locus_tag LOCUS_17530 gene rpsA 2171 3922 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_17530 4037 4387 gene locus_tag LOCUS_17540 gene ihfB 4037 4387 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_17540 4458 4739 gene locus_tag LOCUS_17550 4458 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4749 5930 gene locus_tag LOCUS_17560 gene lapB 4749 5930 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_17560 5927 6625 gene locus_tag LOCUS_17570 gene pyrF 5927 6625 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQT7 protein_id gnl|my_center|LOCUS_17570 6664 7845 gene locus_tag LOCUS_17580 6664 7845 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_17580 8078 8003 gene locus_tag LOCUS_t00180 8078 8003 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8792 8211 gene locus_tag LOCUS_17590 gene dcd 8792 8211 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX5 protein_id gnl|my_center|LOCUS_17590 9645 8839 gene locus_tag LOCUS_17600 9645 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10338 9670 gene locus_tag LOCUS_17610 gene purN 10338 9670 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_17610 11384 10335 gene locus_tag LOCUS_17620 gene purM 11384 10335 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H3 protein_id gnl|my_center|LOCUS_17620 11680 12645 gene locus_tag LOCUS_17630 11680 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 12630 13352 gene locus_tag LOCUS_17640 12630 13352 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_17640 14616 13435 gene locus_tag LOCUS_17650 gene aspC 14616 13435 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_17650 14748 16778 gene locus_tag LOCUS_17660 gene uvrB 14748 16778 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C9 protein_id gnl|my_center|LOCUS_17660 18473 16866 gene locus_tag LOCUS_17670 gene cysNC 18473 16866 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_17670 19385 18474 gene locus_tag LOCUS_17680 gene cysD 19385 18474 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_17680 19703 20191 gene locus_tag LOCUS_17690 19703 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 20278 21204 gene locus_tag LOCUS_17700 20278 21204 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_17700 21197 21985 gene locus_tag LOCUS_17710 21197 21985 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence053 1970 1827 gene locus_tag LOCUS_17720 1970 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3013 2141 gene locus_tag LOCUS_17730 3013 2141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263794.1 protein_id gnl|my_center|LOCUS_17730 3088 4347 gene locus_tag LOCUS_17740 3088 4347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 protein_id gnl|my_center|LOCUS_17740 4347 4778 gene locus_tag LOCUS_17750 gene yqaA 4347 4778 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_17750 4936 5148 gene locus_tag LOCUS_17760 4936 5148 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_17760 5207 6619 gene locus_tag LOCUS_17770 5207 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 7057 6671 gene locus_tag LOCUS_17780 7057 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 7965 7378 gene locus_tag LOCUS_17790 7965 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 8451 8134 gene locus_tag LOCUS_17800 8451 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 8672 9001 gene locus_tag LOCUS_17810 8672 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 9996 9133 gene locus_tag LOCUS_17820 9996 9133 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_17820 10095 11024 gene locus_tag LOCUS_17830 10095 11024 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881688.1 protein_id gnl|my_center|LOCUS_17830 11223 11939 gene locus_tag LOCUS_17840 11223 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12089 12880 gene locus_tag LOCUS_17850 12089 12880 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_17850 13388 12921 gene locus_tag LOCUS_17860 13388 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 13798 13400 gene locus_tag LOCUS_17870 13798 13400 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261873.1 protein_id gnl|my_center|LOCUS_17870 16241 14001 gene locus_tag LOCUS_17880 16241 14001 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_17880 16261 16530 gene locus_tag LOCUS_17890 16261 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 16673 17254 gene locus_tag LOCUS_17900 16673 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 17513 18607 gene locus_tag LOCUS_17910 17513 18607 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_17910 18766 18500 gene locus_tag LOCUS_17920 18766 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 18735 20918 gene locus_tag LOCUS_17930 18735 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 20915 21283 gene locus_tag LOCUS_17940 20915 21283 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_17940 21298 21753 gene locus_tag LOCUS_17950 21298 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence054 569 99 gene locus_tag LOCUS_17960 569 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 931 2028 gene locus_tag LOCUS_17970 931 2028 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_17970 2031 3416 gene locus_tag LOCUS_17980 2031 3416 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974511.1 protein_id gnl|my_center|LOCUS_17980 3608 4369 gene locus_tag LOCUS_17990 gene fabG 3608 4369 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974510.1 protein_id gnl|my_center|LOCUS_17990 4616 6880 gene locus_tag LOCUS_18000 4616 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 6898 8241 gene locus_tag LOCUS_18010 6898 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 8634 9707 gene locus_tag LOCUS_18020 8634 9707 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSD8 protein_id gnl|my_center|LOCUS_18020 9735 10385 gene locus_tag LOCUS_18030 9735 10385 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_18030 11651 10389 gene locus_tag LOCUS_18040 11651 10389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_18040 12428 11814 gene locus_tag LOCUS_18050 12428 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 protein_id gnl|my_center|LOCUS_18050 14899 12842 gene locus_tag LOCUS_18060 14899 12842 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096762.1 protein_id gnl|my_center|LOCUS_18060 16071 14995 gene locus_tag LOCUS_18070 gene paaE 16071 14995 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_18070 16688 16110 gene locus_tag LOCUS_18080 gene paaD 16688 16110 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_18080 17436 16675 gene locus_tag LOCUS_18090 gene paaC 17436 16675 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_18090 17726 17445 gene locus_tag LOCUS_18100 gene paaB 17726 17445 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_18100 18748 17756 gene locus_tag LOCUS_18110 gene paaA 18748 17756 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_18110 20286 18979 gene locus_tag LOCUS_18120 gene paaA 20286 18979 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_18120 21643 20435 gene locus_tag LOCUS_18130 gene paaJ 21643 20435 CDS product beta-ketoadipyl CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545612.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence055 1370 3382 gene locus_tag LOCUS_18140 1370 3382 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268340.1 protein_id gnl|my_center|LOCUS_18140 4121 3483 gene locus_tag LOCUS_18150 4121 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4783 4289 gene locus_tag LOCUS_18160 4783 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6493 5243 gene locus_tag LOCUS_18170 6493 5243 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479444.1 protein_id gnl|my_center|LOCUS_18170 7570 6815 gene locus_tag LOCUS_18180 7570 6815 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_18180 7712 7954 gene locus_tag LOCUS_18190 7712 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 8628 7996 gene locus_tag LOCUS_18200 8628 7996 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_18200 8772 9932 gene locus_tag LOCUS_18210 8772 9932 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 protein_id gnl|my_center|LOCUS_18210 9913 10641 gene locus_tag LOCUS_18220 gene cobB 9913 10641 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRF3 protein_id gnl|my_center|LOCUS_18220 10730 10996 gene locus_tag LOCUS_18230 10730 10996 CDS product DNA-damage-inducible protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258569.1 protein_id gnl|my_center|LOCUS_18230 10989 11204 gene locus_tag LOCUS_18240 10989 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18240 11990 11250 gene locus_tag LOCUS_18250 gene ssuB 11990 11250 CDS product aliphatic sulfonates import ATP-binding protein SsuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P97027 protein_id gnl|my_center|LOCUS_18250 12750 11977 gene locus_tag LOCUS_18260 12750 11977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532065.1 protein_id gnl|my_center|LOCUS_18260 13753 12737 gene locus_tag LOCUS_18270 13753 12737 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_18270 14258 13929 gene locus_tag LOCUS_18280 14258 13929 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_18280 15309 14812 gene locus_tag LOCUS_18290 15309 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 15895 15404 gene locus_tag LOCUS_18300 15895 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 16121 17233 gene locus_tag LOCUS_18310 16121 17233 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044382.1 protein_id gnl|my_center|LOCUS_18310 17236 20349 gene locus_tag LOCUS_18320 17236 20349 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_18320 21175 20417 gene locus_tag LOCUS_18330 21175 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_18330 21494 21781 gene locus_tag LOCUS_18340 21494 21781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence056 92 3 gene locus_tag LOCUS_t00190 92 3 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 612 1598 gene locus_tag LOCUS_18350 gene dctP 612 1598 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_18350 1715 2659 gene locus_tag LOCUS_18360 1715 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2846 3436 gene locus_tag LOCUS_18370 2846 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4634 3417 gene locus_tag LOCUS_18380 4634 3417 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_18380 5202 4693 gene locus_tag LOCUS_18390 5202 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5341 6726 gene locus_tag LOCUS_18400 gene rimO 5341 6726 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM9 protein_id gnl|my_center|LOCUS_18400 6977 9271 gene locus_tag LOCUS_18410 6977 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_18410 10244 9420 gene locus_tag LOCUS_18420 10244 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 11091 10324 gene locus_tag LOCUS_18430 11091 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 13007 11619 gene locus_tag LOCUS_18440 gene dctM 13007 11619 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_18440 13546 13007 gene locus_tag LOCUS_18450 gene dctQ 13546 13007 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS0 protein_id gnl|my_center|LOCUS_18450 13626 13916 gene locus_tag LOCUS_18460 13626 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14426 14217 gene locus_tag LOCUS_18470 14426 14217 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_18470 16062 14710 gene locus_tag LOCUS_18480 gene dctD 16062 14710 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 protein_id gnl|my_center|LOCUS_18480 17986 16055 gene locus_tag LOCUS_18490 17986 16055 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477467.1 protein_id gnl|my_center|LOCUS_18490 18312 19436 gene locus_tag LOCUS_18500 gene dctP 18312 19436 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_18500 19557 19943 gene locus_tag LOCUS_18510 19557 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 19952 20317 gene locus_tag LOCUS_18520 19952 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 20319 20606 gene locus_tag LOCUS_18530 20319 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 20609 20929 gene locus_tag LOCUS_18540 20609 20929 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_18540 20926 21918 gene locus_tag LOCUS_18550 20926 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence057 292 2499 gene locus_tag LOCUS_18560 292 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2963 2694 gene locus_tag LOCUS_18570 2963 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3177 3025 gene locus_tag LOCUS_18580 3177 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3914 5080 gene locus_tag LOCUS_18590 3914 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5131 8493 gene locus_tag LOCUS_18600 gene hsdR 5131 8493 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_18600 8591 11053 gene locus_tag LOCUS_18610 8591 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544679.1 protein_id gnl|my_center|LOCUS_18610 11050 11961 gene locus_tag LOCUS_18620 11050 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11951 13015 gene locus_tag LOCUS_18630 11951 13015 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102643.1 protein_id gnl|my_center|LOCUS_18630 13096 14715 gene locus_tag LOCUS_18640 gene hsdM 13096 14715 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_18640 14964 16076 gene locus_tag LOCUS_18650 14964 16076 CDS product type I restriction modification enzyme protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_18650 16425 16847 gene locus_tag LOCUS_18660 16425 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 17013 17885 gene locus_tag LOCUS_18670 17013 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 18978 18073 gene locus_tag LOCUS_18680 18978 18073 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490513.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence058 351 2348 gene locus_tag LOCUS_18690 gene ccmF 351 2348 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_18690 2345 2866 gene locus_tag LOCUS_18700 gene dsbE 2345 2866 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD52 protein_id gnl|my_center|LOCUS_18700 2869 3363 gene locus_tag LOCUS_18710 gene ccmH 2869 3363 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_18710 3360 4571 gene locus_tag LOCUS_18720 gene cycH 3360 4571 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_18720 5670 4654 gene locus_tag LOCUS_18730 5670 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7005 5818 gene locus_tag LOCUS_18740 7005 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_18740 7630 9579 gene locus_tag LOCUS_18750 gene acsA 7630 9579 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K7 protein_id gnl|my_center|LOCUS_18750 9800 10471 gene locus_tag LOCUS_18760 gene agmR 9800 10471 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_18760 13974 10528 gene locus_tag LOCUS_18770 13974 10528 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_18770 14277 16076 gene locus_tag LOCUS_18780 14277 16076 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_18780 16076 16681 gene locus_tag LOCUS_18790 16076 16681 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_18790 17175 18155 gene locus_tag LOCUS_18800 17175 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 18689 18138 gene locus_tag LOCUS_18810 18689 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 19665 19300 gene locus_tag LOCUS_18820 19665 19300 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_18820 20598 19822 gene locus_tag LOCUS_18830 gene lepB 20598 19822 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF9 protein_id gnl|my_center|LOCUS_18830 20779 21678 gene locus_tag LOCUS_18840 20779 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence059 354 31 gene locus_tag LOCUS_18850 354 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 484 2172 gene locus_tag LOCUS_18860 gene fadD1 484 2172 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_18860 2626 2234 gene locus_tag LOCUS_18870 2626 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 6104 2883 gene locus_tag LOCUS_18880 6104 2883 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_18880 7162 6107 gene locus_tag LOCUS_18890 7162 6107 CDS product multidrug transporter AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_18890 7533 7769 gene locus_tag LOCUS_18900 gene grxA 7533 7769 CDS product glutaredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1P9 protein_id gnl|my_center|LOCUS_18900 8501 7827 gene locus_tag LOCUS_18910 8501 7827 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 protein_id gnl|my_center|LOCUS_18910 8723 8568 gene locus_tag LOCUS_18920 8723 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 9348 8737 gene locus_tag LOCUS_18930 9348 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 10072 9422 gene locus_tag LOCUS_18940 10072 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 10037 10177 gene locus_tag LOCUS_18950 10037 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 10980 10216 gene locus_tag LOCUS_18960 10980 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 12126 11053 gene locus_tag LOCUS_18970 12126 11053 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_18970 12176 13993 gene locus_tag LOCUS_18980 gene atmA 12176 13993 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_18980 14001 14768 gene locus_tag LOCUS_18990 gene xni 14001 14768 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQX0 protein_id gnl|my_center|LOCUS_18990 14871 15290 gene locus_tag LOCUS_19000 gene ybaW 14871 15290 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194531.1 protein_id gnl|my_center|LOCUS_19000 15287 15904 gene locus_tag LOCUS_19010 15287 15904 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_19010 16111 15911 gene locus_tag LOCUS_19020 16111 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 16313 17194 gene locus_tag LOCUS_19030 gene poxA 16313 17194 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_19030 17286 17750 gene locus_tag LOCUS_19040 17286 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 20315 17838 gene locus_tag LOCUS_19050 20315 17838 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_19050 20456 20725 gene locus_tag LOCUS_19060 20456 20725 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 protein_id gnl|my_center|LOCUS_19060 21226 21405 gene locus_tag LOCUS_19070 21226 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence060 <1 2195 gene locus_tag LOCUS_19080 <1 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:bifunctional diguanylate cyclase/phosphodiesterase 2476 4311 gene locus_tag LOCUS_19090 gene edd 2476 4311 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_19090 5102 4452 gene locus_tag LOCUS_19100 gene eda 5102 4452 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_19100 5850 5116 gene locus_tag LOCUS_19110 gene pgl 5850 5116 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_19110 7312 5837 gene locus_tag LOCUS_19120 gene zwf 7312 5837 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68282 protein_id gnl|my_center|LOCUS_19120 7542 8399 gene locus_tag LOCUS_19130 7542 8399 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 protein_id gnl|my_center|LOCUS_19130 8963 8472 gene locus_tag LOCUS_19140 8963 8472 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 protein_id gnl|my_center|LOCUS_19140 9181 10437 gene locus_tag LOCUS_19150 gene dadA 9181 10437 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB3 protein_id gnl|my_center|LOCUS_19150 10476 10859 gene locus_tag LOCUS_19160 10476 10859 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_19160 10889 11971 gene locus_tag LOCUS_19170 gene alr 10889 11971 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW2 protein_id gnl|my_center|LOCUS_19170 12065 12418 gene locus_tag LOCUS_19180 gene yoaB 12065 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_19180 12619 13581 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgtccttcacagacgcgtggatcgaaac 13725 16010 gene locus_tag LOCUS_19190 13725 16010 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_19190 16062 16736 gene locus_tag LOCUS_19200 16062 16736 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_19200 16733 18622 gene locus_tag LOCUS_19210 16733 18622 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 protein_id gnl|my_center|LOCUS_19210 18622 19491 gene locus_tag LOCUS_19220 18622 19491 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_19220 19515 20138 gene locus_tag LOCUS_19230 19515 20138 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_19230 20135 21151 gene locus_tag LOCUS_19240 gene cas1 20135 21151 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF5 protein_id gnl|my_center|LOCUS_19240 >Feature sequence061 7 386 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaaacctgccccgtttataaggggattaagac 592 1158 gene locus_tag LOCUS_19250 592 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1746 1216 gene locus_tag LOCUS_19260 1746 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2569 1862 gene locus_tag LOCUS_19270 2569 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3545 2655 gene locus_tag LOCUS_19280 3545 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4206 3853 gene locus_tag LOCUS_19290 4206 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4975 4424 gene locus_tag LOCUS_19300 4975 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5928 5032 gene locus_tag LOCUS_19310 5928 5032 CDS product HSR1-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703400.1 protein_id gnl|my_center|LOCUS_19310 6109 7827 gene locus_tag LOCUS_19320 6109 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8252 9952 gene locus_tag LOCUS_19330 8252 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 9949 10710 gene locus_tag LOCUS_19340 9949 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 10713 12302 gene locus_tag LOCUS_19350 10713 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 12299 13741 gene locus_tag LOCUS_19360 12299 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_19360 13738 14250 gene locus_tag LOCUS_19370 13738 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 14247 16406 gene locus_tag LOCUS_19380 14247 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 16403 17560 gene locus_tag LOCUS_19390 16403 17560 CDS product CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_19390 17621 18580 gene locus_tag LOCUS_19400 gene cas6_1 17621 18580 CDS product CRISPR-associated protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence062 2427 1261 gene locus_tag LOCUS_19410 gene liuA 2427 1261 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_19410 2916 2494 gene locus_tag LOCUS_19420 gene liuR 2916 2494 CDS product liu genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_19420 3206 4015 gene locus_tag LOCUS_19430 3206 4015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_19430 4012 4725 gene locus_tag LOCUS_19440 4012 4725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_19440 4872 6077 gene locus_tag LOCUS_19450 4872 6077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566398.1 protein_id gnl|my_center|LOCUS_19450 6389 7267 gene locus_tag LOCUS_19460 6389 7267 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_19460 7279 8205 gene locus_tag LOCUS_19470 7279 8205 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 protein_id gnl|my_center|LOCUS_19470 8322 9503 gene locus_tag LOCUS_19480 gene ivdA 8322 9503 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_19480 10587 9625 gene locus_tag LOCUS_19490 10587 9625 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_19490 12932 10782 gene locus_tag LOCUS_19500 12932 10782 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_19500 13615 13016 gene locus_tag LOCUS_19510 13615 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 15158 13668 gene locus_tag LOCUS_19520 gene cfaA 15158 13668 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_19520 16186 15155 gene locus_tag LOCUS_19530 16186 15155 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_19530 17550 16183 gene locus_tag LOCUS_19540 17550 16183 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_19540 18386 17547 gene locus_tag LOCUS_19550 18386 17547 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_19550 18829 18383 gene locus_tag LOCUS_19560 18829 18383 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_19560 20361 18826 gene locus_tag LOCUS_19570 20361 18826 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266743.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence063 918 1781 gene locus_tag LOCUS_19580 918 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_19580 2552 3010 gene locus_tag LOCUS_19590 2552 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3338 3658 gene locus_tag LOCUS_19600 3338 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4525 3791 gene locus_tag LOCUS_19610 4525 3791 CDS product putative response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K77 protein_id gnl|my_center|LOCUS_19610 5688 4522 gene locus_tag LOCUS_19620 5688 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7139 5676 gene locus_tag LOCUS_19630 7139 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 7936 7136 gene locus_tag LOCUS_19640 7936 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9164 7947 gene locus_tag LOCUS_19650 9164 7947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_19650 9925 9161 gene locus_tag LOCUS_19660 gene macB 9925 9161 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N80 protein_id gnl|my_center|LOCUS_19660 10504 9929 gene locus_tag LOCUS_19670 10504 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 10797 11339 gene locus_tag LOCUS_19680 10797 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 11490 15476 gene locus_tag LOCUS_19690 11490 15476 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_19690 16207 15581 gene locus_tag LOCUS_19700 gene hflD 16207 15581 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 protein_id gnl|my_center|LOCUS_19700 17306 16200 gene locus_tag LOCUS_19710 gene mnmA 17306 16200 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_19710 17760 17308 gene locus_tag LOCUS_19720 17760 17308 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_19720 18596 17895 gene locus_tag LOCUS_19730 gene rluE 18596 17895 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_19730 >Feature sequence064 1270 560 gene locus_tag LOCUS_19740 1270 560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_19740 2159 1272 gene locus_tag LOCUS_19750 2159 1272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039245.1 protein_id gnl|my_center|LOCUS_19750 3118 2156 gene locus_tag LOCUS_19760 3118 2156 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_19760 3997 3128 gene locus_tag LOCUS_19770 3997 3128 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_19770 5337 4159 gene locus_tag LOCUS_19780 5337 4159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088819.1 protein_id gnl|my_center|LOCUS_19780 6964 5678 gene locus_tag LOCUS_19790 6964 5678 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_19790 8246 7074 gene locus_tag LOCUS_19800 gene benE 8246 7074 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_19800 8615 10372 gene locus_tag LOCUS_19810 8615 10372 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_19810 10609 10415 gene locus_tag LOCUS_19820 10609 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 10602 11510 gene locus_tag LOCUS_19830 10602 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_19830 11520 12068 gene locus_tag LOCUS_19840 11520 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 12093 13631 gene locus_tag LOCUS_19850 12093 13631 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_19850 13762 15219 gene locus_tag LOCUS_19860 13762 15219 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_19860 15709 15308 gene locus_tag LOCUS_19870 15709 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246697.1 protein_id gnl|my_center|LOCUS_19870 16692 15964 gene locus_tag LOCUS_19880 16692 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 17323 16862 gene locus_tag LOCUS_19890 17323 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 17714 17238 gene locus_tag LOCUS_19900 17714 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 17728 17964 gene locus_tag LOCUS_19910 17728 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 18701 17916 gene locus_tag LOCUS_19920 gene xylL 18701 17916 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_19920 <19451 18896 gene locus_tag LOCUS_19930 <19451 18896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705526.1:NADH oxidase >Feature sequence065 <1 989 gene locus_tag LOCUS_19940 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388790.1:GGDEF-domain containing protein 1042 2142 gene locus_tag LOCUS_19950 1042 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2281 3930 gene locus_tag LOCUS_19960 2281 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3934 4791 gene locus_tag LOCUS_19970 3934 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4812 6902 gene locus_tag LOCUS_19980 4812 6902 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_19980 7546 6950 gene locus_tag LOCUS_19990 7546 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 10602 7756 gene locus_tag LOCUS_20000 10602 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 11626 10721 gene locus_tag LOCUS_20010 gene aguB 11626 10721 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_20010 12629 11616 gene locus_tag LOCUS_20020 gene aguA 12629 11616 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_20020 12856 14109 gene locus_tag LOCUS_20030 12856 14109 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_20030 14102 14788 gene locus_tag LOCUS_20040 gene lolD 14102 14788 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_20040 15344 14808 gene locus_tag LOCUS_20050 15344 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_20050 15401 17812 gene locus_tag LOCUS_20060 gene comA 15401 17812 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_20060 17938 18588 gene locus_tag LOCUS_20070 17938 18588 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence066 2235 1078 gene locus_tag LOCUS_20080 2235 1078 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_20080 3407 2250 gene locus_tag LOCUS_20090 3407 2250 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_20090 4415 3522 gene locus_tag LOCUS_20100 gene dhcR 4415 3522 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_20100 4635 5336 gene locus_tag LOCUS_20110 4635 5336 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407626.1 protein_id gnl|my_center|LOCUS_20110 5351 6007 gene locus_tag LOCUS_20120 5351 6007 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315741.1 protein_id gnl|my_center|LOCUS_20120 6189 6866 gene locus_tag LOCUS_20130 6189 6866 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 protein_id gnl|my_center|LOCUS_20130 6993 7631 gene locus_tag LOCUS_20140 6993 7631 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_20140 8160 7678 gene locus_tag LOCUS_20150 8160 7678 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_20150 8943 8377 gene locus_tag LOCUS_20160 gene btuE 8943 8377 CDS product thioredoxin/glutathione peroxidase BtuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FZL1 protein_id gnl|my_center|LOCUS_20160 10344 9280 gene locus_tag LOCUS_20170 gene fba 10344 9280 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_20170 11553 10426 gene locus_tag LOCUS_20180 11553 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 12858 11695 gene locus_tag LOCUS_20190 gene pgk 12858 11695 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y4 protein_id gnl|my_center|LOCUS_20190 13934 12918 gene locus_tag LOCUS_20200 gene epd 13934 12918 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_20200 14217 15734 gene locus_tag LOCUS_20210 gene exaC 14217 15734 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_20210 16334 17323 gene locus_tag LOCUS_20220 16334 17323 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_20220 17896 17420 gene locus_tag LOCUS_20230 17896 17420 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_20230 18456 18019 gene locus_tag LOCUS_20240 18456 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence067 1064 2206 gene locus_tag LOCUS_20250 gene trmA 1064 2206 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KN8 protein_id gnl|my_center|LOCUS_20250 2206 3729 gene locus_tag LOCUS_20260 gene dbpA 2206 3729 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_20260 4017 3757 gene locus_tag LOCUS_20270 4017 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105954.1 protein_id gnl|my_center|LOCUS_20270 4264 4010 gene locus_tag LOCUS_20280 4264 4010 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NP7 protein_id gnl|my_center|LOCUS_20280 5070 4465 gene locus_tag LOCUS_20290 5070 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 5567 5073 gene locus_tag LOCUS_20300 5567 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 6183 5713 gene locus_tag LOCUS_20310 6183 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939050.1 protein_id gnl|my_center|LOCUS_20310 6491 7894 gene locus_tag LOCUS_20320 6491 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229352.1 protein_id gnl|my_center|LOCUS_20320 8078 8704 gene locus_tag LOCUS_20330 8078 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 9625 8717 gene locus_tag LOCUS_20340 9625 8717 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_20340 10145 9627 gene locus_tag LOCUS_20350 10145 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 11054 10161 gene locus_tag LOCUS_20360 11054 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 11628 11353 gene locus_tag LOCUS_20370 11628 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 12674 11712 gene locus_tag LOCUS_20380 12674 11712 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 protein_id gnl|my_center|LOCUS_20380 12851 13384 gene locus_tag LOCUS_20390 12851 13384 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 protein_id gnl|my_center|LOCUS_20390 13762 13613 gene locus_tag LOCUS_20400 13762 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 14035 15072 gene locus_tag LOCUS_20410 14035 15072 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762859.1 protein_id gnl|my_center|LOCUS_20410 16075 15263 gene locus_tag LOCUS_20420 16075 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 16228 16824 gene locus_tag LOCUS_20430 16228 16824 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267660.1 protein_id gnl|my_center|LOCUS_20430 16837 17685 gene locus_tag LOCUS_20440 16837 17685 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence068 260 1759 gene locus_tag LOCUS_20450 gene mphN 260 1759 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_20450 1925 2287 gene locus_tag LOCUS_20460 gene mphO 1925 2287 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_20460 2290 3351 gene locus_tag LOCUS_20470 gene mphP 2290 3351 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_20470 3877 4812 gene locus_tag LOCUS_20480 3877 4812 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 protein_id gnl|my_center|LOCUS_20480 5428 4910 gene locus_tag LOCUS_20490 5428 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6415 5468 gene locus_tag LOCUS_20500 6415 5468 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260922.1 protein_id gnl|my_center|LOCUS_20500 6604 7002 gene locus_tag LOCUS_20510 6604 7002 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_20510 7134 8087 gene locus_tag LOCUS_20520 7134 8087 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 protein_id gnl|my_center|LOCUS_20520 8135 9115 gene locus_tag LOCUS_20530 8135 9115 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_20530 9112 9567 gene locus_tag LOCUS_20540 9112 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 9560 10555 gene locus_tag LOCUS_20550 9560 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 11155 10568 gene locus_tag LOCUS_20560 11155 10568 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV74 protein_id gnl|my_center|LOCUS_20560 11833 11249 gene locus_tag LOCUS_20570 11833 11249 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_20570 12102 12902 gene locus_tag LOCUS_20580 12102 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 13191 14129 gene locus_tag LOCUS_20590 13191 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 14396 15910 gene locus_tag LOCUS_20600 14396 15910 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_20600 >Feature sequence069 1150 149 gene locus_tag LOCUS_20610 1150 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2096 1272 gene locus_tag LOCUS_20620 2096 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2278 2093 gene locus_tag LOCUS_20630 2278 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2543 2998 gene locus_tag LOCUS_20640 gene mraZ 2543 2998 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY1 protein_id gnl|my_center|LOCUS_20640 2995 3930 gene locus_tag LOCUS_20650 gene rsmH 2995 3930 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_20650 3927 4172 gene locus_tag LOCUS_20660 3927 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4169 5911 gene locus_tag LOCUS_20670 gene ftsI 4169 5911 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_20670 5899 7428 gene locus_tag LOCUS_20680 gene murE 5899 7428 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6N4 protein_id gnl|my_center|LOCUS_20680 7418 8788 gene locus_tag LOCUS_20690 gene murF 7418 8788 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_20690 8794 9876 gene locus_tag LOCUS_20700 gene mraY 8794 9876 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_20700 9884 11233 gene locus_tag LOCUS_20710 gene murD 9884 11233 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_20710 11230 12384 gene locus_tag LOCUS_20720 gene ftsW 11230 12384 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW00 protein_id gnl|my_center|LOCUS_20720 12377 13459 gene locus_tag LOCUS_20730 gene murG 12377 13459 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GS7 protein_id gnl|my_center|LOCUS_20730 13449 14915 gene locus_tag LOCUS_20740 gene murC 13449 14915 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY6 protein_id gnl|my_center|LOCUS_20740 14917 15849 gene locus_tag LOCUS_20750 gene ddlB 14917 15849 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_20750 15963 16607 gene locus_tag LOCUS_20760 15963 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 16607 17842 gene locus_tag LOCUS_20770 gene ftsA 16607 17842 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_20770 >Feature sequence070 26 1003 gene locus_tag LOCUS_20780 26 1003 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_20780 1088 2248 gene locus_tag LOCUS_20790 gene metK 1088 2248 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_20790 2291 3688 gene locus_tag LOCUS_20800 gene ahcY 2291 3688 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_20800 3848 4900 gene locus_tag LOCUS_20810 3848 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5073 5642 gene locus_tag LOCUS_20820 gene neuA 5073 5642 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0Z7 protein_id gnl|my_center|LOCUS_20820 5632 6672 gene locus_tag LOCUS_20830 gene siaC 5632 6672 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215299.1 protein_id gnl|my_center|LOCUS_20830 6638 7798 gene locus_tag LOCUS_20840 gene neuC 6638 7798 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_20840 8811 7795 gene locus_tag LOCUS_20850 8811 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 9554 8832 gene locus_tag LOCUS_20860 9554 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_20860 10579 9557 gene locus_tag LOCUS_20870 gene waaC 10579 9557 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_20870 11100 10621 gene locus_tag LOCUS_20880 gene chpC 11100 10621 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_20880 12145 11075 gene locus_tag LOCUS_20890 gene chpB 12145 11075 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_20890 <18192 12147 gene locus_tag LOCUS_20900 <18192 12147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein >Feature sequence071 42 117 gene locus_tag LOCUS_t00200 42 117 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 169 244 gene locus_tag LOCUS_t00210 169 244 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 369 938 gene locus_tag LOCUS_20910 369 938 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_20910 935 1942 gene locus_tag LOCUS_20920 935 1942 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706039.1 protein_id gnl|my_center|LOCUS_20920 1963 2730 gene locus_tag LOCUS_20930 gene kdsB 1963 2730 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_20930 3478 2825 gene locus_tag LOCUS_20940 3478 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3691 7266 gene locus_tag LOCUS_20950 gene recC 3691 7266 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP4 protein_id gnl|my_center|LOCUS_20950 7266 11333 gene locus_tag LOCUS_20960 gene recB 7266 11333 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLR2 protein_id gnl|my_center|LOCUS_20960 11330 13420 gene locus_tag LOCUS_20970 gene recD 11330 13420 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CA2 protein_id gnl|my_center|LOCUS_20970 13417 16758 gene locus_tag LOCUS_20980 13417 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 16983 17687 gene locus_tag LOCUS_20990 16983 17687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence072 769 488 gene locus_tag LOCUS_21000 769 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1008 793 gene locus_tag LOCUS_21010 1008 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2620 1073 gene locus_tag LOCUS_21020 2620 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3621 2761 gene locus_tag LOCUS_21030 gene btuF 3621 2761 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_21030 4217 3618 gene locus_tag LOCUS_21040 4217 3618 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_21040 5855 4302 gene locus_tag LOCUS_21050 gene cobQ 5855 4302 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLL6 protein_id gnl|my_center|LOCUS_21050 6487 5858 gene locus_tag LOCUS_21060 6487 5858 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480583.1 protein_id gnl|my_center|LOCUS_21060 7107 6484 gene locus_tag LOCUS_21070 gene cobU 7107 6484 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215857.1 protein_id gnl|my_center|LOCUS_21070 7937 7104 gene locus_tag LOCUS_21080 gene cobS 7937 7104 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q45 protein_id gnl|my_center|LOCUS_21080 9039 7930 gene locus_tag LOCUS_21090 gene cobT 9039 7930 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q46 protein_id gnl|my_center|LOCUS_21090 10122 9076 gene locus_tag LOCUS_21100 gene btuC 10122 9076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_21100 11012 10119 gene locus_tag LOCUS_21110 gene btuD 11012 10119 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_21110 11884 11426 gene locus_tag LOCUS_21120 11884 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 13029 11881 gene locus_tag LOCUS_21130 13029 11881 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 protein_id gnl|my_center|LOCUS_21130 13245 14759 gene locus_tag LOCUS_21140 13245 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 14763 15380 gene locus_tag LOCUS_21150 14763 15380 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_21150 16173 15364 gene locus_tag LOCUS_21160 16173 15364 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888042.1 protein_id gnl|my_center|LOCUS_21160 16601 16170 gene locus_tag LOCUS_21170 16601 16170 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_21170 17139 16687 gene locus_tag LOCUS_21180 17139 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093139.1 protein_id gnl|my_center|LOCUS_21180 <17810 17169 gene locus_tag LOCUS_21190 <17810 17169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102517.1:AMP-binding protein >Feature sequence073 350 93 gene locus_tag LOCUS_21200 350 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1048 302 gene locus_tag LOCUS_21210 gene ccmC 1048 302 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_21210 1729 1061 gene locus_tag LOCUS_21220 gene ccmB 1729 1061 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_21220 2430 1726 gene locus_tag LOCUS_21230 gene ccmA 2430 1726 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_21230 3200 2523 gene locus_tag LOCUS_21240 3200 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3532 4926 gene locus_tag LOCUS_21250 gene hemN 3532 4926 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_21250 5039 5470 gene locus_tag LOCUS_21260 5039 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 5654 6481 gene locus_tag LOCUS_21270 5654 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_21270 7665 6727 gene locus_tag LOCUS_21280 7665 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7842 8198 gene locus_tag LOCUS_21290 7842 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8259 9470 gene locus_tag LOCUS_21300 gene ackA 8259 9470 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED55 protein_id gnl|my_center|LOCUS_21300 9467 11533 gene locus_tag LOCUS_21310 gene pta 9467 11533 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_21310 11632 12525 gene locus_tag LOCUS_21320 11632 12525 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_21320 12647 13594 gene locus_tag LOCUS_21330 gene cysK 12647 13594 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3K8 protein_id gnl|my_center|LOCUS_21330 13803 14309 gene locus_tag LOCUS_21340 13803 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 14729 14355 gene locus_tag LOCUS_21350 14729 14355 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_21350 15212 14778 gene locus_tag LOCUS_21360 gene dtd 15212 14778 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNJ7 protein_id gnl|my_center|LOCUS_21360 15271 15939 gene locus_tag LOCUS_21370 15271 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 16146 17228 gene locus_tag LOCUS_21380 16146 17228 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence074 1612 1292 gene locus_tag LOCUS_21390 gene glpE 1612 1292 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U8 protein_id gnl|my_center|LOCUS_21390 2470 1655 gene locus_tag LOCUS_21400 gene apaH 2470 1655 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF6 protein_id gnl|my_center|LOCUS_21400 2868 2491 gene locus_tag LOCUS_21410 gene apaG 2868 2491 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_21410 3688 2855 gene locus_tag LOCUS_21420 gene rsmA 3688 2855 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_21420 4682 3699 gene locus_tag LOCUS_21430 gene pdxA1 4682 3699 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58715 protein_id gnl|my_center|LOCUS_21430 5959 4679 gene locus_tag LOCUS_21440 gene surA 5959 4679 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_21440 8210 5949 gene locus_tag LOCUS_21450 gene lptD 8210 5949 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A43 protein_id gnl|my_center|LOCUS_21450 8608 9627 gene locus_tag LOCUS_21460 8608 9627 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_21460 9624 10358 gene locus_tag LOCUS_21470 9624 10358 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_21470 10362 11153 gene locus_tag LOCUS_21480 gene djlA 10362 11153 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_21480 11578 11147 gene locus_tag LOCUS_21490 11578 11147 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_21490 11741 12043 gene locus_tag LOCUS_21500 gene yhbQ 11741 12043 CDS product UPF0213 protein YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67350 protein_id gnl|my_center|LOCUS_21500 12142 12903 gene locus_tag LOCUS_21510 12142 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 12932 13825 gene locus_tag LOCUS_21520 12932 13825 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 protein_id gnl|my_center|LOCUS_21520 13825 15729 gene locus_tag LOCUS_21530 gene xcpQ 13825 15729 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_21530 16143 17603 gene locus_tag LOCUS_21540 gene davD 16143 17603 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_21540 >Feature sequence075 <1 687 gene locus_tag LOCUS_21550 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081423274.1:restriction endonuclease subunit S 702 1247 gene locus_tag LOCUS_21560 702 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1279 1560 gene locus_tag LOCUS_21570 gene tnp 1279 1560 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974622.1 protein_id gnl|my_center|LOCUS_21570 1713 2420 gene locus_tag LOCUS_21580 1713 2420 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095140.1 protein_id gnl|my_center|LOCUS_21580 2501 3613 gene locus_tag LOCUS_21590 2501 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 5086 5937 gene locus_tag LOCUS_21600 5086 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6835 5945 gene locus_tag LOCUS_21610 6835 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 8314 6866 gene locus_tag LOCUS_21620 8314 6866 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074230.1 protein_id gnl|my_center|LOCUS_21620 9815 8385 gene locus_tag LOCUS_21630 9815 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 9919 10431 gene locus_tag LOCUS_21640 9919 10431 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_21640 10428 11063 gene locus_tag LOCUS_21650 10428 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11316 11606 gene locus_tag LOCUS_21660 11316 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21660 11666 12457 gene locus_tag LOCUS_21670 11666 12457 CDS product ISSod1, transposase OrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_720421.1 protein_id gnl|my_center|LOCUS_21670 13498 14127 gene locus_tag LOCUS_21680 13498 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21680 14137 14598 gene locus_tag LOCUS_21690 14137 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21690 14829 16016 gene locus_tag LOCUS_21700 14829 16016 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_21700 16245 17039 gene locus_tag LOCUS_21710 16245 17039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence076 321 794 gene locus_tag LOCUS_21720 321 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_21720 2131 809 gene locus_tag LOCUS_21730 2131 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3096 2329 gene locus_tag LOCUS_21740 3096 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3950 3201 gene locus_tag LOCUS_21750 3950 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5725 4052 gene locus_tag LOCUS_21760 5725 4052 CDS product peptide ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 protein_id gnl|my_center|LOCUS_21760 7176 5737 gene locus_tag LOCUS_21770 7176 5737 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_21770 8164 7187 gene locus_tag LOCUS_21780 gene oppB 8164 7187 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_21780 10401 8164 gene locus_tag LOCUS_21790 gene hbpA 10401 8164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_21790 10870 10700 gene locus_tag LOCUS_21800 10870 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10845 12266 gene locus_tag LOCUS_21810 10845 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 13159 12278 gene locus_tag LOCUS_21820 13159 12278 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_21820 13324 14235 gene locus_tag LOCUS_21830 gene menA 13324 14235 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFQ9 protein_id gnl|my_center|LOCUS_21830 14319 14894 gene locus_tag LOCUS_21840 14319 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 15268 15005 gene locus_tag LOCUS_21850 15268 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 16150 15446 gene locus_tag LOCUS_21860 16150 15446 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_21860 16564 16154 gene locus_tag LOCUS_21870 16564 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 17264 16638 gene locus_tag LOCUS_21880 gene eraR 17264 16638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence077 <1 786 gene locus_tag LOCUS_21890 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002555108.1:rod shape-determining protein 946 1734 gene locus_tag LOCUS_21900 946 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1731 2207 gene locus_tag LOCUS_21910 gene mreD 1731 2207 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BN4 protein_id gnl|my_center|LOCUS_21910 2204 2803 gene locus_tag LOCUS_21920 2204 2803 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_21920 2813 4264 gene locus_tag LOCUS_21930 gene cafA 2813 4264 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_21930 4274 8368 gene locus_tag LOCUS_21940 4274 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 8378 9187 gene locus_tag LOCUS_21950 8378 9187 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 protein_id gnl|my_center|LOCUS_21950 11039 9210 gene locus_tag LOCUS_21960 gene dsbD 11039 9210 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN44 protein_id gnl|my_center|LOCUS_21960 12115 11147 gene locus_tag LOCUS_21970 gene ispB 12115 11147 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_21970 12476 12787 gene locus_tag LOCUS_21980 gene rplU 12476 12787 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_21980 12880 13140 gene locus_tag LOCUS_21990 gene rpmA 12880 13140 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU3 protein_id gnl|my_center|LOCUS_21990 13231 14424 gene locus_tag LOCUS_22000 gene obg 13231 14424 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_22000 14433 15569 gene locus_tag LOCUS_22010 gene proB 14433 15569 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_22010 15655 16494 gene locus_tag LOCUS_22020 gene kdsA 15655 16494 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_22020 >Feature sequence078 <1 845 gene locus_tag LOCUS_22030 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003163304.1:motility protein FimV 849 1673 gene locus_tag LOCUS_22040 gene truA 849 1673 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD27 protein_id gnl|my_center|LOCUS_22040 1716 2354 gene locus_tag LOCUS_22050 gene trpF 1716 2354 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_22050 2347 3561 gene locus_tag LOCUS_22060 gene trpB 2347 3561 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_22060 3652 4455 gene locus_tag LOCUS_22070 gene trpA 3652 4455 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_22070 4455 5780 gene locus_tag LOCUS_22080 gene folC 4455 5780 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z501 protein_id gnl|my_center|LOCUS_22080 5765 6523 gene locus_tag LOCUS_22090 5765 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 6677 7171 gene locus_tag LOCUS_22100 6677 7171 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770588.1 protein_id gnl|my_center|LOCUS_22100 7199 8719 gene locus_tag LOCUS_22110 gene purF 7199 8719 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_22110 8753 9976 gene locus_tag LOCUS_22120 gene metZ 8753 9976 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_22120 10275 11198 gene locus_tag LOCUS_22130 10275 11198 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_22130 11195 12223 gene locus_tag LOCUS_22140 11195 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_22140 12220 14247 gene locus_tag LOCUS_22150 gene tgpA 12220 14247 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_22150 14904 14275 gene locus_tag LOCUS_22160 14904 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 14994 15860 gene locus_tag LOCUS_22170 14994 15860 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence079 188 1516 gene locus_tag LOCUS_22180 188 1516 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_22180 2174 3313 gene locus_tag LOCUS_22190 2174 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4764 3823 gene locus_tag LOCUS_22200 4764 3823 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 protein_id gnl|my_center|LOCUS_22200 5026 6051 gene locus_tag LOCUS_22210 5026 6051 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_22210 6190 6735 gene locus_tag LOCUS_22220 6190 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6746 8068 gene locus_tag LOCUS_22230 6746 8068 CDS product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_22230 8086 8517 gene locus_tag LOCUS_22240 8086 8517 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595959.1 protein_id gnl|my_center|LOCUS_22240 8694 9698 gene locus_tag LOCUS_22250 gene mauG 8694 9698 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_22250 10522 9773 gene locus_tag LOCUS_22260 10522 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_22260 10893 10522 gene locus_tag LOCUS_22270 10893 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 11175 12926 gene locus_tag LOCUS_22280 11175 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 14594 13131 gene locus_tag LOCUS_22290 gene gatB 14594 13131 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_22290 16074 14605 gene locus_tag LOCUS_22300 gene gatA 16074 14605 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_22300 16388 16101 gene locus_tag LOCUS_22310 gene gatC 16388 16101 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_22310 >Feature sequence080 943 362 gene locus_tag LOCUS_22320 943 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1180 2037 gene locus_tag LOCUS_22330 1180 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_22330 2161 2721 gene locus_tag LOCUS_22340 2161 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3436 2777 gene locus_tag LOCUS_22350 3436 2777 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_22350 3685 6042 gene locus_tag LOCUS_22360 3685 6042 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098284.1 protein_id gnl|my_center|LOCUS_22360 6264 7301 gene locus_tag LOCUS_22370 gene pyrC 6264 7301 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_22370 7363 7998 gene locus_tag LOCUS_22380 gene rnt 7363 7998 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP36 protein_id gnl|my_center|LOCUS_22380 8003 8371 gene locus_tag LOCUS_22390 8003 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 protein_id gnl|my_center|LOCUS_22390 8857 8543 gene locus_tag LOCUS_22400 gene nirD-2 8857 8543 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_22400 11432 8871 gene locus_tag LOCUS_22410 gene nirB 11432 8871 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049205.1 protein_id gnl|my_center|LOCUS_22410 11851 11633 gene locus_tag LOCUS_22420 11851 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 12632 15133 gene locus_tag LOCUS_22430 gene narB 12632 15133 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_22430 15320 15622 gene locus_tag LOCUS_22440 15320 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 16286 15639 gene locus_tag LOCUS_22450 16286 15639 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence081 4979 3861 gene locus_tag LOCUS_22460 gene asd-1 4979 3861 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJM5 protein_id gnl|my_center|LOCUS_22460 6071 4992 gene locus_tag LOCUS_22470 gene leuB 6071 4992 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_22470 6773 6129 gene locus_tag LOCUS_22480 gene leuD 6773 6129 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_22480 8210 6789 gene locus_tag LOCUS_22490 gene leuC 8210 6789 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_22490 8449 9324 gene locus_tag LOCUS_22500 8449 9324 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_22500 9392 10324 gene locus_tag LOCUS_22510 gene uspE 9392 10324 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_22510 12333 10450 gene locus_tag LOCUS_22520 12333 10450 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105893.1 protein_id gnl|my_center|LOCUS_22520 13445 12573 gene locus_tag LOCUS_22530 gene sucD 13445 12573 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_22530 14611 13445 gene locus_tag LOCUS_22540 gene sucC 14611 13445 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_22540 <15966 14741 gene locus_tag LOCUS_22550 <15966 14741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q883Z5:dihydrolipoyl dehydrogenase >Feature sequence082 1380 2738 gene locus_tag LOCUS_22560 1380 2738 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_22560 2905 3771 gene locus_tag LOCUS_22570 gene ttcA 2905 3771 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG9 protein_id gnl|my_center|LOCUS_22570 4088 3801 gene locus_tag LOCUS_22580 4088 3801 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889208.1 protein_id gnl|my_center|LOCUS_22580 4329 4078 gene locus_tag LOCUS_22590 4329 4078 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMA1 protein_id gnl|my_center|LOCUS_22590 5675 4428 gene locus_tag LOCUS_22600 5675 4428 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_22600 6349 5798 gene locus_tag LOCUS_22610 6349 5798 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_22610 6765 6352 gene locus_tag LOCUS_22620 6765 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6969 7718 gene locus_tag LOCUS_22630 6969 7718 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_22630 7711 9270 gene locus_tag LOCUS_22640 7711 9270 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_22640 9669 9298 gene locus_tag LOCUS_22650 9669 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 10159 9719 gene locus_tag LOCUS_22660 10159 9719 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011716.1 protein_id gnl|my_center|LOCUS_22660 10797 10369 gene locus_tag LOCUS_22670 10797 10369 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074397.1 protein_id gnl|my_center|LOCUS_22670 11126 10797 gene locus_tag LOCUS_22680 11126 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 protein_id gnl|my_center|LOCUS_22680 11771 11244 gene locus_tag LOCUS_22690 11771 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 12212 12790 gene locus_tag LOCUS_22700 12212 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 14360 12948 gene locus_tag LOCUS_22710 14360 12948 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_22710 <15738 14744 gene locus_tag LOCUS_22720 <15738 14744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106349.1:glutamate synthase >Feature sequence083 2839 1478 gene locus_tag LOCUS_22730 2839 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3131 2943 gene locus_tag LOCUS_22740 3131 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 4515 3742 gene locus_tag LOCUS_22750 gene rlpA 4515 3742 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 protein_id gnl|my_center|LOCUS_22750 5483 4512 gene locus_tag LOCUS_22760 5483 4512 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_22760 6651 5509 gene locus_tag LOCUS_22770 gene rodA 6651 5509 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_22770 8504 6651 gene locus_tag LOCUS_22780 gene pbpA 8504 6651 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_22780 8979 8512 gene locus_tag LOCUS_22790 gene rlmH 8979 8512 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_22790 9332 8976 gene locus_tag LOCUS_22800 gene rsfS 9332 8976 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_22800 9980 9333 gene locus_tag LOCUS_22810 gene nadD 9980 9333 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN51 protein_id gnl|my_center|LOCUS_22810 11236 9980 gene locus_tag LOCUS_22820 gene proA 11236 9980 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_22820 11325 12257 gene locus_tag LOCUS_22830 11325 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 12254 13228 gene locus_tag LOCUS_22840 12254 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 13494 13225 gene locus_tag LOCUS_22850 13494 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 13642 14661 gene locus_tag LOCUS_22860 13642 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_22860 14658 15161 gene locus_tag LOCUS_22870 14658 15161 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL22 protein_id gnl|my_center|LOCUS_22870 15407 15141 gene locus_tag LOCUS_22880 15407 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence084 928 311 gene locus_tag LOCUS_22890 gene rplY 928 311 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_22890 1969 1028 gene locus_tag LOCUS_22900 gene prs 1969 1028 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX2 protein_id gnl|my_center|LOCUS_22900 2090 2016 gene locus_tag LOCUS_t00220 2090 2016 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2963 2094 gene locus_tag LOCUS_22910 gene ispE 2963 2094 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_22910 3540 2956 gene locus_tag LOCUS_22920 3540 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5285 3537 gene locus_tag LOCUS_22930 5285 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_22930 5521 6801 gene locus_tag LOCUS_22940 gene hemA 5521 6801 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_22940 6807 7895 gene locus_tag LOCUS_22950 gene prfA 6807 7895 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN4 protein_id gnl|my_center|LOCUS_22950 7895 8809 gene locus_tag LOCUS_22960 gene prmC 7895 8809 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN3 protein_id gnl|my_center|LOCUS_22960 8809 9567 gene locus_tag LOCUS_22970 gene moeB 8809 9567 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_22970 9513 9737 gene locus_tag LOCUS_22980 9513 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 9866 11140 gene locus_tag LOCUS_22990 gene sqr 9866 11140 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_22990 11809 11225 gene locus_tag LOCUS_23000 gene gmhA 11809 11225 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_23000 12249 11860 gene locus_tag LOCUS_23010 12249 11860 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SH5 protein_id gnl|my_center|LOCUS_23010 14120 12318 gene locus_tag LOCUS_23020 14120 12318 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_23020 14179 15021 gene locus_tag LOCUS_23030 gene rsmI 14179 15021 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ3 protein_id gnl|my_center|LOCUS_23030 >Feature sequence085 185 99 gene locus_tag LOCUS_t00230 185 99 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 328 242 gene locus_tag LOCUS_t00240 328 242 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 521 1597 gene locus_tag LOCUS_23040 gene queA 521 1597 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_23040 1604 2743 gene locus_tag LOCUS_23050 gene tgt 1604 2743 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_23050 2813 3172 gene locus_tag LOCUS_23060 2813 3172 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_23060 3214 5106 gene locus_tag LOCUS_23070 gene secD 3214 5106 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX41 protein_id gnl|my_center|LOCUS_23070 5106 6020 gene locus_tag LOCUS_23080 gene secF 5106 6020 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D5 protein_id gnl|my_center|LOCUS_23080 6129 6995 gene locus_tag LOCUS_23090 gene rlmJ 6129 6995 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGN2 protein_id gnl|my_center|LOCUS_23090 7920 7021 gene locus_tag LOCUS_23100 7920 7021 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_23100 8028 8753 gene locus_tag LOCUS_23110 gene yccA 8028 8753 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375134.1 protein_id gnl|my_center|LOCUS_23110 8944 9591 gene locus_tag LOCUS_23120 8944 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_23120 9711 10247 gene locus_tag LOCUS_23130 9711 10247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106004.1 protein_id gnl|my_center|LOCUS_23130 10478 12046 gene locus_tag LOCUS_23140 10478 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 14707 12074 gene locus_tag LOCUS_23150 gene hrpB 14707 12074 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_23150 14835 15035 gene locus_tag LOCUS_23160 14835 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence086 2677 299 gene locus_tag LOCUS_23170 2677 299 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN9 protein_id gnl|my_center|LOCUS_23170 2956 3774 gene locus_tag LOCUS_23180 2956 3774 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_23180 4680 3793 gene locus_tag LOCUS_23190 4680 3793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_23190 4907 6241 gene locus_tag LOCUS_23200 4907 6241 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 protein_id gnl|my_center|LOCUS_23200 7351 6263 gene locus_tag LOCUS_23210 7351 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 8940 8464 gene locus_tag LOCUS_23220 8940 8464 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR1 protein_id gnl|my_center|LOCUS_23220 9791 9048 gene locus_tag LOCUS_23230 9791 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_23230 10598 9882 gene locus_tag LOCUS_23240 gene arsH 10598 9882 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_23240 11004 10696 gene locus_tag LOCUS_23250 11004 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 11439 11095 gene locus_tag LOCUS_23260 11439 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 12160 11489 gene locus_tag LOCUS_23270 gene fabG 12160 11489 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_23270 13472 12249 gene locus_tag LOCUS_23280 gene nqrF 13472 12249 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_23280 14099 13485 gene locus_tag LOCUS_23290 gene nqrE 14099 13485 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_23290 14761 14099 gene locus_tag LOCUS_23300 gene nqrD 14761 14099 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_23300 >Feature sequence087 <1 1288 gene locus_tag LOCUS_23310 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q500M3:ATP-dependent DNA helicase Rep 1570 1313 gene locus_tag LOCUS_23320 1570 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1926 2669 gene locus_tag LOCUS_23330 1926 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2750 3088 gene locus_tag LOCUS_23340 gene glnK 2750 3088 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_23340 3146 4417 gene locus_tag LOCUS_23350 3146 4417 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_23350 4653 5132 gene locus_tag LOCUS_23360 4653 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_23360 5398 5204 gene locus_tag LOCUS_23370 5398 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6419 5541 gene locus_tag LOCUS_23380 6419 5541 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 protein_id gnl|my_center|LOCUS_23380 6561 8729 gene locus_tag LOCUS_23390 gene uvrD 6561 8729 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_23390 9236 8829 gene locus_tag LOCUS_23400 9236 8829 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535335.1 protein_id gnl|my_center|LOCUS_23400 9509 10516 gene locus_tag LOCUS_23410 9509 10516 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_23410 10634 12007 gene locus_tag LOCUS_23420 10634 12007 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_23420 12000 13277 gene locus_tag LOCUS_23430 12000 13277 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_23430 13302 14105 gene locus_tag LOCUS_23440 gene pstB 13302 14105 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_23440 14128 14847 gene locus_tag LOCUS_23450 gene phoU 14128 14847 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_23450 >Feature sequence088 707 892 gene locus_tag LOCUS_23460 707 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 919 2850 gene locus_tag LOCUS_23470 gene thiC 919 2850 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_23470 2851 3930 gene locus_tag LOCUS_23480 gene thiO 2851 3930 CDS product thiamine biosynthesis oxidoreductase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205267.1 protein_id gnl|my_center|LOCUS_23480 3927 4154 gene locus_tag LOCUS_23490 3927 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4156 5034 gene locus_tag LOCUS_23500 gene thiG 4156 5034 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GC6 protein_id gnl|my_center|LOCUS_23500 5064 6590 gene locus_tag LOCUS_23510 gene thiDE 5064 6590 CDS product phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947297.1 protein_id gnl|my_center|LOCUS_23510 6725 8626 gene locus_tag LOCUS_23520 gene htpG 6725 8626 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_23520 8802 9362 gene locus_tag LOCUS_23530 8802 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 9372 9830 gene locus_tag LOCUS_23540 9372 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 9964 10215 gene locus_tag LOCUS_23550 9964 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 10651 10229 gene locus_tag LOCUS_23560 10651 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 11281 10679 gene locus_tag LOCUS_23570 gene lexA1 11281 10679 CDS product LexA repressor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB9 protein_id gnl|my_center|LOCUS_23570 11587 12228 gene locus_tag LOCUS_23580 gene psrA 11587 12228 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_23580 12249 12773 gene locus_tag LOCUS_23590 12249 12773 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_23590 12758 13837 gene locus_tag LOCUS_23600 gene nagZ 12758 13837 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC2 protein_id gnl|my_center|LOCUS_23600 13856 14605 gene locus_tag LOCUS_23610 13856 14605 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRB0 protein_id gnl|my_center|LOCUS_23610 >Feature sequence089 756 959 gene locus_tag LOCUS_23620 756 959 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_23620 1603 1118 gene locus_tag LOCUS_23630 gene recX 1603 1118 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56647 protein_id gnl|my_center|LOCUS_23630 2624 1584 gene locus_tag LOCUS_23640 gene recA 2624 1584 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_23640 3241 2765 gene locus_tag LOCUS_23650 3241 2765 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947530.1 protein_id gnl|my_center|LOCUS_23650 3432 4319 gene locus_tag LOCUS_23660 3432 4319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705822.1 protein_id gnl|my_center|LOCUS_23660 4516 6603 gene locus_tag LOCUS_23670 4516 6603 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_23670 6628 7896 gene locus_tag LOCUS_23680 6628 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 8381 8647 gene locus_tag LOCUS_23690 8381 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 8672 9946 gene locus_tag LOCUS_23700 8672 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 11373 10018 gene locus_tag LOCUS_23710 11373 10018 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_23710 11731 12108 gene locus_tag LOCUS_23720 11731 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 12086 12598 gene locus_tag LOCUS_23730 12086 12598 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_23730 12602 13054 gene locus_tag LOCUS_23740 12602 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13074 13535 gene locus_tag LOCUS_23750 13074 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 13532 13840 gene locus_tag LOCUS_23760 13532 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 14447 14112 gene locus_tag LOCUS_23770 14447 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence090 377 1702 gene locus_tag LOCUS_23780 gene secY 377 1702 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF5 protein_id gnl|my_center|LOCUS_23780 1942 2298 gene locus_tag LOCUS_23790 gene rpsM 1942 2298 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_23790 2369 2758 gene locus_tag LOCUS_23800 gene rpsK 2369 2758 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_23800 2771 3391 gene locus_tag LOCUS_23810 gene rpsD 2771 3391 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_23810 3413 4414 gene locus_tag LOCUS_23820 gene rpoA 3413 4414 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_23820 4446 4856 gene locus_tag LOCUS_23830 gene rplQ 4446 4856 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_23830 6286 5009 gene locus_tag LOCUS_23840 6286 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 6768 6286 gene locus_tag LOCUS_23850 6768 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 7764 6772 gene locus_tag LOCUS_23860 7764 6772 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_23860 8616 7771 gene locus_tag LOCUS_23870 8616 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 10079 8706 gene locus_tag LOCUS_23880 10079 8706 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_23880 10272 10850 gene locus_tag LOCUS_23890 10272 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10843 11094 gene locus_tag LOCUS_23900 10843 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 11084 12706 gene locus_tag LOCUS_23910 11084 12706 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105771.1 protein_id gnl|my_center|LOCUS_23910 12717 13853 gene locus_tag LOCUS_23920 gene cydB 12717 13853 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 protein_id gnl|my_center|LOCUS_23920 14037 14336 gene locus_tag LOCUS_23930 14037 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence091 247 20 gene locus_tag LOCUS_23940 247 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 700 1902 gene locus_tag LOCUS_23950 gene dcaF 700 1902 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_23950 1929 4031 gene locus_tag LOCUS_23960 1929 4031 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_23960 4062 5063 gene locus_tag LOCUS_23970 4062 5063 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_23970 5132 5893 gene locus_tag LOCUS_23980 gene echH 5132 5893 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_23980 5945 6802 gene locus_tag LOCUS_23990 5945 6802 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_23990 7246 8442 gene locus_tag LOCUS_24000 7246 8442 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_24000 8453 9592 gene locus_tag LOCUS_24010 8453 9592 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_24010 9728 10477 gene locus_tag LOCUS_24020 gene etfB 9728 10477 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_24020 10479 11411 gene locus_tag LOCUS_24030 10479 11411 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_24030 11537 13189 gene locus_tag LOCUS_24040 11537 13189 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_24040 13534 13701 gene locus_tag LOCUS_24050 13534 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence092 <1 1761 gene locus_tag LOCUS_24060 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1N7:translation initiation factor IF-2 2263 3366 gene locus_tag LOCUS_24070 2263 3366 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_24070 3482 6574 gene locus_tag LOCUS_24080 3482 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 8032 6836 gene locus_tag LOCUS_24090 8032 6836 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_24090 10909 8306 gene locus_tag LOCUS_24100 10909 8306 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_24100 12185 11052 gene locus_tag LOCUS_24110 gene prpC 12185 11052 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_24110 13189 12308 gene locus_tag LOCUS_24120 gene prpB 13189 12308 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P70 protein_id gnl|my_center|LOCUS_24120 13854 13186 gene locus_tag LOCUS_24130 13854 13186 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence093 317 898 gene locus_tag LOCUS_24140 317 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1155 1595 gene locus_tag LOCUS_24150 1155 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1592 2209 gene locus_tag LOCUS_24160 1592 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2231 3064 gene locus_tag LOCUS_24170 2231 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 5309 3288 gene locus_tag LOCUS_24180 5309 3288 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_24180 8215 5435 gene locus_tag LOCUS_24190 8215 5435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_24190 8575 9504 gene locus_tag LOCUS_24200 8575 9504 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_24200 9508 10554 gene locus_tag LOCUS_24210 9508 10554 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_24210 10923 12083 gene locus_tag LOCUS_24220 gene wecB 10923 12083 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE3 protein_id gnl|my_center|LOCUS_24220 12124 13371 gene locus_tag LOCUS_24230 gene wecC 12124 13371 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence094 484 560 gene locus_tag LOCUS_t00250 484 560 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1611 571 gene locus_tag LOCUS_24240 1611 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_24240 2911 1922 gene locus_tag LOCUS_24250 2911 1922 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_24250 3944 3036 gene locus_tag LOCUS_24260 3944 3036 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_24260 4085 4624 gene locus_tag LOCUS_24270 4085 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 4810 5697 gene locus_tag LOCUS_24280 4810 5697 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_24280 5821 6705 gene locus_tag LOCUS_24290 5821 6705 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_24290 7054 8310 gene locus_tag LOCUS_24300 gene amtB 7054 8310 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_24300 9738 8389 gene locus_tag LOCUS_24310 gene astB 9738 8389 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJE9 protein_id gnl|my_center|LOCUS_24310 11260 9740 gene locus_tag LOCUS_24320 gene astD 11260 9740 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC68 protein_id gnl|my_center|LOCUS_24320 12347 11271 gene locus_tag LOCUS_24330 gene astA 12347 11271 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZR0 protein_id gnl|my_center|LOCUS_24330 13606 12326 gene locus_tag LOCUS_24340 13606 12326 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_24340 14019 14429 gene locus_tag LOCUS_24350 14019 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence095 235 3456 gene locus_tag LOCUS_24360 gene carB 235 3456 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_24360 3550 4026 gene locus_tag LOCUS_24370 gene greA 3550 4026 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_24370 4653 4105 gene locus_tag LOCUS_24380 4653 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 5855 4986 gene locus_tag LOCUS_24390 5855 4986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123045.1 protein_id gnl|my_center|LOCUS_24390 6412 5870 gene locus_tag LOCUS_24400 6412 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 protein_id gnl|my_center|LOCUS_24400 7107 6454 gene locus_tag LOCUS_24410 7107 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 protein_id gnl|my_center|LOCUS_24410 9288 7147 gene locus_tag LOCUS_24420 9288 7147 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_24420 9371 10423 gene locus_tag LOCUS_24430 9371 10423 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106318.1 protein_id gnl|my_center|LOCUS_24430 12405 10690 gene locus_tag LOCUS_24440 gene mphR 12405 10690 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_24440 12772 13206 gene locus_tag LOCUS_24450 12772 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 13268 14191 gene locus_tag LOCUS_24460 13268 14191 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence096 409 143 gene locus_tag LOCUS_24470 409 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 589 1497 gene locus_tag LOCUS_24480 589 1497 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_24480 2342 1515 gene locus_tag LOCUS_24490 2342 1515 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619831.1 protein_id gnl|my_center|LOCUS_24490 2584 3180 gene locus_tag LOCUS_24500 2584 3180 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_24500 3438 4529 gene locus_tag LOCUS_24510 3438 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4522 6741 gene locus_tag LOCUS_24520 4522 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6741 7808 gene locus_tag LOCUS_24530 6741 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 8641 7973 gene locus_tag LOCUS_24540 8641 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_24540 9089 11806 gene locus_tag LOCUS_24550 gene acnA 9089 11806 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2F7 protein_id gnl|my_center|LOCUS_24550 13367 11958 gene locus_tag LOCUS_24560 13367 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence097 1204 179 gene locus_tag LOCUS_24570 gene rsgA 1204 179 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_24570 1315 1863 gene locus_tag LOCUS_24580 gene orn 1315 1863 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_24580 1915 2145 gene locus_tag LOCUS_24590 1915 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2453 2875 gene locus_tag LOCUS_24600 2453 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2882 3871 gene locus_tag LOCUS_24610 2882 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3861 5483 gene locus_tag LOCUS_24620 3861 5483 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_24620 5464 8640 gene locus_tag LOCUS_24630 gene cusA 5464 8640 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_24630 8653 9273 gene locus_tag LOCUS_24640 8653 9273 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148830.1 protein_id gnl|my_center|LOCUS_24640 9408 10109 gene locus_tag LOCUS_24650 9408 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 10136 10654 gene locus_tag LOCUS_24660 10136 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_24660 10755 11435 gene locus_tag LOCUS_24670 10755 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_24670 11437 12063 gene locus_tag LOCUS_24680 11437 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 12060 12575 gene locus_tag LOCUS_24690 12060 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 12578 13339 gene locus_tag LOCUS_24700 12578 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence098 3015 1774 gene locus_tag LOCUS_24710 3015 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3644 3012 gene locus_tag LOCUS_24720 3644 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5307 3637 gene locus_tag LOCUS_24730 5307 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6194 5304 gene locus_tag LOCUS_24740 6194 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 7627 6332 gene locus_tag LOCUS_24750 gene wgeD 7627 6332 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975737.1 protein_id gnl|my_center|LOCUS_24750 8526 7624 gene locus_tag LOCUS_24760 8526 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 8848 8669 gene locus_tag LOCUS_24770 8848 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 10160 8859 gene locus_tag LOCUS_24780 10160 8859 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704236.1 protein_id gnl|my_center|LOCUS_24780 12646 10157 gene locus_tag LOCUS_24790 12646 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 13466 12870 gene locus_tag LOCUS_24800 13466 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence099 376 1773 gene locus_tag LOCUS_24810 376 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_24810 2006 2290 gene locus_tag LOCUS_24820 gene rpsP 2006 2290 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_24820 2302 2844 gene locus_tag LOCUS_24830 gene rimM 2302 2844 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_24830 2864 3637 gene locus_tag LOCUS_24840 gene trmD 2864 3637 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG25 protein_id gnl|my_center|LOCUS_24840 3648 4001 gene locus_tag LOCUS_24850 gene rplS 3648 4001 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_24850 4237 5100 gene locus_tag LOCUS_24860 4237 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 6841 6026 gene locus_tag LOCUS_24870 gene truC 6841 6026 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD4 protein_id gnl|my_center|LOCUS_24870 6947 9799 gene locus_tag LOCUS_24880 6947 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 9939 11513 gene locus_tag LOCUS_24890 9939 11513 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364240.1 protein_id gnl|my_center|LOCUS_24890 11854 12720 gene locus_tag LOCUS_24900 11854 12720 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967912.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence100 656 162 gene locus_tag LOCUS_24910 gene ilvH 656 162 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_24910 2383 659 gene locus_tag LOCUS_24920 gene ilvB 2383 659 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N6 protein_id gnl|my_center|LOCUS_24920 2753 3223 gene locus_tag LOCUS_24930 2753 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_24930 3660 3226 gene locus_tag LOCUS_24940 3660 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3902 3642 gene locus_tag LOCUS_24950 3902 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4903 3938 gene locus_tag LOCUS_24960 gene rluD 4903 3938 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_24960 5049 5873 gene locus_tag LOCUS_24970 gene bamD 5049 5873 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_24970 7601 5973 gene locus_tag LOCUS_24980 gene nadE 7601 5973 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_24980 7698 9236 gene locus_tag LOCUS_24990 gene pilS 7698 9236 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_24990 9239 10594 gene locus_tag LOCUS_25000 gene pilR 9239 10594 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_25000 10679 11263 gene locus_tag LOCUS_25010 10679 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 11353 11916 gene locus_tag LOCUS_25020 11353 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 12111 11941 gene locus_tag LOCUS_25030 12111 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence101 1082 126 gene locus_tag LOCUS_25040 1082 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2941 1184 gene locus_tag LOCUS_25050 gene fan1 2941 1184 CDS product Fanconi-associated nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N0 protein_id gnl|my_center|LOCUS_25050 5756 2928 gene locus_tag LOCUS_25060 5756 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 8043 6046 gene locus_tag LOCUS_25070 8043 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 8693 8259 gene locus_tag LOCUS_25080 8693 8259 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_25080 9927 8977 gene locus_tag LOCUS_25090 9927 8977 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_25090 10626 9931 gene locus_tag LOCUS_25100 10626 9931 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_25100 10691 11434 gene locus_tag LOCUS_25110 10691 11434 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_25110 11497 12357 gene locus_tag LOCUS_25120 11497 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence102 682 305 gene locus_tag LOCUS_25130 682 305 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_25130 961 1812 gene locus_tag LOCUS_25140 961 1812 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_25140 2480 1902 gene locus_tag LOCUS_25150 2480 1902 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_25150 4011 2632 gene locus_tag LOCUS_25160 4011 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_25160 5078 4167 gene locus_tag LOCUS_25170 5078 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 5134 5727 gene locus_tag LOCUS_25180 5134 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 5731 6762 gene locus_tag LOCUS_25190 5731 6762 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_25190 6926 7891 gene locus_tag LOCUS_25200 6926 7891 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q99 protein_id gnl|my_center|LOCUS_25200 8148 8444 gene locus_tag LOCUS_25210 8148 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_25210 8437 8655 gene locus_tag LOCUS_25220 8437 8655 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_25220 8752 9105 gene locus_tag LOCUS_25230 8752 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 9613 10455 gene locus_tag LOCUS_25240 9613 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755976.1 protein_id gnl|my_center|LOCUS_25240 10498 10830 gene locus_tag LOCUS_25250 10498 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 11881 10904 gene locus_tag LOCUS_25260 11881 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550739.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence103 <1 547 gene locus_tag LOCUS_25270 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103012.1:long-chain-fatty-acid--CoA ligase 1812 616 gene locus_tag LOCUS_25280 1812 616 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_25280 2214 1891 gene locus_tag LOCUS_25290 2214 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2426 2244 gene locus_tag LOCUS_25300 2426 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 5281 2573 gene locus_tag LOCUS_25310 5281 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 5489 6925 gene locus_tag LOCUS_25320 gene cpeA 5489 6925 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74V83 protein_id gnl|my_center|LOCUS_25320 7801 6953 gene locus_tag LOCUS_25330 7801 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 8007 8471 gene locus_tag LOCUS_25340 8007 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 8587 9681 gene locus_tag LOCUS_25350 8587 9681 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_25350 9696 9950 gene locus_tag LOCUS_25360 gene tusA 9696 9950 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_25360 9974 10426 gene locus_tag LOCUS_25370 9974 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468055.1 protein_id gnl|my_center|LOCUS_25370 10861 10445 gene locus_tag LOCUS_25380 10861 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 11096 12388 gene locus_tag LOCUS_25390 11096 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence104 993 247 gene locus_tag LOCUS_25400 gene phaB 993 247 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946794.1 protein_id gnl|my_center|LOCUS_25400 1458 2915 gene locus_tag LOCUS_25410 gene thiI 1458 2915 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_25410 4395 3004 gene locus_tag LOCUS_25420 gene sthA 4395 3004 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_25420 4788 4555 gene locus_tag LOCUS_25430 4788 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5760 4804 gene locus_tag LOCUS_25440 gene apbE 5760 4804 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ0 protein_id gnl|my_center|LOCUS_25440 6225 6557 gene locus_tag LOCUS_25450 6225 6557 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_25450 7559 6597 gene locus_tag LOCUS_25460 7559 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 8543 7605 gene locus_tag LOCUS_25470 8543 7605 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072569.1 protein_id gnl|my_center|LOCUS_25470 8647 8985 gene locus_tag LOCUS_25480 8647 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 8985 10082 gene locus_tag LOCUS_25490 gene rlmG 8985 10082 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WA9 protein_id gnl|my_center|LOCUS_25490 10079 10588 gene locus_tag LOCUS_25500 10079 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 10676 11992 gene locus_tag LOCUS_25510 gene yegQ 10676 11992 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence105 317 3283 gene locus_tag LOCUS_25520 317 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 4290 3559 gene locus_tag LOCUS_25530 4290 3559 CDS product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200476.1 protein_id gnl|my_center|LOCUS_25530 4550 6925 gene locus_tag LOCUS_25540 gene fhuA 4550 6925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_25540 7159 8829 gene locus_tag LOCUS_25550 7159 8829 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_25550 9007 10638 gene locus_tag LOCUS_25560 gene phoA 9007 10638 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_25560 10631 12304 gene locus_tag LOCUS_25570 gene phoA 10631 12304 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence106 1260 109 gene locus_tag LOCUS_25580 1260 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2539 1577 gene locus_tag LOCUS_25590 2539 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2625 2987 gene locus_tag LOCUS_25600 2625 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3027 4250 gene locus_tag LOCUS_25610 3027 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4599 4345 gene locus_tag LOCUS_25620 4599 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 5128 5394 gene locus_tag LOCUS_25630 5128 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 5515 5820 gene locus_tag LOCUS_25640 5515 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 5831 6655 gene locus_tag LOCUS_25650 gene betA 5831 6655 CDS product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764962.1 protein_id gnl|my_center|LOCUS_25650 6719 7753 gene locus_tag LOCUS_25660 6719 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 7874 8929 gene locus_tag LOCUS_25670 7874 8929 CDS product cobalamin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939317.1 protein_id gnl|my_center|LOCUS_25670 8939 9772 gene locus_tag LOCUS_25680 8939 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 9898 10887 gene locus_tag LOCUS_25690 9898 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939321.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence107 2414 303 gene locus_tag LOCUS_25700 gene pilQ 2414 303 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_25700 2965 2417 gene locus_tag LOCUS_25710 gene pilP 2965 2417 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_25710 3602 2952 gene locus_tag LOCUS_25720 gene pilO 3602 2952 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_25720 4170 3604 gene locus_tag LOCUS_25730 gene pilN 4170 3604 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_25730 5266 4163 gene locus_tag LOCUS_25740 gene pilM 5266 4163 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_25740 5385 7862 gene locus_tag LOCUS_25750 5385 7862 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 protein_id gnl|my_center|LOCUS_25750 9442 7937 gene locus_tag LOCUS_25760 9442 7937 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_25760 9552 10781 gene locus_tag LOCUS_25770 gene serA 9552 10781 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_25770 11620 10856 gene locus_tag LOCUS_25780 gene hisF 11620 10856 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_25780 <12297 11623 gene locus_tag LOCUS_25790 <12297 11623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU43:1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase >Feature sequence108 3288 97 gene locus_tag LOCUS_25800 gene czcA 3288 97 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_25800 4376 3285 gene locus_tag LOCUS_25810 4376 3285 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957780.1 protein_id gnl|my_center|LOCUS_25810 5962 4496 gene locus_tag LOCUS_25820 gene opmQ 5962 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_25820 6790 6227 gene locus_tag LOCUS_25830 6790 6227 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_25830 7296 8426 gene locus_tag LOCUS_25840 gene dapE 7296 8426 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU0 protein_id gnl|my_center|LOCUS_25840 8423 9373 gene locus_tag LOCUS_25850 8423 9373 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_25850 9370 9810 gene locus_tag LOCUS_25860 gene holC 9370 9810 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_25860 9807 10664 gene locus_tag LOCUS_25870 9807 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence109 <1 2605 gene locus_tag LOCUS_25880 <1 2605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206955.1:peptidase M16 2666 3112 gene locus_tag LOCUS_25890 2666 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3231 4238 gene locus_tag LOCUS_25900 3231 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_25900 4235 7528 gene locus_tag LOCUS_25910 4235 7528 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_25910 7898 9289 gene locus_tag LOCUS_25920 7898 9289 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_25920 9289 10278 gene locus_tag LOCUS_25930 9289 10278 CDS product CRISPR type I-F system protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 protein_id gnl|my_center|LOCUS_25930 10290 11339 gene locus_tag LOCUS_25940 10290 11339 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_25940 11343 11897 gene locus_tag LOCUS_25950 11343 11897 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_25950 12026 12173 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcgctgccgcacaggcagctcagaaa >Feature sequence110 3956 2745 gene locus_tag LOCUS_25960 gene fabB 3956 2745 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_25960 4926 4153 gene locus_tag LOCUS_25970 4926 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 6596 4923 gene locus_tag LOCUS_25980 6596 4923 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_25980 7678 6596 gene locus_tag LOCUS_25990 7678 6596 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969005.1 protein_id gnl|my_center|LOCUS_25990 8734 7784 gene locus_tag LOCUS_26000 8734 7784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707380.1 protein_id gnl|my_center|LOCUS_26000 8918 9946 gene locus_tag LOCUS_26010 gene waaC 8918 9946 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244577.1 protein_id gnl|my_center|LOCUS_26010 10064 10897 gene locus_tag LOCUS_26020 10064 10897 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268341.1 protein_id gnl|my_center|LOCUS_26020 11791 10907 gene locus_tag LOCUS_26030 11791 10907 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence111 1248 181 gene locus_tag LOCUS_26040 1248 181 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_26040 1628 1335 gene locus_tag LOCUS_26050 1628 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3563 2658 gene locus_tag LOCUS_26060 3563 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4431 3721 gene locus_tag LOCUS_26070 4431 3721 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200084.1 protein_id gnl|my_center|LOCUS_26070 5332 4466 gene locus_tag LOCUS_26080 5332 4466 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067627.1 protein_id gnl|my_center|LOCUS_26080 5624 6586 gene locus_tag LOCUS_26090 5624 6586 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_26090 6616 7470 gene locus_tag LOCUS_26100 6616 7470 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIL3 protein_id gnl|my_center|LOCUS_26100 7463 8683 gene locus_tag LOCUS_26110 7463 8683 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_26110 10502 8772 gene locus_tag LOCUS_26120 10502 8772 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_26120 10975 11802 gene locus_tag LOCUS_26130 gene galU 10975 11802 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880P1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence112 <1 584 gene locus_tag LOCUS_26140 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389192.1:DNA-directed RNA polymerase sigma-70 factor 588 1661 gene locus_tag LOCUS_26150 588 1661 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 protein_id gnl|my_center|LOCUS_26150 1712 4633 gene locus_tag LOCUS_26160 gene iroN 1712 4633 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_26160 4800 7067 gene locus_tag LOCUS_26170 4800 7067 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973965.1 protein_id gnl|my_center|LOCUS_26170 8039 7167 gene locus_tag LOCUS_26180 8039 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8469 8032 gene locus_tag LOCUS_26190 8469 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 8677 9648 gene locus_tag LOCUS_26200 gene ywcH 8677 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_26200 10109 9678 gene locus_tag LOCUS_26210 10109 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 10489 10692 gene locus_tag LOCUS_26220 10489 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 10765 10923 gene locus_tag LOCUS_26230 10765 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 11393 11956 gene locus_tag LOCUS_26240 11393 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence113 539 249 gene locus_tag LOCUS_26250 539 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2164 722 gene locus_tag LOCUS_26260 gene rhlE 2164 722 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J63 protein_id gnl|my_center|LOCUS_26260 2636 4021 gene locus_tag LOCUS_26270 2636 4021 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_26270 4240 5244 gene locus_tag LOCUS_26280 4240 5244 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_26280 5280 6119 gene locus_tag LOCUS_26290 5280 6119 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_26290 6257 7423 gene locus_tag LOCUS_26300 6257 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_26300 7586 8860 gene locus_tag LOCUS_26310 7586 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 8984 9658 gene locus_tag LOCUS_26320 8984 9658 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_26320 9666 10871 gene locus_tag LOCUS_26330 9666 10871 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_26330 11284 10892 gene locus_tag LOCUS_26340 11284 10892 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence114 260 75 gene locus_tag LOCUS_26350 260 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1138 383 gene locus_tag LOCUS_26360 gene hupC 1138 383 CDS product putative Ni/Fe-hydrogenase B-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21960 protein_id gnl|my_center|LOCUS_26360 2993 1185 gene locus_tag LOCUS_26370 gene hupL 2993 1185 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_26370 4084 2990 gene locus_tag LOCUS_26380 gene hupA 4084 2990 CDS product uptake hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12635 protein_id gnl|my_center|LOCUS_26380 4472 4897 gene locus_tag LOCUS_26390 4472 4897 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316399.1 protein_id gnl|my_center|LOCUS_26390 5038 5307 gene locus_tag LOCUS_26400 5038 5307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_26400 5314 6198 gene locus_tag LOCUS_26410 5314 6198 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_26410 6179 6766 gene locus_tag LOCUS_26420 6179 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6763 7275 gene locus_tag LOCUS_26430 6763 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 7272 7970 gene locus_tag LOCUS_26440 7272 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 8138 9154 gene locus_tag LOCUS_26450 8138 9154 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_26450 9857 9198 gene locus_tag LOCUS_26460 9857 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10528 10187 gene locus_tag LOCUS_26470 10528 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 <11720 10683 gene locus_tag LOCUS_26480 <11720 10683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P13794:outer membrane porin F >Feature sequence115 <1 707 gene locus_tag LOCUS_26490 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316247.1:PrkA family serine protein kinase 774 2057 gene locus_tag LOCUS_26500 774 2057 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V0 protein_id gnl|my_center|LOCUS_26500 2054 3553 gene locus_tag LOCUS_26510 2054 3553 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_26510 4564 3626 gene locus_tag LOCUS_26520 gene pagO 4564 3626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_26520 4976 6592 gene locus_tag LOCUS_26530 4976 6592 CDS product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_26530 6684 7958 gene locus_tag LOCUS_26540 gene cca 6684 7958 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZI64 protein_id gnl|my_center|LOCUS_26540 8499 7960 gene locus_tag LOCUS_26550 gene folK 8499 7960 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 protein_id gnl|my_center|LOCUS_26550 8854 8501 gene locus_tag LOCUS_26560 gene folB 8854 8501 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD5 protein_id gnl|my_center|LOCUS_26560 9888 8854 gene locus_tag LOCUS_26570 gene tsaD 9888 8854 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL5 protein_id gnl|my_center|LOCUS_26570 10074 10289 gene locus_tag LOCUS_26580 gene rpsU 10074 10289 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_26580 10318 10764 gene locus_tag LOCUS_26590 10318 10764 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence116 <1 554 gene locus_tag LOCUS_26600 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I450:ribonuclease D 628 927 gene locus_tag LOCUS_26610 628 927 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKI8 protein_id gnl|my_center|LOCUS_26610 924 1364 gene locus_tag LOCUS_26620 924 1364 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I445 protein_id gnl|my_center|LOCUS_26620 1352 1774 gene locus_tag LOCUS_26630 1352 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1899 2771 gene locus_tag LOCUS_26640 1899 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_26640 2776 3954 gene locus_tag LOCUS_26650 2776 3954 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_26650 4588 4031 gene locus_tag LOCUS_26660 4588 4031 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_26660 4832 6766 gene locus_tag LOCUS_26670 gene thrS 4832 6766 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP9 protein_id gnl|my_center|LOCUS_26670 6850 7311 gene locus_tag LOCUS_26680 gene infC 6850 7311 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_26680 7469 7663 gene locus_tag LOCUS_26690 gene rpmI 7469 7663 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A163 protein_id gnl|my_center|LOCUS_26690 7683 8036 gene locus_tag LOCUS_26700 gene rplT 7683 8036 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A2 protein_id gnl|my_center|LOCUS_26700 8183 9187 gene locus_tag LOCUS_26710 gene pheS 8183 9187 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_26710 >Feature sequence117 734 117 gene locus_tag LOCUS_26720 734 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1606 731 gene locus_tag LOCUS_26730 1606 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2162 2527 gene locus_tag LOCUS_26740 2162 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2833 2528 gene locus_tag LOCUS_26750 2833 2528 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721013.1 protein_id gnl|my_center|LOCUS_26750 3037 4185 gene locus_tag LOCUS_26760 3037 4185 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_26760 6014 4371 gene locus_tag LOCUS_26770 gene pgm 6014 4371 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_26770 7027 6149 gene locus_tag LOCUS_26780 7027 6149 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_26780 7165 8274 gene locus_tag LOCUS_26790 7165 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_26790 8354 9334 gene locus_tag LOCUS_26800 8354 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 9608 10771 gene locus_tag LOCUS_26810 9608 10771 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_26810 10771 11421 gene locus_tag LOCUS_26820 gene prfH 10771 11421 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence118 595 3057 gene locus_tag LOCUS_26830 595 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3392 3096 gene locus_tag LOCUS_26840 3392 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4557 3385 gene locus_tag LOCUS_26850 4557 3385 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479712.1 protein_id gnl|my_center|LOCUS_26850 4780 4550 gene locus_tag LOCUS_26860 4780 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4917 5144 gene locus_tag LOCUS_26870 4917 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 5194 6285 gene locus_tag LOCUS_26880 5194 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 6263 6910 gene locus_tag LOCUS_26890 6263 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6922 7986 gene locus_tag LOCUS_26900 6922 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 8184 9431 gene locus_tag LOCUS_26910 8184 9431 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_26910 9428 10150 gene locus_tag LOCUS_26920 9428 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 <11456 10727 gene locus_tag LOCUS_26930 <11456 10727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001277248.1:WYL domain-containing protein >Feature sequence119 1063 722 gene locus_tag LOCUS_26940 1063 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1315 1704 gene locus_tag LOCUS_26950 1315 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1777 5421 gene locus_tag LOCUS_26960 1777 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 6264 5746 gene locus_tag LOCUS_26970 6264 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890104.1 protein_id gnl|my_center|LOCUS_26970 6751 7278 gene locus_tag LOCUS_26980 6751 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 7613 7320 gene locus_tag LOCUS_26990 7613 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144102.1 protein_id gnl|my_center|LOCUS_26990 7857 7603 gene locus_tag LOCUS_27000 7857 7603 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_27000 8128 8844 gene locus_tag LOCUS_27010 8128 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 9214 8846 gene locus_tag LOCUS_27020 9214 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 9382 9942 gene locus_tag LOCUS_27030 9382 9942 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904930.1 protein_id gnl|my_center|LOCUS_27030 10049 10291 gene locus_tag LOCUS_27040 10049 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 10303 10611 gene locus_tag LOCUS_27050 10303 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence120 47 271 gene locus_tag LOCUS_27060 47 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 742 978 gene locus_tag LOCUS_27070 742 978 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531627.1 protein_id gnl|my_center|LOCUS_27070 992 1291 gene locus_tag LOCUS_27080 992 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1655 2299 gene locus_tag LOCUS_27090 1655 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2390 2788 gene locus_tag LOCUS_27100 2390 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3621 5204 gene locus_tag LOCUS_27110 gene hsdM-2 3621 5204 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_27110 5201 6016 gene locus_tag LOCUS_27120 5201 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_27120 6013 7248 gene locus_tag LOCUS_27130 6013 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 7245 8285 gene locus_tag LOCUS_27140 gene rhuM 7245 8285 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_27140 8398 10950 gene locus_tag LOCUS_27150 8398 10950 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706627.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence121 3572 444 gene locus_tag LOCUS_27160 3572 444 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_27160 4857 3583 gene locus_tag LOCUS_27170 4857 3583 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_27170 6064 4868 gene locus_tag LOCUS_27180 gene czcC 6064 4868 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_27180 7176 6205 gene locus_tag LOCUS_27190 7176 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 7571 7173 gene locus_tag LOCUS_27200 7571 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 9043 7850 gene locus_tag LOCUS_27210 9043 7850 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence122 156 539 gene locus_tag LOCUS_27220 156 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 578 1624 gene locus_tag LOCUS_27230 578 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1650 8060 gene locus_tag LOCUS_27240 1650 8060 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_27240 8053 10242 gene locus_tag LOCUS_27250 8053 10242 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JRX8 protein_id gnl|my_center|LOCUS_27250 >Feature sequence123 264 932 gene locus_tag LOCUS_27260 264 932 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_27260 925 1620 gene locus_tag LOCUS_27270 gene queE 925 1620 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVJ8 protein_id gnl|my_center|LOCUS_27270 2620 1652 gene locus_tag LOCUS_27280 gene qor 2620 1652 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_27280 3523 2654 gene locus_tag LOCUS_27290 gene hdtR 3523 2654 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_27290 3674 4012 gene locus_tag LOCUS_27300 3674 4012 CDS product UPF0438 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31811 protein_id gnl|my_center|LOCUS_27300 4171 3953 gene locus_tag LOCUS_27310 4171 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4223 4441 gene locus_tag LOCUS_27320 4223 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27320 4438 5343 gene locus_tag LOCUS_27330 gene rimK 4438 5343 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_27330 5452 6618 gene locus_tag LOCUS_27340 gene argD 5452 6618 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_27340 6642 7547 gene locus_tag LOCUS_27350 gene argF 6642 7547 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_27350 7641 8579 gene locus_tag LOCUS_27360 7641 8579 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_27360 10093 8609 gene locus_tag LOCUS_27370 10093 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence124 2120 105 gene locus_tag LOCUS_27380 2120 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_27380 3537 2113 gene locus_tag LOCUS_27390 3537 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3976 3581 gene locus_tag LOCUS_27400 3976 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 4331 3987 gene locus_tag LOCUS_27410 4331 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6378 4348 gene locus_tag LOCUS_27420 6378 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258536.1 protein_id gnl|my_center|LOCUS_27420 9773 6375 gene locus_tag LOCUS_27430 9773 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889722.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence125 57 1088 gene locus_tag LOCUS_27440 gene dapD 57 1088 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_27440 1361 2143 gene locus_tag LOCUS_27450 1361 2143 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_27450 2147 2560 gene locus_tag LOCUS_27460 2147 2560 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_27460 3561 2557 gene locus_tag LOCUS_27470 3561 2557 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_27470 3621 4196 gene locus_tag LOCUS_27480 3621 4196 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_27480 5166 6761 gene locus_tag LOCUS_27490 5166 6761 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_27490 7307 6897 gene locus_tag LOCUS_27500 7307 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 7665 7330 gene locus_tag LOCUS_27510 7665 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9893 7671 gene locus_tag LOCUS_27520 9893 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence126 1437 646 gene locus_tag LOCUS_27530 gene paaG 1437 646 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_27530 2611 1589 gene locus_tag LOCUS_27540 gene yhfP 2611 1589 CDS product putative quinone oxidoreductase YhfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07615 protein_id gnl|my_center|LOCUS_27540 3462 2692 gene locus_tag LOCUS_27550 3462 2692 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815612.1 protein_id gnl|my_center|LOCUS_27550 4268 3459 gene locus_tag LOCUS_27560 4268 3459 CDS product dihydroxynaphthoic acid synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064685.1 protein_id gnl|my_center|LOCUS_27560 5042 4275 gene locus_tag LOCUS_27570 5042 4275 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_27570 6705 5065 gene locus_tag LOCUS_27580 6705 5065 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_27580 8741 6726 gene locus_tag LOCUS_27590 gene fadH 8741 6726 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064855.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence127 <1 1224 gene locus_tag LOCUS_27600 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118576.1:NrfA- nitrite reduction protein 1270 1869 gene locus_tag LOCUS_27610 1270 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_27610 1891 2325 gene locus_tag LOCUS_27620 1891 2325 CDS product cytochrome c-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_27620 2325 2801 gene locus_tag LOCUS_27630 2325 2801 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_27630 3078 5447 gene locus_tag LOCUS_27640 3078 5447 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918626.1 protein_id gnl|my_center|LOCUS_27640 5545 6864 gene locus_tag LOCUS_27650 5545 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 9056 6948 gene locus_tag LOCUS_27660 gene pnp 9056 6948 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_27660 9563 9294 gene locus_tag LOCUS_27670 gene rpsO 9563 9294 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 protein_id gnl|my_center|LOCUS_27670 >Feature sequence128 549 61 gene locus_tag LOCUS_27680 549 61 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_27680 792 2489 gene locus_tag LOCUS_27690 gene leuA-2 792 2489 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_27690 2651 3649 gene locus_tag LOCUS_27700 2651 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 4014 6104 gene locus_tag LOCUS_27710 gene nosR 4014 6104 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 protein_id gnl|my_center|LOCUS_27710 6519 7220 gene locus_tag LOCUS_27720 6519 7220 CDS product UPF0174 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26107 protein_id gnl|my_center|LOCUS_27720 8810 7251 gene locus_tag LOCUS_27730 8810 7251 CDS product IS1182 family transposase ISMac2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021981.1 protein_id gnl|my_center|LOCUS_27730 9587 8943 gene locus_tag LOCUS_27740 9587 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence129 <1 999 gene locus_tag LOCUS_27750 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0K9:adenylosuccinate lyase 2544 1300 gene locus_tag LOCUS_27760 2544 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2987 3598 gene locus_tag LOCUS_27770 gene ychE 2987 3598 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_27770 3623 4090 gene locus_tag LOCUS_27780 3623 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_27780 4531 4115 gene locus_tag LOCUS_27790 4531 4115 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_27790 4691 5203 gene locus_tag LOCUS_27800 4691 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 5213 5722 gene locus_tag LOCUS_27810 5213 5722 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478430.1 protein_id gnl|my_center|LOCUS_27810 6286 5795 gene locus_tag LOCUS_27820 6286 5795 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 protein_id gnl|my_center|LOCUS_27820 7117 6341 gene locus_tag LOCUS_27830 7117 6341 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_27830 7873 7208 gene locus_tag LOCUS_27840 7873 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence130 37 354 gene locus_tag LOCUS_27850 37 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 455 1066 gene locus_tag LOCUS_27860 455 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1722 1147 gene locus_tag LOCUS_27870 1722 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2154 1873 gene locus_tag LOCUS_27880 2154 1873 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968628.1 protein_id gnl|my_center|LOCUS_27880 2379 2936 gene locus_tag LOCUS_27890 2379 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 4352 3000 gene locus_tag LOCUS_27900 gene bioA 4352 3000 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS70 protein_id gnl|my_center|LOCUS_27900 4666 5883 gene locus_tag LOCUS_27910 gene bioF 4666 5883 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_27910 5880 6623 gene locus_tag LOCUS_27920 gene bioH 5880 6623 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z221 protein_id gnl|my_center|LOCUS_27920 6620 7516 gene locus_tag LOCUS_27930 gene bioC 6620 7516 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QN4 protein_id gnl|my_center|LOCUS_27930 7513 8268 gene locus_tag LOCUS_27940 gene bioD 7513 8268 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_27940 8598 9236 gene locus_tag LOCUS_27950 8598 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence131 414 1061 gene locus_tag LOCUS_27960 414 1061 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82897 protein_id gnl|my_center|LOCUS_27960 1169 1429 gene locus_tag LOCUS_27970 1169 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1422 1640 gene locus_tag LOCUS_27980 1422 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1705 3306 gene locus_tag LOCUS_27990 1705 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3600 3242 gene locus_tag LOCUS_tm00010 3600 3242 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4169 3684 gene locus_tag LOCUS_28000 gene smpB 4169 3684 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFP4 protein_id gnl|my_center|LOCUS_28000 4338 5696 gene locus_tag LOCUS_28010 4338 5696 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_28010 5715 6146 gene locus_tag LOCUS_28020 gene ratA 5715 6146 CDS product ribosome association toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68560 protein_id gnl|my_center|LOCUS_28020 6139 6447 gene locus_tag LOCUS_28030 6139 6447 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43994 protein_id gnl|my_center|LOCUS_28030 6871 6539 gene locus_tag LOCUS_28040 6871 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 6964 7371 gene locus_tag LOCUS_28050 gene fur 6964 7371 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_28050 9154 7481 gene locus_tag LOCUS_28060 gene recN 9154 7481 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_28060 >Feature sequence132 1667 309 gene locus_tag LOCUS_28070 1667 309 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_28070 1990 1667 gene locus_tag LOCUS_28080 gene fdx 1990 1667 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_28080 3216 2053 gene locus_tag LOCUS_28090 3216 2053 CDS product cytochrome P450 monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731407.1 protein_id gnl|my_center|LOCUS_28090 3854 3441 gene locus_tag LOCUS_28100 3854 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 4994 4092 gene locus_tag LOCUS_28110 4994 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 7196 5016 gene locus_tag LOCUS_28120 7196 5016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_28120 8406 7207 gene locus_tag LOCUS_28130 8406 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence133 2619 1720 gene locus_tag LOCUS_28140 2619 1720 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 protein_id gnl|my_center|LOCUS_28140 2960 3811 gene locus_tag LOCUS_28150 2960 3811 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 protein_id gnl|my_center|LOCUS_28150 6122 3969 gene locus_tag LOCUS_28160 gene spoT 6122 3969 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_28160 6431 6201 gene locus_tag LOCUS_28170 6431 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7242 6601 gene locus_tag LOCUS_28180 gene gmk 7242 6601 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_28180 7670 7344 gene locus_tag LOCUS_28190 gene sugE 7670 7344 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_28190 8894 7779 gene locus_tag LOCUS_28200 8894 7779 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence134 1250 81 gene locus_tag LOCUS_28210 gene hypD2 1250 81 CDS product hydrogenase expression/formation protein hypD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31904 protein_id gnl|my_center|LOCUS_28210 1491 1237 gene locus_tag LOCUS_28220 gene hypC 1491 1237 CDS product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_28220 4299 1504 gene locus_tag LOCUS_28230 4299 1504 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXN2 protein_id gnl|my_center|LOCUS_28230 5774 4299 gene locus_tag LOCUS_28240 gene hoxA 5774 4299 CDS product hydrogenase transcriptional regulatory protein HoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31908 protein_id gnl|my_center|LOCUS_28240 6561 5776 gene locus_tag LOCUS_28250 6561 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 6505 6792 gene locus_tag LOCUS_28260 6505 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7111 6770 gene locus_tag LOCUS_28270 gene hypA2 7111 6770 CDS product putative hydrogenase nickel incorporation protein HypA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45256 protein_id gnl|my_center|LOCUS_28270 8033 7104 gene locus_tag LOCUS_28280 8033 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 8654 8055 gene locus_tag LOCUS_28290 8654 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 8890 8654 gene locus_tag LOCUS_28300 8890 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28300 <9438 8926 gene locus_tag LOCUS_28310 <9438 8926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338271.1:hydrogenase expression/formation protein >Feature sequence135 3560 1116 gene locus_tag LOCUS_28320 3560 1116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088923.1 protein_id gnl|my_center|LOCUS_28320 3860 4642 gene locus_tag LOCUS_28330 gene agmR 3860 4642 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_28330 5447 4809 gene locus_tag LOCUS_28340 gene pdxH 5447 4809 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_28340 5657 6100 gene locus_tag LOCUS_28350 5657 6100 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_28350 7233 6169 gene locus_tag LOCUS_28360 7233 6169 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_28360 8300 7230 gene locus_tag LOCUS_28370 8300 7230 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence136 1898 3694 gene locus_tag LOCUS_28380 1898 3694 CDS product phosphodiesterase/alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601465.1 protein_id gnl|my_center|LOCUS_28380 3847 4611 gene locus_tag LOCUS_28390 3847 4611 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_28390 6442 4613 gene locus_tag LOCUS_28400 6442 4613 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_28400 7341 6487 gene locus_tag LOCUS_28410 7341 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_28410 7520 8452 gene locus_tag LOCUS_28420 7520 8452 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 protein_id gnl|my_center|LOCUS_28420 9251 8397 gene locus_tag LOCUS_28430 gene apbE 9251 8397 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_28430 >Feature sequence137 464 1261 gene locus_tag LOCUS_28440 gene pqqC 464 1261 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_28440 1261 1554 gene locus_tag LOCUS_28450 gene pqqD 1261 1554 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_28450 1523 2707 gene locus_tag LOCUS_28460 gene pqqE 1523 2707 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMC1 protein_id gnl|my_center|LOCUS_28460 2720 4771 gene locus_tag LOCUS_28470 2720 4771 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057522.1 protein_id gnl|my_center|LOCUS_28470 4884 5819 gene locus_tag LOCUS_28480 gene nahR 4884 5819 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_28480 6804 5869 gene locus_tag LOCUS_28490 6804 5869 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_28490 6944 7411 gene locus_tag LOCUS_28500 6944 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_28500 8299 7562 gene locus_tag LOCUS_28510 8299 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 9199 8315 gene locus_tag LOCUS_28520 9199 8315 CDS product HSR1-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703400.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence138 87 755 gene locus_tag LOCUS_28530 87 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2423 1329 gene locus_tag LOCUS_28540 gene int 2423 1329 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946805.1 protein_id gnl|my_center|LOCUS_28540 3673 2801 gene locus_tag LOCUS_28550 3673 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 protein_id gnl|my_center|LOCUS_28550 3794 4510 gene locus_tag LOCUS_28560 gene rph 3794 4510 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQU6 protein_id gnl|my_center|LOCUS_28560 5201 5404 gene locus_tag LOCUS_28570 5201 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 6263 5451 gene locus_tag LOCUS_28580 gene crc 6263 5451 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_28580 6365 7012 gene locus_tag LOCUS_28590 gene pyrE 6365 7012 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD7 protein_id gnl|my_center|LOCUS_28590 7012 7698 gene locus_tag LOCUS_28600 7012 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence139 96 1514 gene locus_tag LOCUS_28610 gene rhlB 96 1514 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_28610 2001 1537 gene locus_tag LOCUS_28620 2001 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2779 2093 gene locus_tag LOCUS_28630 2779 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2782 2967 gene locus_tag LOCUS_28640 2782 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3252 3905 gene locus_tag LOCUS_28650 3252 3905 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 protein_id gnl|my_center|LOCUS_28650 4611 4042 gene locus_tag LOCUS_28660 4611 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5477 4920 gene locus_tag LOCUS_28670 gene folE 5477 4920 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXP6 protein_id gnl|my_center|LOCUS_28670 5980 6318 gene locus_tag LOCUS_28680 5980 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 6537 7403 gene locus_tag LOCUS_28690 6537 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704862.1 protein_id gnl|my_center|LOCUS_28690 7412 7639 gene locus_tag LOCUS_28700 7412 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 8286 7711 gene locus_tag LOCUS_28710 gene yceI 8286 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_28710 8787 8302 gene locus_tag LOCUS_28720 8787 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence140 540 1352 gene locus_tag LOCUS_28730 540 1352 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_28730 1487 1332 gene locus_tag LOCUS_28740 1487 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1872 2651 gene locus_tag LOCUS_28750 gene dltE 1872 2651 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_28750 2815 3858 gene locus_tag LOCUS_28760 2815 3858 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_28760 4205 5401 gene locus_tag LOCUS_28770 gene mexE 4205 5401 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_28770 5408 8560 gene locus_tag LOCUS_28780 gene mexF 5408 8560 CDS product resistance-nodulation-cell division multidrug efflux transporter MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence141 1382 489 gene locus_tag LOCUS_28790 1382 489 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_28790 2574 1561 gene locus_tag LOCUS_28800 gene plsX 2574 1561 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 protein_id gnl|my_center|LOCUS_28800 2761 2576 gene locus_tag LOCUS_28810 gene rpmF 2761 2576 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_28810 3081 2776 gene locus_tag LOCUS_28820 3081 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 4341 3367 gene locus_tag LOCUS_28830 4341 3367 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_28830 4987 4334 gene locus_tag LOCUS_28840 4987 4334 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_28840 5948 4962 gene locus_tag LOCUS_28850 5948 4962 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_28850 >Feature sequence142 3501 334 gene locus_tag LOCUS_28860 3501 334 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_28860 5290 3524 gene locus_tag LOCUS_28870 5290 3524 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_28870 6702 5290 gene locus_tag LOCUS_28880 6702 5290 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 protein_id gnl|my_center|LOCUS_28880 7184 6702 gene locus_tag LOCUS_28890 7184 6702 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_28890 7846 7271 gene locus_tag LOCUS_28900 7846 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 8165 7869 gene locus_tag LOCUS_28910 8165 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence143 2039 954 gene locus_tag LOCUS_28920 2039 954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123234.1 protein_id gnl|my_center|LOCUS_28920 2305 3075 gene locus_tag LOCUS_28930 2305 3075 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_28930 4319 3111 gene locus_tag LOCUS_28940 4319 3111 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106002.1 protein_id gnl|my_center|LOCUS_28940 4533 5090 gene locus_tag LOCUS_28950 4533 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5254 5700 gene locus_tag LOCUS_28960 5254 5700 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I352 protein_id gnl|my_center|LOCUS_28960 6904 5711 gene locus_tag LOCUS_28970 6904 5711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_28970 7581 7093 gene locus_tag LOCUS_28980 7581 7093 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951530.1 protein_id gnl|my_center|LOCUS_28980 <8667 7732 gene locus_tag LOCUS_28990 <8667 7732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948173.1:hydrogenase expression/formation protein HypE >Feature sequence144 524 1399 gene locus_tag LOCUS_29000 gene nifH 524 1399 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C2 protein_id gnl|my_center|LOCUS_29000 1551 3032 gene locus_tag LOCUS_29010 gene nifD 1551 3032 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06121 protein_id gnl|my_center|LOCUS_29010 3121 4701 gene locus_tag LOCUS_29020 gene nifK 3121 4701 CDS product nitrogenase molybdenum-iron protein beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20621 protein_id gnl|my_center|LOCUS_29020 4836 5057 gene locus_tag LOCUS_29030 4836 5057 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_29030 5061 5804 gene locus_tag LOCUS_29040 5061 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 5770 6036 gene locus_tag LOCUS_29050 5770 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 6068 6808 gene locus_tag LOCUS_29060 6068 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 6802 7278 gene locus_tag LOCUS_29070 6802 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 7265 7807 gene locus_tag LOCUS_29080 7265 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7807 8214 gene locus_tag LOCUS_29090 7807 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 8214 8468 gene locus_tag LOCUS_29100 8214 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence145 <1 1801 gene locus_tag LOCUS_29110 <1 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VF3:lipid A export ATP-binding/permease protein MsbA 1807 2799 gene locus_tag LOCUS_29120 gene lpxK 1807 2799 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLY1 protein_id gnl|my_center|LOCUS_29120 2792 3013 gene locus_tag LOCUS_29130 2792 3013 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_29130 3013 3510 gene locus_tag LOCUS_29140 gene ptpA 3013 3510 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_29140 3581 4615 gene locus_tag LOCUS_29150 gene murB 3581 4615 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K016 protein_id gnl|my_center|LOCUS_29150 5358 4612 gene locus_tag LOCUS_29160 gene lpxH 5358 4612 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_29160 5857 5360 gene locus_tag LOCUS_29170 gene ppiB 5857 5360 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_29170 6095 7765 gene locus_tag LOCUS_29180 gene glnS 6095 7765 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_29180 >Feature sequence146 5178 64 gene locus_tag LOCUS_29190 5178 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229642.1 protein_id gnl|my_center|LOCUS_29190 8287 5324 gene locus_tag LOCUS_29200 8287 5324 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_313288.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence147 913 119 gene locus_tag LOCUS_29210 913 119 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_29210 2229 1201 gene locus_tag LOCUS_29220 gene mhpE 2229 1201 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X5J8 protein_id gnl|my_center|LOCUS_29220 3168 2245 gene locus_tag LOCUS_29230 3168 2245 CDS product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 protein_id gnl|my_center|LOCUS_29230 3975 3190 gene locus_tag LOCUS_29240 3975 3190 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_29240 4834 3995 gene locus_tag LOCUS_29250 4834 3995 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_29250 6322 4859 gene locus_tag LOCUS_29260 6322 4859 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_29260 7529 6633 gene locus_tag LOCUS_29270 7529 6633 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_29270 7661 8254 gene locus_tag LOCUS_29280 7661 8254 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence148 784 50 gene locus_tag LOCUS_29290 gene pyrH 784 50 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_29290 1737 883 gene locus_tag LOCUS_29300 gene tsf 1737 883 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82851 protein_id gnl|my_center|LOCUS_29300 2581 1829 gene locus_tag LOCUS_29310 gene rpsB 2581 1829 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_29310 2909 3688 gene locus_tag LOCUS_29320 gene map 2909 3688 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BV1 protein_id gnl|my_center|LOCUS_29320 3688 6381 gene locus_tag LOCUS_29330 gene glnD 3688 6381 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_29330 7728 6370 gene locus_tag LOCUS_29340 7728 6370 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence149 2 373 gene locus_tag LOCUS_29350 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 462 2558 gene locus_tag LOCUS_29360 462 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2582 3739 gene locus_tag LOCUS_29370 2582 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 3741 4853 gene locus_tag LOCUS_29380 gene hmuS 3741 4853 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_29380 4853 5755 gene locus_tag LOCUS_29390 4853 5755 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_29390 5879 6898 gene locus_tag LOCUS_29400 5879 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 6901 7689 gene locus_tag LOCUS_29410 gene hmuV 6901 7689 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_29410 >Feature sequence150 1501 254 gene locus_tag LOCUS_29420 1501 254 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_29420 2180 1503 gene locus_tag LOCUS_29430 2180 1503 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 protein_id gnl|my_center|LOCUS_29430 2350 3015 gene locus_tag LOCUS_29440 2350 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3445 3050 gene locus_tag LOCUS_29450 3445 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4128 3457 gene locus_tag LOCUS_29460 4128 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_29460 4803 4156 gene locus_tag LOCUS_29470 4803 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_29470 5144 5956 gene locus_tag LOCUS_29480 5144 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 6582 5977 gene locus_tag LOCUS_29490 6582 5977 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWR1 protein_id gnl|my_center|LOCUS_29490 6815 7867 gene locus_tag LOCUS_29500 6815 7867 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087717.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence151 235 148 gene locus_tag LOCUS_t00260 235 148 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 940 395 gene locus_tag LOCUS_29510 940 395 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_29510 1062 2546 gene locus_tag LOCUS_29520 gene cyaB 1062 2546 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_29520 3172 2582 gene locus_tag LOCUS_29530 gene nfuA 3172 2582 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_29530 3314 7033 gene locus_tag LOCUS_29540 gene metH 3314 7033 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_29540 >Feature sequence152 <1 702 gene locus_tag LOCUS_29550 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SF7:protein translocase subunit SecA 717 1934 gene locus_tag LOCUS_29560 gene argJ 717 1934 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_29560 1931 2341 gene locus_tag LOCUS_29570 1931 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2747 2400 gene locus_tag LOCUS_29580 2747 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4278 2740 gene locus_tag LOCUS_29590 gene lnt 4278 2740 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_29590 3894 3822 gene locus_tag LOCUS_t00270 3894 3822 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5160 4312 gene locus_tag LOCUS_29600 5160 4312 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_29600 5630 5157 gene locus_tag LOCUS_29610 gene ybeY 5630 5157 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_29610 6679 5627 gene locus_tag LOCUS_29620 6679 5627 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_29620 8068 6704 gene locus_tag LOCUS_29630 gene miaB 8068 6704 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_29630 >Feature sequence153 <1 553 gene locus_tag LOCUS_29640 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVY5:cytochrome b 553 1314 gene locus_tag LOCUS_29650 553 1314 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_29650 1409 2038 gene locus_tag LOCUS_29660 gene sspA 1409 2038 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_29660 2061 2492 gene locus_tag LOCUS_29670 gene sspB 2061 2492 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_29670 3317 2622 gene locus_tag LOCUS_29680 3317 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 5493 3481 gene locus_tag LOCUS_29690 5493 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5818 7287 gene locus_tag LOCUS_29700 gene gabD 5818 7287 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772866.1 protein_id gnl|my_center|LOCUS_29700 <8088 7419 gene locus_tag LOCUS_29710 <8088 7419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537680.1:penicillin acylase >Feature sequence154 <1 850 gene locus_tag LOCUS_29720 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073535.1:sodium-dependent bicarbonate transport family permease 942 1631 gene locus_tag LOCUS_29730 942 1631 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 protein_id gnl|my_center|LOCUS_29730 3053 1665 gene locus_tag LOCUS_29740 3053 1665 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_29740 3376 3759 gene locus_tag LOCUS_29750 3376 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3806 4372 gene locus_tag LOCUS_29760 3806 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_29760 4374 4823 gene locus_tag LOCUS_29770 gene osmC 4374 4823 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_29770 4890 5690 gene locus_tag LOCUS_29780 4890 5690 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256130.1 protein_id gnl|my_center|LOCUS_29780 5764 6438 gene locus_tag LOCUS_29790 5764 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970314.1 protein_id gnl|my_center|LOCUS_29790 6682 6491 gene locus_tag LOCUS_29800 6682 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence155 646 413 gene locus_tag LOCUS_29810 646 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 879 1382 gene locus_tag LOCUS_29820 879 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 1386 3137 gene locus_tag LOCUS_29830 1386 3137 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233035.2 protein_id gnl|my_center|LOCUS_29830 3127 3666 gene locus_tag LOCUS_29840 3127 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 4069 3638 gene locus_tag LOCUS_29850 4069 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 4455 4099 gene locus_tag LOCUS_29860 4455 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 6181 4445 gene locus_tag LOCUS_29870 6181 4445 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_29870 6490 6185 gene locus_tag LOCUS_29880 6490 6185 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_29880 <8042 6578 gene locus_tag LOCUS_29890 <8042 6578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103390.1:cellulose synthase >Feature sequence156 112 2487 gene locus_tag LOCUS_29900 112 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2613 3680 gene locus_tag LOCUS_29910 2613 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3906 3688 gene locus_tag LOCUS_29920 3906 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 5136 3970 gene locus_tag LOCUS_29930 5136 3970 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_29930 5931 5449 gene locus_tag LOCUS_29940 5931 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 6373 7467 gene locus_tag LOCUS_29950 6373 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence157 2903 780 gene locus_tag LOCUS_29960 2903 780 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071387.1 protein_id gnl|my_center|LOCUS_29960 3516 3046 gene locus_tag LOCUS_29970 3516 3046 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_29970 5462 3705 gene locus_tag LOCUS_29980 5462 3705 CDS product chlorogenate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200871.1 protein_id gnl|my_center|LOCUS_29980 5764 6249 gene locus_tag LOCUS_29990 5764 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7495 6257 gene locus_tag LOCUS_30000 7495 6257 CDS product hemin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972049.1 protein_id gnl|my_center|LOCUS_30000 7761 7624 gene locus_tag LOCUS_30010 7761 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence158 565 1773 gene locus_tag LOCUS_30020 565 1773 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_30020 1724 2308 gene locus_tag LOCUS_30030 1724 2308 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_30030 3436 2399 gene locus_tag LOCUS_30040 gene dinB 3436 2399 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY20 protein_id gnl|my_center|LOCUS_30040 3648 4016 gene locus_tag LOCUS_30050 3648 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 4009 4677 gene locus_tag LOCUS_30060 gene minC 4009 4677 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E447 protein_id gnl|my_center|LOCUS_30060 4708 5514 gene locus_tag LOCUS_30070 gene minD 4708 5514 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC7 protein_id gnl|my_center|LOCUS_30070 5516 5770 gene locus_tag LOCUS_30080 gene minE 5516 5770 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_30080 6830 5847 gene locus_tag LOCUS_30090 6830 5847 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_30090 7542 6916 gene locus_tag LOCUS_30100 7542 6916 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence159 607 308 gene locus_tag LOCUS_30110 607 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2149 662 gene locus_tag LOCUS_30120 2149 662 CDS product CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545465.1 protein_id gnl|my_center|LOCUS_30120 3559 2270 gene locus_tag LOCUS_30130 3559 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3869 3672 gene locus_tag LOCUS_30140 3869 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4291 3947 gene locus_tag LOCUS_30150 4291 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_30150 4778 5068 gene locus_tag LOCUS_30160 4778 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 5105 6085 gene locus_tag LOCUS_30170 gene cas1-1 5105 6085 CDS product CRISPR-associated endonuclease Cas1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS2 protein_id gnl|my_center|LOCUS_30170 6078 6434 gene locus_tag LOCUS_30180 6078 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 6725 7027 gene locus_tag LOCUS_30190 6725 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205522.1 protein_id gnl|my_center|LOCUS_30190 7030 7338 gene locus_tag LOCUS_30200 7030 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44191 protein_id gnl|my_center|LOCUS_30200 >Feature sequence160 765 965 gene locus_tag LOCUS_30210 765 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1092 1574 gene locus_tag LOCUS_30220 1092 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1706 1957 gene locus_tag LOCUS_30230 1706 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2045 2479 gene locus_tag LOCUS_30240 2045 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2666 3385 gene locus_tag LOCUS_30250 2666 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3681 4841 gene locus_tag LOCUS_30260 3681 4841 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_30260 4884 5186 gene locus_tag LOCUS_30270 4884 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 5259 7511 gene locus_tag LOCUS_30280 gene gidA 5259 7511 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_30280 >Feature sequence161 1087 422 gene locus_tag LOCUS_30290 gene coq7 1087 422 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_30290 1198 2673 gene locus_tag LOCUS_30300 1198 2673 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_30300 5032 2684 gene locus_tag LOCUS_30310 5032 2684 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244646.1 protein_id gnl|my_center|LOCUS_30310 6351 5056 gene locus_tag LOCUS_30320 gene purD 6351 5056 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_30320 <7597 6367 gene locus_tag LOCUS_30330 <7597 6367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUV9:bifunctional purine biosynthesis protein PurH >Feature sequence162 2879 2499 gene locus_tag LOCUS_30340 gene rplL 2879 2499 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E236 protein_id gnl|my_center|LOCUS_30340 3457 2924 gene locus_tag LOCUS_30350 gene rplJ 3457 2924 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID4 protein_id gnl|my_center|LOCUS_30350 4331 3636 gene locus_tag LOCUS_30360 gene rplA 4331 3636 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y1 protein_id gnl|my_center|LOCUS_30360 4765 4331 gene locus_tag LOCUS_30370 gene rplK 4765 4331 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_30370 5377 4841 gene locus_tag LOCUS_30380 gene nusG 5377 4841 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_30380 5753 5385 gene locus_tag LOCUS_30390 gene secE 5753 5385 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y4 protein_id gnl|my_center|LOCUS_30390 5878 5803 gene locus_tag LOCUS_t00280 5878 5803 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence163 494 1315 gene locus_tag LOCUS_30400 494 1315 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106425.1 protein_id gnl|my_center|LOCUS_30400 1322 1450 gene locus_tag LOCUS_30410 1322 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1443 3452 gene locus_tag LOCUS_30420 gene liuD 1443 3452 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 protein_id gnl|my_center|LOCUS_30420 3452 4366 gene locus_tag LOCUS_30430 gene liuE 3452 4366 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_30430 4451 5032 gene locus_tag LOCUS_30440 4451 5032 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 protein_id gnl|my_center|LOCUS_30440 5136 6830 gene locus_tag LOCUS_30450 5136 6830 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_30450 7051 7278 gene locus_tag LOCUS_30460 7051 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence164 310 1284 gene locus_tag LOCUS_30470 310 1284 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_30470 1342 1782 gene locus_tag LOCUS_30480 1342 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1892 2863 gene locus_tag LOCUS_30490 1892 2863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_30490 3137 4624 gene locus_tag LOCUS_30500 3137 4624 CDS product reactivating factor for ethanolamine ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462271.1 protein_id gnl|my_center|LOCUS_30500 4639 6867 gene locus_tag LOCUS_30510 4639 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence165 2119 809 gene locus_tag LOCUS_30520 2119 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3787 2141 gene locus_tag LOCUS_30530 3787 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 6351 3913 gene locus_tag LOCUS_30540 6351 3913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_30540 7350 6355 gene locus_tag LOCUS_30550 7350 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence166 648 1196 gene locus_tag LOCUS_30560 648 1196 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089643.1 protein_id gnl|my_center|LOCUS_30560 1193 2227 gene locus_tag LOCUS_30570 gene ansA 1193 2227 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_30570 2315 3655 gene locus_tag LOCUS_30580 2315 3655 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880613.1 protein_id gnl|my_center|LOCUS_30580 3652 3912 gene locus_tag LOCUS_30590 3652 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4020 4529 gene locus_tag LOCUS_30600 4020 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4554 5072 gene locus_tag LOCUS_30610 4554 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 7301 5121 gene locus_tag LOCUS_30620 7301 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence167 447 190 gene locus_tag LOCUS_30630 447 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 616 371 gene locus_tag LOCUS_30640 616 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1471 722 gene locus_tag LOCUS_30650 1471 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123813.1 protein_id gnl|my_center|LOCUS_30650 2199 1714 gene locus_tag LOCUS_30660 2199 1714 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_30660 2691 2398 gene locus_tag LOCUS_30670 2691 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3580 2723 gene locus_tag LOCUS_30680 3580 2723 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_30680 3720 4475 gene locus_tag LOCUS_30690 3720 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 4968 4786 gene locus_tag LOCUS_30700 4968 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 5111 6025 gene locus_tag LOCUS_30710 gene gcvA 5111 6025 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_30710 6471 6004 gene locus_tag LOCUS_30720 6471 6004 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_30720 6561 7109 gene locus_tag LOCUS_30730 6561 7109 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence168 3108 2398 gene locus_tag LOCUS_30740 gene sdhB 3108 2398 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_30740 4891 3122 gene locus_tag LOCUS_30750 gene sdhA 4891 3122 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_30750 5242 4895 gene locus_tag LOCUS_30760 gene sdhD 5242 4895 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D6 protein_id gnl|my_center|LOCUS_30760 5493 5236 gene locus_tag LOCUS_30770 5493 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 5963 7240 gene locus_tag LOCUS_30780 gene gltA 5963 7240 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_30780 >Feature sequence169 <1 1556 gene locus_tag LOCUS_30790 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938992.1:DEAD/DEAH box helicase 1596 2348 gene locus_tag LOCUS_30800 1596 2348 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_30800 2552 2334 gene locus_tag LOCUS_30810 2552 2334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_30810 2786 3244 gene locus_tag LOCUS_30820 2786 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3244 4623 gene locus_tag LOCUS_30830 3244 4623 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 protein_id gnl|my_center|LOCUS_30830 4869 5375 gene locus_tag LOCUS_30840 4869 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 5391 5705 gene locus_tag LOCUS_30850 5391 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30850 6219 5746 gene locus_tag LOCUS_30860 6219 5746 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_30860 <7318 6368 gene locus_tag LOCUS_30870 <7318 6368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004533897.1:acyl-CoA dehydrogenase >Feature sequence170 1149 202 gene locus_tag LOCUS_30880 1149 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705473.1 protein_id gnl|my_center|LOCUS_30880 2138 1230 gene locus_tag LOCUS_30890 2138 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2396 4402 gene locus_tag LOCUS_30900 2396 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 5151 4459 gene locus_tag LOCUS_30910 5151 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 protein_id gnl|my_center|LOCUS_30910 5915 5349 gene locus_tag LOCUS_30920 5915 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 6394 7017 gene locus_tag LOCUS_30930 6394 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence171 1712 639 gene locus_tag LOCUS_30940 1712 639 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_30940 1830 2774 gene locus_tag LOCUS_30950 1830 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_30950 3564 2794 gene locus_tag LOCUS_30960 3564 2794 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF8 protein_id gnl|my_center|LOCUS_30960 3688 4662 gene locus_tag LOCUS_30970 gene cysB 3688 4662 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_30970 5462 4740 gene locus_tag LOCUS_30980 gene cysH 5462 4740 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_30980 5752 6369 gene locus_tag LOCUS_30990 5752 6369 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_30990 >Feature sequence172 1206 2126 gene locus_tag LOCUS_31000 1206 2126 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_31000 2971 2123 gene locus_tag LOCUS_31010 gene yghU 2971 2123 CDS product glutathione S-transferase YghU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348524.1 protein_id gnl|my_center|LOCUS_31010 3227 4816 gene locus_tag LOCUS_31020 gene prfC 3227 4816 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_31020 4935 5366 gene locus_tag LOCUS_31030 gene rplM 4935 5366 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_31030 5370 5762 gene locus_tag LOCUS_31040 gene rpsI 5370 5762 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX3 protein_id gnl|my_center|LOCUS_31040 5990 6586 gene locus_tag LOCUS_31050 5990 6586 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_31050 >Feature sequence173 950 1195 gene locus_tag LOCUS_31060 950 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1579 2187 gene locus_tag LOCUS_31070 1579 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3060 2257 gene locus_tag LOCUS_31080 gene dapB 3060 2257 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38103 protein_id gnl|my_center|LOCUS_31080 4271 3150 gene locus_tag LOCUS_31090 gene dnaJ 4271 3150 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_31090 6295 4364 gene locus_tag LOCUS_31100 gene dnaK 6295 4364 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_31100 <6953 6441 gene locus_tag LOCUS_31110 <6953 6441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV42:protein GrpE >Feature sequence174 569 2062 gene locus_tag LOCUS_31120 gene hldE 569 2062 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05074 protein_id gnl|my_center|LOCUS_31120 2059 3018 gene locus_tag LOCUS_31130 gene hldD 2059 3018 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_31130 3023 3937 gene locus_tag LOCUS_31140 gene lpxL 3023 3937 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_31140 5444 3999 gene locus_tag LOCUS_31150 5444 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 6145 5651 gene locus_tag LOCUS_31160 6145 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 <6861 6298 gene locus_tag LOCUS_31170 <6861 6298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096276.1:secretion pathway ATPase >Feature sequence175 113 451 gene locus_tag LOCUS_31180 113 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_31180 570 1175 gene locus_tag LOCUS_31190 570 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1958 1392 gene locus_tag LOCUS_31200 1958 1392 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_31200 4948 2186 gene locus_tag LOCUS_31210 4948 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 6337 5246 gene locus_tag LOCUS_31220 gene ychF 6337 5246 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_31220 >Feature sequence176 878 570 gene locus_tag LOCUS_31230 878 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112569.1 protein_id gnl|my_center|LOCUS_31230 955 2106 gene locus_tag LOCUS_31240 955 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3502 2168 gene locus_tag LOCUS_31250 gene dgt2 3502 2168 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG5 protein_id gnl|my_center|LOCUS_31250 3827 4090 gene locus_tag LOCUS_31260 3827 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_31260 4106 5887 gene locus_tag LOCUS_31270 4106 5887 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_31270 6029 6280 gene locus_tag LOCUS_31280 6029 6280 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence177 <1 843 gene locus_tag LOCUS_31290 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964482.1:Fe-S cluster assembly protein SufB 959 1714 gene locus_tag LOCUS_31300 959 1714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_31300 1716 3089 gene locus_tag LOCUS_31310 1716 3089 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_31310 3089 4318 gene locus_tag LOCUS_31320 3089 4318 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_31320 4383 4742 gene locus_tag LOCUS_31330 4383 4742 CDS product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_31330 4814 5044 gene locus_tag LOCUS_31340 4814 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 5067 5594 gene locus_tag LOCUS_31350 5067 5594 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_31350 5605 6309 gene locus_tag LOCUS_31360 5605 6309 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence178 1436 546 gene locus_tag LOCUS_31370 1436 546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_31370 1359 1529 gene locus_tag LOCUS_31380 1359 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1535 2599 gene locus_tag LOCUS_31390 1535 2599 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228330.1 protein_id gnl|my_center|LOCUS_31390 4801 3071 gene locus_tag LOCUS_31400 gene mphR 4801 3071 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_31400 5005 5379 gene locus_tag LOCUS_31410 5005 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 5426 6412 gene locus_tag LOCUS_31420 gene mphL 5426 6412 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_31420 >Feature sequence179 1583 132 gene locus_tag LOCUS_31430 gene mltF 1583 132 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_31430 2041 5940 gene locus_tag LOCUS_31440 gene purL 2041 5940 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_31440 >Feature sequence180 39 611 gene locus_tag LOCUS_31450 39 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1066 608 gene locus_tag LOCUS_31460 1066 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704085.1 protein_id gnl|my_center|LOCUS_31460 1098 1964 gene locus_tag LOCUS_31470 1098 1964 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 protein_id gnl|my_center|LOCUS_31470 1961 2431 gene locus_tag LOCUS_31480 1961 2431 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHE0 protein_id gnl|my_center|LOCUS_31480 3145 2462 gene locus_tag LOCUS_31490 3145 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3269 4075 gene locus_tag LOCUS_31500 gene smtA 3269 4075 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LN6 protein_id gnl|my_center|LOCUS_31500 4072 4581 gene locus_tag LOCUS_31510 4072 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 protein_id gnl|my_center|LOCUS_31510 4747 4671 gene locus_tag LOCUS_t00290 4747 4671 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4964 5431 gene locus_tag LOCUS_31520 4964 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence181 558 1235 gene locus_tag LOCUS_31530 558 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2302 1307 gene locus_tag LOCUS_31540 2302 1307 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_31540 2430 3554 gene locus_tag LOCUS_31550 2430 3554 CDS product calcium-gated potassium channel mthK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877130.1 protein_id gnl|my_center|LOCUS_31550 3671 4627 gene locus_tag LOCUS_31560 gene birA 3671 4627 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_31560 4608 5318 gene locus_tag LOCUS_31570 gene coaX 4608 5318 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y6 protein_id gnl|my_center|LOCUS_31570 5294 5965 gene locus_tag LOCUS_31580 5294 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_31580 6041 6124 gene locus_tag LOCUS_t00300 6041 6124 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6230 6303 gene locus_tag LOCUS_t00310 6230 6303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 83 535 gene locus_tag LOCUS_31590 83 535 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_31590 516 1463 gene locus_tag LOCUS_31600 gene ispH 516 1463 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_31600 1900 1481 gene locus_tag LOCUS_31610 gene pilE 1900 1481 CDS product type IV minor pilin protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_31610 2751 1897 gene locus_tag LOCUS_31620 2751 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3263 2748 gene locus_tag LOCUS_31630 3263 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3935 3729 gene locus_tag LOCUS_31640 3935 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 <6411 3895 gene locus_tag LOCUS_31650 <6411 3895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY >Feature sequence183 722 1636 gene locus_tag LOCUS_31660 722 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1646 2194 gene locus_tag LOCUS_31670 1646 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 2198 3496 gene locus_tag LOCUS_31680 2198 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3493 5760 gene locus_tag LOCUS_31690 3493 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence184 2095 563 gene locus_tag LOCUS_31700 2095 563 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_31700 2916 2092 gene locus_tag LOCUS_31710 2916 2092 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_31710 3104 3928 gene locus_tag LOCUS_31720 gene pdhR 3104 3928 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331318.1 protein_id gnl|my_center|LOCUS_31720 4427 4020 gene locus_tag LOCUS_31730 4427 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5999 4593 gene locus_tag LOCUS_31740 5999 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence185 426 97 gene locus_tag LOCUS_31750 426 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1462 437 gene locus_tag LOCUS_31760 gene gpsA 1462 437 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_31760 2118 1615 gene locus_tag LOCUS_31770 2118 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_31770 3290 2118 gene locus_tag LOCUS_31780 3290 2118 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_31780 4317 3487 gene locus_tag LOCUS_31790 gene queF 4317 3487 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RS6 protein_id gnl|my_center|LOCUS_31790 5167 4391 gene locus_tag LOCUS_31800 5167 4391 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I032 protein_id gnl|my_center|LOCUS_31800 <6089 5167 gene locus_tag LOCUS_31810 <6089 5167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090885.1:ABC transporter ATP-binding protein >Feature sequence186 3 78 gene locus_tag LOCUS_t00320 3 78 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 103 176 gene locus_tag LOCUS_t00330 103 176 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 228 314 gene locus_tag LOCUS_t00340 228 314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 694 467 gene locus_tag LOCUS_31820 694 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 1417 818 gene locus_tag LOCUS_31830 1417 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1984 1502 gene locus_tag LOCUS_31840 1984 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2322 1987 gene locus_tag LOCUS_31850 2322 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3431 2394 gene locus_tag LOCUS_31860 3431 2394 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309082.1 protein_id gnl|my_center|LOCUS_31860 3668 3432 gene locus_tag LOCUS_31870 3668 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4303 3665 gene locus_tag LOCUS_31880 4303 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5994 4300 gene locus_tag LOCUS_31890 gene dcm 5994 4300 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816510.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence187 <1 791 gene locus_tag LOCUS_31900 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q884P8:50S ribosomal protein L3 glutamine methyltransferase 853 1950 gene locus_tag LOCUS_31910 gene aroC 853 1950 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC2 protein_id gnl|my_center|LOCUS_31910 2167 3330 gene locus_tag LOCUS_31920 2167 3330 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_31920 3370 3615 gene locus_tag LOCUS_31930 3370 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3839 4225 gene locus_tag LOCUS_31940 3839 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence188 2071 2274 gene locus_tag LOCUS_31950 2071 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2468 3409 gene locus_tag LOCUS_31960 2468 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_31960 3802 3545 gene locus_tag LOCUS_31970 3802 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 <5944 4023 gene locus_tag LOCUS_31980 <5944 4023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123510.1:ferredoxin >Feature sequence189 1077 295 gene locus_tag LOCUS_31990 1077 295 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_31990 1477 1199 gene locus_tag LOCUS_32000 1477 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2512 1583 gene locus_tag LOCUS_32010 2512 1583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_32010 2618 3490 gene locus_tag LOCUS_32020 2618 3490 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 protein_id gnl|my_center|LOCUS_32020 3572 3799 gene locus_tag LOCUS_32030 3572 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 3790 4941 gene locus_tag LOCUS_32040 3790 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 4950 5447 gene locus_tag LOCUS_32050 4950 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence190 122 427 gene locus_tag LOCUS_32060 122 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 451 1584 gene locus_tag LOCUS_32070 451 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1581 2114 gene locus_tag LOCUS_32080 1581 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2119 2598 gene locus_tag LOCUS_32090 2119 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2598 5564 gene locus_tag LOCUS_32100 2598 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence191 <1 1219 gene locus_tag LOCUS_32110 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYL3:regulatory protein NosR 1305 2468 gene locus_tag LOCUS_32120 1305 2468 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_32120 2452 4215 gene locus_tag LOCUS_32130 gene ercS 2452 4215 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_32130 4518 4276 gene locus_tag LOCUS_32140 4518 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 <5496 4588 gene locus_tag LOCUS_32150 <5496 4588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704796.1:hemagglutinin >Feature sequence192 1213 1881 gene locus_tag LOCUS_32160 1213 1881 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_32160 1878 3194 gene locus_tag LOCUS_32170 1878 3194 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268280.1 protein_id gnl|my_center|LOCUS_32170 3562 3248 gene locus_tag LOCUS_32180 3562 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 <5440 3559 gene locus_tag LOCUS_32190 <5440 3559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086886.1:cation efflux system protein >Feature sequence193 745 509 gene locus_tag LOCUS_32200 745 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 1477 839 gene locus_tag LOCUS_32210 1477 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_32210 1754 1497 gene locus_tag LOCUS_32220 1754 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1869 2240 gene locus_tag LOCUS_32230 1869 2240 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_32230 2246 3535 gene locus_tag LOCUS_32240 2246 3535 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_32240 3752 4921 gene locus_tag LOCUS_32250 3752 4921 CDS product depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550372.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence194 3051 3173 gene locus_tag LOCUS_32260 3051 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 5249 3174 gene locus_tag LOCUS_32270 5249 3174 CDS product ATP-dependent Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence195 <1 1508 gene locus_tag LOCUS_32280 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001232919.1:Fis family transcriptional regulator 2368 1514 gene locus_tag LOCUS_32290 2368 1514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 protein_id gnl|my_center|LOCUS_32290 2818 2390 gene locus_tag LOCUS_32300 2818 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2982 4001 gene locus_tag LOCUS_32310 gene hemH 2982 4001 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RH3 protein_id gnl|my_center|LOCUS_32310 4242 4520 gene locus_tag LOCUS_32320 4242 4520 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_32320 4727 5251 gene locus_tag LOCUS_32330 gene tadA 4727 5251 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_32330 >Feature sequence196 311 87 gene locus_tag LOCUS_32340 311 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1068 622 gene locus_tag LOCUS_32350 1068 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2587 1175 gene locus_tag LOCUS_32360 2587 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_32360 3130 2693 gene locus_tag LOCUS_32370 3130 2693 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_32370 4657 3218 gene locus_tag LOCUS_32380 4657 3218 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190045.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence197 <1 525 gene locus_tag LOCUS_32390 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMV4:malate synthase G 1584 688 gene locus_tag LOCUS_32400 gene intI 1584 688 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_32400 1996 2670 gene locus_tag LOCUS_32410 1996 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 2873 3109 gene locus_tag LOCUS_32420 2873 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3143 3694 gene locus_tag LOCUS_32430 3143 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence198 427 1416 gene locus_tag LOCUS_32440 427 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1499 2098 gene locus_tag LOCUS_32450 1499 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 2092 2310 gene locus_tag LOCUS_32460 2092 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2427 4304 gene locus_tag LOCUS_32470 2427 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence199 <1 541 gene locus_tag LOCUS_32480 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VW48:putative cytosol aminopeptidase 959 1585 gene locus_tag LOCUS_32490 959 1585 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531257.1 protein_id gnl|my_center|LOCUS_32490 3505 1595 gene locus_tag LOCUS_32500 3505 1595 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence200 3069 2140 gene locus_tag LOCUS_32510 3069 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_32510 4074 3166 gene locus_tag LOCUS_32520 gene lpxC 4074 3166 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_32520 <5028 4182 gene locus_tag LOCUS_32530 <5028 4182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87WZ0:cell division protein FtsZ >Feature sequence201 491 147 gene locus_tag LOCUS_32540 491 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1103 552 gene locus_tag LOCUS_32550 1103 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 2572 2111 gene locus_tag LOCUS_32560 2572 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3279 3473 gene locus_tag LOCUS_32570 3279 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3470 4162 gene locus_tag LOCUS_32580 3470 4162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_32580 4166 4705 gene locus_tag LOCUS_32590 4166 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_32590 4810 4885 gene locus_tag LOCUS_t00350 4810 4885 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence202 230 721 gene locus_tag LOCUS_32600 230 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2152 806 gene locus_tag LOCUS_32610 2152 806 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514626.1 protein_id gnl|my_center|LOCUS_32610 3939 2185 gene locus_tag LOCUS_32620 3939 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 4664 4248 gene locus_tag LOCUS_32630 4664 4248 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_32630 >Feature sequence203 2141 654 gene locus_tag LOCUS_32640 gene guaB 2141 654 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_32640 2469 3854 gene locus_tag LOCUS_32650 gene xseA 2469 3854 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX12 protein_id gnl|my_center|LOCUS_32650 3945 4862 gene locus_tag LOCUS_32660 3945 4862 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266915.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence204 174 1064 gene locus_tag LOCUS_32670 174 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 1096 1506 gene locus_tag LOCUS_32680 gene pcaC 1096 1506 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_32680 1576 2319 gene locus_tag LOCUS_32690 1576 2319 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405525.1 protein_id gnl|my_center|LOCUS_32690 3898 2765 gene locus_tag LOCUS_32700 gene ribB 3898 2765 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882G0 protein_id gnl|my_center|LOCUS_32700 3957 4247 gene locus_tag LOCUS_32710 3957 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence205 842 498 gene locus_tag LOCUS_32720 gene pilZ 842 498 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_32720 1896 823 gene locus_tag LOCUS_32730 gene holB 1896 823 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_32730 2563 1904 gene locus_tag LOCUS_32740 gene tmk 2563 1904 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_32740 3596 2583 gene locus_tag LOCUS_32750 3596 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_32750 4438 3593 gene locus_tag LOCUS_32760 gene pabC 4438 3593 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQI0 protein_id gnl|my_center|LOCUS_32760 >Feature sequence206 1255 3099 gene locus_tag LOCUS_32770 1255 3099 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 protein_id gnl|my_center|LOCUS_32770 3660 3154 gene locus_tag LOCUS_32780 3660 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479627.1 protein_id gnl|my_center|LOCUS_32780 3908 4378 gene locus_tag LOCUS_32790 3908 4378 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_32790 4718 4359 gene locus_tag LOCUS_32800 4718 4359 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence207 605 297 gene locus_tag LOCUS_32810 605 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1185 769 gene locus_tag LOCUS_32820 1185 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2006 1251 gene locus_tag LOCUS_32830 gene cylG 2006 1251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861303.1 protein_id gnl|my_center|LOCUS_32830 2413 3786 gene locus_tag LOCUS_32840 2413 3786 CDS product 3-phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_32840 3786 4277 gene locus_tag LOCUS_32850 3786 4277 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence208 169 1140 gene locus_tag LOCUS_32860 169 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1571 1176 gene locus_tag LOCUS_32870 1571 1176 CDS product glycolate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 protein_id gnl|my_center|LOCUS_32870 1890 3350 gene locus_tag LOCUS_32880 1890 3350 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_32880 3362 4207 gene locus_tag LOCUS_32890 3362 4207 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence209 >Feature sequence210 1115 498 gene locus_tag LOCUS_32900 gene msrQ 1115 498 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF07 protein_id gnl|my_center|LOCUS_32900 2116 1115 gene locus_tag LOCUS_32910 gene msrP 2116 1115 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_32910 2967 2167 gene locus_tag LOCUS_32920 gene pssA 2967 2167 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_32920 3891 3013 gene locus_tag LOCUS_32930 gene ilvY 3891 3013 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence211 1557 118 gene locus_tag LOCUS_32940 gene mqo1 1557 118 CDS product putative malate:quinone oxidoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF4 protein_id gnl|my_center|LOCUS_32940 2077 2319 gene locus_tag LOCUS_32950 2077 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3519 2383 gene locus_tag LOCUS_32960 3519 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence212 <1 2146 gene locus_tag LOCUS_32970 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I553:alanine--tRNA ligase 2316 3551 gene locus_tag LOCUS_32980 2316 3551 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_32980 3742 3933 gene locus_tag LOCUS_32990 gene csrA 3742 3933 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_32990 4031 4120 gene locus_tag LOCUS_t00360 4031 4120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence213 2454 1054 gene locus_tag LOCUS_33000 2454 1054 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 protein_id gnl|my_center|LOCUS_33000 2904 3710 gene locus_tag LOCUS_33010 2904 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence214 1250 48 gene locus_tag LOCUS_33020 gene dcaF 1250 48 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_33020 2735 1269 gene locus_tag LOCUS_33030 2735 1269 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_33030 3576 2794 gene locus_tag LOCUS_33040 3576 2794 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence215 406 3885 gene locus_tag LOCUS_33050 gene mfd 406 3885 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_33050 >Feature sequence216 3164 324 gene locus_tag LOCUS_33060 3164 324 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804175.1 protein_id gnl|my_center|LOCUS_33060 <4292 3365 gene locus_tag LOCUS_33070 <4292 3365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32150:extracellular ribonuclease >Feature sequence217 3610 2423 gene locus_tag LOCUS_33080 3610 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence218 257 72 gene locus_tag LOCUS_33090 gene rpmD 257 72 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF39 protein_id gnl|my_center|LOCUS_33090 785 264 gene locus_tag LOCUS_33100 gene rpsE 785 264 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_33100 1147 797 gene locus_tag LOCUS_33110 gene rplR 1147 797 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_33110 1691 1158 gene locus_tag LOCUS_33120 gene rplF 1691 1158 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_33120 2093 1701 gene locus_tag LOCUS_33130 gene rpsH 2093 1701 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_33130 2457 2152 gene locus_tag LOCUS_33140 gene rpsN 2457 2152 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_33140 3007 2468 gene locus_tag LOCUS_33150 gene rplE 3007 2468 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_33150 3343 3026 gene locus_tag LOCUS_33160 gene rplX 3343 3026 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE6 protein_id gnl|my_center|LOCUS_33160 3722 3354 gene locus_tag LOCUS_33170 gene rplN 3722 3354 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ4 protein_id gnl|my_center|LOCUS_33170 4020 3754 gene locus_tag LOCUS_33180 gene rpsQ 4020 3754 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ3 protein_id gnl|my_center|LOCUS_33180 4217 4023 gene locus_tag LOCUS_33190 gene rpmC 4217 4023 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE3 protein_id gnl|my_center|LOCUS_33190 >Feature sequence219 591 43 gene locus_tag LOCUS_33200 591 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 1691 1518 gene locus_tag LOCUS_33210 1691 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 1958 2218 gene locus_tag LOCUS_33220 1958 2218 CDS product cytotoxic translational repressor of toxin-antitoxin stability system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_33220 2202 2546 gene locus_tag LOCUS_33230 2202 2546 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704715.1 protein_id gnl|my_center|LOCUS_33230 <4188 2590 gene locus_tag LOCUS_33240 <4188 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104918.1:allophanate hydrolase >Feature sequence220 760 1014 gene locus_tag LOCUS_33250 760 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 1074 2846 gene locus_tag LOCUS_33260 1074 2846 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_33260 2858 4027 gene locus_tag LOCUS_33270 2858 4027 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence221 <1 2858 gene locus_tag LOCUS_33280 <1 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZZ33:glutamate-ammonia-ligase adenylyltransferase 2889 3818 gene locus_tag LOCUS_33290 gene ilvE 2889 3818 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_33290 >Feature sequence222 340 1380 gene locus_tag LOCUS_33300 340 1380 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706113.1 protein_id gnl|my_center|LOCUS_33300 <4100 1451 gene locus_tag LOCUS_33310 <4100 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CEW2:RNA polymerase-associated protein RapA >Feature sequence223 <1 722 gene locus_tag LOCUS_33320 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVM3:riboflavin biosynthesis protein 773 3664 gene locus_tag LOCUS_33330 gene ileS 773 3664 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_33330 >Feature sequence224 1097 132 gene locus_tag LOCUS_33340 gene xylS 1097 132 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_33340 2416 1355 gene locus_tag LOCUS_33350 gene mhpE 2416 1355 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q9 protein_id gnl|my_center|LOCUS_33350 3345 2413 gene locus_tag LOCUS_33360 3345 2413 CDS product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 protein_id gnl|my_center|LOCUS_33360 3587 3369 gene locus_tag LOCUS_33370 3587 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 >Feature sequence225 1442 1573 gene locus_tag LOCUS_33380 1442 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 1563 2687 gene locus_tag LOCUS_33390 1563 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence226 3 1706 gene locus_tag LOCUS_33400 3 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1979 3619 gene locus_tag LOCUS_33410 gene SUL1 1979 3619 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence227 1594 221 gene locus_tag LOCUS_33420 1594 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 1887 1642 gene locus_tag LOCUS_33430 1887 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence228 2352 1195 gene locus_tag LOCUS_33440 2352 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3563 2349 gene locus_tag LOCUS_33450 3563 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence229 3016 1340 gene locus_tag LOCUS_33460 3016 1340 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence230 1091 120 gene locus_tag LOCUS_33470 gene lipA 1091 120 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_33470 1868 1218 gene locus_tag LOCUS_33480 gene lipB 1868 1218 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_33480 2170 1868 gene locus_tag LOCUS_33490 2170 1868 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_33490 3319 2177 gene locus_tag LOCUS_33500 gene dacC 3319 2177 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence231 1190 579 gene locus_tag LOCUS_33510 1190 579 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458897.1 protein_id gnl|my_center|LOCUS_33510 1536 1210 gene locus_tag LOCUS_33520 1536 1210 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_33520 3544 1538 gene locus_tag LOCUS_33530 gene dnaX 3544 1538 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_33530 >Feature sequence232 364 582 gene locus_tag LOCUS_33540 gene infA 364 582 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 protein_id gnl|my_center|LOCUS_33540 3147 877 gene locus_tag LOCUS_33550 gene clpA 3147 877 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_33550 3405 3157 gene locus_tag LOCUS_33560 3405 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence233 1285 869 gene locus_tag LOCUS_33570 gene rbfA 1285 869 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ6 protein_id gnl|my_center|LOCUS_33570 <3553 1414 gene locus_tag LOCUS_33580 <3553 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV55:translation initiation factor IF-2 >Feature sequence234 879 1499 gene locus_tag LOCUS_33590 gene rluA 879 1499 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_33590 2237 1506 gene locus_tag LOCUS_33600 2237 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3079 2234 gene locus_tag LOCUS_33610 3079 2234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039165.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence235 150 1052 gene locus_tag LOCUS_33620 gene argB 150 1052 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_33620 1079 1696 gene locus_tag LOCUS_33630 gene slmA 1079 1696 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_33630 2749 1697 gene locus_tag LOCUS_33640 2749 1697 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_33640 <3518 2749 gene locus_tag LOCUS_33650 <3518 2749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706923.1:membrane protein >Feature sequence236 <1 3204 gene locus_tag LOCUS_33660 <1 3204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096802.1:urea carboxylase >Feature sequence237 201 686 gene locus_tag LOCUS_33670 201 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1428 769 gene locus_tag LOCUS_33680 1428 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_33680 2534 1425 gene locus_tag LOCUS_33690 2534 1425 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_33690 3420 2632 gene locus_tag LOCUS_33700 3420 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence238 422 1756 gene locus_tag LOCUS_33710 gene nqrA 422 1756 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_33710 1759 2970 gene locus_tag LOCUS_33720 gene nqrB 1759 2970 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_33720 >Feature sequence239 957 256 gene locus_tag LOCUS_33730 957 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1598 1984 gene locus_tag LOCUS_33740 1598 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2052 2492 gene locus_tag LOCUS_33750 2052 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence240 2096 1278 gene locus_tag LOCUS_33760 2096 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2458 2129 gene locus_tag LOCUS_33770 2458 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence241 1046 2083 gene locus_tag LOCUS_33780 1046 2083 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence242 811 1482 gene locus_tag LOCUS_33790 gene pspA 811 1482 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_33790 1577 1840 gene locus_tag LOCUS_33800 gene pspB 1577 1840 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_33800 1840 2289 gene locus_tag LOCUS_33810 1840 2289 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705755.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence243 874 2850 gene locus_tag LOCUS_33820 874 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence244 1217 150 gene locus_tag LOCUS_33830 1217 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 1785 1321 gene locus_tag LOCUS_33840 1785 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 <2920 2373 gene locus_tag LOCUS_33850 <2920 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940317.1:hybrid sensor histidine kinase/response regulator >Feature sequence245 1219 623 gene locus_tag LOCUS_33860 1219 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 <2877 1213 gene locus_tag LOCUS_33870 <2877 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I502:proline--tRNA ligase >Feature sequence246 <1 1533 gene locus_tag LOCUS_33880 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880909.1:cellulose synthase catalytic subunit (UDP-forming) >Feature sequence247 524 135 gene locus_tag LOCUS_33890 gene dgkA 524 135 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MWQ1 protein_id gnl|my_center|LOCUS_33890 966 1586 gene locus_tag LOCUS_33900 gene hupD 966 1586 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_33900 1586 2002 gene locus_tag LOCUS_33910 1586 2002 CDS product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388920.1 protein_id gnl|my_center|LOCUS_33910 1995 2417 gene locus_tag LOCUS_33920 gene hupG 1995 2417 CDS product hydrogenase expression/formation protein HupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48339 protein_id gnl|my_center|LOCUS_33920 >Feature sequence248 1873 215 gene locus_tag LOCUS_33930 gene algA 1873 215 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence249 >Feature sequence250 407 1147 gene locus_tag LOCUS_33940 gene cmoA 407 1147 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G3 protein_id gnl|my_center|LOCUS_33940 1165 2211 gene locus_tag LOCUS_33950 gene cmoB 1165 2211 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_33950 <2795 2182 gene locus_tag LOCUS_33960 <2795 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZV00:tRNA-dihydrouridine(16) synthase >Feature sequence251 1490 384 gene locus_tag LOCUS_33970 gene selU 1490 384 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_33970 2545 1490 gene locus_tag LOCUS_33980 gene selD 2545 1490 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQF1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence252 1396 851 gene locus_tag LOCUS_33990 gene fldA 1396 851 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQL3 protein_id gnl|my_center|LOCUS_33990 2390 1614 gene locus_tag LOCUS_34000 2390 1614 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267943.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence253 98 22 gene locus_tag LOCUS_t00370 98 22 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1047 442 gene locus_tag LOCUS_34010 1047 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 1558 1097 gene locus_tag LOCUS_34020 1558 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 2069 2449 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaaacctgccccgtttataaggggattaagac >Feature sequence254 775 644 gene locus_tag LOCUS_34030 775 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1182 898 gene locus_tag LOCUS_34040 1182 898 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_34040 1517 1179 gene locus_tag LOCUS_34050 1517 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence255 <1 768 gene locus_tag LOCUS_34060 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769626.1:2-oxoglutarate dehydrogenase subunit E1 801 1997 gene locus_tag LOCUS_34070 gene sucB 801 1997 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_34070 >Feature sequence256 1885 305 gene locus_tag LOCUS_34080 gene mviN 1885 305 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_34080 >Feature sequence257 289 213 gene locus_tag LOCUS_t00380 289 213 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 555 1256 gene locus_tag LOCUS_34090 555 1256 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW30 protein_id gnl|my_center|LOCUS_34090 2063 1987 gene locus_tag LOCUS_t00390 2063 1987 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence258 >Feature sequence259 14 1135 gene locus_tag LOCUS_34100 gene zapE 14 1135 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_34100 1535 1236 gene locus_tag LOCUS_34110 1535 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence260 484 672 gene locus_tag LOCUS_34120 484 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 718 1881 gene locus_tag LOCUS_34130 718 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence261 247 1101 gene locus_tag LOCUS_34140 247 1101 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence262 993 634 gene locus_tag LOCUS_34150 993 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1214 1429 gene locus_tag LOCUS_34160 1214 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence263 88 1581 gene locus_tag LOCUS_34170 88 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence264 <1 638 gene locus_tag LOCUS_34180 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766202.1:glutathione-disulfide reductase 1731 691 gene locus_tag LOCUS_34190 1731 691 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268129.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence265 <1 801 gene locus_tag LOCUS_34200 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7H2:elongation factor G 2 1362 901 gene locus_tag LOCUS_34210 gene cysC 1362 901 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJT1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence266 588 70 gene locus_tag LOCUS_34220 588 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 1578 1144 gene locus_tag LOCUS_34230 1578 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence267 257 397 gene locus_tag LOCUS_34240 257 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 <1717 986 gene locus_tag LOCUS_34250 <1717 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206430.1:acyl-CoA dehydrogenase >Feature sequence268 2 1177 gene locus_tag LOCUS_34260 2 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence269 231 611 gene locus_tag LOCUS_34270 231 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 608 916 gene locus_tag LOCUS_34280 608 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 913 1158 gene locus_tag LOCUS_34290 913 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 1155 1661 gene locus_tag LOCUS_34300 1155 1661 CDS product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988475.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence270 <1 1118 gene locus_tag LOCUS_34310 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706041.1:acyl-CoA synthetase >Feature sequence271 248 826 gene locus_tag LOCUS_34320 248 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_34320 880 1209 gene locus_tag LOCUS_34330 880 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 1444 1238 gene locus_tag LOCUS_34340 1444 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence272 199 432 gene locus_tag LOCUS_34350 gene acpP 199 432 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH4 protein_id gnl|my_center|LOCUS_34350 >Feature sequence273 1301 438 gene locus_tag LOCUS_34360 gene tesB 1301 438 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence274 526 1059 gene locus_tag LOCUS_34370 526 1059 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405523.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence275 663 139 gene locus_tag LOCUS_34380 663 139 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195901.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence276 1202 198 gene locus_tag LOCUS_34390 1202 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence277 <1 891 gene locus_tag LOCUS_34400 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPK0:argininosuccinate synthase >Feature sequence278 >Feature sequence279 >Feature sequence280 78 344 gene locus_tag LOCUS_34410 gene trp1400A 78 344 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815231.1 protein_id gnl|my_center|LOCUS_34410 701 1174 gene locus_tag LOCUS_34420 701 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence281 >Feature sequence282 <1161 34 gene locus_tag LOCUS_34430 <1161 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918162.1:transposase >Feature sequence283 347 700 gene locus_tag LOCUS_34440 347 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence284 790 1029 gene locus_tag LOCUS_34450 790 1029 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence285 3 536 gene locus_tag LOCUS_34460 3 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 1000 764 gene locus_tag LOCUS_34470 gene cspD 1000 764 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence286 634 242 gene locus_tag LOCUS_34480 634 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence287 >Feature sequence288 >Feature sequence289 992 6 gene locus_tag LOCUS_34490 992 6 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence290 >Feature sequence291 224 772 gene locus_tag LOCUS_34500 224 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500