>Feature sequence01 2667 730 gene locus_tag LOCUS_00010 2667 730 CDS product type I restriction endonuclease EcoAI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100193.1 protein_id gnl|my_center|LOCUS_00010 4154 2664 gene locus_tag LOCUS_00020 4154 2664 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_00020 6739 4241 gene locus_tag LOCUS_00030 6739 4241 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_00030 7490 7065 gene locus_tag LOCUS_00040 7490 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7782 7495 gene locus_tag LOCUS_00050 7782 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8006 7779 gene locus_tag LOCUS_00060 8006 7779 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209920.1 protein_id gnl|my_center|LOCUS_00060 8257 8093 gene locus_tag LOCUS_00070 8257 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9138 8323 gene locus_tag LOCUS_00080 9138 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10308 9139 gene locus_tag LOCUS_00090 gene int 10308 9139 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_00090 10555 10480 gene locus_tag LOCUS_t00010 10555 10480 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11367 10618 gene locus_tag LOCUS_00100 11367 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_00100 11834 11364 gene locus_tag LOCUS_00110 11834 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12183 11848 gene locus_tag LOCUS_00120 12183 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12997 12254 gene locus_tag LOCUS_00130 12997 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13150 14079 gene locus_tag LOCUS_00140 13150 14079 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_00140 14328 14729 gene locus_tag LOCUS_00150 gene flgB 14328 14729 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_00150 14732 15181 gene locus_tag LOCUS_00160 gene flgC 14732 15181 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 protein_id gnl|my_center|LOCUS_00160 15192 15980 gene locus_tag LOCUS_00170 gene flgD 15192 15980 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_00170 15995 19624 gene locus_tag LOCUS_00180 15995 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19838 20584 gene locus_tag LOCUS_00190 gene flgF 19838 20584 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Z7 protein_id gnl|my_center|LOCUS_00190 20597 21382 gene locus_tag LOCUS_00200 gene flgG 20597 21382 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 protein_id gnl|my_center|LOCUS_00200 21395 22078 gene locus_tag LOCUS_00210 gene flgH 21395 22078 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_00210 22984 24096 gene locus_tag LOCUS_00220 gene flgI 22984 24096 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR7 protein_id gnl|my_center|LOCUS_00220 24093 24392 gene locus_tag LOCUS_00230 24093 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24557 25831 gene locus_tag LOCUS_00240 24557 25831 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226163.1 protein_id gnl|my_center|LOCUS_00240 25933 26334 gene locus_tag LOCUS_00250 25933 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26345 26662 gene locus_tag LOCUS_00260 gene glpE 26345 26662 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DV5 protein_id gnl|my_center|LOCUS_00260 26667 26993 gene locus_tag LOCUS_00270 26667 26993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27064 27489 gene locus_tag LOCUS_00280 27064 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_00280 27689 28804 gene locus_tag LOCUS_00290 27689 28804 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223975.1 protein_id gnl|my_center|LOCUS_00290 28818 29933 gene locus_tag LOCUS_00300 28818 29933 CDS product putative fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702326.1 protein_id gnl|my_center|LOCUS_00300 30035 30433 gene locus_tag LOCUS_00310 30035 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_00310 30524 31933 gene locus_tag LOCUS_00320 gene thrC 30524 31933 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_00320 32017 32484 gene locus_tag LOCUS_00330 32017 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262099.1 protein_id gnl|my_center|LOCUS_00330 32587 33360 gene locus_tag LOCUS_00340 32587 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33357 34904 gene locus_tag LOCUS_00350 33357 34904 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_00350 34901 35863 gene locus_tag LOCUS_00360 34901 35863 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_00360 36718 35888 gene locus_tag LOCUS_00370 36718 35888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707806.1 protein_id gnl|my_center|LOCUS_00370 36857 37738 gene locus_tag LOCUS_00380 36857 37738 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_00380 37738 38529 gene locus_tag LOCUS_00390 gene hyi 37738 38529 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_00390 38946 38575 gene locus_tag LOCUS_00400 38946 38575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39279 39067 gene locus_tag LOCUS_00410 gene cspA 39279 39067 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_00410 39584 40192 gene locus_tag LOCUS_00420 39584 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_00420 42493 40193 gene locus_tag LOCUS_00430 gene feoB 42493 40193 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G9 protein_id gnl|my_center|LOCUS_00430 42744 42493 gene locus_tag LOCUS_00440 42744 42493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43023 43484 gene locus_tag LOCUS_00450 43023 43484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45505 43577 gene locus_tag LOCUS_00460 gene rnb 45505 43577 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX84 protein_id gnl|my_center|LOCUS_00460 46235 45576 gene locus_tag LOCUS_00470 46235 45576 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269047.1 protein_id gnl|my_center|LOCUS_00470 47010 46228 gene locus_tag LOCUS_00480 47010 46228 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_00480 47042 47674 gene locus_tag LOCUS_00490 gene msrA 47042 47674 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_00490 47671 48477 gene locus_tag LOCUS_00500 47671 48477 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928340.1 protein_id gnl|my_center|LOCUS_00500 48487 49554 gene locus_tag LOCUS_00510 48487 49554 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN6 protein_id gnl|my_center|LOCUS_00510 49538 50227 gene locus_tag LOCUS_00520 49538 50227 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_00520 51134 50256 gene locus_tag LOCUS_00530 gene rrp12 51134 50256 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_00530 51535 51611 gene locus_tag LOCUS_t00020 51535 51611 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52387 52016 gene locus_tag LOCUS_00540 52387 52016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 52787 53392 gene locus_tag LOCUS_00550 52787 53392 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_00550 53441 54160 gene locus_tag LOCUS_00560 53441 54160 CDS product pteridine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_00560 54546 54142 gene locus_tag LOCUS_00570 54546 54142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 54627 56360 gene locus_tag LOCUS_00580 gene recJ 54627 56360 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_00580 56448 56954 gene locus_tag LOCUS_00590 56448 56954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 56960 58813 gene locus_tag LOCUS_00600 56960 58813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58813 59172 gene locus_tag LOCUS_00610 58813 59172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530030.1 protein_id gnl|my_center|LOCUS_00610 59484 59224 gene locus_tag LOCUS_00620 59484 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62461 59627 gene locus_tag LOCUS_00630 62461 59627 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_00630 62735 62475 gene locus_tag LOCUS_00640 62735 62475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 62912 63463 gene locus_tag LOCUS_00650 62912 63463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63877 63488 gene locus_tag LOCUS_00660 63877 63488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63945 65165 gene locus_tag LOCUS_00670 63945 65165 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277810.1 protein_id gnl|my_center|LOCUS_00670 65949 65152 gene locus_tag LOCUS_00680 65949 65152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101159.1 protein_id gnl|my_center|LOCUS_00680 66104 66970 gene locus_tag LOCUS_00690 gene fieF 66104 66970 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_00690 67018 68133 gene locus_tag LOCUS_00700 67018 68133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 68389 69657 gene locus_tag LOCUS_00710 68389 69657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 70572 69688 gene locus_tag LOCUS_00720 70572 69688 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_00720 72696 70579 gene locus_tag LOCUS_00730 gene pta 72696 70579 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A5 protein_id gnl|my_center|LOCUS_00730 73883 72693 gene locus_tag LOCUS_00740 gene ackA 73883 72693 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A4 protein_id gnl|my_center|LOCUS_00740 74149 75090 gene locus_tag LOCUS_00750 74149 75090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75896 75120 gene locus_tag LOCUS_00760 75896 75120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768625.1 protein_id gnl|my_center|LOCUS_00760 75993 76556 gene locus_tag LOCUS_00770 75993 76556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 76749 77414 gene locus_tag LOCUS_00780 76749 77414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 77712 77416 gene locus_tag LOCUS_00790 77712 77416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 protein_id gnl|my_center|LOCUS_00790 79457 77709 gene locus_tag LOCUS_00800 79457 77709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 79565 80209 gene locus_tag LOCUS_00810 gene ccmA 79565 80209 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_00810 80206 80874 gene locus_tag LOCUS_00820 gene ccmB 80206 80874 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3S8 protein_id gnl|my_center|LOCUS_00820 80882 81628 gene locus_tag LOCUS_00830 gene ccmC 80882 81628 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_00830 81628 81816 gene locus_tag LOCUS_00840 gene ccmD 81628 81816 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z06 protein_id gnl|my_center|LOCUS_00840 81800 82261 gene locus_tag LOCUS_00850 gene ccmE 81800 82261 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_00850 82261 84243 gene locus_tag LOCUS_00860 gene ccmF 82261 84243 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_00860 84240 84761 gene locus_tag LOCUS_00870 gene dsbE 84240 84761 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA86 protein_id gnl|my_center|LOCUS_00870 84758 85225 gene locus_tag LOCUS_00880 gene ccmH 84758 85225 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_00880 85222 86457 gene locus_tag LOCUS_00890 gene cycH 85222 86457 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_00890 86482 87414 gene locus_tag LOCUS_00900 86482 87414 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_00900 89698 87377 gene locus_tag LOCUS_00910 89698 87377 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_00910 89852 91201 gene locus_tag LOCUS_00920 89852 91201 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 protein_id gnl|my_center|LOCUS_00920 91243 92073 gene locus_tag LOCUS_00930 gene lepB 91243 92073 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_00930 92273 92674 gene locus_tag LOCUS_00940 92273 92674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 92779 94920 gene locus_tag LOCUS_00950 92779 94920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 94850 95440 gene locus_tag LOCUS_00960 94850 95440 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105745.1 protein_id gnl|my_center|LOCUS_00960 95415 95978 gene locus_tag LOCUS_00970 95415 95978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96724 96017 gene locus_tag LOCUS_00980 96724 96017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 96996 97376 gene locus_tag LOCUS_00990 96996 97376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 98314 97439 gene locus_tag LOCUS_01000 98314 97439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_01000 98487 99503 gene locus_tag LOCUS_01010 gene rr07 98487 99503 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_01010 99563 100627 gene locus_tag LOCUS_01020 99563 100627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 100790 101038 gene locus_tag LOCUS_01030 100790 101038 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 protein_id gnl|my_center|LOCUS_01030 101073 101783 gene locus_tag LOCUS_01040 101073 101783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 102265 101972 gene locus_tag LOCUS_01050 102265 101972 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166105.1 protein_id gnl|my_center|LOCUS_01050 105074 102417 gene locus_tag LOCUS_01060 gene topA 105074 102417 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_01060 105301 106077 gene locus_tag LOCUS_01070 105301 106077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 106145 107038 gene locus_tag LOCUS_01080 106145 107038 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104733.1 protein_id gnl|my_center|LOCUS_01080 107940 107029 gene locus_tag LOCUS_01090 107940 107029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_01090 108002 108889 gene locus_tag LOCUS_01100 gene nadK 108002 108889 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_01100 108891 109853 gene locus_tag LOCUS_01110 108891 109853 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104727.1 protein_id gnl|my_center|LOCUS_01110 109853 110704 gene locus_tag LOCUS_01120 109853 110704 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406491.1 protein_id gnl|my_center|LOCUS_01120 110691 110942 gene locus_tag LOCUS_01130 110691 110942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 110946 111800 gene locus_tag LOCUS_01140 110946 111800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_01140 111866 114478 gene locus_tag LOCUS_01150 gene pepN 111866 114478 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_01150 114539 115492 gene locus_tag LOCUS_01160 114539 115492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115514 116578 gene locus_tag LOCUS_01170 115514 116578 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_01170 116907 120407 gene locus_tag LOCUS_01180 gene dnaE 116907 120407 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_01180 120427 121761 gene locus_tag LOCUS_01190 gene tilS 120427 121761 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_01190 121813 122235 gene locus_tag LOCUS_01200 121813 122235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 122399 123715 gene locus_tag LOCUS_01210 122399 123715 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 protein_id gnl|my_center|LOCUS_01210 123712 125385 gene locus_tag LOCUS_01220 123712 125385 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_01220 125382 128495 gene locus_tag LOCUS_01230 gene cusA 125382 128495 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_01230 128660 129157 gene locus_tag LOCUS_01240 128660 129157 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_01240 129200 129949 gene locus_tag LOCUS_01250 129200 129949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 129992 130891 gene locus_tag LOCUS_01260 129992 130891 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_01260 132886 130904 gene locus_tag LOCUS_01270 132886 130904 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707373.1 protein_id gnl|my_center|LOCUS_01270 133939 133139 gene locus_tag LOCUS_01280 133939 133139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 135725 134130 gene locus_tag LOCUS_01290 135725 134130 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_01290 136118 135816 gene locus_tag LOCUS_01300 136118 135816 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 protein_id gnl|my_center|LOCUS_01300 136339 136118 gene locus_tag LOCUS_01310 136339 136118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_01310 136647 137204 gene locus_tag LOCUS_01320 136647 137204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 137231 137773 gene locus_tag LOCUS_01330 137231 137773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_01330 137828 138070 gene locus_tag LOCUS_01340 137828 138070 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070492.1 protein_id gnl|my_center|LOCUS_01340 138829 138071 gene locus_tag LOCUS_01350 138829 138071 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_01350 139074 141674 gene locus_tag LOCUS_01360 139074 141674 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_01360 141884 143746 gene locus_tag LOCUS_01370 gene deaD 141884 143746 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK4 protein_id gnl|my_center|LOCUS_01370 145400 143784 gene locus_tag LOCUS_01380 145400 143784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 145726 147183 gene locus_tag LOCUS_01390 145726 147183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 147201 147623 gene locus_tag LOCUS_01400 147201 147623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 protein_id gnl|my_center|LOCUS_01400 147801 148382 gene locus_tag LOCUS_01410 gene azr 147801 148382 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 protein_id gnl|my_center|LOCUS_01410 148624 148361 gene locus_tag LOCUS_01420 148624 148361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148711 149196 gene locus_tag LOCUS_01430 148711 149196 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W2 protein_id gnl|my_center|LOCUS_01430 149404 149640 gene locus_tag LOCUS_01440 149404 149640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 151493 149796 gene locus_tag LOCUS_01450 gene leuA-2 151493 149796 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_01450 151809 152294 gene locus_tag LOCUS_01460 151809 152294 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_01460 153349 153708 gene locus_tag LOCUS_01470 153349 153708 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_01470 153701 154252 gene locus_tag LOCUS_01480 gene tadA 153701 154252 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_01480 154249 154785 gene locus_tag LOCUS_01490 154249 154785 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_01490 156311 154809 gene locus_tag LOCUS_01500 gene mltF 156311 154809 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN1 protein_id gnl|my_center|LOCUS_01500 156536 157147 gene locus_tag LOCUS_01510 156536 157147 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_01510 157619 157239 gene locus_tag LOCUS_01520 157619 157239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_01520 158873 157641 gene locus_tag LOCUS_01530 gene fmdA 158873 157641 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_01530 159957 158866 gene locus_tag LOCUS_01540 gene amiB 159957 158866 CDS product ATP-dependent protease ATP-binding subunit-like protein AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51416 protein_id gnl|my_center|LOCUS_01540 161018 159972 gene locus_tag LOCUS_01550 gene amiE 161018 159972 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 protein_id gnl|my_center|LOCUS_01550 161749 161060 gene locus_tag LOCUS_01560 161749 161060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_01560 162524 161760 gene locus_tag LOCUS_01570 162524 161760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 protein_id gnl|my_center|LOCUS_01570 163677 162517 gene locus_tag LOCUS_01580 163677 162517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083790.1 protein_id gnl|my_center|LOCUS_01580 164617 163691 gene locus_tag LOCUS_01590 164617 163691 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_01590 166016 164763 gene locus_tag LOCUS_01600 166016 164763 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083788.1 protein_id gnl|my_center|LOCUS_01600 166246 169635 gene locus_tag LOCUS_01610 166246 169635 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_01610 169628 170539 gene locus_tag LOCUS_01620 169628 170539 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083786.1 protein_id gnl|my_center|LOCUS_01620 172206 171208 gene locus_tag LOCUS_01630 gene eutR 172206 171208 CDS product HTH-type transcriptional regulator eutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36547 protein_id gnl|my_center|LOCUS_01630 172412 173818 gene locus_tag LOCUS_01640 gene eutB 172412 173818 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_01640 173829 174656 gene locus_tag LOCUS_01650 gene eutC 173829 174656 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M3 protein_id gnl|my_center|LOCUS_01650 174683 176125 gene locus_tag LOCUS_01660 174683 176125 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_01660 176518 180429 gene locus_tag LOCUS_01670 gene purL 176518 180429 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_01670 180511 181398 gene locus_tag LOCUS_01680 180511 181398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 182523 181798 gene locus_tag LOCUS_01690 182523 181798 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_01690 183314 182751 gene locus_tag LOCUS_01700 183314 182751 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_01700 185198 183339 gene locus_tag LOCUS_01710 gene btuB 185198 183339 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE6 protein_id gnl|my_center|LOCUS_01710 187617 185683 gene locus_tag LOCUS_01720 187617 185683 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_01720 188550 187645 gene locus_tag LOCUS_01730 188550 187645 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP04 protein_id gnl|my_center|LOCUS_01730 188653 189138 gene locus_tag LOCUS_01740 188653 189138 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHB9 protein_id gnl|my_center|LOCUS_01740 189138 190544 gene locus_tag LOCUS_01750 189138 190544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_01750 190551 191375 gene locus_tag LOCUS_01760 190551 191375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 191765 194464 gene locus_tag LOCUS_01770 191765 194464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 196870 194504 gene locus_tag LOCUS_01780 196870 194504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727593.1 protein_id gnl|my_center|LOCUS_01780 197108 199903 gene locus_tag LOCUS_01790 197108 199903 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_01790 201438 200923 gene locus_tag LOCUS_01800 201438 200923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 202179 201583 gene locus_tag LOCUS_01810 202179 201583 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_01810 205778 202863 gene locus_tag LOCUS_01820 gene gcvP 205778 202863 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ6 protein_id gnl|my_center|LOCUS_01820 206281 205886 gene locus_tag LOCUS_01830 gene gcvH 206281 205886 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L7 protein_id gnl|my_center|LOCUS_01830 207446 206364 gene locus_tag LOCUS_01840 gene gcvT 207446 206364 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_01840 209432 207588 gene locus_tag LOCUS_01850 209432 207588 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_01850 210519 209563 gene locus_tag LOCUS_01860 210519 209563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 210518 212050 gene locus_tag LOCUS_01870 210518 212050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 212787 212086 gene locus_tag LOCUS_01880 gene bioD 212787 212086 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_01880 213572 212784 gene locus_tag LOCUS_01890 gene bioC 213572 212784 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH67 protein_id gnl|my_center|LOCUS_01890 214296 213559 gene locus_tag LOCUS_01900 214296 213559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 215456 214293 gene locus_tag LOCUS_01910 gene bioF 215456 214293 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_01910 215566 216858 gene locus_tag LOCUS_01920 gene bioA 215566 216858 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS70 protein_id gnl|my_center|LOCUS_01920 217054 218130 gene locus_tag LOCUS_01930 217054 218130 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_01930 218134 220872 gene locus_tag LOCUS_01940 218134 220872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202935.1 protein_id gnl|my_center|LOCUS_01940 220874 222001 gene locus_tag LOCUS_01950 220874 222001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_01950 222484 222332 gene locus_tag LOCUS_01960 222484 222332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 223640 222576 gene locus_tag LOCUS_01970 223640 222576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769324.1 protein_id gnl|my_center|LOCUS_01970 223999 223718 gene locus_tag LOCUS_01980 223999 223718 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 protein_id gnl|my_center|LOCUS_01980 224073 224396 gene locus_tag LOCUS_01990 224073 224396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 225000 224356 gene locus_tag LOCUS_02000 225000 224356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071870.1 protein_id gnl|my_center|LOCUS_02000 225818 224997 gene locus_tag LOCUS_02010 225818 224997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 226311 226766 gene locus_tag LOCUS_02020 gene mraZ 226311 226766 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX20 protein_id gnl|my_center|LOCUS_02020 226763 227701 gene locus_tag LOCUS_02030 gene rsmH 226763 227701 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY2 protein_id gnl|my_center|LOCUS_02030 227698 227952 gene locus_tag LOCUS_02040 227698 227952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 227949 229670 gene locus_tag LOCUS_02050 gene ftsI 227949 229670 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_02050 229667 231130 gene locus_tag LOCUS_02060 gene murE 229667 231130 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY0 protein_id gnl|my_center|LOCUS_02060 231120 232478 gene locus_tag LOCUS_02070 gene murF 231120 232478 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_02070 232481 233563 gene locus_tag LOCUS_02080 gene mraY 232481 233563 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_02080 233563 234909 gene locus_tag LOCUS_02090 gene murD 233563 234909 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_02090 234909 236066 gene locus_tag LOCUS_02100 gene ftsW 234909 236066 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_02100 236059 237144 gene locus_tag LOCUS_02110 gene murG 236059 237144 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_02110 237134 238588 gene locus_tag LOCUS_02120 gene murC 237134 238588 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_02120 238585 239511 gene locus_tag LOCUS_02130 gene ddl 238585 239511 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_02130 239501 240277 gene locus_tag LOCUS_02140 gene ftsQ 239501 240277 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 protein_id gnl|my_center|LOCUS_02140 240277 241512 gene locus_tag LOCUS_02150 gene ftsA 240277 241512 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_02150 241549 242745 gene locus_tag LOCUS_02160 gene ftsZ 241549 242745 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ0 protein_id gnl|my_center|LOCUS_02160 242862 243770 gene locus_tag LOCUS_02170 gene lpxC 242862 243770 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_02170 244021 244854 gene locus_tag LOCUS_02180 244021 244854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_02180 244945 247683 gene locus_tag LOCUS_02190 gene secA 244945 247683 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_02190 247711 248928 gene locus_tag LOCUS_02200 gene argJ 247711 248928 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_02200 248938 249348 gene locus_tag LOCUS_02210 248938 249348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 249421 250380 gene locus_tag LOCUS_02220 249421 250380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 251644 250448 gene locus_tag LOCUS_02230 251644 250448 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_02230 252733 251687 gene locus_tag LOCUS_02240 252733 251687 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_02240 253483 253139 gene locus_tag LOCUS_02250 253483 253139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 254990 253476 gene locus_tag LOCUS_02260 gene lnt 254990 253476 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_02260 255848 255018 gene locus_tag LOCUS_02270 255848 255018 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_02270 256363 255845 gene locus_tag LOCUS_02280 gene ybeY 256363 255845 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A899 protein_id gnl|my_center|LOCUS_02280 257478 256360 gene locus_tag LOCUS_02290 257478 256360 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_02290 258855 257506 gene locus_tag LOCUS_02300 gene miaB 258855 257506 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_02300 259319 259501 gene locus_tag LOCUS_02310 259319 259501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 260406 259453 gene locus_tag LOCUS_02320 260406 259453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 260669 261271 gene locus_tag LOCUS_02330 260669 261271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 262602 261358 gene locus_tag LOCUS_02340 262602 261358 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 protein_id gnl|my_center|LOCUS_02340 262793 263917 gene locus_tag LOCUS_02350 262793 263917 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 protein_id gnl|my_center|LOCUS_02350 264998 263907 gene locus_tag LOCUS_02360 gene ychF 264998 263907 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_02360 265657 265070 gene locus_tag LOCUS_02370 gene pth 265657 265070 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN5 protein_id gnl|my_center|LOCUS_02370 266376 265750 gene locus_tag LOCUS_02380 gene rplY 266376 265750 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_02380 267422 266475 gene locus_tag LOCUS_02390 gene prs 267422 266475 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_02390 267538 267464 gene locus_tag LOCUS_t00030 267538 267464 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 268408 267542 gene locus_tag LOCUS_02400 gene ispE 268408 267542 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_02400 269000 268401 gene locus_tag LOCUS_02410 gene lolB 269000 268401 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_02410 270790 269000 gene locus_tag LOCUS_02420 270790 269000 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_02420 271074 272375 gene locus_tag LOCUS_02430 gene hemA 271074 272375 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_02430 272376 273461 gene locus_tag LOCUS_02440 gene prfA 272376 273461 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_02440 273461 274297 gene locus_tag LOCUS_02450 gene prmC 273461 274297 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRT6 protein_id gnl|my_center|LOCUS_02450 274334 275095 gene locus_tag LOCUS_02460 gene moeB 274334 275095 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_02460 275303 276103 gene locus_tag LOCUS_02470 gene rkpT1 275303 276103 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKG3 protein_id gnl|my_center|LOCUS_02470 276100 276768 gene locus_tag LOCUS_02480 gene kpsT 276100 276768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323198.1 protein_id gnl|my_center|LOCUS_02480 276977 278251 gene locus_tag LOCUS_02490 gene kpsE 276977 278251 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905924.1 protein_id gnl|my_center|LOCUS_02490 278248 279882 gene locus_tag LOCUS_02500 gene kpsD 278248 279882 CDS product polysialic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976914.1 protein_id gnl|my_center|LOCUS_02500 279919 280944 gene locus_tag LOCUS_02510 gene rfbA 279919 280944 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA9 protein_id gnl|my_center|LOCUS_02510 280941 281489 gene locus_tag LOCUS_02520 280941 281489 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344923.1 protein_id gnl|my_center|LOCUS_02520 281516 282394 gene locus_tag LOCUS_02530 gene rfbD 281516 282394 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_02530 282391 283476 gene locus_tag LOCUS_02540 gene rfbB 282391 283476 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_02540 283476 287795 gene locus_tag LOCUS_02550 283476 287795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 287800 288810 gene locus_tag LOCUS_02560 287800 288810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 288876 289619 gene locus_tag LOCUS_02570 288876 289619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389315.1 protein_id gnl|my_center|LOCUS_02570 289783 290793 gene locus_tag LOCUS_02580 289783 290793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 290847 291713 gene locus_tag LOCUS_02590 290847 291713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 291788 292765 gene locus_tag LOCUS_02600 291788 292765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 292829 293305 gene locus_tag LOCUS_02610 292829 293305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 293315 293539 gene locus_tag LOCUS_02620 293315 293539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 293555 296215 gene locus_tag LOCUS_02630 293555 296215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 296215 297174 gene locus_tag LOCUS_02640 296215 297174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 297274 298746 gene locus_tag LOCUS_02650 297274 298746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 298736 300022 gene locus_tag LOCUS_02660 298736 300022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 300038 301021 gene locus_tag LOCUS_02670 300038 301021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 302395 301037 gene locus_tag LOCUS_02680 302395 301037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 302582 304675 gene locus_tag LOCUS_02690 gene lipA 302582 304675 CDS product capsule polysaccharide modification protein LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05013 protein_id gnl|my_center|LOCUS_02690 304733 305887 gene locus_tag LOCUS_02700 304733 305887 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 protein_id gnl|my_center|LOCUS_02700 306521 305925 gene locus_tag LOCUS_02710 306521 305925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 308687 306783 gene locus_tag LOCUS_02720 308687 306783 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_02720 311597 308781 gene locus_tag LOCUS_02730 311597 308781 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_02730 311910 312824 gene locus_tag LOCUS_02740 311910 312824 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_02740 312835 313944 gene locus_tag LOCUS_02750 312835 313944 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_02750 314540 313953 gene locus_tag LOCUS_02760 gene gmhA 314540 313953 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_02760 314997 314614 gene locus_tag LOCUS_02770 314997 314614 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY4 protein_id gnl|my_center|LOCUS_02770 316774 315035 gene locus_tag LOCUS_02780 316774 315035 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_02780 317027 316743 gene locus_tag LOCUS_02790 317027 316743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 316929 317750 gene locus_tag LOCUS_02800 gene yraL 316929 317750 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MKV8 protein_id gnl|my_center|LOCUS_02800 317750 318382 gene locus_tag LOCUS_02810 317750 318382 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_02810 318456 319205 gene locus_tag LOCUS_02820 318456 319205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 319225 319653 gene locus_tag LOCUS_02830 319225 319653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 319653 320282 gene locus_tag LOCUS_02840 319653 320282 CDS product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 protein_id gnl|my_center|LOCUS_02840 320279 322195 gene locus_tag LOCUS_02850 320279 322195 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 protein_id gnl|my_center|LOCUS_02850 323065 322211 gene locus_tag LOCUS_02860 323065 322211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_02860 323309 324529 gene locus_tag LOCUS_02870 323309 324529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_02870 324532 327738 gene locus_tag LOCUS_02880 324532 327738 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479898.1 protein_id gnl|my_center|LOCUS_02880 328703 327819 gene locus_tag LOCUS_02890 328703 327819 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_02890 328819 329592 gene locus_tag LOCUS_02900 gene fpr 328819 329592 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_02900 329709 330164 gene locus_tag LOCUS_02910 329709 330164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 330304 330600 gene locus_tag LOCUS_02920 330304 330600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 330687 331247 gene locus_tag LOCUS_02930 330687 331247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 331484 332512 gene locus_tag LOCUS_02940 331484 332512 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_02940 332516 333625 gene locus_tag LOCUS_02950 332516 333625 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_02950 334837 333803 gene locus_tag LOCUS_02960 334837 333803 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_02960 335504 334896 gene locus_tag LOCUS_02970 gene ylfA 335504 334896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_02970 335715 336701 gene locus_tag LOCUS_02980 335715 336701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 336698 337489 gene locus_tag LOCUS_02990 gene hutD 336698 337489 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGW0 protein_id gnl|my_center|LOCUS_02990 337618 338262 gene locus_tag LOCUS_03000 337618 338262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 338674 338270 gene locus_tag LOCUS_03010 338674 338270 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS24 protein_id gnl|my_center|LOCUS_03010 339479 338841 gene locus_tag LOCUS_03020 gene nth 339479 338841 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_03020 340885 339851 gene locus_tag LOCUS_03030 gene dapD 340885 339851 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_03030 341270 340926 gene locus_tag LOCUS_03040 341270 340926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 341392 341919 gene locus_tag LOCUS_03050 341392 341919 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_03050 342103 344094 gene locus_tag LOCUS_03060 gene mcp40H-8 342103 344094 CDS product methyl-accepting chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_03060 344976 344104 gene locus_tag LOCUS_03070 344976 344104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_03070 345563 345048 gene locus_tag LOCUS_03080 345563 345048 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_03080 345787 346797 gene locus_tag LOCUS_03090 345787 346797 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_03090 346790 348319 gene locus_tag LOCUS_03100 gene rmrB 346790 348319 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070866.1 protein_id gnl|my_center|LOCUS_03100 348535 349500 gene locus_tag LOCUS_03110 348535 349500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103611.1 protein_id gnl|my_center|LOCUS_03110 349570 350673 gene locus_tag LOCUS_03120 349570 350673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704685.1 protein_id gnl|my_center|LOCUS_03120 351371 351090 gene locus_tag LOCUS_03130 351371 351090 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R6 protein_id gnl|my_center|LOCUS_03130 352148 351486 gene locus_tag LOCUS_03140 gene pphA 352148 351486 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930070.1 protein_id gnl|my_center|LOCUS_03140 353473 352145 gene locus_tag LOCUS_03150 353473 352145 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 protein_id gnl|my_center|LOCUS_03150 354083 353592 gene locus_tag LOCUS_03160 354083 353592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 354475 354933 gene locus_tag LOCUS_03170 354475 354933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 354915 355430 gene locus_tag LOCUS_03180 354915 355430 CDS product beta-1,4-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022157.1 protein_id gnl|my_center|LOCUS_03180 355430 356266 gene locus_tag LOCUS_03190 355430 356266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 356343 356699 gene locus_tag LOCUS_03200 356343 356699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 356731 357630 gene locus_tag LOCUS_03210 356731 357630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942156.1 protein_id gnl|my_center|LOCUS_03210 357743 358912 gene locus_tag LOCUS_03220 357743 358912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 358912 359874 gene locus_tag LOCUS_03230 358912 359874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 359894 361309 gene locus_tag LOCUS_03240 359894 361309 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203520.1 protein_id gnl|my_center|LOCUS_03240 361512 362783 gene locus_tag LOCUS_03250 361512 362783 CDS product coenzyme F420 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975144.1 protein_id gnl|my_center|LOCUS_03250 362824 363966 gene locus_tag LOCUS_03260 362824 363966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_03260 365301 366737 gene locus_tag LOCUS_03270 gene cpsB 365301 366737 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_03270 366836 368242 gene locus_tag LOCUS_03280 366836 368242 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_03280 368954 370036 gene locus_tag LOCUS_03290 368954 370036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 370090 370641 gene locus_tag LOCUS_03300 370090 370641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_03300 370832 372892 gene locus_tag LOCUS_03310 370832 372892 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_03310 372904 373533 gene locus_tag LOCUS_03320 372904 373533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 373957 375090 gene locus_tag LOCUS_03330 gene abhD3 373957 375090 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_03330 375289 375801 gene locus_tag LOCUS_03340 375289 375801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 375798 377039 gene locus_tag LOCUS_03350 375798 377039 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_03350 377195 377485 gene locus_tag LOCUS_03360 377195 377485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 377655 377579 gene locus_tag LOCUS_t00040 377655 377579 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 379547 377940 gene locus_tag LOCUS_03370 gene cysNC 379547 377940 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_03370 380455 379547 gene locus_tag LOCUS_03380 gene cysD 380455 379547 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_03380 380733 381362 gene locus_tag LOCUS_03390 380733 381362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_03390 381556 382671 gene locus_tag LOCUS_03400 gene zapE 381556 382671 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_03400 383948 382737 gene locus_tag LOCUS_03410 383948 382737 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_03410 384759 383941 gene locus_tag LOCUS_03420 384759 383941 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 protein_id gnl|my_center|LOCUS_03420 385703 384756 gene locus_tag LOCUS_03430 385703 384756 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_03430 385865 386719 gene locus_tag LOCUS_03440 gene pheA 385865 386719 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_03440 387656 386736 gene locus_tag LOCUS_03450 387656 386736 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_03450 388430 387819 gene locus_tag LOCUS_03460 388430 387819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03460 388807 388433 gene locus_tag LOCUS_03470 388807 388433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 389022 390917 gene locus_tag LOCUS_03480 gene htpG 389022 390917 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_03480 390989 391474 gene locus_tag LOCUS_03490 390989 391474 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688081.1 protein_id gnl|my_center|LOCUS_03490 391570 392142 gene locus_tag LOCUS_03500 391570 392142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 392142 392597 gene locus_tag LOCUS_03510 392142 392597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 392672 392926 gene locus_tag LOCUS_03520 392672 392926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315798.1 protein_id gnl|my_center|LOCUS_03520 393493 393071 gene locus_tag LOCUS_03530 393493 393071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 394104 393505 gene locus_tag LOCUS_03540 gene lexA 394104 393505 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA7 protein_id gnl|my_center|LOCUS_03540 394286 394966 gene locus_tag LOCUS_03550 gene psrA 394286 394966 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_03550 394956 395447 gene locus_tag LOCUS_03560 394956 395447 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_03560 395444 396472 gene locus_tag LOCUS_03570 gene nagZ 395444 396472 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC2 protein_id gnl|my_center|LOCUS_03570 396483 397226 gene locus_tag LOCUS_03580 396483 397226 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_03580 397238 398437 gene locus_tag LOCUS_03590 397238 398437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 protein_id gnl|my_center|LOCUS_03590 398467 398892 gene locus_tag LOCUS_03600 398467 398892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 400153 398933 gene locus_tag LOCUS_03610 400153 398933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_03610 401667 400456 gene locus_tag LOCUS_03620 401667 400456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 403739 401889 gene locus_tag LOCUS_03630 403739 401889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 404481 403747 gene locus_tag LOCUS_03640 404481 403747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 407924 404478 gene locus_tag LOCUS_03650 gene mfd 407924 404478 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_03650 408146 409594 gene locus_tag LOCUS_03660 408146 409594 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_03660 409876 411210 gene locus_tag LOCUS_03670 gene nqrA 409876 411210 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_03670 411213 412424 gene locus_tag LOCUS_03680 gene nqrB 411213 412424 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_03680 412414 413214 gene locus_tag LOCUS_03690 gene nqrC 412414 413214 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E0 protein_id gnl|my_center|LOCUS_03690 413216 413878 gene locus_tag LOCUS_03700 gene nqrD 413216 413878 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_03700 413878 414492 gene locus_tag LOCUS_03710 gene nqrE 413878 414492 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_03710 414500 415729 gene locus_tag LOCUS_03720 gene nqrF 414500 415729 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_03720 415804 416952 gene locus_tag LOCUS_03730 415804 416952 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_03730 417078 417749 gene locus_tag LOCUS_03740 gene fabG 417078 417749 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_03740 417793 418152 gene locus_tag LOCUS_03750 417793 418152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 418140 418808 gene locus_tag LOCUS_03760 418140 418808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 418895 419116 gene locus_tag LOCUS_03770 418895 419116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 420416 419160 gene locus_tag LOCUS_03780 420416 419160 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_03780 420546 420866 gene locus_tag LOCUS_03790 gene arsR 420546 420866 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008949.1 protein_id gnl|my_center|LOCUS_03790 420899 421378 gene locus_tag LOCUS_03800 420899 421378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 421378 422385 gene locus_tag LOCUS_03810 421378 422385 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_03810 422507 422665 gene locus_tag LOCUS_03820 422507 422665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 422812 424224 gene locus_tag LOCUS_03830 gene hemN 422812 424224 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_03830 424247 424981 gene locus_tag LOCUS_03840 gene btr 424247 424981 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810448.1 protein_id gnl|my_center|LOCUS_03840 425222 427408 gene locus_tag LOCUS_03850 gene katG 425222 427408 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CVH1 protein_id gnl|my_center|LOCUS_03850 430621 427478 gene locus_tag LOCUS_03860 gene putA 430621 427478 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F6 protein_id gnl|my_center|LOCUS_03860 431146 430682 gene locus_tag LOCUS_03870 431146 430682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 432965 431157 gene locus_tag LOCUS_03880 432965 431157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 433686 433135 gene locus_tag LOCUS_03890 gene folE 433686 433135 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXP6 protein_id gnl|my_center|LOCUS_03890 434580 433774 gene locus_tag LOCUS_03900 gene murI 434580 433774 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E218 protein_id gnl|my_center|LOCUS_03900 435272 434700 gene locus_tag LOCUS_03910 435272 434700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262066.1 protein_id gnl|my_center|LOCUS_03910 435796 435311 gene locus_tag LOCUS_03920 435796 435311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 435988 436458 gene locus_tag LOCUS_03930 435988 436458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 437352 436447 gene locus_tag LOCUS_03940 gene rbgA 437352 436447 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_03940 437473 437688 gene locus_tag LOCUS_03950 437473 437688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 437783 438094 gene locus_tag LOCUS_03960 gene bolA 437783 438094 CDS product morphogene protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114234.1 protein_id gnl|my_center|LOCUS_03960 438096 438752 gene locus_tag LOCUS_03970 438096 438752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_03970 438843 440207 gene locus_tag LOCUS_03980 438843 440207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_03980 440327 441184 gene locus_tag LOCUS_03990 gene ureD 440327 441184 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_03990 441188 441490 gene locus_tag LOCUS_04000 gene ureA 441188 441490 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJZ5 protein_id gnl|my_center|LOCUS_04000 441504 441809 gene locus_tag LOCUS_04010 gene ureB 441504 441809 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN07 protein_id gnl|my_center|LOCUS_04010 441809 443512 gene locus_tag LOCUS_04020 gene ureC2 441809 443512 CDS product urease subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN06 protein_id gnl|my_center|LOCUS_04020 443555 444121 gene locus_tag LOCUS_04030 443555 444121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 444165 444386 gene locus_tag LOCUS_04040 444165 444386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 444392 445084 gene locus_tag LOCUS_04050 gene ureF 444392 445084 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_04050 445308 445949 gene locus_tag LOCUS_04060 gene ureG 445308 445949 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTJ5 protein_id gnl|my_center|LOCUS_04060 446346 448940 gene locus_tag LOCUS_04070 446346 448940 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 protein_id gnl|my_center|LOCUS_04070 449736 449161 gene locus_tag LOCUS_04080 449736 449161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 449832 450506 gene locus_tag LOCUS_04090 449832 450506 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038030.1 protein_id gnl|my_center|LOCUS_04090 451541 450507 gene locus_tag LOCUS_04100 451541 450507 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_04100 452129 451551 gene locus_tag LOCUS_04110 452129 451551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_04110 452417 452136 gene locus_tag LOCUS_04120 452417 452136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 452649 453167 gene locus_tag LOCUS_04130 gene greB 452649 453167 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43882 protein_id gnl|my_center|LOCUS_04130 453222 453737 gene locus_tag LOCUS_04140 453222 453737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 454653 453754 gene locus_tag LOCUS_04150 gene ttcA 454653 453754 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_04150 455289 454795 gene locus_tag LOCUS_04160 455289 454795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 456183 455416 gene locus_tag LOCUS_04170 456183 455416 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_04170 456274 456074 gene locus_tag LOCUS_04180 456274 456074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 458721 456277 gene locus_tag LOCUS_04190 458721 456277 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_04190 459209 458721 gene locus_tag LOCUS_04200 gene ccoH 459209 458721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_04200 460712 459303 gene locus_tag LOCUS_04210 460712 459303 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_04210 461767 460856 gene locus_tag LOCUS_04220 gene ccoP 461767 460856 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_04220 461946 461770 gene locus_tag LOCUS_04230 461946 461770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 462559 461951 gene locus_tag LOCUS_04240 gene ccoO1 462559 461951 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_04240 464002 462572 gene locus_tag LOCUS_04250 gene ccoN1 464002 462572 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 protein_id gnl|my_center|LOCUS_04250 464245 464877 gene locus_tag LOCUS_04260 464245 464877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_04260 465148 464867 gene locus_tag LOCUS_04270 465148 464867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 465263 466222 gene locus_tag LOCUS_04280 465263 466222 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204922.1 protein_id gnl|my_center|LOCUS_04280 466222 466914 gene locus_tag LOCUS_04290 466222 466914 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_04290 467403 466930 gene locus_tag LOCUS_04300 gene bcp 467403 466930 CDS product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44411 protein_id gnl|my_center|LOCUS_04300 468020 467505 gene locus_tag LOCUS_04310 468020 467505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 469168 468020 gene locus_tag LOCUS_04320 gene nrdB 469168 468020 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230900.2 protein_id gnl|my_center|LOCUS_04320 471510 469207 gene locus_tag LOCUS_04330 gene nrdA 471510 469207 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH95 protein_id gnl|my_center|LOCUS_04330 471921 472661 gene locus_tag LOCUS_04340 471921 472661 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_04340 472709 474223 gene locus_tag LOCUS_04350 472709 474223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 474352 475473 gene locus_tag LOCUS_04360 474352 475473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_04360 476379 475474 gene locus_tag LOCUS_04370 gene argF 476379 475474 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 protein_id gnl|my_center|LOCUS_04370 477588 476419 gene locus_tag LOCUS_04380 gene argD 477588 476419 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_04380 478608 477703 gene locus_tag LOCUS_04390 gene rimK 478608 477703 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_04390 479043 478627 gene locus_tag LOCUS_04400 gene rimK2 479043 478627 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_04400 479371 479024 gene locus_tag LOCUS_04410 479371 479024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368901.1 protein_id gnl|my_center|LOCUS_04410 479571 480431 gene locus_tag LOCUS_04420 gene hdtR 479571 480431 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_04420 480428 481417 gene locus_tag LOCUS_04430 480428 481417 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647271.1 protein_id gnl|my_center|LOCUS_04430 482079 481399 gene locus_tag LOCUS_04440 gene piuC 482079 481399 CDS product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 protein_id gnl|my_center|LOCUS_04440 483239 482115 gene locus_tag LOCUS_04450 483239 482115 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_04450 485593 483263 gene locus_tag LOCUS_04460 485593 483263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086681.1 protein_id gnl|my_center|LOCUS_04460 486447 485596 gene locus_tag LOCUS_04470 486447 485596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 486839 486447 gene locus_tag LOCUS_04480 486839 486447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 487243 486836 gene locus_tag LOCUS_04490 487243 486836 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_604208.2 protein_id gnl|my_center|LOCUS_04490 487917 487243 gene locus_tag LOCUS_04500 487917 487243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 488814 488128 gene locus_tag LOCUS_04510 gene queE 488814 488128 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC0 protein_id gnl|my_center|LOCUS_04510 489476 488814 gene locus_tag LOCUS_04520 489476 488814 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence02 98 23 gene locus_tag LOCUS_t00050 98 23 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 670 182 gene locus_tag LOCUS_04530 670 182 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I017 protein_id gnl|my_center|LOCUS_04530 861 1490 gene locus_tag LOCUS_04540 861 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1569 2186 gene locus_tag LOCUS_04550 gene rpoE 1569 2186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_04550 2161 2490 gene locus_tag LOCUS_04560 2161 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2480 2731 gene locus_tag LOCUS_04570 2480 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2733 3242 gene locus_tag LOCUS_04580 2733 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3295 4182 gene locus_tag LOCUS_04590 3295 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4713 4270 gene locus_tag LOCUS_04600 gene msrB 4713 4270 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 protein_id gnl|my_center|LOCUS_04600 4708 5961 gene locus_tag LOCUS_04610 4708 5961 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_04610 7318 6179 gene locus_tag LOCUS_04620 gene pdxB 7318 6179 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R9 protein_id gnl|my_center|LOCUS_04620 7590 10442 gene locus_tag LOCUS_04630 gene acnB 7590 10442 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_04630 10667 10942 gene locus_tag LOCUS_04640 10667 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10939 12333 gene locus_tag LOCUS_04650 10939 12333 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_04650 12326 13435 gene locus_tag LOCUS_04660 12326 13435 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106270.1 protein_id gnl|my_center|LOCUS_04660 13432 13962 gene locus_tag LOCUS_04670 13432 13962 CDS product His-Xaa-Ser repeat protein HxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106271.1 protein_id gnl|my_center|LOCUS_04670 13989 14318 gene locus_tag LOCUS_04680 13989 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106272.1 protein_id gnl|my_center|LOCUS_04680 14514 15602 gene locus_tag LOCUS_04690 14514 15602 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_04690 16114 16380 gene locus_tag LOCUS_04700 16114 16380 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_04700 16515 17192 gene locus_tag LOCUS_04710 16515 17192 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_04710 17334 20042 gene locus_tag LOCUS_04720 17334 20042 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_04720 20991 20401 gene locus_tag LOCUS_04730 20991 20401 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 protein_id gnl|my_center|LOCUS_04730 21269 22054 gene locus_tag LOCUS_04740 21269 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 22218 23111 gene locus_tag LOCUS_04750 22218 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24976 23201 gene locus_tag LOCUS_04760 gene aspS 24976 23201 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_04760 25485 26306 gene locus_tag LOCUS_04770 25485 26306 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202679.1 protein_id gnl|my_center|LOCUS_04770 26507 26854 gene locus_tag LOCUS_04780 26507 26854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 26924 27535 gene locus_tag LOCUS_04790 26924 27535 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_04790 28312 27518 gene locus_tag LOCUS_04800 gene gloB 28312 27518 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_04800 28779 28321 gene locus_tag LOCUS_04810 28779 28321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 28851 29993 gene locus_tag LOCUS_04820 28851 29993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_04820 30063 30266 gene locus_tag LOCUS_04830 30063 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 32352 31255 gene locus_tag LOCUS_04840 32352 31255 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390575.1 protein_id gnl|my_center|LOCUS_04840 32555 34024 gene locus_tag LOCUS_04850 32555 34024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_04850 35281 34430 gene locus_tag LOCUS_04860 35281 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 35832 35347 gene locus_tag LOCUS_04870 35832 35347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 35950 37332 gene locus_tag LOCUS_04880 gene rimO 35950 37332 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNW0 protein_id gnl|my_center|LOCUS_04880 37523 39904 gene locus_tag LOCUS_04890 gene lon 37523 39904 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_04890 40932 40042 gene locus_tag LOCUS_04900 40932 40042 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704619.1 protein_id gnl|my_center|LOCUS_04900 43478 41043 gene locus_tag LOCUS_04910 43478 41043 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707108.1 protein_id gnl|my_center|LOCUS_04910 45310 43478 gene locus_tag LOCUS_04920 45310 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 45509 45991 gene locus_tag LOCUS_04930 45509 45991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_04930 46095 46493 gene locus_tag LOCUS_04940 46095 46493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 46759 46508 gene locus_tag LOCUS_04950 46759 46508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 47238 46846 gene locus_tag LOCUS_04960 47238 46846 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412376.1 protein_id gnl|my_center|LOCUS_04960 47727 47248 gene locus_tag LOCUS_04970 47727 47248 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083098.1 protein_id gnl|my_center|LOCUS_04970 48763 47984 gene locus_tag LOCUS_04980 48763 47984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 49554 48772 gene locus_tag LOCUS_04990 49554 48772 CDS product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_04990 50731 49715 gene locus_tag LOCUS_05000 gene cheB 50731 49715 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3S1 protein_id gnl|my_center|LOCUS_05000 53024 50739 gene locus_tag LOCUS_05010 53024 50739 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_05010 53818 53036 gene locus_tag LOCUS_05020 53818 53036 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 protein_id gnl|my_center|LOCUS_05020 54218 53832 gene locus_tag LOCUS_05030 54218 53832 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316827.1 protein_id gnl|my_center|LOCUS_05030 55196 54468 gene locus_tag LOCUS_05040 gene fliA 55196 54468 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29248 protein_id gnl|my_center|LOCUS_05040 56018 55200 gene locus_tag LOCUS_05050 56018 55200 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 protein_id gnl|my_center|LOCUS_05050 57380 56025 gene locus_tag LOCUS_05060 gene flhF 57380 56025 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_05060 59609 57393 gene locus_tag LOCUS_05070 gene flhA 59609 57393 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_05070 61921 60779 gene locus_tag LOCUS_05080 gene flhB 61921 60779 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_05080 62726 61950 gene locus_tag LOCUS_05090 gene fliR 62726 61950 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_05090 62999 62730 gene locus_tag LOCUS_05100 gene fliQ 62999 62730 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_05100 63918 63031 gene locus_tag LOCUS_05110 gene fliP 63918 63031 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_05110 64337 63915 gene locus_tag LOCUS_05120 64337 63915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 64791 64312 gene locus_tag LOCUS_05130 64791 64312 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YW6 protein_id gnl|my_center|LOCUS_05130 65770 64802 gene locus_tag LOCUS_05140 gene fliM 65770 64802 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_05140 66296 65778 gene locus_tag LOCUS_05150 66296 65778 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_05150 67921 66536 gene locus_tag LOCUS_05160 67921 66536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 68278 67988 gene locus_tag LOCUS_05170 68278 67988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 68787 68329 gene locus_tag LOCUS_05180 68787 68329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 70126 68807 gene locus_tag LOCUS_05190 gene fliI 70126 68807 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_05190 71318 70101 gene locus_tag LOCUS_05200 71318 70101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 72340 71318 gene locus_tag LOCUS_05210 gene fliG 72340 71318 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_05210 74048 72333 gene locus_tag LOCUS_05220 gene fliF 74048 72333 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51463 protein_id gnl|my_center|LOCUS_05220 74464 74063 gene locus_tag LOCUS_05230 74464 74063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 75950 74583 gene locus_tag LOCUS_05240 gene fleR 75950 74583 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_05240 77194 75995 gene locus_tag LOCUS_05250 gene fleS 77194 75995 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_05250 79548 78112 gene locus_tag LOCUS_05260 gene fleQ 79548 78112 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_05260 80307 79858 gene locus_tag LOCUS_05270 gene fliS 80307 79858 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_05270 80579 82618 gene locus_tag LOCUS_05280 80579 82618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 83311 82628 gene locus_tag LOCUS_05290 gene ung 83311 82628 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_05290 83424 84311 gene locus_tag LOCUS_05300 83424 84311 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460669.1 protein_id gnl|my_center|LOCUS_05300 85667 84405 gene locus_tag LOCUS_05310 85667 84405 CDS product arabinose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279096.1 protein_id gnl|my_center|LOCUS_05310 86860 85670 gene locus_tag LOCUS_05320 86860 85670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 87162 88085 gene locus_tag LOCUS_05330 87162 88085 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477402.1 protein_id gnl|my_center|LOCUS_05330 88599 88105 gene locus_tag LOCUS_05340 88599 88105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 89331 88627 gene locus_tag LOCUS_05350 89331 88627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 91323 89503 gene locus_tag LOCUS_05360 91323 89503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 92505 91429 gene locus_tag LOCUS_05370 92505 91429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 93072 92599 gene locus_tag LOCUS_05380 gene ybaK 93072 92599 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3V9 protein_id gnl|my_center|LOCUS_05380 93403 93194 gene locus_tag LOCUS_05390 93403 93194 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_05390 94147 93644 gene locus_tag LOCUS_05400 gene yjgM 94147 93644 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262212.1 protein_id gnl|my_center|LOCUS_05400 94338 94982 gene locus_tag LOCUS_05410 94338 94982 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38102 protein_id gnl|my_center|LOCUS_05410 95355 94993 gene locus_tag LOCUS_05420 95355 94993 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037385.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 97541 96021 gene locus_tag LOCUS_05430 gene lysS 97541 96021 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB1 protein_id gnl|my_center|LOCUS_05430 98742 97840 gene locus_tag LOCUS_05440 gene prfB 98742 97840 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 103007 99054 gene locus_tag LOCUS_05450 103007 99054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 103493 103119 gene locus_tag LOCUS_05460 103493 103119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 106646 103563 gene locus_tag LOCUS_05470 106646 103563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 107098 109137 gene locus_tag LOCUS_05480 107098 109137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 109140 110123 gene locus_tag LOCUS_05490 109140 110123 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786732.1 protein_id gnl|my_center|LOCUS_05490 110116 111291 gene locus_tag LOCUS_05500 110116 111291 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261001.1 protein_id gnl|my_center|LOCUS_05500 111288 112430 gene locus_tag LOCUS_05510 111288 112430 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_05510 112420 113496 gene locus_tag LOCUS_05520 112420 113496 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 protein_id gnl|my_center|LOCUS_05520 113474 114172 gene locus_tag LOCUS_05530 gene pglB 113474 114172 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403382.1 protein_id gnl|my_center|LOCUS_05530 114175 115239 gene locus_tag LOCUS_05540 114175 115239 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 protein_id gnl|my_center|LOCUS_05540 115236 115958 gene locus_tag LOCUS_05550 115236 115958 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 protein_id gnl|my_center|LOCUS_05550 115942 117306 gene locus_tag LOCUS_05560 115942 117306 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466255.1 protein_id gnl|my_center|LOCUS_05560 117306 118073 gene locus_tag LOCUS_05570 gene ptmA 117306 118073 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_05570 118083 118754 gene locus_tag LOCUS_05580 118083 118754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 118805 119875 gene locus_tag LOCUS_05590 gene pseA 118805 119875 CDS product flagellin modification protein, PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_05590 119872 120492 gene locus_tag LOCUS_05600 gene hisH 119872 120492 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_05600 120485 121279 gene locus_tag LOCUS_05610 gene hisF 120485 121279 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66567 protein_id gnl|my_center|LOCUS_05610 121418 122008 gene locus_tag LOCUS_05620 121418 122008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879652.1 protein_id gnl|my_center|LOCUS_05620 121999 122520 gene locus_tag LOCUS_05630 121999 122520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 122767 125136 gene locus_tag LOCUS_05640 122767 125136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 125679 125209 gene locus_tag LOCUS_05650 125679 125209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 125876 127375 gene locus_tag LOCUS_05660 125876 127375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369856.1 protein_id gnl|my_center|LOCUS_05660 129192 127441 gene locus_tag LOCUS_05670 gene ycjM 129192 127441 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602336.1 protein_id gnl|my_center|LOCUS_05670 129822 129214 gene locus_tag LOCUS_05680 129822 129214 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_05680 131649 129829 gene locus_tag LOCUS_05690 gene edd 131649 129829 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_05690 132375 131674 gene locus_tag LOCUS_05700 gene pgl 132375 131674 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_05700 133840 132383 gene locus_tag LOCUS_05710 gene zwf 133840 132383 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKN7 protein_id gnl|my_center|LOCUS_05710 134178 135014 gene locus_tag LOCUS_05720 gene galU 134178 135014 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_05720 135019 136368 gene locus_tag LOCUS_05730 gene manB 135019 136368 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_05730 136494 136569 gene locus_tag LOCUS_t00060 136494 136569 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 136578 136654 gene locus_tag LOCUS_t00070 136578 136654 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 136733 136969 gene locus_tag LOCUS_05740 136733 136969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 137740 137048 gene locus_tag LOCUS_05750 137740 137048 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_05750 138100 137885 gene locus_tag LOCUS_05760 138100 137885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 138236 139057 gene locus_tag LOCUS_05770 138236 139057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 139879 139121 gene locus_tag LOCUS_05780 139879 139121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 140843 140133 gene locus_tag LOCUS_05790 gene purC 140843 140133 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_05790 141648 140866 gene locus_tag LOCUS_05800 141648 140866 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_05800 142289 141645 gene locus_tag LOCUS_05810 142289 141645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 143171 142296 gene locus_tag LOCUS_05820 gene dapA 143171 142296 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_05820 144368 143301 gene locus_tag LOCUS_05830 144368 143301 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 protein_id gnl|my_center|LOCUS_05830 144617 144372 gene locus_tag LOCUS_05840 144617 144372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_05840 144744 146177 gene locus_tag LOCUS_05850 144744 146177 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_05850 147321 146278 gene locus_tag LOCUS_05860 gene nadA 147321 146278 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_05860 147573 147498 gene locus_tag LOCUS_t00080 147573 147498 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 147692 147617 gene locus_tag LOCUS_t00090 147692 147617 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 148683 147844 gene locus_tag LOCUS_05870 148683 147844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 149216 148683 gene locus_tag LOCUS_05880 gene pal 149216 148683 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418623.1 protein_id gnl|my_center|LOCUS_05880 150506 149256 gene locus_tag LOCUS_05890 gene tolB 150506 149256 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 protein_id gnl|my_center|LOCUS_05890 151471 150536 gene locus_tag LOCUS_05900 151471 150536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 151922 151473 gene locus_tag LOCUS_05910 gene tolR 151922 151473 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_05910 152629 151922 gene locus_tag LOCUS_05920 152629 151922 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_05920 153801 152761 gene locus_tag LOCUS_05930 gene ruvB 153801 152761 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_05930 154421 153813 gene locus_tag LOCUS_05940 gene ruvA 154421 153813 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBL2 protein_id gnl|my_center|LOCUS_05940 155040 154522 gene locus_tag LOCUS_05950 gene ruvC 155040 154522 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL3 protein_id gnl|my_center|LOCUS_05950 155446 155042 gene locus_tag LOCUS_05960 155446 155042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 158159 155574 gene locus_tag LOCUS_05970 gene clpB 158159 155574 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_05970 158328 159209 gene locus_tag LOCUS_05980 158328 159209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_05980 159281 160180 gene locus_tag LOCUS_05990 159281 160180 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 protein_id gnl|my_center|LOCUS_05990 160617 160171 gene locus_tag LOCUS_06000 160617 160171 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_06000 160820 162949 gene locus_tag LOCUS_06010 gene prc 160820 162949 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_06010 163679 162981 gene locus_tag LOCUS_06020 163679 162981 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268586.1 protein_id gnl|my_center|LOCUS_06020 164694 163681 gene locus_tag LOCUS_06030 164694 163681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269704.1 protein_id gnl|my_center|LOCUS_06030 164841 165890 gene locus_tag LOCUS_06040 gene purM 164841 165890 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI8 protein_id gnl|my_center|LOCUS_06040 165887 166573 gene locus_tag LOCUS_06050 gene purN 165887 166573 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ91 protein_id gnl|my_center|LOCUS_06050 166615 167313 gene locus_tag LOCUS_06060 166615 167313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 167371 167952 gene locus_tag LOCUS_06070 gene dcd 167371 167952 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFZ8 protein_id gnl|my_center|LOCUS_06070 168126 168201 gene locus_tag LOCUS_t00100 168126 168201 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 168329 170236 gene locus_tag LOCUS_06080 gene wbfY 168329 170236 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_06080 170725 170288 gene locus_tag LOCUS_06090 gene wbfU 170725 170288 CDS product galactosyl transferase WbfU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073059.1 protein_id gnl|my_center|LOCUS_06090 172804 171812 gene locus_tag LOCUS_06100 172804 171812 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_06100 173825 172887 gene locus_tag LOCUS_06110 173825 172887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 174824 173826 gene locus_tag LOCUS_06120 gene glf 174824 173826 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 protein_id gnl|my_center|LOCUS_06120 176148 174973 gene locus_tag LOCUS_06130 176148 174973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 178683 176266 gene locus_tag LOCUS_06140 178683 176266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 179197 178685 gene locus_tag LOCUS_06150 179197 178685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 180893 179922 gene locus_tag LOCUS_06160 180893 179922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 182367 180904 gene locus_tag LOCUS_06170 182367 180904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 183005 182364 gene locus_tag LOCUS_06180 gene rfbB 183005 182364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112130.1 protein_id gnl|my_center|LOCUS_06180 184474 183002 gene locus_tag LOCUS_06190 184474 183002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 185183 184485 gene locus_tag LOCUS_06200 gene pyrF 185183 184485 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58644 protein_id gnl|my_center|LOCUS_06200 186358 185180 gene locus_tag LOCUS_06210 gene lapB 186358 185180 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_06210 186711 186409 gene locus_tag LOCUS_06220 gene ihfB 186711 186409 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_06220 188568 186883 gene locus_tag LOCUS_06230 gene rpsA 188568 186883 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_06230 189370 188696 gene locus_tag LOCUS_06240 gene cmk 189370 188696 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_06240 191625 189376 gene locus_tag LOCUS_06250 gene aroA 191625 189376 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_06250 192734 191622 gene locus_tag LOCUS_06260 gene hisC2 192734 191622 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_06260 193861 192743 gene locus_tag LOCUS_06270 gene pheA 193861 192743 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_06270 194936 193854 gene locus_tag LOCUS_06280 gene serC 194936 193854 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T5 protein_id gnl|my_center|LOCUS_06280 197644 195014 gene locus_tag LOCUS_06290 gene gyrA 197644 195014 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3Q9 protein_id gnl|my_center|LOCUS_06290 199312 197846 gene locus_tag LOCUS_06300 gene rhlE 199312 197846 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_06300 199503 200822 gene locus_tag LOCUS_06310 199503 200822 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_06310 200858 201598 gene locus_tag LOCUS_06320 gene ubiG 200858 201598 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_06320 201595 202290 gene locus_tag LOCUS_06330 gene gph2 201595 202290 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_06330 202298 203050 gene locus_tag LOCUS_06340 202298 203050 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_06340 203374 204312 gene locus_tag LOCUS_06350 203374 204312 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_06350 206188 205349 gene locus_tag LOCUS_06360 206188 205349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 207089 206181 gene locus_tag LOCUS_06370 207089 206181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 207918 207058 gene locus_tag LOCUS_06380 207918 207058 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 protein_id gnl|my_center|LOCUS_06380 209005 207989 gene locus_tag LOCUS_06390 gene trpS 209005 207989 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7X0 protein_id gnl|my_center|LOCUS_06390 209698 209090 gene locus_tag LOCUS_06400 gene alkB 209698 209090 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_06400 210743 210123 gene locus_tag LOCUS_06410 210743 210123 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_06410 211624 210740 gene locus_tag LOCUS_06420 211624 210740 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114833.1 protein_id gnl|my_center|LOCUS_06420 211691 212296 gene locus_tag LOCUS_06430 211691 212296 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V24 protein_id gnl|my_center|LOCUS_06430 212293 212592 gene locus_tag LOCUS_06440 gene yciL 212293 212592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_06440 212589 213272 gene locus_tag LOCUS_06450 212589 213272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 213283 213867 gene locus_tag LOCUS_06460 gene ppiA 213283 213867 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MV77 protein_id gnl|my_center|LOCUS_06460 213874 215904 gene locus_tag LOCUS_06470 gene mnmC 213874 215904 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_06470 216195 215893 gene locus_tag LOCUS_06480 216195 215893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 216601 216182 gene locus_tag LOCUS_06490 216601 216182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_06490 216982 218868 gene locus_tag LOCUS_06500 216982 218868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 220072 218924 gene locus_tag LOCUS_06510 220072 218924 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_06510 221481 220381 gene locus_tag LOCUS_06520 gene aroC 221481 220381 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC2 protein_id gnl|my_center|LOCUS_06520 222455 221544 gene locus_tag LOCUS_06530 gene prmB 222455 221544 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_06530 223500 222562 gene locus_tag LOCUS_06540 gene rssA 223500 222562 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_06540 224400 223510 gene locus_tag LOCUS_06550 224400 223510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 225444 224578 gene locus_tag LOCUS_06560 225444 224578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 225850 225428 gene locus_tag LOCUS_06570 225850 225428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 227254 226019 gene locus_tag LOCUS_06580 227254 226019 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_06580 227408 227758 gene locus_tag LOCUS_06590 gene arsC 227408 227758 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_06590 227758 228360 gene locus_tag LOCUS_06600 gene wrbA 227758 228360 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_06600 228357 228734 gene locus_tag LOCUS_06610 228357 228734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 229068 228844 gene locus_tag LOCUS_06620 229068 228844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 229252 229923 gene locus_tag LOCUS_06630 gene gstA 229252 229923 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_06630 229946 232348 gene locus_tag LOCUS_06640 229946 232348 CDS product 9-hexadecenoic acid cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106322.1 protein_id gnl|my_center|LOCUS_06640 232576 232418 gene locus_tag LOCUS_06650 232576 232418 CDS product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 protein_id gnl|my_center|LOCUS_06650 233441 232638 gene locus_tag LOCUS_06660 233441 232638 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406281.1 protein_id gnl|my_center|LOCUS_06660 234533 233586 gene locus_tag LOCUS_06670 234533 233586 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_06670 235079 234606 gene locus_tag LOCUS_06680 235079 234606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 protein_id gnl|my_center|LOCUS_06680 235232 236104 gene locus_tag LOCUS_06690 235232 236104 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 protein_id gnl|my_center|LOCUS_06690 237026 236151 gene locus_tag LOCUS_06700 237026 236151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 240193 237197 gene locus_tag LOCUS_06710 gene oar 240193 237197 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_06710 241838 240435 gene locus_tag LOCUS_06720 gene yegQ 241838 240435 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_06720 242430 241963 gene locus_tag LOCUS_06730 242430 241963 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_06730 242605 244050 gene locus_tag LOCUS_06740 gene ycf24 242605 244050 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_06740 244324 245088 gene locus_tag LOCUS_06750 244324 245088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_06750 245088 246401 gene locus_tag LOCUS_06760 gene sufD 245088 246401 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_06760 246401 247654 gene locus_tag LOCUS_06770 246401 247654 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_06770 247708 248082 gene locus_tag LOCUS_06780 gene sufA 247708 248082 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367171.1 protein_id gnl|my_center|LOCUS_06780 249324 248395 gene locus_tag LOCUS_06790 249324 248395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 250130 249774 gene locus_tag LOCUS_06800 gene qacF 250130 249774 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_06800 252234 250297 gene locus_tag LOCUS_06810 gene acsA2 252234 250297 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_06810 252592 253509 gene locus_tag LOCUS_06820 252592 253509 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 protein_id gnl|my_center|LOCUS_06820 254174 253530 gene locus_tag LOCUS_06830 gene pdxH 254174 253530 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDP5 protein_id gnl|my_center|LOCUS_06830 254272 254721 gene locus_tag LOCUS_06840 254272 254721 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_06840 255836 254772 gene locus_tag LOCUS_06850 255836 254772 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_06850 256903 255833 gene locus_tag LOCUS_06860 256903 255833 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_06860 257097 258560 gene locus_tag LOCUS_06870 gene pepA 257097 258560 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_06870 <260533 258645 gene locus_tag LOCUS_06880 <260533 258645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941476.1:membrane protein >Feature sequence03 223 624 gene locus_tag LOCUS_06890 223 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1151 855 gene locus_tag LOCUS_06900 1151 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2009 1194 gene locus_tag LOCUS_06910 2009 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204740.1 protein_id gnl|my_center|LOCUS_06910 3012 1993 gene locus_tag LOCUS_06920 3012 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935873.1 protein_id gnl|my_center|LOCUS_06920 6096 3985 gene locus_tag LOCUS_06930 6096 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_06930 6603 6097 gene locus_tag LOCUS_06940 6603 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7754 6606 gene locus_tag LOCUS_06950 7754 6606 CDS product UNC-44 ankyrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_06950 10331 7779 gene locus_tag LOCUS_06960 10331 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_06960 13788 10339 gene locus_tag LOCUS_06970 13788 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_06970 17345 13788 gene locus_tag LOCUS_06980 17345 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038868.1 protein_id gnl|my_center|LOCUS_06980 17998 17360 gene locus_tag LOCUS_06990 17998 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_06990 18627 17995 gene locus_tag LOCUS_07000 18627 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 19012 20037 gene locus_tag LOCUS_07010 19012 20037 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 protein_id gnl|my_center|LOCUS_07010 20818 20069 gene locus_tag LOCUS_07020 20818 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_07020 21516 20884 gene locus_tag LOCUS_07030 21516 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 22405 21596 gene locus_tag LOCUS_07040 22405 21596 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103698.1 protein_id gnl|my_center|LOCUS_07040 23463 22483 gene locus_tag LOCUS_07050 23463 22483 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061840.1 protein_id gnl|my_center|LOCUS_07050 23840 24061 gene locus_tag LOCUS_07060 23840 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 24058 24375 gene locus_tag LOCUS_07070 24058 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 24641 25183 gene locus_tag LOCUS_07080 gene isiB 24641 25183 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 protein_id gnl|my_center|LOCUS_07080 27467 26127 gene locus_tag LOCUS_07090 gene clpX 27467 26127 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_07090 28357 27467 gene locus_tag LOCUS_07100 28357 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 28863 28354 gene locus_tag LOCUS_07110 28863 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 29265 28933 gene locus_tag LOCUS_07120 gene nifW 29265 28933 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS27 protein_id gnl|my_center|LOCUS_07120 29841 29335 gene locus_tag LOCUS_07130 29841 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 30721 29888 gene locus_tag LOCUS_07140 30721 29888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31926 30694 gene locus_tag LOCUS_07150 31926 30694 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_07150 33157 31949 gene locus_tag LOCUS_07160 33157 31949 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_07160 34076 33159 gene locus_tag LOCUS_07170 34076 33159 CDS product nitrogen fixation protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EB3 protein_id gnl|my_center|LOCUS_07170 34422 34099 gene locus_tag LOCUS_07180 34422 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 protein_id gnl|my_center|LOCUS_07180 35306 34773 gene locus_tag LOCUS_07190 35306 34773 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706837.1 protein_id gnl|my_center|LOCUS_07190 37333 36488 gene locus_tag LOCUS_07200 37333 36488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 37704 37312 gene locus_tag LOCUS_07210 37704 37312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 37940 37701 gene locus_tag LOCUS_07220 37940 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 38813 38514 gene locus_tag LOCUS_07230 38813 38514 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_07230 39219 39001 gene locus_tag LOCUS_07240 39219 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 39710 39246 gene locus_tag LOCUS_07250 39710 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_07250 40250 39780 gene locus_tag LOCUS_07260 40250 39780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 41646 40270 gene locus_tag LOCUS_07270 41646 40270 CDS product nitrogenase molybdenum-cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_07270 43088 41643 gene locus_tag LOCUS_07280 gene nifE 43088 41643 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55673 protein_id gnl|my_center|LOCUS_07280 43626 43288 gene locus_tag LOCUS_07290 43626 43288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 44395 43841 gene locus_tag LOCUS_07300 gene ybcL 44395 43841 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 protein_id gnl|my_center|LOCUS_07300 44637 46541 gene locus_tag LOCUS_07310 44637 46541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 46672 47133 gene locus_tag LOCUS_07320 46672 47133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 47254 49158 gene locus_tag LOCUS_07330 47254 49158 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268122.1 protein_id gnl|my_center|LOCUS_07330 49258 50652 gene locus_tag LOCUS_07340 gene norM 49258 50652 CDS product multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82855 protein_id gnl|my_center|LOCUS_07340 50808 50662 gene locus_tag LOCUS_07350 50808 50662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 51142 50990 gene locus_tag LOCUS_07360 51142 50990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 51366 51728 gene locus_tag LOCUS_07370 51366 51728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 52212 51850 gene locus_tag LOCUS_07380 52212 51850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 53999 52404 gene locus_tag LOCUS_07390 53999 52404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_07390 54262 54008 gene locus_tag LOCUS_07400 54262 54008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 54539 55027 gene locus_tag LOCUS_07410 54539 55027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 55090 55914 gene locus_tag LOCUS_07420 55090 55914 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267943.1 protein_id gnl|my_center|LOCUS_07420 56041 56733 gene locus_tag LOCUS_07430 gene modB 56041 56733 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_07430 56724 57809 gene locus_tag LOCUS_07440 gene modC 56724 57809 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 protein_id gnl|my_center|LOCUS_07440 57846 58199 gene locus_tag LOCUS_07450 57846 58199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 59541 58792 gene locus_tag LOCUS_07460 59541 58792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 60683 59856 gene locus_tag LOCUS_07470 60683 59856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 61085 60687 gene locus_tag LOCUS_07480 61085 60687 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_07480 61643 61143 gene locus_tag LOCUS_07490 61643 61143 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462739.1 protein_id gnl|my_center|LOCUS_07490 62805 61663 gene locus_tag LOCUS_07500 62805 61663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460509.1 protein_id gnl|my_center|LOCUS_07500 64298 64041 gene locus_tag LOCUS_07510 64298 64041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 64737 64312 gene locus_tag LOCUS_07520 64737 64312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 65248 64724 gene locus_tag LOCUS_07530 65248 64724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 65664 65245 gene locus_tag LOCUS_07540 65664 65245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 66423 65668 gene locus_tag LOCUS_07550 66423 65668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_07550 66696 66427 gene locus_tag LOCUS_07560 66696 66427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 67418 66693 gene locus_tag LOCUS_07570 67418 66693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 67639 67421 gene locus_tag LOCUS_07580 67639 67421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 69755 68184 gene locus_tag LOCUS_07590 gene nifK 69755 68184 CDS product nitrogenase molybdenum-iron protein beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20621 protein_id gnl|my_center|LOCUS_07590 71459 69978 gene locus_tag LOCUS_07600 gene nifD 71459 69978 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06121 protein_id gnl|my_center|LOCUS_07600 72548 71673 gene locus_tag LOCUS_07610 gene nifH 72548 71673 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C2 protein_id gnl|my_center|LOCUS_07610 73002 73874 gene locus_tag LOCUS_07620 73002 73874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 74026 74244 gene locus_tag LOCUS_07630 74026 74244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 74426 75427 gene locus_tag LOCUS_07640 74426 75427 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_07640 75973 75455 gene locus_tag LOCUS_07650 75973 75455 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923342.1 protein_id gnl|my_center|LOCUS_07650 77608 76391 gene locus_tag LOCUS_07660 77608 76391 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_07660 78276 78070 gene locus_tag LOCUS_07670 78276 78070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 78855 78292 gene locus_tag LOCUS_07680 78855 78292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 79649 78897 gene locus_tag LOCUS_07690 79649 78897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 79928 79662 gene locus_tag LOCUS_07700 79928 79662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 80266 79928 gene locus_tag LOCUS_07710 80266 79928 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL7 protein_id gnl|my_center|LOCUS_07710 81071 80292 gene locus_tag LOCUS_07720 81071 80292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 81720 81094 gene locus_tag LOCUS_07730 81720 81094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 82101 81745 gene locus_tag LOCUS_07740 82101 81745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 82494 82216 gene locus_tag LOCUS_07750 82494 82216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 84012 82507 gene locus_tag LOCUS_07760 gene nifB 84012 82507 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06770 protein_id gnl|my_center|LOCUS_07760 84902 85222 gene locus_tag LOCUS_07770 84902 85222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 85247 85687 gene locus_tag LOCUS_07780 85247 85687 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_07780 85917 85738 gene locus_tag LOCUS_07790 85917 85738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 85916 87205 gene locus_tag LOCUS_07800 85916 87205 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 protein_id gnl|my_center|LOCUS_07800 88026 87262 gene locus_tag LOCUS_07810 88026 87262 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_07810 88154 89032 gene locus_tag LOCUS_07820 88154 89032 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090284.1 protein_id gnl|my_center|LOCUS_07820 89278 90711 gene locus_tag LOCUS_07830 89278 90711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 90702 92267 gene locus_tag LOCUS_07840 90702 92267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 93936 92341 gene locus_tag LOCUS_07850 gene nifA-2 93936 92341 CDS product Nif-specific regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_07850 95544 93952 gene locus_tag LOCUS_07860 95544 93952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 95908 96480 gene locus_tag LOCUS_07870 gene rnfA 95908 96480 CDS product electron transport complex subunit RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC6 protein_id gnl|my_center|LOCUS_07870 96507 97034 gene locus_tag LOCUS_07880 96507 97034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 97036 98628 gene locus_tag LOCUS_07890 gene rnfC 97036 98628 CDS product electron transport complex subunit RnfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC4 protein_id gnl|my_center|LOCUS_07890 98625 99707 gene locus_tag LOCUS_07900 gene rnfD 98625 99707 CDS product electron transport complex subunit RnfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC3 protein_id gnl|my_center|LOCUS_07900 99732 100373 gene locus_tag LOCUS_07910 99732 100373 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_07910 100370 101038 gene locus_tag LOCUS_07920 gene rnfE 100370 101038 CDS product electron transport complex subunit RnfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC1 protein_id gnl|my_center|LOCUS_07920 101047 101310 gene locus_tag LOCUS_07930 gene rnfH 101047 101310 CDS product protein RnfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXC0 protein_id gnl|my_center|LOCUS_07930 101457 102473 gene locus_tag LOCUS_07940 101457 102473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 102473 104113 gene locus_tag LOCUS_07950 102473 104113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 105086 104133 gene locus_tag LOCUS_07960 gene ldh 105086 104133 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324694.1 protein_id gnl|my_center|LOCUS_07960 106916 105201 gene locus_tag LOCUS_07970 106916 105201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 107493 108467 gene locus_tag LOCUS_07980 gene moaA 107493 108467 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 protein_id gnl|my_center|LOCUS_07980 108469 109053 gene locus_tag LOCUS_07990 gene mobA 108469 109053 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_07990 109046 109570 gene locus_tag LOCUS_08000 109046 109570 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY1 protein_id gnl|my_center|LOCUS_08000 109574 110071 gene locus_tag LOCUS_08010 gene moaC 109574 110071 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY2 protein_id gnl|my_center|LOCUS_08010 110068 110310 gene locus_tag LOCUS_08020 gene moaD 110068 110310 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY3 protein_id gnl|my_center|LOCUS_08020 110311 110766 gene locus_tag LOCUS_08030 110311 110766 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_08030 111953 110832 gene locus_tag LOCUS_08040 gene pilU 111953 110832 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_08040 112999 111962 gene locus_tag LOCUS_08050 gene pilT 112999 111962 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_08050 113241 113963 gene locus_tag LOCUS_08060 113241 113963 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461710.1 protein_id gnl|my_center|LOCUS_08060 113960 114781 gene locus_tag LOCUS_08070 gene proC 113960 114781 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_08070 114895 115521 gene locus_tag LOCUS_08080 114895 115521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_08080 115518 115823 gene locus_tag LOCUS_08090 115518 115823 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY9 protein_id gnl|my_center|LOCUS_08090 115912 117069 gene locus_tag LOCUS_08100 gene metX 115912 117069 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57714 protein_id gnl|my_center|LOCUS_08100 117066 117674 gene locus_tag LOCUS_08110 117066 117674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_08110 117676 118134 gene locus_tag LOCUS_08120 117676 118134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_08120 118137 118733 gene locus_tag LOCUS_08130 gene rdgB 118137 118733 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83JS0 protein_id gnl|my_center|LOCUS_08130 118750 119889 gene locus_tag LOCUS_08140 118750 119889 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_08140 120531 119947 gene locus_tag LOCUS_08150 120531 119947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_08150 120674 120994 gene locus_tag LOCUS_08160 120674 120994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_08160 121105 121932 gene locus_tag LOCUS_08170 121105 121932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102782.1 protein_id gnl|my_center|LOCUS_08170 122063 122851 gene locus_tag LOCUS_08180 122063 122851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884454.1 protein_id gnl|my_center|LOCUS_08180 123651 122914 gene locus_tag LOCUS_08190 123651 122914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 123769 124353 gene locus_tag LOCUS_08200 123769 124353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_08200 125394 124669 gene locus_tag LOCUS_08210 gene plsC 125394 124669 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA1 protein_id gnl|my_center|LOCUS_08210 126942 125425 gene locus_tag LOCUS_08220 gene ilvA1 126942 125425 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_08220 127053 127727 gene locus_tag LOCUS_08230 gene rpiA 127053 127727 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_08230 127753 130518 gene locus_tag LOCUS_08240 127753 130518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 130669 131679 gene locus_tag LOCUS_08250 gene hemB 130669 131679 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_08250 131683 133830 gene locus_tag LOCUS_08260 gene ppk 131683 133830 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_08260 135354 133846 gene locus_tag LOCUS_08270 gene ppx 135354 133846 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_08270 135492 135818 gene locus_tag LOCUS_08280 gene trxA 135492 135818 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_08280 136029 137291 gene locus_tag LOCUS_08290 gene rho 136029 137291 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_08290 137721 138335 gene locus_tag LOCUS_08300 gene ychE 137721 138335 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_08300 138413 138904 gene locus_tag LOCUS_08310 138413 138904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 140359 138938 gene locus_tag LOCUS_08320 140359 138938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 142587 140773 gene locus_tag LOCUS_08330 gene glmS 142587 140773 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX0 protein_id gnl|my_center|LOCUS_08330 143383 142589 gene locus_tag LOCUS_08340 gene srlR 143383 142589 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 protein_id gnl|my_center|LOCUS_08340 144998 143439 gene locus_tag LOCUS_08350 144998 143439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 145768 145136 gene locus_tag LOCUS_08360 gene dsbA 145768 145136 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_08360 146576 145974 gene locus_tag LOCUS_08370 gene cc4 146576 145974 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_08370 146919 146620 gene locus_tag LOCUS_08380 gene scyA 146919 146620 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_08380 147091 147753 gene locus_tag LOCUS_08390 gene engB 147091 147753 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG0 protein_id gnl|my_center|LOCUS_08390 149853 147997 gene locus_tag LOCUS_08400 149853 147997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 151873 150035 gene locus_tag LOCUS_08410 151873 150035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 152096 153640 gene locus_tag LOCUS_08420 152096 153640 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_08420 156764 153969 gene locus_tag LOCUS_08430 gene polA 156764 153969 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_08430 156837 157130 gene locus_tag LOCUS_08440 156837 157130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 157170 158153 gene locus_tag LOCUS_08450 gene thrB 157170 158153 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ53 protein_id gnl|my_center|LOCUS_08450 158310 159329 gene locus_tag LOCUS_08460 158310 159329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528805.1 protein_id gnl|my_center|LOCUS_08460 159932 159621 gene locus_tag LOCUS_08470 159932 159621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 160894 160070 gene locus_tag LOCUS_08480 160894 160070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 161528 160884 gene locus_tag LOCUS_08490 gene pnuT 161528 160884 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_08490 161843 161577 gene locus_tag LOCUS_08500 161843 161577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 164047 161936 gene locus_tag LOCUS_08510 164047 161936 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_08510 164570 164962 gene locus_tag LOCUS_08520 164570 164962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 164975 165169 gene locus_tag LOCUS_08530 164975 165169 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_08530 165312 166202 gene locus_tag LOCUS_08540 gene htpX 165312 166202 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I013 protein_id gnl|my_center|LOCUS_08540 166388 167107 gene locus_tag LOCUS_08550 gene gufA 166388 167107 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_08550 167132 167617 gene locus_tag LOCUS_08560 167132 167617 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_08560 168691 167636 gene locus_tag LOCUS_08570 168691 167636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 169300 168698 gene locus_tag LOCUS_08580 169300 168698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 171023 169302 gene locus_tag LOCUS_08590 171023 169302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 171168 171974 gene locus_tag LOCUS_08600 171168 171974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_08600 172161 171982 gene locus_tag LOCUS_08610 172161 171982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 172796 172158 gene locus_tag LOCUS_08620 172796 172158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 173143 172820 gene locus_tag LOCUS_08630 173143 172820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 173499 173218 gene locus_tag LOCUS_08640 173499 173218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 175556 173496 gene locus_tag LOCUS_08650 gene prlC 175556 173496 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_08650 175921 176625 gene locus_tag LOCUS_08660 175921 176625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 176738 177025 gene locus_tag LOCUS_08670 gene parD-4 176738 177025 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_08670 176985 177293 gene locus_tag LOCUS_08680 176985 177293 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_08680 177309 177872 gene locus_tag LOCUS_08690 177309 177872 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_08690 178782 177883 gene locus_tag LOCUS_08700 178782 177883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 180342 178804 gene locus_tag LOCUS_08710 180342 178804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 182035 180578 gene locus_tag LOCUS_08720 182035 180578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 182166 182657 gene locus_tag LOCUS_08730 gene rpoE1 182166 182657 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533844.1 protein_id gnl|my_center|LOCUS_08730 182664 183377 gene locus_tag LOCUS_08740 182664 183377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 183626 183408 gene locus_tag LOCUS_08750 183626 183408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 184671 183718 gene locus_tag LOCUS_08760 184671 183718 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259727.1 protein_id gnl|my_center|LOCUS_08760 185077 184754 gene locus_tag LOCUS_08770 185077 184754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 185225 186010 gene locus_tag LOCUS_08780 185225 186010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 187233 186154 gene locus_tag LOCUS_08790 187233 186154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 188155 187247 gene locus_tag LOCUS_08800 188155 187247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 190416 188347 gene locus_tag LOCUS_08810 190416 188347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 191596 190430 gene locus_tag LOCUS_08820 gene livK 191596 190430 CDS product leucine/isoleucine/valine-binding protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121339.1 protein_id gnl|my_center|LOCUS_08820 192658 191780 gene locus_tag LOCUS_08830 192658 191780 CDS product putative oxidoreductase EphD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700844.1 protein_id gnl|my_center|LOCUS_08830 192735 193364 gene locus_tag LOCUS_08840 192735 193364 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_08840 193366 193692 gene locus_tag LOCUS_08850 gene yqjZ 193366 193692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_08850 193709 194818 gene locus_tag LOCUS_08860 gene selD 193709 194818 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKE7 protein_id gnl|my_center|LOCUS_08860 194815 195948 gene locus_tag LOCUS_08870 gene selU 194815 195948 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_08870 195957 196835 gene locus_tag LOCUS_08880 gene phnD 195957 196835 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_08880 196838 197491 gene locus_tag LOCUS_08890 gene phnC1 196838 197491 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889G0 protein_id gnl|my_center|LOCUS_08890 197491 199032 gene locus_tag LOCUS_08900 gene phnE 197491 199032 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_08900 201144 199057 gene locus_tag LOCUS_08910 201144 199057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 201276 201917 gene locus_tag LOCUS_08920 201276 201917 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_08920 201994 202998 gene locus_tag LOCUS_08930 201994 202998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 203558 203124 gene locus_tag LOCUS_08940 203558 203124 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_08940 203803 204306 gene locus_tag LOCUS_08950 203803 204306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719538.1 protein_id gnl|my_center|LOCUS_08950 204416 205975 gene locus_tag LOCUS_08960 204416 205975 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_08960 208435 206960 gene locus_tag LOCUS_08970 208435 206960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 208607 209326 gene locus_tag LOCUS_08980 208607 209326 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_08980 210402 209404 gene locus_tag LOCUS_08990 210402 209404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 210597 212417 gene locus_tag LOCUS_09000 210597 212417 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_09000 212617 214446 gene locus_tag LOCUS_09010 212617 214446 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_09010 215405 214566 gene locus_tag LOCUS_09020 gene aroE 215405 214566 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43904 protein_id gnl|my_center|LOCUS_09020 216376 215435 gene locus_tag LOCUS_09030 gene hemF 216376 215435 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_09030 216954 216394 gene locus_tag LOCUS_09040 gene tsaC 216954 216394 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S6 protein_id gnl|my_center|LOCUS_09040 218129 217053 gene locus_tag LOCUS_09050 218129 217053 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654772.1 protein_id gnl|my_center|LOCUS_09050 219276 218236 gene locus_tag LOCUS_09060 219276 218236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_09060 219380 219901 gene locus_tag LOCUS_09070 gene def 219380 219901 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S9 protein_id gnl|my_center|LOCUS_09070 219905 220858 gene locus_tag LOCUS_09080 gene fmt 219905 220858 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T0 protein_id gnl|my_center|LOCUS_09080 220855 222189 gene locus_tag LOCUS_09090 gene rsmB 220855 222189 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_09090 222231 223604 gene locus_tag LOCUS_09100 gene trkA 222231 223604 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_09100 223637 225085 gene locus_tag LOCUS_09110 gene trkH 223637 225085 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_09110 225529 227016 gene locus_tag LOCUS_09120 225529 227016 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_09120 227028 227888 gene locus_tag LOCUS_09130 227028 227888 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_09130 227930 228502 gene locus_tag LOCUS_09140 227930 228502 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_09140 228502 228690 gene locus_tag LOCUS_09150 228502 228690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 228783 229379 gene locus_tag LOCUS_09160 228783 229379 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_09160 230701 229820 gene locus_tag LOCUS_09170 230701 229820 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_09170 230957 232588 gene locus_tag LOCUS_09180 230957 232588 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_09180 232591 233226 gene locus_tag LOCUS_09190 232591 233226 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 protein_id gnl|my_center|LOCUS_09190 233727 233254 gene locus_tag LOCUS_09200 233727 233254 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_09200 234568 233747 gene locus_tag LOCUS_09210 234568 233747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 234729 235958 gene locus_tag LOCUS_09220 234729 235958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 235973 236689 gene locus_tag LOCUS_09230 gene ftsE 235973 236689 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_09230 236679 237647 gene locus_tag LOCUS_09240 gene ftsX 236679 237647 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG1 protein_id gnl|my_center|LOCUS_09240 237881 238750 gene locus_tag LOCUS_09250 gene rpoH 237881 238750 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM47 protein_id gnl|my_center|LOCUS_09250 238867 239646 gene locus_tag LOCUS_09260 238867 239646 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_09260 240159 239677 gene locus_tag LOCUS_09270 240159 239677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 240658 240308 gene locus_tag LOCUS_09280 240658 240308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 241475 240798 gene locus_tag LOCUS_09290 241475 240798 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_09290 241779 241492 gene locus_tag LOCUS_09300 241779 241492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 241744 241914 gene locus_tag LOCUS_09310 241744 241914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 242436 242161 gene locus_tag LOCUS_09320 242436 242161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 242878 242678 gene locus_tag LOCUS_09330 242878 242678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 243945 243313 gene locus_tag LOCUS_09340 243945 243313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 244464 244030 gene locus_tag LOCUS_09350 244464 244030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 245689 245036 gene locus_tag LOCUS_09360 245689 245036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 246299 245892 gene locus_tag LOCUS_09370 246299 245892 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_09370 246807 246358 gene locus_tag LOCUS_09380 246807 246358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 247108 246908 gene locus_tag LOCUS_09390 247108 246908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence04 199 115 gene locus_tag LOCUS_t00110 199 115 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 390 1448 gene locus_tag LOCUS_09400 gene queA 390 1448 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D1 protein_id gnl|my_center|LOCUS_09400 1445 2644 gene locus_tag LOCUS_09410 gene tgt 1445 2644 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_09410 2709 3065 gene locus_tag LOCUS_09420 2709 3065 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_09420 3119 4981 gene locus_tag LOCUS_09430 gene secD 3119 4981 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX41 protein_id gnl|my_center|LOCUS_09430 4978 5886 gene locus_tag LOCUS_09440 gene secF 4978 5886 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_09440 6116 5898 gene locus_tag LOCUS_09450 6116 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6218 7351 gene locus_tag LOCUS_09460 6218 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_09460 8243 7356 gene locus_tag LOCUS_09470 8243 7356 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_09470 8357 9079 gene locus_tag LOCUS_09480 8357 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03268 protein_id gnl|my_center|LOCUS_09480 9171 9476 gene locus_tag LOCUS_09490 9171 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9563 9874 gene locus_tag LOCUS_09500 9563 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 11173 9905 gene locus_tag LOCUS_09510 11173 9905 CDS product nitrate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 protein_id gnl|my_center|LOCUS_09510 11367 12245 gene locus_tag LOCUS_09520 11367 12245 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_09520 12333 12752 gene locus_tag LOCUS_09530 12333 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13138 14166 gene locus_tag LOCUS_09540 13138 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 14345 15874 gene locus_tag LOCUS_09550 14345 15874 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704796.1 protein_id gnl|my_center|LOCUS_09550 16011 16604 gene locus_tag LOCUS_09560 16011 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 16594 17700 gene locus_tag LOCUS_09570 16594 17700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_09570 18737 17742 gene locus_tag LOCUS_09580 18737 17742 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_09580 18873 19352 gene locus_tag LOCUS_09590 18873 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 19615 19965 gene locus_tag LOCUS_09600 19615 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 20250 20600 gene locus_tag LOCUS_09610 20250 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 22263 20659 gene locus_tag LOCUS_09620 gene gabD2 22263 20659 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_09620 23137 22424 gene locus_tag LOCUS_09630 23137 22424 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_09630 23783 23127 gene locus_tag LOCUS_09640 23783 23127 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_09640 24844 23786 gene locus_tag LOCUS_09650 24844 23786 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED2 protein_id gnl|my_center|LOCUS_09650 26846 24846 gene locus_tag LOCUS_09660 26846 24846 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT88 protein_id gnl|my_center|LOCUS_09660 27439 26843 gene locus_tag LOCUS_09670 27439 26843 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_09670 28028 27447 gene locus_tag LOCUS_09680 gene rnfA 28028 27447 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_09680 28270 29361 gene locus_tag LOCUS_09690 28270 29361 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_09690 29408 29593 gene locus_tag LOCUS_09700 29408 29593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 29934 31244 gene locus_tag LOCUS_09710 29934 31244 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483370.1 protein_id gnl|my_center|LOCUS_09710 32856 31543 gene locus_tag LOCUS_09720 32856 31543 CDS product pili assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269298.1 protein_id gnl|my_center|LOCUS_09720 34709 33096 gene locus_tag LOCUS_09730 34709 33096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 protein_id gnl|my_center|LOCUS_09730 35599 34721 gene locus_tag LOCUS_09740 35599 34721 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482423.1 protein_id gnl|my_center|LOCUS_09740 36480 35596 gene locus_tag LOCUS_09750 gene oppB 36480 35596 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_09750 38205 36556 gene locus_tag LOCUS_09760 38205 36556 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_09760 38424 38615 gene locus_tag LOCUS_09770 38424 38615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 38786 40822 gene locus_tag LOCUS_09780 gene fadH 38786 40822 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104734.1 protein_id gnl|my_center|LOCUS_09780 42409 41102 gene locus_tag LOCUS_09790 42409 41102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_09790 42545 42928 gene locus_tag LOCUS_09800 42545 42928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 42925 43884 gene locus_tag LOCUS_09810 42925 43884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 43902 45176 gene locus_tag LOCUS_09820 gene czcC 43902 45176 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_09820 45187 46464 gene locus_tag LOCUS_09830 45187 46464 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_09830 46479 49610 gene locus_tag LOCUS_09840 46479 49610 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_09840 49607 50305 gene locus_tag LOCUS_09850 49607 50305 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_09850 50318 50872 gene locus_tag LOCUS_09860 50318 50872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 50905 51237 gene locus_tag LOCUS_09870 50905 51237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 52700 51330 gene locus_tag LOCUS_09880 52700 51330 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_09880 52942 54399 gene locus_tag LOCUS_09890 52942 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 54427 55329 gene locus_tag LOCUS_09900 54427 55329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 55353 58994 gene locus_tag LOCUS_09910 55353 58994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084480.1 protein_id gnl|my_center|LOCUS_09910 59175 59588 gene locus_tag LOCUS_09920 59175 59588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083895.1 protein_id gnl|my_center|LOCUS_09920 60230 59589 gene locus_tag LOCUS_09930 60230 59589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 60309 61064 gene locus_tag LOCUS_09940 60309 61064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 62023 61061 gene locus_tag LOCUS_09950 62023 61061 CDS product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_09950 62868 62020 gene locus_tag LOCUS_09960 62868 62020 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206792.1 protein_id gnl|my_center|LOCUS_09960 63401 62979 gene locus_tag LOCUS_09970 63401 62979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 63661 64071 gene locus_tag LOCUS_09980 63661 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 64158 66278 gene locus_tag LOCUS_09990 64158 66278 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_09990 66470 67150 gene locus_tag LOCUS_10000 66470 67150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 67147 67551 gene locus_tag LOCUS_10010 67147 67551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 67603 68640 gene locus_tag LOCUS_10020 67603 68640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_10020 69261 68674 gene locus_tag LOCUS_10030 69261 68674 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_10030 71039 69261 gene locus_tag LOCUS_10040 gene proS 71039 69261 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 protein_id gnl|my_center|LOCUS_10040 71184 71825 gene locus_tag LOCUS_10050 71184 71825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530328.1 protein_id gnl|my_center|LOCUS_10050 71822 72403 gene locus_tag LOCUS_10060 gene tag 71822 72403 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209626.1 protein_id gnl|my_center|LOCUS_10060 72485 73327 gene locus_tag LOCUS_10070 72485 73327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_10070 73344 74525 gene locus_tag LOCUS_10080 73344 74525 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_10080 74703 75365 gene locus_tag LOCUS_10090 74703 75365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 75362 75970 gene locus_tag LOCUS_10100 75362 75970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 75940 76440 gene locus_tag LOCUS_10110 75940 76440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 76444 76971 gene locus_tag LOCUS_10120 76444 76971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 76976 78913 gene locus_tag LOCUS_10130 76976 78913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 78910 81726 gene locus_tag LOCUS_10140 78910 81726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 81707 82555 gene locus_tag LOCUS_10150 81707 82555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 82552 82878 gene locus_tag LOCUS_10160 82552 82878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 82955 83605 gene locus_tag LOCUS_10170 82955 83605 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_10170 83623 84135 gene locus_tag LOCUS_10180 83623 84135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 84132 84635 gene locus_tag LOCUS_10190 84132 84635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 84635 85594 gene locus_tag LOCUS_10200 84635 85594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 85704 87386 gene locus_tag LOCUS_10210 85704 87386 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268682.1 protein_id gnl|my_center|LOCUS_10210 87451 91341 gene locus_tag LOCUS_10220 87451 91341 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_10220 91522 91839 gene locus_tag LOCUS_10230 91522 91839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 91845 92756 gene locus_tag LOCUS_10240 91845 92756 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYW0 protein_id gnl|my_center|LOCUS_10240 92749 93492 gene locus_tag LOCUS_10250 92749 93492 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_10250 93559 94326 gene locus_tag LOCUS_10260 93559 94326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_10260 95671 94370 gene locus_tag LOCUS_10270 95671 94370 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_10270 95928 96914 gene locus_tag LOCUS_10280 gene cysB 95928 96914 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_10280 97003 97620 gene locus_tag LOCUS_10290 gene thrH 97003 97620 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_10290 98690 97635 gene locus_tag LOCUS_10300 98690 97635 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 protein_id gnl|my_center|LOCUS_10300 99209 99973 gene locus_tag LOCUS_10310 99209 99973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 100282 101073 gene locus_tag LOCUS_10320 100282 101073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 101101 102147 gene locus_tag LOCUS_10330 101101 102147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_10330 102214 103833 gene locus_tag LOCUS_10340 102214 103833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_10340 103743 104654 gene locus_tag LOCUS_10350 103743 104654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 104635 105474 gene locus_tag LOCUS_10360 104635 105474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 106318 105497 gene locus_tag LOCUS_10370 106318 105497 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_10370 106413 108779 gene locus_tag LOCUS_10380 gene ppsA 106413 108779 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_10380 108796 109749 gene locus_tag LOCUS_10390 108796 109749 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765719.1 protein_id gnl|my_center|LOCUS_10390 109736 110422 gene locus_tag LOCUS_10400 109736 110422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 110433 110924 gene locus_tag LOCUS_10410 110433 110924 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_10410 110996 111715 gene locus_tag LOCUS_10420 110996 111715 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_10420 111813 112514 gene locus_tag LOCUS_10430 111813 112514 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103931.1 protein_id gnl|my_center|LOCUS_10430 112511 113389 gene locus_tag LOCUS_10440 gene prpB 112511 113389 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P70 protein_id gnl|my_center|LOCUS_10440 113636 114763 gene locus_tag LOCUS_10450 gene prpC 113636 114763 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_10450 114849 117443 gene locus_tag LOCUS_10460 gene acnA 114849 117443 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224931.1 protein_id gnl|my_center|LOCUS_10460 117738 118916 gene locus_tag LOCUS_10470 117738 118916 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_10470 122004 119017 gene locus_tag LOCUS_10480 122004 119017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 122615 123589 gene locus_tag LOCUS_10490 122615 123589 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_10490 123586 124236 gene locus_tag LOCUS_10500 123586 124236 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_10500 124229 125203 gene locus_tag LOCUS_10510 124229 125203 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_10510 125251 125787 gene locus_tag LOCUS_10520 gene yceD 125251 125787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420140.1 protein_id gnl|my_center|LOCUS_10520 125801 125986 gene locus_tag LOCUS_10530 gene rpmF 125801 125986 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_10530 125992 127026 gene locus_tag LOCUS_10540 gene plsX 125992 127026 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_10540 127129 128073 gene locus_tag LOCUS_10550 127129 128073 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_10550 128070 128822 gene locus_tag LOCUS_10560 gene fabG 128070 128822 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_10560 128869 129102 gene locus_tag LOCUS_10570 gene acpP 128869 129102 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH5 protein_id gnl|my_center|LOCUS_10570 129193 130428 gene locus_tag LOCUS_10580 gene fabF 129193 130428 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHQ5 protein_id gnl|my_center|LOCUS_10580 130428 131255 gene locus_tag LOCUS_10590 gene pabC 130428 131255 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_10590 131332 132381 gene locus_tag LOCUS_10600 131332 132381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_10600 132378 133034 gene locus_tag LOCUS_10610 gene tmk 132378 133034 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_10610 133031 134029 gene locus_tag LOCUS_10620 gene holB 133031 134029 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_10620 134026 134370 gene locus_tag LOCUS_10630 gene pilZ 134026 134370 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_10630 135573 134440 gene locus_tag LOCUS_10640 135573 134440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_10640 135640 138564 gene locus_tag LOCUS_10650 gene preP2 135640 138564 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_10650 142894 138566 gene locus_tag LOCUS_10660 142894 138566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 143167 143577 gene locus_tag LOCUS_10670 143167 143577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_10670 143574 143996 gene locus_tag LOCUS_10680 143574 143996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_10680 144285 145439 gene locus_tag LOCUS_10690 144285 145439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 146297 145485 gene locus_tag LOCUS_10700 gene xthA 146297 145485 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_10700 147802 146294 gene locus_tag LOCUS_10710 gene thiI 147802 146294 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_10710 149120 147879 gene locus_tag LOCUS_10720 149120 147879 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_10720 149408 150040 gene locus_tag LOCUS_10730 149408 150040 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 protein_id gnl|my_center|LOCUS_10730 151263 150136 gene locus_tag LOCUS_10740 151263 150136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 151414 153792 gene locus_tag LOCUS_10750 151414 153792 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN6 protein_id gnl|my_center|LOCUS_10750 153840 155273 gene locus_tag LOCUS_10760 153840 155273 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_10760 155286 156089 gene locus_tag LOCUS_10770 155286 156089 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_10770 156949 156551 gene locus_tag LOCUS_10780 156949 156551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 157213 158013 gene locus_tag LOCUS_10790 157213 158013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 158452 159255 gene locus_tag LOCUS_10800 158452 159255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 159589 160341 gene locus_tag LOCUS_10810 159589 160341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 160348 160680 gene locus_tag LOCUS_10820 160348 160680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 160886 161173 gene locus_tag LOCUS_10830 160886 161173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 161306 164323 gene locus_tag LOCUS_10840 161306 164323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 164403 165014 gene locus_tag LOCUS_10850 164403 165014 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902690.1 protein_id gnl|my_center|LOCUS_10850 165049 165450 gene locus_tag LOCUS_10860 gene zntR 165049 165450 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_10860 166108 165800 gene locus_tag LOCUS_10870 gene merP 166108 165800 CDS product mercuric transport protein periplasmic component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A216 protein_id gnl|my_center|LOCUS_10870 166464 166105 gene locus_tag LOCUS_10880 166464 166105 CDS product mercuric transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_10880 166942 166541 gene locus_tag LOCUS_10890 166942 166541 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425271.1 protein_id gnl|my_center|LOCUS_10890 168375 166939 gene locus_tag LOCUS_10900 gene cusS 168375 166939 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253852.1 protein_id gnl|my_center|LOCUS_10900 169057 168365 gene locus_tag LOCUS_10910 gene cusR 169057 168365 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 protein_id gnl|my_center|LOCUS_10910 169256 171136 gene locus_tag LOCUS_10920 gene copA 169256 171136 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_10920 171133 172002 gene locus_tag LOCUS_10930 171133 172002 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267051.1 protein_id gnl|my_center|LOCUS_10930 172055 172354 gene locus_tag LOCUS_10940 172055 172354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 172378 172959 gene locus_tag LOCUS_10950 172378 172959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 173764 173033 gene locus_tag LOCUS_10960 173764 173033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 174047 173673 gene locus_tag LOCUS_10970 174047 173673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 174889 174287 gene locus_tag LOCUS_10980 174889 174287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10980 175695 175231 gene locus_tag LOCUS_10990 175695 175231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 175820 177976 gene locus_tag LOCUS_11000 175820 177976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 178894 178562 gene locus_tag LOCUS_11010 178894 178562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 179733 179413 gene locus_tag LOCUS_11020 179733 179413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 181235 179886 gene locus_tag LOCUS_11030 181235 179886 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_11030 183550 181235 gene locus_tag LOCUS_11040 183550 181235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_11040 184141 183611 gene locus_tag LOCUS_11050 184141 183611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 184495 184238 gene locus_tag LOCUS_11060 184495 184238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 184988 184530 gene locus_tag LOCUS_11070 184988 184530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 186407 185052 gene locus_tag LOCUS_11080 186407 185052 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_11080 187258 186404 gene locus_tag LOCUS_11090 187258 186404 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_11090 188910 187342 gene locus_tag LOCUS_11100 188910 187342 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_11100 189233 188868 gene locus_tag LOCUS_11110 189233 188868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 189744 189292 gene locus_tag LOCUS_11120 189744 189292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 190408 189755 gene locus_tag LOCUS_11130 190408 189755 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_11130 191096 190758 gene locus_tag LOCUS_11140 191096 190758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 191487 191134 gene locus_tag LOCUS_11150 191487 191134 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_11150 193654 191525 gene locus_tag LOCUS_11160 193654 191525 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_11160 194634 194224 gene locus_tag LOCUS_11170 gene zntR 194634 194224 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence05 367 732 gene locus_tag LOCUS_11180 367 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1257 2861 gene locus_tag LOCUS_11190 1257 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4084 2867 gene locus_tag LOCUS_11200 4084 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4248 4739 gene locus_tag LOCUS_11210 4248 4739 CDS product swarming motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145128.1 protein_id gnl|my_center|LOCUS_11210 4876 5340 gene locus_tag LOCUS_11220 4876 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5443 7665 gene locus_tag LOCUS_11230 5443 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7776 8072 gene locus_tag LOCUS_11240 7776 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8065 8763 gene locus_tag LOCUS_11250 gene ispD 8065 8763 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_11250 8776 9258 gene locus_tag LOCUS_11260 gene ispF 8776 9258 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_11260 9255 10262 gene locus_tag LOCUS_11270 gene truD 9255 10262 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_11270 10243 10980 gene locus_tag LOCUS_11280 gene surE 10243 10980 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY05 protein_id gnl|my_center|LOCUS_11280 10985 11659 gene locus_tag LOCUS_11290 gene pcm 10985 11659 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L4 protein_id gnl|my_center|LOCUS_11290 11717 12616 gene locus_tag LOCUS_11300 11717 12616 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_11300 12803 13567 gene locus_tag LOCUS_11310 12803 13567 CDS product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 protein_id gnl|my_center|LOCUS_11310 13665 14648 gene locus_tag LOCUS_11320 gene rpoS 13665 14648 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDD3 protein_id gnl|my_center|LOCUS_11320 14877 16805 gene locus_tag LOCUS_11330 14877 16805 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986569.1 protein_id gnl|my_center|LOCUS_11330 17461 16847 gene locus_tag LOCUS_11340 gene ssb 17461 16847 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U1 protein_id gnl|my_center|LOCUS_11340 18824 17442 gene locus_tag LOCUS_11350 18824 17442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_11350 18996 19688 gene locus_tag LOCUS_11360 18996 19688 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_11360 19834 22668 gene locus_tag LOCUS_11370 gene uvrA 19834 22668 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_11370 22677 23237 gene locus_tag LOCUS_11380 22677 23237 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_11380 24596 23259 gene locus_tag LOCUS_11390 24596 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 24747 24917 gene locus_tag LOCUS_11400 24747 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 24943 26151 gene locus_tag LOCUS_11410 24943 26151 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_11410 28230 26170 gene locus_tag LOCUS_11420 gene fimX 28230 26170 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_11420 30060 28261 gene locus_tag LOCUS_11430 30060 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 protein_id gnl|my_center|LOCUS_11430 31236 30217 gene locus_tag LOCUS_11440 gene epmB 31236 30217 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44641 protein_id gnl|my_center|LOCUS_11440 31272 31838 gene locus_tag LOCUS_11450 gene efp 31272 31838 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KX9 protein_id gnl|my_center|LOCUS_11450 31939 32784 gene locus_tag LOCUS_11460 gene lysS 31939 32784 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 protein_id gnl|my_center|LOCUS_11460 33652 32795 gene locus_tag LOCUS_11470 33652 32795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 34498 33674 gene locus_tag LOCUS_11480 34498 33674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 36248 34596 gene locus_tag LOCUS_11490 36248 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 36404 37255 gene locus_tag LOCUS_11500 gene motA 36404 37255 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_11500 37255 38268 gene locus_tag LOCUS_11510 gene motB 37255 38268 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_11510 39319 38279 gene locus_tag LOCUS_11520 gene rsgA 39319 38279 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_11520 39469 40011 gene locus_tag LOCUS_11530 gene orn 39469 40011 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_11530 40082 40762 gene locus_tag LOCUS_11540 40082 40762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 41497 40775 gene locus_tag LOCUS_11550 41497 40775 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_11550 42655 41576 gene locus_tag LOCUS_11560 gene queG 42655 41576 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_11560 42741 44276 gene locus_tag LOCUS_11570 42741 44276 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_11570 44252 44755 gene locus_tag LOCUS_11580 44252 44755 CDS product tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244610.1 protein_id gnl|my_center|LOCUS_11580 44771 46117 gene locus_tag LOCUS_11590 gene amiB 44771 46117 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_11590 46173 48035 gene locus_tag LOCUS_11600 gene mutL 46173 48035 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_11600 48035 48991 gene locus_tag LOCUS_11610 gene miaA 48035 48991 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVD2 protein_id gnl|my_center|LOCUS_11610 49127 49375 gene locus_tag LOCUS_11620 gene hfq 49127 49375 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_11620 49393 50700 gene locus_tag LOCUS_11630 gene hflX 49393 50700 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_11630 50697 50852 gene locus_tag LOCUS_11640 50697 50852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 50839 52011 gene locus_tag LOCUS_11650 gene hflK 50839 52011 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_11650 52011 52880 gene locus_tag LOCUS_11660 gene hflC 52011 52880 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_11660 53030 53230 gene locus_tag LOCUS_11670 53030 53230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_11670 53265 54431 gene locus_tag LOCUS_11680 gene hisZ 53265 54431 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_11680 54450 55742 gene locus_tag LOCUS_11690 gene purA 54450 55742 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_11690 56899 55886 gene locus_tag LOCUS_11700 56899 55886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 58680 57157 gene locus_tag LOCUS_11710 58680 57157 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_11710 59649 58783 gene locus_tag LOCUS_11720 59649 58783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_11720 59748 60869 gene locus_tag LOCUS_11730 gene frmA 59748 60869 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E800 protein_id gnl|my_center|LOCUS_11730 60881 61714 gene locus_tag LOCUS_11740 gene frmB 60881 61714 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC6 protein_id gnl|my_center|LOCUS_11740 61943 63565 gene locus_tag LOCUS_11750 61943 63565 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265611.1 protein_id gnl|my_center|LOCUS_11750 63562 63744 gene locus_tag LOCUS_11760 63562 63744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 63994 66054 gene locus_tag LOCUS_11770 63994 66054 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 protein_id gnl|my_center|LOCUS_11770 66151 67146 gene locus_tag LOCUS_11780 gene ldhA 66151 67146 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186160.1 protein_id gnl|my_center|LOCUS_11780 67176 67376 gene locus_tag LOCUS_11790 67176 67376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 67395 68132 gene locus_tag LOCUS_11800 67395 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 68129 68461 gene locus_tag LOCUS_11810 68129 68461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 68458 68853 gene locus_tag LOCUS_11820 68458 68853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 69001 69663 gene locus_tag LOCUS_11830 69001 69663 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_11830 70518 69811 gene locus_tag LOCUS_11840 gene mtnC 70518 69811 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_11840 71067 70519 gene locus_tag LOCUS_11850 gene mtnD 71067 70519 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 protein_id gnl|my_center|LOCUS_11850 71702 71064 gene locus_tag LOCUS_11860 gene mtnB 71702 71064 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_11860 72719 71715 gene locus_tag LOCUS_11870 gene mtnA 72719 71715 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_11870 74463 72805 gene locus_tag LOCUS_11880 gene pgi 74463 72805 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_11880 75017 74637 gene locus_tag LOCUS_11890 gene panD 75017 74637 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_11890 75995 75135 gene locus_tag LOCUS_11900 gene panC 75995 75135 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_11900 76801 75992 gene locus_tag LOCUS_11910 gene panB 76801 75992 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_11910 77353 76859 gene locus_tag LOCUS_11920 gene folK 77353 76859 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_11920 78726 77359 gene locus_tag LOCUS_11930 gene pcnB 78726 77359 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_11930 81234 79813 gene locus_tag LOCUS_11940 gene cbrB 81234 79813 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_11940 84181 81248 gene locus_tag LOCUS_11950 gene cbrA 84181 81248 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_11950 84350 84171 gene locus_tag LOCUS_11960 84350 84171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_11960 85284 84403 gene locus_tag LOCUS_11970 gene gluQ 85284 84403 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_11970 85798 85364 gene locus_tag LOCUS_11980 gene dksA 85798 85364 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY79 protein_id gnl|my_center|LOCUS_11980 86057 87184 gene locus_tag LOCUS_11990 86057 87184 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV76 protein_id gnl|my_center|LOCUS_11990 87174 87899 gene locus_tag LOCUS_12000 gene sfsA 87174 87899 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF86 protein_id gnl|my_center|LOCUS_12000 88381 87935 gene locus_tag LOCUS_12010 88381 87935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 88878 88528 gene locus_tag LOCUS_12020 88878 88528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_12020 88957 91344 gene locus_tag LOCUS_12030 gene polB 88957 91344 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGA1 protein_id gnl|my_center|LOCUS_12030 92122 91634 gene locus_tag LOCUS_12040 92122 91634 CDS product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_12040 94365 92119 gene locus_tag LOCUS_12050 94365 92119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 95981 94365 gene locus_tag LOCUS_12060 95981 94365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_12060 96562 95984 gene locus_tag LOCUS_12070 96562 95984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 96863 96564 gene locus_tag LOCUS_12080 96863 96564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 97249 96860 gene locus_tag LOCUS_12090 97249 96860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 97388 97900 gene locus_tag LOCUS_12100 97388 97900 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_12100 97897 98130 gene locus_tag LOCUS_12110 97897 98130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 98123 98398 gene locus_tag LOCUS_12120 98123 98398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 98343 98669 gene locus_tag LOCUS_12130 98343 98669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 98666 99418 gene locus_tag LOCUS_12140 98666 99418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 99418 99795 gene locus_tag LOCUS_12150 99418 99795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 99785 100057 gene locus_tag LOCUS_12160 99785 100057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 100837 100322 gene locus_tag LOCUS_12170 100837 100322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 101832 100843 gene locus_tag LOCUS_12180 101832 100843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 102363 101887 gene locus_tag LOCUS_12190 102363 101887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070549.1 protein_id gnl|my_center|LOCUS_12190 102845 102375 gene locus_tag LOCUS_12200 102845 102375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 102934 103215 gene locus_tag LOCUS_12210 102934 103215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 103212 103430 gene locus_tag LOCUS_12220 103212 103430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 103427 103723 gene locus_tag LOCUS_12230 103427 103723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 103735 104616 gene locus_tag LOCUS_12240 103735 104616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 104618 106363 gene locus_tag LOCUS_12250 104618 106363 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_12250 106357 107505 gene locus_tag LOCUS_12260 106357 107505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602369.1 protein_id gnl|my_center|LOCUS_12260 107517 107783 gene locus_tag LOCUS_12270 107517 107783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 107780 108100 gene locus_tag LOCUS_12280 107780 108100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 108097 108948 gene locus_tag LOCUS_12290 108097 108948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 108983 109141 gene locus_tag LOCUS_12300 108983 109141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 109188 109718 gene locus_tag LOCUS_12310 109188 109718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 109705 110055 gene locus_tag LOCUS_12320 109705 110055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 110072 110626 gene locus_tag LOCUS_12330 110072 110626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 110619 110813 gene locus_tag LOCUS_12340 110619 110813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 110800 111015 gene locus_tag LOCUS_12350 110800 111015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 111012 111689 gene locus_tag LOCUS_12360 111012 111689 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 protein_id gnl|my_center|LOCUS_12360 111770 112006 gene locus_tag LOCUS_12370 111770 112006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 112076 112237 gene locus_tag LOCUS_12380 112076 112237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 112295 112744 gene locus_tag LOCUS_12390 112295 112744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 protein_id gnl|my_center|LOCUS_12390 112741 113094 gene locus_tag LOCUS_12400 112741 113094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 113458 114489 gene locus_tag LOCUS_12410 113458 114489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273067.1 protein_id gnl|my_center|LOCUS_12410 114501 115436 gene locus_tag LOCUS_12420 114501 115436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 protein_id gnl|my_center|LOCUS_12420 115450 115743 gene locus_tag LOCUS_12430 115450 115743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 115740 116072 gene locus_tag LOCUS_12440 115740 116072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 116075 116584 gene locus_tag LOCUS_12450 116075 116584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 116584 117015 gene locus_tag LOCUS_12460 116584 117015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 117034 117222 gene locus_tag LOCUS_12470 117034 117222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 117222 117998 gene locus_tag LOCUS_12480 117222 117998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 118236 121766 gene locus_tag LOCUS_12490 118236 121766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 121768 122145 gene locus_tag LOCUS_12500 121768 122145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 122145 125699 gene locus_tag LOCUS_12510 122145 125699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 125699 126700 gene locus_tag LOCUS_12520 125699 126700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 126697 127437 gene locus_tag LOCUS_12530 126697 127437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 127559 129325 gene locus_tag LOCUS_12540 127559 129325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 129325 129552 gene locus_tag LOCUS_12550 129325 129552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 129704 129892 gene locus_tag LOCUS_12560 129704 129892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 129843 130613 gene locus_tag LOCUS_12570 129843 130613 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_12570 130911 130597 gene locus_tag LOCUS_12580 130911 130597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 131035 131229 gene locus_tag LOCUS_12590 131035 131229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 132500 131853 gene locus_tag LOCUS_12600 132500 131853 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_12600 133142 132576 gene locus_tag LOCUS_12610 133142 132576 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_12610 133311 134279 gene locus_tag LOCUS_12620 gene yfjQ 133311 134279 CDS product putative metal ion transporter YfjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31543 protein_id gnl|my_center|LOCUS_12620 134669 134439 gene locus_tag LOCUS_12630 134669 134439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 136530 135355 gene locus_tag LOCUS_12640 136530 135355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_12640 137695 136535 gene locus_tag LOCUS_12650 137695 136535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 138861 137740 gene locus_tag LOCUS_12660 138861 137740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 140285 138858 gene locus_tag LOCUS_12670 140285 138858 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_12670 141818 140331 gene locus_tag LOCUS_12680 141818 140331 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926278.1 protein_id gnl|my_center|LOCUS_12680 142018 143244 gene locus_tag LOCUS_12690 142018 143244 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972567.1 protein_id gnl|my_center|LOCUS_12690 144726 143620 gene locus_tag LOCUS_12700 144726 143620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 145744 144929 gene locus_tag LOCUS_12710 145744 144929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 147063 145744 gene locus_tag LOCUS_12720 147063 145744 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_12720 148342 147203 gene locus_tag LOCUS_12730 148342 147203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_12730 149905 148373 gene locus_tag LOCUS_12740 gene gpmI 149905 148373 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_12740 150034 150525 gene locus_tag LOCUS_12750 150034 150525 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_12750 150556 151032 gene locus_tag LOCUS_12760 gene secB 150556 151032 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2A2 protein_id gnl|my_center|LOCUS_12760 151511 151047 gene locus_tag LOCUS_12770 gene yibK 151511 151047 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2E6 protein_id gnl|my_center|LOCUS_12770 151645 152601 gene locus_tag LOCUS_12780 151645 152601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 152585 153253 gene locus_tag LOCUS_12790 152585 153253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 153269 153931 gene locus_tag LOCUS_12800 153269 153931 CDS product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835144.1 protein_id gnl|my_center|LOCUS_12800 153924 154265 gene locus_tag LOCUS_12810 153924 154265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 154280 155893 gene locus_tag LOCUS_12820 gene mshL 154280 155893 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_12820 155896 156789 gene locus_tag LOCUS_12830 155896 156789 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_12830 156786 157724 gene locus_tag LOCUS_12840 156786 157724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 157726 159453 gene locus_tag LOCUS_12850 157726 159453 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_12850 159450 160670 gene locus_tag LOCUS_12860 159450 160670 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_12860 161059 161532 gene locus_tag LOCUS_12870 161059 161532 CDS product MSHA pilin protein MshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883247.1 protein_id gnl|my_center|LOCUS_12870 161548 162012 gene locus_tag LOCUS_12880 161548 162012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 162025 162513 gene locus_tag LOCUS_12890 gene mshD2 162025 162513 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262980.1 protein_id gnl|my_center|LOCUS_12890 162513 163328 gene locus_tag LOCUS_12900 gene mshO 162513 163328 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_12900 163318 163725 gene locus_tag LOCUS_12910 163318 163725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 163727 166813 gene locus_tag LOCUS_12920 163727 166813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 166816 170562 gene locus_tag LOCUS_12930 166816 170562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 171999 170581 gene locus_tag LOCUS_12940 gene ntrC 171999 170581 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_12940 173078 171996 gene locus_tag LOCUS_12950 173078 171996 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_12950 173787 173251 gene locus_tag LOCUS_12960 173787 173251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_12960 174007 174441 gene locus_tag LOCUS_12970 gene dtd 174007 174441 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ2 protein_id gnl|my_center|LOCUS_12970 174975 174463 gene locus_tag LOCUS_12980 174975 174463 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_12980 175325 174972 gene locus_tag LOCUS_12990 175325 174972 CDS product HopJ1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768752.1 protein_id gnl|my_center|LOCUS_12990 175715 175404 gene locus_tag LOCUS_13000 175715 175404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 176115 175948 gene locus_tag LOCUS_13010 176115 175948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 177813 176164 gene locus_tag LOCUS_13020 gene merA 177813 176164 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTZ0 protein_id gnl|my_center|LOCUS_13020 178045 177806 gene locus_tag LOCUS_13030 178045 177806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 178382 178119 gene locus_tag LOCUS_13040 178382 178119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_13040 178675 178379 gene locus_tag LOCUS_13050 178675 178379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 179039 178689 gene locus_tag LOCUS_13060 179039 178689 CDS product mercuric transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_13060 179113 179559 gene locus_tag LOCUS_13070 gene merR 179113 179559 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_13070 179638 180939 gene locus_tag LOCUS_13080 179638 180939 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_13080 181915 183462 gene locus_tag LOCUS_13090 181915 183462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 183459 187181 gene locus_tag LOCUS_13100 183459 187181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 188029 187334 gene locus_tag LOCUS_13110 188029 187334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 188616 189068 gene locus_tag LOCUS_13120 gene umuD 188616 189068 CDS product protein impA' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705912.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence06 2456 1218 gene locus_tag LOCUS_13130 2456 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_13130 2640 5051 gene locus_tag LOCUS_13140 2640 5051 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074356.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 4963 5574 gene locus_tag LOCUS_13150 4963 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 5637 5906 gene locus_tag LOCUS_13160 5637 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6105 6554 gene locus_tag LOCUS_13170 6105 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7503 6625 gene locus_tag LOCUS_13180 7503 6625 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_13180 7892 7578 gene locus_tag LOCUS_13190 gene glnB 7892 7578 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_13190 11110 7970 gene locus_tag LOCUS_13200 11110 7970 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_13200 12135 11194 gene locus_tag LOCUS_13210 12135 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13043 12132 gene locus_tag LOCUS_13220 13043 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 15000 14095 gene locus_tag LOCUS_13230 15000 14095 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_13230 15079 15486 gene locus_tag LOCUS_13240 15079 15486 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_13240 17425 15464 gene locus_tag LOCUS_13250 17425 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_13250 18984 17746 gene locus_tag LOCUS_13260 18984 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_13260 19262 22249 gene locus_tag LOCUS_13270 19262 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 23942 22539 gene locus_tag LOCUS_13280 23942 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 24924 23956 gene locus_tag LOCUS_13290 24924 23956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 26920 24941 gene locus_tag LOCUS_13300 26920 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 27257 26895 gene locus_tag LOCUS_13310 27257 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 28271 28035 gene locus_tag LOCUS_13320 28271 28035 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_13320 29291 28296 gene locus_tag LOCUS_13330 29291 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_13330 29708 32125 gene locus_tag LOCUS_13340 29708 32125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 32106 33452 gene locus_tag LOCUS_13350 32106 33452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_13350 33473 34771 gene locus_tag LOCUS_13360 33473 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117990.1 protein_id gnl|my_center|LOCUS_13360 35047 35526 gene locus_tag LOCUS_13370 35047 35526 CDS product cytochrome C556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 protein_id gnl|my_center|LOCUS_13370 35538 36200 gene locus_tag LOCUS_13380 35538 36200 CDS product nickel-dependent hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225210.1 protein_id gnl|my_center|LOCUS_13380 36312 39047 gene locus_tag LOCUS_13390 gene rapA 36312 39047 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60241 protein_id gnl|my_center|LOCUS_13390 37336 37427 gene locus_tag LOCUS_t00120 37336 37427 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 39639 39160 gene locus_tag LOCUS_13400 gene dps 39639 39160 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_13400 41802 39781 gene locus_tag LOCUS_13410 41802 39781 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 protein_id gnl|my_center|LOCUS_13410 42164 42718 gene locus_tag LOCUS_13420 42164 42718 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 protein_id gnl|my_center|LOCUS_13420 43835 42771 gene locus_tag LOCUS_13430 gene cheB1 43835 42771 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD3 protein_id gnl|my_center|LOCUS_13430 44332 43838 gene locus_tag LOCUS_13440 gene cheD 44332 43838 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD2 protein_id gnl|my_center|LOCUS_13440 45144 44338 gene locus_tag LOCUS_13450 gene cheR-1 45144 44338 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888V6 protein_id gnl|my_center|LOCUS_13450 45887 45330 gene locus_tag LOCUS_13460 gene cheW-1 45887 45330 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_13460 47534 45897 gene locus_tag LOCUS_13470 47534 45897 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266628.1 protein_id gnl|my_center|LOCUS_13470 49901 47940 gene locus_tag LOCUS_13480 gene mcpA 49901 47940 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974789.1 protein_id gnl|my_center|LOCUS_13480 52162 49973 gene locus_tag LOCUS_13490 gene cheA-1 52162 49973 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_13490 52487 52173 gene locus_tag LOCUS_13500 gene rsbV 52487 52173 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH29 protein_id gnl|my_center|LOCUS_13500 52876 52511 gene locus_tag LOCUS_13510 52876 52511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 protein_id gnl|my_center|LOCUS_13510 53880 52888 gene locus_tag LOCUS_13520 53880 52888 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_13520 53806 54024 gene locus_tag LOCUS_13530 53806 54024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 55903 54542 gene locus_tag LOCUS_13540 gene gor-2 55903 54542 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104922.1 protein_id gnl|my_center|LOCUS_13540 56436 55906 gene locus_tag LOCUS_13550 gene gspM 56436 55906 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT5 protein_id gnl|my_center|LOCUS_13550 57620 56433 gene locus_tag LOCUS_13560 57620 56433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 58619 57624 gene locus_tag LOCUS_13570 gene xcpX 58619 57624 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_13570 59377 58631 gene locus_tag LOCUS_13580 59377 58631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 59760 59377 gene locus_tag LOCUS_13590 gene xcpV 59760 59377 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_13590 60343 59762 gene locus_tag LOCUS_13600 60343 59762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 60807 60343 gene locus_tag LOCUS_13610 gene gspG 60807 60343 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_13610 62034 60817 gene locus_tag LOCUS_13620 gene xcpS 62034 60817 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_13620 63552 62038 gene locus_tag LOCUS_13630 gene xcpR 63552 62038 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_13630 64673 63744 gene locus_tag LOCUS_13640 gene etfA 64673 63744 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_13640 65439 64690 gene locus_tag LOCUS_13650 gene etfB 65439 64690 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_13650 65749 67389 gene locus_tag LOCUS_13660 65749 67389 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_13660 68697 67474 gene locus_tag LOCUS_13670 68697 67474 CDS product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 protein_id gnl|my_center|LOCUS_13670 69638 68787 gene locus_tag LOCUS_13680 69638 68787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 70309 69788 gene locus_tag LOCUS_13690 70309 69788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_13690 71102 70314 gene locus_tag LOCUS_13700 71102 70314 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_13700 71754 71380 gene locus_tag LOCUS_13710 71754 71380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 72041 71955 gene locus_tag LOCUS_t00130 72041 71955 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72160 72087 gene locus_tag LOCUS_t00140 72160 72087 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 72298 72223 gene locus_tag LOCUS_t00150 72298 72223 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72940 72395 gene locus_tag LOCUS_13720 72940 72395 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_13720 74774 72948 gene locus_tag LOCUS_13730 gene uvrC 74774 72948 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_13730 75421 74774 gene locus_tag LOCUS_13740 gene gacA 75421 74774 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 protein_id gnl|my_center|LOCUS_13740 75662 75572 gene locus_tag LOCUS_t00160 75662 75572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75849 76235 gene locus_tag LOCUS_13750 75849 76235 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707698.1 protein_id gnl|my_center|LOCUS_13750 76235 76567 gene locus_tag LOCUS_13760 76235 76567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 76569 76832 gene locus_tag LOCUS_13770 76569 76832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 76829 77137 gene locus_tag LOCUS_13780 76829 77137 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_13780 77134 78102 gene locus_tag LOCUS_13790 77134 78102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_13790 79512 78142 gene locus_tag LOCUS_13800 gene cysG 79512 78142 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_13800 80792 79509 gene locus_tag LOCUS_13810 gene serS 80792 79509 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 protein_id gnl|my_center|LOCUS_13810 81174 80800 gene locus_tag LOCUS_13820 gene crcB 81174 80800 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF5 protein_id gnl|my_center|LOCUS_13820 82515 81175 gene locus_tag LOCUS_13830 82515 81175 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_13830 83128 82493 gene locus_tag LOCUS_13840 gene lolA 83128 82493 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_13840 85657 83144 gene locus_tag LOCUS_13850 85657 83144 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 protein_id gnl|my_center|LOCUS_13850 85716 86417 gene locus_tag LOCUS_13860 gene aat 85716 86417 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_13860 86414 87121 gene locus_tag LOCUS_13870 gene ate 86414 87121 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 protein_id gnl|my_center|LOCUS_13870 87187 87405 gene locus_tag LOCUS_13880 gene infA 87187 87405 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_13880 89711 87453 gene locus_tag LOCUS_13890 gene clpA 89711 87453 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_13890 90076 89726 gene locus_tag LOCUS_13900 gene clpS 90076 89726 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_13900 90260 90514 gene locus_tag LOCUS_13910 gene cspD 90260 90514 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_13910 92823 90595 gene locus_tag LOCUS_13920 gene icd 92823 90595 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_13920 93033 93632 gene locus_tag LOCUS_13930 93033 93632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 93698 94144 gene locus_tag LOCUS_13940 93698 94144 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_13940 94144 95253 gene locus_tag LOCUS_13950 gene mnmA 94144 95253 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_13950 95250 95876 gene locus_tag LOCUS_13960 gene hflD 95250 95876 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3W6 protein_id gnl|my_center|LOCUS_13960 95890 96855 gene locus_tag LOCUS_13970 gene dusA 95890 96855 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDG7 protein_id gnl|my_center|LOCUS_13970 97184 96849 gene locus_tag LOCUS_13980 97184 96849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 97299 98249 gene locus_tag LOCUS_13990 gene tal 97299 98249 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45055 protein_id gnl|my_center|LOCUS_13990 98246 98680 gene locus_tag LOCUS_14000 98246 98680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 100064 98736 gene locus_tag LOCUS_14010 gene sthA 100064 98736 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_14010 100438 100205 gene locus_tag LOCUS_14020 100438 100205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 101417 100440 gene locus_tag LOCUS_14030 101417 100440 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_14030 102495 101554 gene locus_tag LOCUS_14040 102495 101554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_14040 102646 103008 gene locus_tag LOCUS_14050 102646 103008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 103008 104117 gene locus_tag LOCUS_14060 gene rlmG 103008 104117 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE2 protein_id gnl|my_center|LOCUS_14060 104114 104641 gene locus_tag LOCUS_14070 104114 104641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 104644 105288 gene locus_tag LOCUS_14080 gene rluA 104644 105288 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_14080 106451 105243 gene locus_tag LOCUS_14090 106451 105243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037018.1 protein_id gnl|my_center|LOCUS_14090 106574 107437 gene locus_tag LOCUS_14100 gene rpfD 106574 107437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 protein_id gnl|my_center|LOCUS_14100 108227 107472 gene locus_tag LOCUS_14110 108227 107472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 109090 108224 gene locus_tag LOCUS_14120 109090 108224 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_14120 109871 109080 gene locus_tag LOCUS_14130 109871 109080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947453.1 protein_id gnl|my_center|LOCUS_14130 110384 109914 gene locus_tag LOCUS_14140 110384 109914 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_14140 110646 110374 gene locus_tag LOCUS_14150 110646 110374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 111696 110671 gene locus_tag LOCUS_14160 gene gpsA 111696 110671 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_14160 112286 111792 gene locus_tag LOCUS_14170 112286 111792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_14170 113455 112283 gene locus_tag LOCUS_14180 113455 112283 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_14180 113691 113996 gene locus_tag LOCUS_14190 113691 113996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 114684 114097 gene locus_tag LOCUS_14200 gene nfuA 114684 114097 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_14200 114857 118570 gene locus_tag LOCUS_14210 gene metH 114857 118570 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_14210 118574 119965 gene locus_tag LOCUS_14220 118574 119965 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003738285.1 protein_id gnl|my_center|LOCUS_14220 120940 120182 gene locus_tag LOCUS_14230 120940 120182 CDS product MltA-interacting protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 protein_id gnl|my_center|LOCUS_14230 122075 121251 gene locus_tag LOCUS_14240 gene rlmJ 122075 121251 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGN2 protein_id gnl|my_center|LOCUS_14240 123515 122412 gene locus_tag LOCUS_14250 123515 122412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 124221 125297 gene locus_tag LOCUS_14260 gene hupS 124221 125297 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_14260 125297 127096 gene locus_tag LOCUS_14270 gene hupL 125297 127096 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_14270 127119 127346 gene locus_tag LOCUS_14280 127119 127346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 127360 128049 gene locus_tag LOCUS_14290 gene hupC 127360 128049 CDS product putative Ni/Fe-hydrogenase B-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21960 protein_id gnl|my_center|LOCUS_14290 128222 127989 gene locus_tag LOCUS_14300 128222 127989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 128443 129186 gene locus_tag LOCUS_14310 gene hupD 128443 129186 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_14310 129189 129551 gene locus_tag LOCUS_14320 129189 129551 CDS product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388920.1 protein_id gnl|my_center|LOCUS_14320 129551 129958 gene locus_tag LOCUS_14330 129551 129958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 129955 130845 gene locus_tag LOCUS_14340 gene hupH 129955 130845 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_14340 130862 131083 gene locus_tag LOCUS_14350 130862 131083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14350 131087 131674 gene locus_tag LOCUS_14360 131087 131674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14360 131683 132930 gene locus_tag LOCUS_14370 131683 132930 CDS product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_14370 132923 133264 gene locus_tag LOCUS_14380 gene hypA2 132923 133264 CDS product putative hydrogenase nickel incorporation protein HypA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45256 protein_id gnl|my_center|LOCUS_14380 133295 133597 gene locus_tag LOCUS_14390 133295 133597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 133504 134163 gene locus_tag LOCUS_14400 133504 134163 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_14400 134186 134440 gene locus_tag LOCUS_14410 gene hypC 134186 134440 CDS product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_14410 134437 135612 gene locus_tag LOCUS_14420 gene hypD2 134437 135612 CDS product hydrogenase expression/formation protein hypD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31904 protein_id gnl|my_center|LOCUS_14420 135609 136670 gene locus_tag LOCUS_14430 gene hypE 135609 136670 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_14430 136674 138152 gene locus_tag LOCUS_14440 gene hoxA 136674 138152 CDS product hydrogenase transcriptional regulatory protein HoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31908 protein_id gnl|my_center|LOCUS_14440 138149 139468 gene locus_tag LOCUS_14450 138149 139468 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_14450 139534 140499 gene locus_tag LOCUS_14460 gene hupU 139534 140499 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_14460 140496 142013 gene locus_tag LOCUS_14470 gene hupV 140496 142013 CDS product HupV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_14470 142015 144516 gene locus_tag LOCUS_14480 gene hypF 142015 144516 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQJ3 protein_id gnl|my_center|LOCUS_14480 145144 144662 gene locus_tag LOCUS_14490 145144 144662 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204661.1 protein_id gnl|my_center|LOCUS_14490 146320 145280 gene locus_tag LOCUS_14500 146320 145280 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161578.1 protein_id gnl|my_center|LOCUS_14500 146790 147557 gene locus_tag LOCUS_14510 146790 147557 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_14510 148994 147714 gene locus_tag LOCUS_14520 148994 147714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 150257 149283 gene locus_tag LOCUS_14530 150257 149283 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529501.1 protein_id gnl|my_center|LOCUS_14530 150376 151224 gene locus_tag LOCUS_14540 150376 151224 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_14540 151224 151676 gene locus_tag LOCUS_14550 151224 151676 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969827.1 protein_id gnl|my_center|LOCUS_14550 151697 152065 gene locus_tag LOCUS_14560 151697 152065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 152212 152976 gene locus_tag LOCUS_14570 152212 152976 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400412.1 protein_id gnl|my_center|LOCUS_14570 153115 153585 gene locus_tag LOCUS_14580 gene slyA 153115 153585 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073765.1 protein_id gnl|my_center|LOCUS_14580 153582 154649 gene locus_tag LOCUS_14590 153582 154649 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073764.1 protein_id gnl|my_center|LOCUS_14590 154660 155691 gene locus_tag LOCUS_14600 154660 155691 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705154.1 protein_id gnl|my_center|LOCUS_14600 155827 158220 gene locus_tag LOCUS_14610 155827 158220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 159948 158266 gene locus_tag LOCUS_14620 159948 158266 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_14620 160209 161885 gene locus_tag LOCUS_14630 gene cysI 160209 161885 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_14630 161866 162312 gene locus_tag LOCUS_14640 161866 162312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_14640 162980 162651 gene locus_tag LOCUS_14650 162980 162651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 163567 163013 gene locus_tag LOCUS_14660 gene fldA 163567 163013 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25776 protein_id gnl|my_center|LOCUS_14660 164376 163681 gene locus_tag LOCUS_14670 164376 163681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 164920 164369 gene locus_tag LOCUS_14680 164920 164369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 165754 164933 gene locus_tag LOCUS_14690 gene draT 165754 164933 CDS product N-acyl homoserine lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_14690 165831 166751 gene locus_tag LOCUS_14700 gene draG 165831 166751 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_14700 166843 168003 gene locus_tag LOCUS_14710 166843 168003 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_14710 169268 168276 gene locus_tag LOCUS_14720 169268 168276 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_14720 170336 169275 gene locus_tag LOCUS_14730 170336 169275 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_14730 170638 170952 gene locus_tag LOCUS_14740 170638 170952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_14740 171633 170980 gene locus_tag LOCUS_14750 171633 170980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064807.1 protein_id gnl|my_center|LOCUS_14750 173269 171620 gene locus_tag LOCUS_14760 173269 171620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 173502 175013 gene locus_tag LOCUS_14770 gene nhaB 173502 175013 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_14770 175781 175068 gene locus_tag LOCUS_14780 gene dnaQ 175781 175068 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_14780 176218 175778 gene locus_tag LOCUS_14790 gene rnhA 176218 175778 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYE5 protein_id gnl|my_center|LOCUS_14790 177006 176209 gene locus_tag LOCUS_14800 177006 176209 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_14800 177080 178480 gene locus_tag LOCUS_14810 gene mltD 177080 178480 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_14810 178604 179398 gene locus_tag LOCUS_14820 gene fabI 178604 179398 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YS1 protein_id gnl|my_center|LOCUS_14820 181295 179463 gene locus_tag LOCUS_14830 181295 179463 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R77 protein_id gnl|my_center|LOCUS_14830 181436 181360 gene locus_tag LOCUS_t00170 181436 181360 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 181738 181466 gene locus_tag LOCUS_14840 181738 181466 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_14840 184260 181870 gene locus_tag LOCUS_14850 gene lon 184260 181870 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_14850 185702 184413 gene locus_tag LOCUS_14860 gene clpX 185702 184413 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM6 protein_id gnl|my_center|LOCUS_14860 186420 185797 gene locus_tag LOCUS_14870 gene clpP 186420 185797 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Q5 protein_id gnl|my_center|LOCUS_14870 187851 186535 gene locus_tag LOCUS_14880 gene tig 187851 186535 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU0 protein_id gnl|my_center|LOCUS_14880 188068 187993 gene locus_tag LOCUS_t00180 188068 187993 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 188209 188133 gene locus_tag LOCUS_t00190 188209 188133 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 241 152 gene locus_tag LOCUS_t00200 241 152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 932 366 gene locus_tag LOCUS_14890 932 366 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 protein_id gnl|my_center|LOCUS_14890 1789 968 gene locus_tag LOCUS_14900 gene queF 1789 968 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0J1 protein_id gnl|my_center|LOCUS_14900 2582 1791 gene locus_tag LOCUS_14910 2582 1791 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_14910 3499 2579 gene locus_tag LOCUS_14920 3499 2579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_14920 3578 3967 gene locus_tag LOCUS_14930 3578 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_14930 4284 6326 gene locus_tag LOCUS_14940 gene dcp 4284 6326 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073393.1 protein_id gnl|my_center|LOCUS_14940 6507 7622 gene locus_tag LOCUS_14950 6507 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 8767 7631 gene locus_tag LOCUS_14960 8767 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_14960 10239 8764 gene locus_tag LOCUS_14970 10239 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 11417 10239 gene locus_tag LOCUS_14980 11417 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 13641 11611 gene locus_tag LOCUS_14990 gene rlmL 13641 11611 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_14990 14014 14208 gene locus_tag LOCUS_15000 gene rmf 14014 14208 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF9 protein_id gnl|my_center|LOCUS_15000 15356 14337 gene locus_tag LOCUS_15010 gene pyrD 15356 14337 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_15010 15644 15420 gene locus_tag LOCUS_15020 15644 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 20570 15729 gene locus_tag LOCUS_15030 gene gdhB 20570 15729 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_15030 20798 21757 gene locus_tag LOCUS_15040 20798 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_15040 21757 22692 gene locus_tag LOCUS_15050 21757 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122330.1 protein_id gnl|my_center|LOCUS_15050 22689 23204 gene locus_tag LOCUS_15060 22689 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 23197 24180 gene locus_tag LOCUS_15070 23197 24180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_15070 24182 26113 gene locus_tag LOCUS_15080 24182 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 26107 27846 gene locus_tag LOCUS_15090 26107 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_15090 29285 27909 gene locus_tag LOCUS_15100 29285 27909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 30727 29282 gene locus_tag LOCUS_15110 30727 29282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637910.2 protein_id gnl|my_center|LOCUS_15110 30962 31786 gene locus_tag LOCUS_15120 30962 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 32293 31790 gene locus_tag LOCUS_15130 32293 31790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 32511 33155 gene locus_tag LOCUS_15140 32511 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 33654 33247 gene locus_tag LOCUS_15150 33654 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 34002 33664 gene locus_tag LOCUS_15160 34002 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 35447 34119 gene locus_tag LOCUS_15170 35447 34119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 36147 35440 gene locus_tag LOCUS_15180 36147 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 36719 36315 gene locus_tag LOCUS_15190 36719 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 37249 36800 gene locus_tag LOCUS_15200 37249 36800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 38807 37347 gene locus_tag LOCUS_15210 38807 37347 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_15210 39229 39417 gene locus_tag LOCUS_15220 39229 39417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 42083 44212 gene locus_tag LOCUS_15230 42083 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 45402 44896 gene locus_tag LOCUS_15240 45402 44896 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208072.1 protein_id gnl|my_center|LOCUS_15240 47945 45918 gene locus_tag LOCUS_15250 gene ligA 47945 45918 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN5 protein_id gnl|my_center|LOCUS_15250 49182 47956 gene locus_tag LOCUS_15260 49182 47956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 52915 49412 gene locus_tag LOCUS_15270 gene smc 52915 49412 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_15270 53579 52920 gene locus_tag LOCUS_15280 53579 52920 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765300.1 protein_id gnl|my_center|LOCUS_15280 53776 54924 gene locus_tag LOCUS_15290 gene alkB2 53776 54924 CDS product alkane 1-monooxygenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6H941 protein_id gnl|my_center|LOCUS_15290 56376 55027 gene locus_tag LOCUS_15300 gene astB 56376 55027 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMV4 protein_id gnl|my_center|LOCUS_15300 57833 56373 gene locus_tag LOCUS_15310 gene astD 57833 56373 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76217 protein_id gnl|my_center|LOCUS_15310 58843 57830 gene locus_tag LOCUS_15320 58843 57830 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX89 protein_id gnl|my_center|LOCUS_15320 60060 58846 gene locus_tag LOCUS_15330 60060 58846 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_15330 60281 61642 gene locus_tag LOCUS_15340 60281 61642 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886801.1 protein_id gnl|my_center|LOCUS_15340 61654 62136 gene locus_tag LOCUS_15350 61654 62136 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887171.1 protein_id gnl|my_center|LOCUS_15350 62324 64936 gene locus_tag LOCUS_15360 62324 64936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 65185 64970 gene locus_tag LOCUS_15370 65185 64970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 65090 65668 gene locus_tag LOCUS_15380 65090 65668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 65682 65930 gene locus_tag LOCUS_15390 65682 65930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 66307 65954 gene locus_tag LOCUS_15400 66307 65954 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_15400 66448 67977 gene locus_tag LOCUS_15410 66448 67977 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_15410 67977 68168 gene locus_tag LOCUS_15420 67977 68168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 68158 68343 gene locus_tag LOCUS_15430 68158 68343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 68857 68456 gene locus_tag LOCUS_15440 68857 68456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 69786 69034 gene locus_tag LOCUS_15450 69786 69034 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191996.1 protein_id gnl|my_center|LOCUS_15450 71691 69943 gene locus_tag LOCUS_15460 71691 69943 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_15460 73306 71840 gene locus_tag LOCUS_15470 gene crnA 73306 71840 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_15470 73729 73400 gene locus_tag LOCUS_15480 gene nirD-2 73729 73400 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_15480 76377 73747 gene locus_tag LOCUS_15490 gene nirB 76377 73747 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049205.1 protein_id gnl|my_center|LOCUS_15490 76853 79504 gene locus_tag LOCUS_15500 76853 79504 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_15500 79710 80144 gene locus_tag LOCUS_15510 79710 80144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 protein_id gnl|my_center|LOCUS_15510 80248 80643 gene locus_tag LOCUS_15520 80248 80643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_15520 80899 81996 gene locus_tag LOCUS_15530 gene potF 80899 81996 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQL0 protein_id gnl|my_center|LOCUS_15530 82132 83265 gene locus_tag LOCUS_15540 82132 83265 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM7 protein_id gnl|my_center|LOCUS_15540 83262 84173 gene locus_tag LOCUS_15550 gene potH 83262 84173 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707794.1 protein_id gnl|my_center|LOCUS_15550 84170 84985 gene locus_tag LOCUS_15560 84170 84985 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_15560 87344 85017 gene locus_tag LOCUS_15570 87344 85017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 87948 87499 gene locus_tag LOCUS_15580 87948 87499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 88376 87936 gene locus_tag LOCUS_15590 88376 87936 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U753 protein_id gnl|my_center|LOCUS_15590 88680 88381 gene locus_tag LOCUS_15600 88680 88381 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK58 protein_id gnl|my_center|LOCUS_15600 89823 88699 gene locus_tag LOCUS_15610 gene rnd 89823 88699 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_15610 90368 89820 gene locus_tag LOCUS_15620 gene recR 90368 89820 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM04 protein_id gnl|my_center|LOCUS_15620 90702 90376 gene locus_tag LOCUS_15630 90702 90376 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE9 protein_id gnl|my_center|LOCUS_15630 92768 90732 gene locus_tag LOCUS_15640 gene dnaX 92768 90732 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_15640 93364 93095 gene locus_tag LOCUS_15650 gene ybfE 93364 93095 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602226.1 protein_id gnl|my_center|LOCUS_15650 93490 95880 gene locus_tag LOCUS_15660 93490 95880 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_15660 96498 95935 gene locus_tag LOCUS_15670 96498 95935 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_15670 97262 96798 gene locus_tag LOCUS_15680 97262 96798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 98251 97367 gene locus_tag LOCUS_15690 gene poxA 98251 97367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_15690 98879 98256 gene locus_tag LOCUS_15700 98879 98256 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_15700 99286 98876 gene locus_tag LOCUS_15710 99286 98876 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 protein_id gnl|my_center|LOCUS_15710 99454 100527 gene locus_tag LOCUS_15720 99454 100527 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_15720 100625 101335 gene locus_tag LOCUS_15730 100625 101335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 101343 102113 gene locus_tag LOCUS_15740 101343 102113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_15740 104400 103045 gene locus_tag LOCUS_15750 gene rhlB 104400 103045 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_15750 104527 104985 gene locus_tag LOCUS_15760 104527 104985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 105169 105807 gene locus_tag LOCUS_15770 105169 105807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 107784 105727 gene locus_tag LOCUS_15780 gene tgpA 107784 105727 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_15780 108743 107748 gene locus_tag LOCUS_15790 108743 107748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_15790 109642 108740 gene locus_tag LOCUS_15800 109642 108740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_15800 109985 110410 gene locus_tag LOCUS_15810 109985 110410 CDS product heat-shock protein 20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529498.1 protein_id gnl|my_center|LOCUS_15810 111042 110488 gene locus_tag LOCUS_15820 111042 110488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 112465 111239 gene locus_tag LOCUS_15830 gene metZ 112465 111239 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_15830 113988 112462 gene locus_tag LOCUS_15840 gene purF 113988 112462 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_15840 114517 114029 gene locus_tag LOCUS_15850 114517 114029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_15850 115140 114592 gene locus_tag LOCUS_15860 gene dedD 115140 114592 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957873.1 protein_id gnl|my_center|LOCUS_15860 116387 115125 gene locus_tag LOCUS_15870 116387 115125 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMT7 protein_id gnl|my_center|LOCUS_15870 117211 116408 gene locus_tag LOCUS_15880 gene trpA 117211 116408 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_15880 118830 117601 gene locus_tag LOCUS_15890 gene trpB 118830 117601 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_15890 119443 118799 gene locus_tag LOCUS_15900 gene trpF 119443 118799 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_15900 119872 119486 gene locus_tag LOCUS_15910 119872 119486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_15910 120252 119869 gene locus_tag LOCUS_15920 120252 119869 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224338.1 protein_id gnl|my_center|LOCUS_15920 120341 121135 gene locus_tag LOCUS_15930 120341 121135 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227633.1 protein_id gnl|my_center|LOCUS_15930 121881 121069 gene locus_tag LOCUS_15940 gene truA 121881 121069 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_15940 124689 121885 gene locus_tag LOCUS_15950 gene fimV 124689 121885 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_15950 126098 124956 gene locus_tag LOCUS_15960 gene asd-1 126098 124956 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJM5 protein_id gnl|my_center|LOCUS_15960 127187 126102 gene locus_tag LOCUS_15970 gene leuB 127187 126102 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C0 protein_id gnl|my_center|LOCUS_15970 128200 127559 gene locus_tag LOCUS_15980 gene leuD 128200 127559 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_15980 129630 128212 gene locus_tag LOCUS_15990 gene leuC 129630 128212 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_15990 129757 130629 gene locus_tag LOCUS_16000 129757 130629 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038431.1 protein_id gnl|my_center|LOCUS_16000 131017 130649 gene locus_tag LOCUS_16010 131017 130649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 131598 131014 gene locus_tag LOCUS_16020 131598 131014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 132295 131837 gene locus_tag LOCUS_16030 132295 131837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 132909 132331 gene locus_tag LOCUS_16040 132909 132331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 133902 133045 gene locus_tag LOCUS_16050 133902 133045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_16050 134374 133919 gene locus_tag LOCUS_16060 134374 133919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 134915 134418 gene locus_tag LOCUS_16070 134915 134418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232750.2 protein_id gnl|my_center|LOCUS_16070 135087 134908 gene locus_tag LOCUS_16080 135087 134908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 136191 135139 gene locus_tag LOCUS_16090 136191 135139 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_16090 136568 138112 gene locus_tag LOCUS_16100 136568 138112 CDS product chlorogenate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 protein_id gnl|my_center|LOCUS_16100 138263 139189 gene locus_tag LOCUS_16110 gene uspE 138263 139189 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_16110 139288 140625 gene locus_tag LOCUS_16120 139288 140625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 141902 140706 gene locus_tag LOCUS_16130 gene purT 141902 140706 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V7 protein_id gnl|my_center|LOCUS_16130 142139 141930 gene locus_tag LOCUS_16140 142139 141930 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266929.1 protein_id gnl|my_center|LOCUS_16140 142090 142401 gene locus_tag LOCUS_16150 142090 142401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 142803 142282 gene locus_tag LOCUS_16160 142803 142282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_16160 143399 142818 gene locus_tag LOCUS_16170 143399 142818 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_16170 143742 144092 gene locus_tag LOCUS_16180 143742 144092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 144158 144706 gene locus_tag LOCUS_16190 144158 144706 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_16190 145070 144747 gene locus_tag LOCUS_16200 145070 144747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_16200 145293 145072 gene locus_tag LOCUS_16210 145293 145072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 145467 146012 gene locus_tag LOCUS_16220 145467 146012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 146022 146174 gene locus_tag LOCUS_16230 146022 146174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 146171 146821 gene locus_tag LOCUS_16240 146171 146821 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 protein_id gnl|my_center|LOCUS_16240 149954 146829 gene locus_tag LOCUS_16250 gene czcA 149954 146829 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_16250 151144 149951 gene locus_tag LOCUS_16260 151144 149951 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_16260 152493 151141 gene locus_tag LOCUS_16270 gene ibeB 152493 151141 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_16270 153930 152716 gene locus_tag LOCUS_16280 153930 152716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_16280 156348 154042 gene locus_tag LOCUS_16290 156348 154042 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_16290 157483 156683 gene locus_tag LOCUS_16300 157483 156683 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_16300 159837 157480 gene locus_tag LOCUS_16310 159837 157480 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_16310 162687 160366 gene locus_tag LOCUS_16320 162687 160366 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_16320 163547 162714 gene locus_tag LOCUS_16330 163547 162714 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105801.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence08 48 124 gene locus_tag LOCUS_t00210 48 124 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 408 1208 gene locus_tag LOCUS_16340 408 1208 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_16340 1346 1663 gene locus_tag LOCUS_16350 1346 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2334 1666 gene locus_tag LOCUS_16360 2334 1666 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423213.1 protein_id gnl|my_center|LOCUS_16360 3551 2421 gene locus_tag LOCUS_16370 3551 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_16370 4836 3724 gene locus_tag LOCUS_16380 4836 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_16380 5066 5623 gene locus_tag LOCUS_16390 5066 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5737 6492 gene locus_tag LOCUS_16400 5737 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7018 6482 gene locus_tag LOCUS_16410 7018 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 7536 7015 gene locus_tag LOCUS_16420 7536 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7973 7533 gene locus_tag LOCUS_16430 7973 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8149 8925 gene locus_tag LOCUS_16440 8149 8925 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384112.1 protein_id gnl|my_center|LOCUS_16440 9404 8955 gene locus_tag LOCUS_16450 9404 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 12634 9503 gene locus_tag LOCUS_16460 gene acrB 12634 9503 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208616.1 protein_id gnl|my_center|LOCUS_16460 13809 12640 gene locus_tag LOCUS_16470 gene acrA 13809 12640 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208615.1 protein_id gnl|my_center|LOCUS_16470 13956 14603 gene locus_tag LOCUS_16480 13956 14603 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 protein_id gnl|my_center|LOCUS_16480 14662 15324 gene locus_tag LOCUS_16490 14662 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16159 15338 gene locus_tag LOCUS_16500 16159 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 18127 16493 gene locus_tag LOCUS_16510 gene groL1 18127 16493 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_16510 18470 18177 gene locus_tag LOCUS_16520 gene groS 18470 18177 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30720 protein_id gnl|my_center|LOCUS_16520 19125 18631 gene locus_tag LOCUS_16530 gene fxsA 19125 18631 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262747.1 protein_id gnl|my_center|LOCUS_16530 19353 20798 gene locus_tag LOCUS_16540 19353 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_16540 20804 21136 gene locus_tag LOCUS_16550 20804 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112757.1 protein_id gnl|my_center|LOCUS_16550 23482 21146 gene locus_tag LOCUS_16560 23482 21146 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_16560 25342 23735 gene locus_tag LOCUS_16570 gene aceF 25342 23735 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN8 protein_id gnl|my_center|LOCUS_16570 28034 25353 gene locus_tag LOCUS_16580 gene aceE 28034 25353 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_16580 28373 29227 gene locus_tag LOCUS_16590 28373 29227 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRX0 protein_id gnl|my_center|LOCUS_16590 29346 29546 gene locus_tag LOCUS_16600 29346 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_16600 29763 30242 gene locus_tag LOCUS_16610 29763 30242 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_16610 32626 30335 gene locus_tag LOCUS_16620 32626 30335 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 protein_id gnl|my_center|LOCUS_16620 34250 32841 gene locus_tag LOCUS_16630 gene ycaD 34250 32841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_16630 35785 34343 gene locus_tag LOCUS_16640 gene gtfA 35785 34343 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_16640 36264 37766 gene locus_tag LOCUS_16650 gene mqo 36264 37766 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_16650 38843 37854 gene locus_tag LOCUS_16660 38843 37854 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_16660 40096 38861 gene locus_tag LOCUS_16670 40096 38861 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_16670 42027 40726 gene locus_tag LOCUS_16680 42027 40726 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704360.1 protein_id gnl|my_center|LOCUS_16680 43816 42041 gene locus_tag LOCUS_16690 43816 42041 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_16690 44122 43874 gene locus_tag LOCUS_16700 44122 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 44405 45310 gene locus_tag LOCUS_16710 gene dusC 44405 45310 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV00 protein_id gnl|my_center|LOCUS_16710 45436 45636 gene locus_tag LOCUS_16720 45436 45636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 protein_id gnl|my_center|LOCUS_16720 46782 45727 gene locus_tag LOCUS_16730 46782 45727 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSD8 protein_id gnl|my_center|LOCUS_16730 48330 47329 gene locus_tag LOCUS_16740 gene cmoB 48330 47329 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G4 protein_id gnl|my_center|LOCUS_16740 49071 48346 gene locus_tag LOCUS_16750 gene cmoA 49071 48346 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_16750 50913 49120 gene locus_tag LOCUS_16760 50913 49120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 52430 50994 gene locus_tag LOCUS_16770 52430 50994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 53121 52420 gene locus_tag LOCUS_16780 gene gph1 53121 52420 CDS product phosphoglycolate phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S586 protein_id gnl|my_center|LOCUS_16780 53788 53114 gene locus_tag LOCUS_16790 gene rpe 53788 53114 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WKE7 protein_id gnl|my_center|LOCUS_16790 53955 55148 gene locus_tag LOCUS_16800 53955 55148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 55219 56040 gene locus_tag LOCUS_16810 55219 56040 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_16810 56105 56389 gene locus_tag LOCUS_16820 56105 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 56355 56546 gene locus_tag LOCUS_16830 56355 56546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 56564 58612 gene locus_tag LOCUS_16840 gene pepO 56564 58612 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_16840 58792 60063 gene locus_tag LOCUS_16850 58792 60063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 61957 60149 gene locus_tag LOCUS_16860 61957 60149 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086792.1 protein_id gnl|my_center|LOCUS_16860 62202 62699 gene locus_tag LOCUS_16870 62202 62699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 62899 64176 gene locus_tag LOCUS_16880 gene sqr 62899 64176 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_16880 66341 64239 gene locus_tag LOCUS_16890 gene pnp 66341 64239 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_16890 67122 66853 gene locus_tag LOCUS_16900 gene rpsO 67122 66853 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 protein_id gnl|my_center|LOCUS_16900 68186 67227 gene locus_tag LOCUS_16910 gene truB 68186 67227 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI9 protein_id gnl|my_center|LOCUS_16910 68666 68196 gene locus_tag LOCUS_16920 gene rbfA 68666 68196 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_16920 71294 68697 gene locus_tag LOCUS_16930 gene infB 71294 68697 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_16930 72819 71320 gene locus_tag LOCUS_16940 gene nusA 72819 71320 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_16940 73268 72837 gene locus_tag LOCUS_16950 gene rimP 73268 72837 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95578 protein_id gnl|my_center|LOCUS_16950 73728 73643 gene locus_tag LOCUS_t00220 73728 73643 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74143 73745 gene locus_tag LOCUS_16960 gene secG 74143 73745 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_16960 74864 74157 gene locus_tag LOCUS_16970 gene tpiA 74864 74157 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_16970 76311 74977 gene locus_tag LOCUS_16980 gene glmM 76311 74977 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_16980 77147 76308 gene locus_tag LOCUS_16990 gene folP 77147 76308 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_16990 79184 77262 gene locus_tag LOCUS_17000 gene ftsH 79184 77262 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_17000 79870 79247 gene locus_tag LOCUS_17010 gene rlmE 79870 79247 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_17010 79945 80247 gene locus_tag LOCUS_17020 79945 80247 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377487.1 protein_id gnl|my_center|LOCUS_17020 80305 81426 gene locus_tag LOCUS_17030 80305 81426 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_17030 81576 82097 gene locus_tag LOCUS_17040 81576 82097 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121395.1 protein_id gnl|my_center|LOCUS_17040 82914 82114 gene locus_tag LOCUS_17050 82914 82114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 83033 84046 gene locus_tag LOCUS_17060 83033 84046 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207526.1 protein_id gnl|my_center|LOCUS_17060 84635 84159 gene locus_tag LOCUS_17070 gene greA 84635 84159 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64282 protein_id gnl|my_center|LOCUS_17070 87886 84671 gene locus_tag LOCUS_17080 gene carB 87886 84671 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_17080 89052 87904 gene locus_tag LOCUS_17090 gene carA 89052 87904 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_17090 89402 90130 gene locus_tag LOCUS_17100 89402 90130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 90956 90153 gene locus_tag LOCUS_17110 gene dapB 90956 90153 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_17110 92455 91331 gene locus_tag LOCUS_17120 gene dnaJ 92455 91331 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_17120 94672 92768 gene locus_tag LOCUS_17130 gene dnaK 94672 92768 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_17130 95381 94815 gene locus_tag LOCUS_17140 gene grpE 95381 94815 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_17140 95520 97187 gene locus_tag LOCUS_17150 gene recN 95520 97187 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_17150 97614 97207 gene locus_tag LOCUS_17160 gene fur 97614 97207 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_17160 97700 98095 gene locus_tag LOCUS_17170 97700 98095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 98440 98129 gene locus_tag LOCUS_17180 98440 98129 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_17180 98864 98433 gene locus_tag LOCUS_17190 98864 98433 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_17190 100339 98888 gene locus_tag LOCUS_17200 100339 98888 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_17200 100495 100977 gene locus_tag LOCUS_17210 gene smpB 100495 100977 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKI0 protein_id gnl|my_center|LOCUS_17210 101491 101012 gene locus_tag LOCUS_17220 101491 101012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 103561 101624 gene locus_tag LOCUS_17230 gene pepF 103561 101624 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387169.1 protein_id gnl|my_center|LOCUS_17230 103747 104104 gene locus_tag LOCUS_tm00010 103747 104104 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 106132 104645 gene locus_tag LOCUS_17240 gene glpK 106132 104645 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J317 protein_id gnl|my_center|LOCUS_17240 107664 106156 gene locus_tag LOCUS_17250 gene glpD 107664 106156 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J310 protein_id gnl|my_center|LOCUS_17250 108108 110645 gene locus_tag LOCUS_17260 108108 110645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 110854 112725 gene locus_tag LOCUS_17270 110854 112725 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_17270 114187 112757 gene locus_tag LOCUS_17280 114187 112757 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_17280 114419 115792 gene locus_tag LOCUS_17290 gene cry 114419 115792 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJB1 protein_id gnl|my_center|LOCUS_17290 116202 115873 gene locus_tag LOCUS_17300 116202 115873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 117342 116419 gene locus_tag LOCUS_17310 117342 116419 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_17310 117442 118446 gene locus_tag LOCUS_17320 117442 118446 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_17320 118446 118826 gene locus_tag LOCUS_17330 118446 118826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 118954 119925 gene locus_tag LOCUS_17340 118954 119925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_17340 119945 121378 gene locus_tag LOCUS_17350 gene phr 119945 121378 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 protein_id gnl|my_center|LOCUS_17350 121383 122327 gene locus_tag LOCUS_17360 gene desC 121383 122327 CDS product stearoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 protein_id gnl|my_center|LOCUS_17360 122317 122763 gene locus_tag LOCUS_17370 122317 122763 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_17370 122760 123572 gene locus_tag LOCUS_17380 122760 123572 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 protein_id gnl|my_center|LOCUS_17380 123569 124846 gene locus_tag LOCUS_17390 123569 124846 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_17390 124843 125700 gene locus_tag LOCUS_17400 124843 125700 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 protein_id gnl|my_center|LOCUS_17400 125705 126958 gene locus_tag LOCUS_17410 gene cfaA 125705 126958 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_17410 126955 127485 gene locus_tag LOCUS_17420 126955 127485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 127552 128241 gene locus_tag LOCUS_17430 127552 128241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 protein_id gnl|my_center|LOCUS_17430 128234 130315 gene locus_tag LOCUS_17440 128234 130315 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_17440 130433 131461 gene locus_tag LOCUS_17450 130433 131461 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142854.1 protein_id gnl|my_center|LOCUS_17450 131458 132246 gene locus_tag LOCUS_17460 131458 132246 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_17460 133158 132259 gene locus_tag LOCUS_17470 133158 132259 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_17470 133307 133651 gene locus_tag LOCUS_17480 133307 133651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 133848 133633 gene locus_tag LOCUS_17490 133848 133633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 133744 134646 gene locus_tag LOCUS_17500 133744 134646 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_17500 135676 135128 gene locus_tag LOCUS_17510 135676 135128 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_17510 135771 137117 gene locus_tag LOCUS_17520 135771 137117 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_17520 137444 138298 gene locus_tag LOCUS_17530 gene nadC 137444 138298 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_17530 138660 139097 gene locus_tag LOCUS_17540 138660 139097 CDS product pilin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_17540 139668 141146 gene locus_tag LOCUS_17550 139668 141146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 141134 142837 gene locus_tag LOCUS_17560 gene pilB 141134 142837 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_17560 142939 144171 gene locus_tag LOCUS_17570 142939 144171 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_17570 144171 145052 gene locus_tag LOCUS_17580 144171 145052 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_17580 145221 145823 gene locus_tag LOCUS_17590 gene coaE 145221 145823 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_17590 145816 146043 gene locus_tag LOCUS_17600 gene yacG 145816 146043 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_17600 >Feature sequence09 656 1759 gene locus_tag LOCUS_17610 656 1759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_17610 2469 3773 gene locus_tag LOCUS_17620 2469 3773 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706873.1 protein_id gnl|my_center|LOCUS_17620 4001 4462 gene locus_tag LOCUS_17630 4001 4462 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_17630 6513 4522 gene locus_tag LOCUS_17640 gene tktA 6513 4522 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_17640 7344 6625 gene locus_tag LOCUS_17650 7344 6625 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933546.1 protein_id gnl|my_center|LOCUS_17650 7671 9128 gene locus_tag LOCUS_17660 7671 9128 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_17660 9164 10051 gene locus_tag LOCUS_17670 gene ephD 9164 10051 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_17670 10227 11660 gene locus_tag LOCUS_17680 10227 11660 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_17680 12025 11768 gene locus_tag LOCUS_17690 12025 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_17690 12738 12028 gene locus_tag LOCUS_17700 12738 12028 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_17700 13051 12749 gene locus_tag LOCUS_17710 13051 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_17710 14030 13083 gene locus_tag LOCUS_17720 gene thiL 14030 13083 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q4 protein_id gnl|my_center|LOCUS_17720 14495 14034 gene locus_tag LOCUS_17730 gene nusB 14495 14034 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_17730 14977 14501 gene locus_tag LOCUS_17740 gene ribH 14977 14501 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_17740 16107 14992 gene locus_tag LOCUS_17750 gene ribB 16107 14992 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882G0 protein_id gnl|my_center|LOCUS_17750 17289 16123 gene locus_tag LOCUS_17760 gene ribD 17289 16123 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_17760 17753 17286 gene locus_tag LOCUS_17770 gene nrdR 17753 17286 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMX9 protein_id gnl|my_center|LOCUS_17770 18730 17906 gene locus_tag LOCUS_17780 18730 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_17780 18854 19105 gene locus_tag LOCUS_17790 18854 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 20456 19191 gene locus_tag LOCUS_17800 gene glyA 20456 19191 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_17800 20633 22294 gene locus_tag LOCUS_17810 20633 22294 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_17810 22415 22768 gene locus_tag LOCUS_17820 22415 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 22852 23511 gene locus_tag LOCUS_17830 gene ycgM 22852 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76004 protein_id gnl|my_center|LOCUS_17830 23508 24746 gene locus_tag LOCUS_17840 23508 24746 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 protein_id gnl|my_center|LOCUS_17840 24771 25199 gene locus_tag LOCUS_17850 24771 25199 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_17850 25693 25196 gene locus_tag LOCUS_17860 25693 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_17860 26469 25690 gene locus_tag LOCUS_17870 gene smtA 26469 25690 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LN6 protein_id gnl|my_center|LOCUS_17870 26590 27234 gene locus_tag LOCUS_17880 26590 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 27706 27254 gene locus_tag LOCUS_17890 27706 27254 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MC8 protein_id gnl|my_center|LOCUS_17890 28298 27732 gene locus_tag LOCUS_17900 28298 27732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 29640 28558 gene locus_tag LOCUS_17910 29640 28558 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026970.1 protein_id gnl|my_center|LOCUS_17910 30058 29684 gene locus_tag LOCUS_17920 30058 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967288.1 protein_id gnl|my_center|LOCUS_17920 30567 30088 gene locus_tag LOCUS_17930 30567 30088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 31768 30551 gene locus_tag LOCUS_17940 31768 30551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390922.1 protein_id gnl|my_center|LOCUS_17940 32532 31924 gene locus_tag LOCUS_17950 32532 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 protein_id gnl|my_center|LOCUS_17950 33568 32588 gene locus_tag LOCUS_17960 33568 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 protein_id gnl|my_center|LOCUS_17960 35937 33568 gene locus_tag LOCUS_17970 35937 33568 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 protein_id gnl|my_center|LOCUS_17970 36431 35934 gene locus_tag LOCUS_17980 36431 35934 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_17980 37508 36828 gene locus_tag LOCUS_17990 37508 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_17990 39914 37596 gene locus_tag LOCUS_18000 gene metE 39914 37596 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 protein_id gnl|my_center|LOCUS_18000 40019 40900 gene locus_tag LOCUS_18010 gene metR 40019 40900 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_18010 42041 40917 gene locus_tag LOCUS_18020 42041 40917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 42569 42183 gene locus_tag LOCUS_18030 42569 42183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 43009 42933 gene locus_tag LOCUS_t00230 43009 42933 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45310 43457 gene locus_tag LOCUS_18040 gene rpoD 45310 43457 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_18040 47379 45517 gene locus_tag LOCUS_18050 gene dnaG 47379 45517 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_18050 47919 47476 gene locus_tag LOCUS_18060 47919 47476 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_18060 48167 47952 gene locus_tag LOCUS_18070 gene rpsU 48167 47952 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A58 protein_id gnl|my_center|LOCUS_18070 48382 49434 gene locus_tag LOCUS_18080 gene tsaD 48382 49434 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NJS7 protein_id gnl|my_center|LOCUS_18080 49427 49783 gene locus_tag LOCUS_18090 gene folB 49427 49783 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V5 protein_id gnl|my_center|LOCUS_18090 49783 50289 gene locus_tag LOCUS_18100 49783 50289 CDS product 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230176.2 protein_id gnl|my_center|LOCUS_18100 51522 50290 gene locus_tag LOCUS_18110 gene cca 51522 50290 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3M9 protein_id gnl|my_center|LOCUS_18110 53218 51602 gene locus_tag LOCUS_18120 53218 51602 CDS product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_18120 53539 54441 gene locus_tag LOCUS_18130 53539 54441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764892.1 protein_id gnl|my_center|LOCUS_18130 54511 55101 gene locus_tag LOCUS_18140 gene flgP 54511 55101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_18140 55117 56316 gene locus_tag LOCUS_18150 55117 56316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739493.1 protein_id gnl|my_center|LOCUS_18150 57871 56369 gene locus_tag LOCUS_18160 57871 56369 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_18160 59103 57868 gene locus_tag LOCUS_18170 59103 57868 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V0 protein_id gnl|my_center|LOCUS_18170 61233 59188 gene locus_tag LOCUS_18180 61233 59188 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_18180 61793 61476 gene locus_tag LOCUS_18190 gene glpE 61793 61476 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U8 protein_id gnl|my_center|LOCUS_18190 62687 61878 gene locus_tag LOCUS_18200 gene apaH 62687 61878 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_18200 63071 62694 gene locus_tag LOCUS_18210 gene apaG 63071 62694 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_18210 63891 63061 gene locus_tag LOCUS_18220 gene rsmA 63891 63061 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A46 protein_id gnl|my_center|LOCUS_18220 64889 63888 gene locus_tag LOCUS_18230 gene pdxA 64889 63888 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG6 protein_id gnl|my_center|LOCUS_18230 66190 64886 gene locus_tag LOCUS_18240 gene surA 66190 64886 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_18240 68606 66156 gene locus_tag LOCUS_18250 gene lptD 68606 66156 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 protein_id gnl|my_center|LOCUS_18250 68848 69894 gene locus_tag LOCUS_18260 68848 69894 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_18260 69891 70562 gene locus_tag LOCUS_18270 69891 70562 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_18270 70559 71386 gene locus_tag LOCUS_18280 gene djlA 70559 71386 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_18280 71373 71681 gene locus_tag LOCUS_18290 71373 71681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 71826 72611 gene locus_tag LOCUS_18300 71826 72611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 72616 73518 gene locus_tag LOCUS_18310 72616 73518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 73515 75425 gene locus_tag LOCUS_18320 gene xcpQ 73515 75425 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_18320 76103 75477 gene locus_tag LOCUS_18330 76103 75477 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV74 protein_id gnl|my_center|LOCUS_18330 76755 76177 gene locus_tag LOCUS_18340 76755 76177 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_18340 77196 78014 gene locus_tag LOCUS_18350 77196 78014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 78620 78087 gene locus_tag LOCUS_18360 78620 78087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 78794 79546 gene locus_tag LOCUS_18370 78794 79546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 79708 81216 gene locus_tag LOCUS_18380 79708 81216 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_18380 81366 81662 gene locus_tag LOCUS_18390 81366 81662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 81849 83777 gene locus_tag LOCUS_18400 81849 83777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 83849 85624 gene locus_tag LOCUS_18410 83849 85624 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 protein_id gnl|my_center|LOCUS_18410 87046 85664 gene locus_tag LOCUS_18420 87046 85664 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103754.1 protein_id gnl|my_center|LOCUS_18420 87717 87043 gene locus_tag LOCUS_18430 87717 87043 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_18430 88604 87714 gene locus_tag LOCUS_18440 88604 87714 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_18440 90048 88672 gene locus_tag LOCUS_18450 90048 88672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_18450 90266 90039 gene locus_tag LOCUS_18460 90266 90039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 90703 90263 gene locus_tag LOCUS_18470 90703 90263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_18470 90844 92565 gene locus_tag LOCUS_18480 gene dsbD 90844 92565 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_18480 92774 94324 gene locus_tag LOCUS_18490 gene phoA 92774 94324 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_18490 95686 94325 gene locus_tag LOCUS_18500 95686 94325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_18500 96363 95782 gene locus_tag LOCUS_18510 96363 95782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 97076 96378 gene locus_tag LOCUS_18520 97076 96378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 97693 97148 gene locus_tag LOCUS_18530 97693 97148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 97903 98754 gene locus_tag LOCUS_18540 gene purU-3 97903 98754 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X74 protein_id gnl|my_center|LOCUS_18540 99516 99902 gene locus_tag LOCUS_18550 99516 99902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 100037 100489 gene locus_tag LOCUS_18560 100037 100489 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_18560 101188 100562 gene locus_tag LOCUS_18570 101188 100562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084088.1 protein_id gnl|my_center|LOCUS_18570 102105 101293 gene locus_tag LOCUS_18580 102105 101293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_18580 104112 102925 gene locus_tag LOCUS_18590 gene thlA 104112 102925 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_18590 104761 104261 gene locus_tag LOCUS_18600 104761 104261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 105791 104796 gene locus_tag LOCUS_18610 gene srkA 105791 104796 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_18610 106284 105829 gene locus_tag LOCUS_18620 106284 105829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 106240 106512 gene locus_tag LOCUS_18630 106240 106512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 106607 107674 gene locus_tag LOCUS_18640 gene bioB 106607 107674 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_18640 107779 108030 gene locus_tag LOCUS_18650 107779 108030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 108263 108027 gene locus_tag LOCUS_18660 108263 108027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 108377 110167 gene locus_tag LOCUS_18670 108377 110167 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_18670 110322 110912 gene locus_tag LOCUS_18680 110322 110912 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_18680 111313 110969 gene locus_tag LOCUS_18690 111313 110969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 111515 112186 gene locus_tag LOCUS_18700 111515 112186 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267121.1 protein_id gnl|my_center|LOCUS_18700 112395 113876 gene locus_tag LOCUS_18710 112395 113876 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_18710 113887 114471 gene locus_tag LOCUS_18720 gene trpG 113887 114471 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_18720 114493 115536 gene locus_tag LOCUS_18730 gene trpD 114493 115536 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_18730 115547 116347 gene locus_tag LOCUS_18740 gene trpC 115547 116347 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_18740 116355 116714 gene locus_tag LOCUS_18750 116355 116714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 116891 116721 gene locus_tag LOCUS_18760 116891 116721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 117529 116891 gene locus_tag LOCUS_18770 gene vfr 117529 116891 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_18770 117699 118121 gene locus_tag LOCUS_18780 117699 118121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_18780 118162 118941 gene locus_tag LOCUS_18790 gene speD 118162 118941 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_18790 118938 120119 gene locus_tag LOCUS_18800 118938 120119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706360.1 protein_id gnl|my_center|LOCUS_18800 120800 120135 gene locus_tag LOCUS_18810 120800 120135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_18810 122186 121191 gene locus_tag LOCUS_18820 gene rsmC 122186 121191 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44453 protein_id gnl|my_center|LOCUS_18820 123087 122179 gene locus_tag LOCUS_18830 123087 122179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 123211 123678 gene locus_tag LOCUS_18840 123211 123678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 124618 124088 gene locus_tag LOCUS_18850 gene ppa 124618 124088 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_18850 125705 124734 gene locus_tag LOCUS_18860 gene fbp 125705 124734 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 protein_id gnl|my_center|LOCUS_18860 126117 127505 gene locus_tag LOCUS_18870 gene mpl 126117 127505 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_18870 127505 128128 gene locus_tag LOCUS_18880 gene ubiX 127505 128128 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_18880 128121 128483 gene locus_tag LOCUS_18890 128121 128483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_18890 128492 129619 gene locus_tag LOCUS_18900 128492 129619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 129638 130009 gene locus_tag LOCUS_18910 129638 130009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 130094 130930 gene locus_tag LOCUS_18920 130094 130930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 131634 131038 gene locus_tag LOCUS_18930 131634 131038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_18930 132884 131871 gene locus_tag LOCUS_18940 gene holA 132884 131871 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_18940 133369 132881 gene locus_tag LOCUS_18950 gene lptE 133369 132881 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLW7 protein_id gnl|my_center|LOCUS_18950 136303 133724 gene locus_tag LOCUS_18960 gene leuS 136303 133724 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP4 protein_id gnl|my_center|LOCUS_18960 136549 137664 gene locus_tag LOCUS_18970 136549 137664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_18970 137678 138202 gene locus_tag LOCUS_18980 137678 138202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 138186 138905 gene locus_tag LOCUS_18990 138186 138905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 139293 139586 gene locus_tag LOCUS_19000 139293 139586 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence10 1529 3406 gene locus_tag LOCUS_19010 1529 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3403 5661 gene locus_tag LOCUS_19020 gene parC 3403 5661 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_19020 5775 7343 gene locus_tag LOCUS_19030 gene opgG 5775 7343 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSG8 protein_id gnl|my_center|LOCUS_19030 7340 9475 gene locus_tag LOCUS_19040 gene opgH 7340 9475 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF78 protein_id gnl|my_center|LOCUS_19040 9972 9586 gene locus_tag LOCUS_19050 9972 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 10077 10730 gene locus_tag LOCUS_19060 10077 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_19060 10781 11197 gene locus_tag LOCUS_19070 10781 11197 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_19070 11316 12245 gene locus_tag LOCUS_19080 11316 12245 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_19080 12428 13282 gene locus_tag LOCUS_19090 gene speE 12428 13282 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHM1 protein_id gnl|my_center|LOCUS_19090 14443 13664 gene locus_tag LOCUS_19100 14443 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 15492 14614 gene locus_tag LOCUS_19110 15492 14614 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_19110 18020 15492 gene locus_tag LOCUS_19120 18020 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_19120 21464 18084 gene locus_tag LOCUS_19130 21464 18084 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_19130 22514 21579 gene locus_tag LOCUS_19140 22514 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_19140 23977 22514 gene locus_tag LOCUS_19150 23977 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_19150 24746 24135 gene locus_tag LOCUS_19160 24746 24135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 27189 24766 gene locus_tag LOCUS_19170 gene gyrB 27189 24766 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_19170 28274 27186 gene locus_tag LOCUS_19180 gene recF 28274 27186 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_19180 29438 28296 gene locus_tag LOCUS_19190 29438 28296 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_19190 31008 29482 gene locus_tag LOCUS_19200 gene dnaA 31008 29482 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C5 protein_id gnl|my_center|LOCUS_19200 31975 32109 gene locus_tag LOCUS_19210 gene rpmH 31975 32109 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH2 protein_id gnl|my_center|LOCUS_19210 32137 32526 gene locus_tag LOCUS_19220 gene rnpA 32137 32526 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44306 protein_id gnl|my_center|LOCUS_19220 32486 32794 gene locus_tag LOCUS_19230 32486 32794 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y592 protein_id gnl|my_center|LOCUS_19230 32797 34479 gene locus_tag LOCUS_19240 gene yidC 32797 34479 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_19240 34623 36014 gene locus_tag LOCUS_19250 gene mnmE 34623 36014 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TR6 protein_id gnl|my_center|LOCUS_19250 36745 36020 gene locus_tag LOCUS_19260 36745 36020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 37641 36745 gene locus_tag LOCUS_19270 37641 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 39500 37644 gene locus_tag LOCUS_19280 39500 37644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 40513 39497 gene locus_tag LOCUS_19290 40513 39497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 43097 40503 gene locus_tag LOCUS_19300 43097 40503 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_19300 44751 43174 gene locus_tag LOCUS_19310 44751 43174 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383508.1 protein_id gnl|my_center|LOCUS_19310 45035 44826 gene locus_tag LOCUS_19320 45035 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 45627 45256 gene locus_tag LOCUS_19330 45627 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 45912 45739 gene locus_tag LOCUS_19340 45912 45739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 46840 46187 gene locus_tag LOCUS_19350 46840 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 47087 48541 gene locus_tag LOCUS_19360 47087 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 49410 48568 gene locus_tag LOCUS_19370 49410 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_19370 49639 50616 gene locus_tag LOCUS_19380 49639 50616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 52233 50977 gene locus_tag LOCUS_19390 gene dadA 52233 50977 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_19390 52664 54562 gene locus_tag LOCUS_19400 gene mnmG 52664 54562 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_19400 54752 56101 gene locus_tag LOCUS_19410 54752 56101 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073057.1 protein_id gnl|my_center|LOCUS_19410 56115 56399 gene locus_tag LOCUS_19420 56115 56399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 56509 59427 gene locus_tag LOCUS_19430 56509 59427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 60001 59432 gene locus_tag LOCUS_19440 60001 59432 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 protein_id gnl|my_center|LOCUS_19440 60479 60024 gene locus_tag LOCUS_19450 60479 60024 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_19450 61965 60568 gene locus_tag LOCUS_19460 61965 60568 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074116.1 protein_id gnl|my_center|LOCUS_19460 62633 61962 gene locus_tag LOCUS_19470 62633 61962 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_19470 62929 62630 gene locus_tag LOCUS_19480 62929 62630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 63491 62883 gene locus_tag LOCUS_19490 63491 62883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 63833 63501 gene locus_tag LOCUS_19500 63833 63501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 64414 63830 gene locus_tag LOCUS_19510 64414 63830 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_19510 65152 64556 gene locus_tag LOCUS_19520 65152 64556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 65491 66015 gene locus_tag LOCUS_19530 65491 66015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 67169 66012 gene locus_tag LOCUS_19540 67169 66012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_19540 67284 67925 gene locus_tag LOCUS_19550 gene rsmG 67284 67925 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_19550 67957 68748 gene locus_tag LOCUS_19560 gene soj 67957 68748 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_19560 68785 69690 gene locus_tag LOCUS_19570 gene spoOJ 68785 69690 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_19570 69758 70216 gene locus_tag LOCUS_19580 69758 70216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 70239 71150 gene locus_tag LOCUS_19590 gene atpB 70239 71150 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS8 protein_id gnl|my_center|LOCUS_19590 71211 71438 gene locus_tag LOCUS_19600 gene atpE 71211 71438 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_19600 71489 71959 gene locus_tag LOCUS_19610 gene atpF 71489 71959 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_19610 71971 72507 gene locus_tag LOCUS_19620 gene atpH 71971 72507 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_19620 72523 74061 gene locus_tag LOCUS_19630 gene atpA 72523 74061 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_19630 74117 74977 gene locus_tag LOCUS_19640 gene atpG 74117 74977 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_19640 75032 76441 gene locus_tag LOCUS_19650 gene atpD 75032 76441 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C0 protein_id gnl|my_center|LOCUS_19650 76501 76929 gene locus_tag LOCUS_19660 gene atpC 76501 76929 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_19660 77584 78186 gene locus_tag LOCUS_19670 77584 78186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 78322 78906 gene locus_tag LOCUS_19680 78322 78906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 79928 78909 gene locus_tag LOCUS_19690 gene ansA 79928 78909 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A962 protein_id gnl|my_center|LOCUS_19690 80004 80080 gene locus_tag LOCUS_t00240 80004 80080 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 80943 80107 gene locus_tag LOCUS_19700 80943 80107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_19700 81202 82749 gene locus_tag LOCUS_19710 81202 82749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 82941 82750 gene locus_tag LOCUS_19720 82941 82750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 83146 82952 gene locus_tag LOCUS_19730 83146 82952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391039.1 protein_id gnl|my_center|LOCUS_19730 83763 83215 gene locus_tag LOCUS_19740 gene gmhB 83763 83215 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_19740 84521 83763 gene locus_tag LOCUS_19750 84521 83763 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 protein_id gnl|my_center|LOCUS_19750 85069 84509 gene locus_tag LOCUS_19760 85069 84509 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_19760 85654 87789 gene locus_tag LOCUS_19770 85654 87789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 89966 87894 gene locus_tag LOCUS_19780 gene glyS 89966 87894 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_19780 90946 89966 gene locus_tag LOCUS_19790 gene glyQ 90946 89966 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_19790 91233 92681 gene locus_tag LOCUS_19800 91233 92681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 92851 94323 gene locus_tag LOCUS_19810 92851 94323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 94590 96110 gene locus_tag LOCUS_19820 94590 96110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 96287 96925 gene locus_tag LOCUS_19830 gene tpm 96287 96925 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC3 protein_id gnl|my_center|LOCUS_19830 98414 96990 gene locus_tag LOCUS_19840 gene argH 98414 96990 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_19840 99802 98522 gene locus_tag LOCUS_19850 gene kdtA 99802 98522 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891562.1 protein_id gnl|my_center|LOCUS_19850 99901 101331 gene locus_tag LOCUS_19860 gene hldE 99901 101331 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05074 protein_id gnl|my_center|LOCUS_19860 101328 102296 gene locus_tag LOCUS_19870 gene rfaD 101328 102296 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL80 protein_id gnl|my_center|LOCUS_19870 102289 103251 gene locus_tag LOCUS_19880 gene lpxL 102289 103251 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_19880 105996 103417 gene locus_tag LOCUS_19890 105996 103417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 107010 106045 gene locus_tag LOCUS_19900 107010 106045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 106900 107136 gene locus_tag LOCUS_19910 106900 107136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 107200 108711 gene locus_tag LOCUS_19920 gene comM 107200 108711 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_19920 110542 108941 gene locus_tag LOCUS_19930 110542 108941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 110725 112752 gene locus_tag LOCUS_19940 gene rep 110725 112752 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 protein_id gnl|my_center|LOCUS_19940 112850 114229 gene locus_tag LOCUS_19950 gene fumC1 112850 114229 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51404 protein_id gnl|my_center|LOCUS_19950 115109 114249 gene locus_tag LOCUS_19960 115109 114249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 115295 116968 gene locus_tag LOCUS_19970 115295 116968 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522103.1 protein_id gnl|my_center|LOCUS_19970 116965 117432 gene locus_tag LOCUS_19980 116965 117432 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_19980 117739 119121 gene locus_tag LOCUS_19990 117739 119121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 119790 121184 gene locus_tag LOCUS_20000 119790 121184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 121715 122536 gene locus_tag LOCUS_20010 121715 122536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 122700 123080 gene locus_tag LOCUS_20020 122700 123080 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_20020 123457 123930 gene locus_tag LOCUS_20030 123457 123930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 124034 124963 gene locus_tag LOCUS_20040 124034 124963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 125009 125500 gene locus_tag LOCUS_20050 125009 125500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 125505 125852 gene locus_tag LOCUS_20060 125505 125852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence11 357 1562 gene locus_tag LOCUS_20070 357 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2449 1625 gene locus_tag LOCUS_20080 2449 1625 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_20080 2655 2966 gene locus_tag LOCUS_20090 gene rpsJ 2655 2966 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X2 protein_id gnl|my_center|LOCUS_20090 3074 3706 gene locus_tag LOCUS_20100 gene rplC 3074 3706 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_203618.2 protein_id gnl|my_center|LOCUS_20100 3710 4312 gene locus_tag LOCUS_20110 gene rplD 3710 4312 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B4 protein_id gnl|my_center|LOCUS_20110 4309 4605 gene locus_tag LOCUS_20120 gene rplW 4309 4605 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_20120 4618 5442 gene locus_tag LOCUS_20130 gene rplB 4618 5442 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T10 protein_id gnl|my_center|LOCUS_20130 5460 5735 gene locus_tag LOCUS_20140 gene rpsS 5460 5735 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_20140 5749 6081 gene locus_tag LOCUS_20150 gene rplV 5749 6081 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_20150 6094 6783 gene locus_tag LOCUS_20160 gene rpsC 6094 6783 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_20160 6796 7209 gene locus_tag LOCUS_20170 gene rplP 6796 7209 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_20170 7209 7400 gene locus_tag LOCUS_20180 gene rpmC 7209 7400 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE3 protein_id gnl|my_center|LOCUS_20180 7397 7669 gene locus_tag LOCUS_20190 gene rpsQ 7397 7669 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W2 protein_id gnl|my_center|LOCUS_20190 7701 8069 gene locus_tag LOCUS_20200 gene rplN 7701 8069 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ4 protein_id gnl|my_center|LOCUS_20200 8086 8400 gene locus_tag LOCUS_20210 gene rplX 8086 8400 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE6 protein_id gnl|my_center|LOCUS_20210 8415 8954 gene locus_tag LOCUS_20220 gene rplE 8415 8954 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_20220 8965 9270 gene locus_tag LOCUS_20230 gene rpsN 8965 9270 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_20230 9372 9764 gene locus_tag LOCUS_20240 gene rpsH 9372 9764 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ8 protein_id gnl|my_center|LOCUS_20240 9777 10310 gene locus_tag LOCUS_20250 gene rplF 9777 10310 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_20250 10321 10671 gene locus_tag LOCUS_20260 gene rplR 10321 10671 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_20260 10683 11183 gene locus_tag LOCUS_20270 gene rpsE 10683 11183 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN50 protein_id gnl|my_center|LOCUS_20270 11190 11375 gene locus_tag LOCUS_20280 gene rpmD 11190 11375 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK52 protein_id gnl|my_center|LOCUS_20280 11377 11811 gene locus_tag LOCUS_20290 gene rplO 11377 11811 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ4 protein_id gnl|my_center|LOCUS_20290 11811 13133 gene locus_tag LOCUS_20300 gene secY 11811 13133 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF5 protein_id gnl|my_center|LOCUS_20300 13377 13733 gene locus_tag LOCUS_20310 gene rpsM 13377 13733 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_20310 13816 14205 gene locus_tag LOCUS_20320 gene rpsK 13816 14205 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_20320 14221 14841 gene locus_tag LOCUS_20330 gene rpsD 14221 14841 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_20330 14862 15863 gene locus_tag LOCUS_20340 gene rpoA 14862 15863 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_20340 15878 16279 gene locus_tag LOCUS_20350 gene rplQ 15878 16279 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_20350 16858 16349 gene locus_tag LOCUS_20360 16858 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 17145 17894 gene locus_tag LOCUS_20370 17145 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 18818 17895 gene locus_tag LOCUS_20380 18818 17895 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816850.1 protein_id gnl|my_center|LOCUS_20380 18928 19383 gene locus_tag LOCUS_20390 18928 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 19399 20334 gene locus_tag LOCUS_20400 19399 20334 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268189.1 protein_id gnl|my_center|LOCUS_20400 21216 20353 gene locus_tag LOCUS_20410 21216 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 protein_id gnl|my_center|LOCUS_20410 21328 22044 gene locus_tag LOCUS_20420 gene rph 21328 22044 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_20420 22877 22101 gene locus_tag LOCUS_20430 22877 22101 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 protein_id gnl|my_center|LOCUS_20430 22980 23627 gene locus_tag LOCUS_20440 gene pyrE 22980 23627 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY3 protein_id gnl|my_center|LOCUS_20440 23640 24338 gene locus_tag LOCUS_20450 23640 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 24999 24382 gene locus_tag LOCUS_20460 gene slmA 24999 24382 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_20460 25919 24996 gene locus_tag LOCUS_20470 gene argB 25919 24996 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_20470 28523 26007 gene locus_tag LOCUS_20480 28523 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 29094 28639 gene locus_tag LOCUS_20490 gene dut 29094 28639 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP5 protein_id gnl|my_center|LOCUS_20490 30324 29110 gene locus_tag LOCUS_20500 gene coaC 30324 29110 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_20500 30388 31062 gene locus_tag LOCUS_20510 30388 31062 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_20510 31256 31456 gene locus_tag LOCUS_20520 31256 31456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 31668 31904 gene locus_tag LOCUS_20530 gene rpmB 31668 31904 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_20530 31916 32074 gene locus_tag LOCUS_20540 gene rpmG 31916 32074 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T84 protein_id gnl|my_center|LOCUS_20540 32184 32993 gene locus_tag LOCUS_20550 gene mutM 32184 32993 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_20550 34100 33018 gene locus_tag LOCUS_20560 34100 33018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 34099 34320 gene locus_tag LOCUS_20570 34099 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 34330 35133 gene locus_tag LOCUS_20580 34330 35133 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_20580 35218 35787 gene locus_tag LOCUS_20590 35218 35787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 37218 35836 gene locus_tag LOCUS_20600 37218 35836 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_20600 37982 37215 gene locus_tag LOCUS_20610 37982 37215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 protein_id gnl|my_center|LOCUS_20610 38239 39834 gene locus_tag LOCUS_20620 38239 39834 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_20620 40836 39871 gene locus_tag LOCUS_20630 40836 39871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 41440 40853 gene locus_tag LOCUS_20640 41440 40853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 41951 41430 gene locus_tag LOCUS_20650 41951 41430 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_20650 43716 42022 gene locus_tag LOCUS_20660 43716 42022 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_20660 44069 43812 gene locus_tag LOCUS_20670 44069 43812 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_20670 44600 44121 gene locus_tag LOCUS_20680 gene coaD 44600 44121 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM37 protein_id gnl|my_center|LOCUS_20680 44787 45890 gene locus_tag LOCUS_20690 44787 45890 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223455.1 protein_id gnl|my_center|LOCUS_20690 46051 47850 gene locus_tag LOCUS_20700 46051 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 47917 48429 gene locus_tag LOCUS_20710 47917 48429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 48726 50372 gene locus_tag LOCUS_20720 48726 50372 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113025.1 protein_id gnl|my_center|LOCUS_20720 52073 50445 gene locus_tag LOCUS_20730 52073 50445 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_20730 52560 52084 gene locus_tag LOCUS_20740 52560 52084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 52803 53480 gene locus_tag LOCUS_20750 52803 53480 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_20750 53608 54834 gene locus_tag LOCUS_20760 53608 54834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_20760 54836 55624 gene locus_tag LOCUS_20770 54836 55624 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_20770 57443 55674 gene locus_tag LOCUS_20780 57443 55674 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_20780 58284 57556 gene locus_tag LOCUS_20790 gene tatC 58284 57556 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH0 protein_id gnl|my_center|LOCUS_20790 58634 58281 gene locus_tag LOCUS_20800 gene tatB 58634 58281 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB4 protein_id gnl|my_center|LOCUS_20800 58870 58634 gene locus_tag LOCUS_20810 gene tatA 58870 58634 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF9 protein_id gnl|my_center|LOCUS_20810 59241 58909 gene locus_tag LOCUS_20820 gene hisE 59241 58909 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_20820 59663 59253 gene locus_tag LOCUS_20830 gene hisI 59663 59253 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_20830 61359 59704 gene locus_tag LOCUS_20840 gene ubiB 61359 59704 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_20840 62016 61369 gene locus_tag LOCUS_20850 62016 61369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 62774 62016 gene locus_tag LOCUS_20860 gene ubiE 62774 62016 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_20860 62966 63214 gene locus_tag LOCUS_20870 62966 63214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 64327 63278 gene locus_tag LOCUS_20880 gene oprF 64327 63278 CDS product outer membrane porin F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13794 protein_id gnl|my_center|LOCUS_20880 66542 64689 gene locus_tag LOCUS_20890 66542 64689 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_20890 67164 66568 gene locus_tag LOCUS_20900 67164 66568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_20900 67497 67177 gene locus_tag LOCUS_20910 67497 67177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_20910 67695 67510 gene locus_tag LOCUS_20920 67695 67510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 67978 68379 gene locus_tag LOCUS_20930 67978 68379 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_20930 68632 68901 gene locus_tag LOCUS_20940 68632 68901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 69031 69699 gene locus_tag LOCUS_20950 69031 69699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 70354 69641 gene locus_tag LOCUS_20960 70354 69641 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_20960 71025 70354 gene locus_tag LOCUS_20970 71025 70354 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084657.1 protein_id gnl|my_center|LOCUS_20970 71866 71027 gene locus_tag LOCUS_20980 gene dapF 71866 71027 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_20980 73134 71872 gene locus_tag LOCUS_20990 gene lysA 73134 71872 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_20990 73379 73137 gene locus_tag LOCUS_21000 73379 73137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 76285 73442 gene locus_tag LOCUS_21010 76285 73442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 77584 76334 gene locus_tag LOCUS_21020 gene pyrC' 77584 76334 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_21020 78600 77584 gene locus_tag LOCUS_21030 gene pyrB 78600 77584 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_21030 79118 78612 gene locus_tag LOCUS_21040 gene pyrR 79118 78612 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ69 protein_id gnl|my_center|LOCUS_21040 79581 79105 gene locus_tag LOCUS_21050 79581 79105 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_21050 80134 79574 gene locus_tag LOCUS_21060 80134 79574 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP8 protein_id gnl|my_center|LOCUS_21060 81009 80134 gene locus_tag LOCUS_21070 gene tonB3 81009 80134 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_21070 82159 81200 gene locus_tag LOCUS_21080 gene gshB 82159 81200 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_21080 82359 82739 gene locus_tag LOCUS_21090 gene pilG 82359 82739 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_21090 82753 83133 gene locus_tag LOCUS_21100 gene pilH 82753 83133 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_21100 83130 83654 gene locus_tag LOCUS_21110 gene pilI 83130 83654 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_21110 83723 85768 gene locus_tag LOCUS_21120 gene pilJ 83723 85768 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_21120 85887 92129 gene locus_tag LOCUS_21130 85887 92129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 92181 92645 gene locus_tag LOCUS_21140 gene chpC 92181 92645 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_21140 92663 93805 gene locus_tag LOCUS_21150 92663 93805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 93802 95064 gene locus_tag LOCUS_21160 93802 95064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 95094 95747 gene locus_tag LOCUS_21170 95094 95747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 96673 95717 gene locus_tag LOCUS_21180 96673 95717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 97353 96736 gene locus_tag LOCUS_21190 97353 96736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 98575 97469 gene locus_tag LOCUS_21200 98575 97469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 99422 98598 gene locus_tag LOCUS_21210 gene metF 99422 98598 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 protein_id gnl|my_center|LOCUS_21210 101010 99628 gene locus_tag LOCUS_21220 gene ahcY 101010 99628 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 protein_id gnl|my_center|LOCUS_21220 102328 101117 gene locus_tag LOCUS_21230 gene metK 102328 101117 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_21230 103330 102353 gene locus_tag LOCUS_21240 103330 102353 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 protein_id gnl|my_center|LOCUS_21240 103475 104251 gene locus_tag LOCUS_21250 103475 104251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 104396 104566 gene locus_tag LOCUS_21260 104396 104566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 105551 104622 gene locus_tag LOCUS_21270 gene ilvE 105551 104622 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_21270 108529 105623 gene locus_tag LOCUS_21280 gene glnE 108529 105623 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_21280 108695 111010 gene locus_tag LOCUS_21290 108695 111010 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY72 protein_id gnl|my_center|LOCUS_21290 110989 111372 gene locus_tag LOCUS_21300 110989 111372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 112908 111397 gene locus_tag LOCUS_21310 112908 111397 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266221.1 protein_id gnl|my_center|LOCUS_21310 113506 112961 gene locus_tag LOCUS_21320 113506 112961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 114804 113509 gene locus_tag LOCUS_21330 gene hemL 114804 113509 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_21330 115257 114829 gene locus_tag LOCUS_21340 115257 114829 CDS product TIGR00701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_21340 116993 115284 gene locus_tag LOCUS_21350 116993 115284 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_21350 117153 118181 gene locus_tag LOCUS_21360 gene argC 117153 118181 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_21360 118201 118944 gene locus_tag LOCUS_21370 118201 118944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 118945 119391 gene locus_tag LOCUS_21380 118945 119391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 119437 119784 gene locus_tag LOCUS_21390 gene erpA 119437 119784 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_21390 119801 120391 gene locus_tag LOCUS_21400 119801 120391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 121503 120430 gene locus_tag LOCUS_21410 gene anmK 121503 120430 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_21410 122775 121504 gene locus_tag LOCUS_21420 122775 121504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_21420 122908 124206 gene locus_tag LOCUS_21430 gene tyrS 122908 124206 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_21430 >Feature sequence12 17 2023 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttggctgccgcacaggcagctaagaaa 2609 3148 gene locus_tag LOCUS_21440 2609 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3355 3594 gene locus_tag LOCUS_21450 3355 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3500 3790 gene locus_tag LOCUS_21460 3500 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3997 4539 gene locus_tag LOCUS_21470 3997 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4949 4620 gene locus_tag LOCUS_21480 4949 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5313 5954 gene locus_tag LOCUS_21490 5313 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6342 6716 gene locus_tag LOCUS_21500 6342 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7521 6955 gene locus_tag LOCUS_21510 7521 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 10882 7757 gene locus_tag LOCUS_21520 10882 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 11642 11052 gene locus_tag LOCUS_21530 11642 11052 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_21530 12856 11639 gene locus_tag LOCUS_21540 12856 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 12949 13791 gene locus_tag LOCUS_21550 12949 13791 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880107.1 protein_id gnl|my_center|LOCUS_21550 13821 14381 gene locus_tag LOCUS_21560 13821 14381 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705053.1 protein_id gnl|my_center|LOCUS_21560 15713 14436 gene locus_tag LOCUS_21570 15713 14436 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_21570 16703 15834 gene locus_tag LOCUS_21580 16703 15834 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106420.1 protein_id gnl|my_center|LOCUS_21580 16817 17821 gene locus_tag LOCUS_21590 16817 17821 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_21590 17941 19872 gene locus_tag LOCUS_21600 gene thrS 17941 19872 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I099 protein_id gnl|my_center|LOCUS_21600 19974 20414 gene locus_tag LOCUS_21610 gene infC 19974 20414 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A132 protein_id gnl|my_center|LOCUS_21610 20578 20772 gene locus_tag LOCUS_21620 gene rpmI 20578 20772 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A163 protein_id gnl|my_center|LOCUS_21620 20795 21148 gene locus_tag LOCUS_21630 gene rplT 20795 21148 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A159 protein_id gnl|my_center|LOCUS_21630 21313 22317 gene locus_tag LOCUS_21640 gene pheS 21313 22317 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H8 protein_id gnl|my_center|LOCUS_21640 22340 24718 gene locus_tag LOCUS_21650 gene pheT 22340 24718 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_21650 24720 25025 gene locus_tag LOCUS_21660 gene ihfA 24720 25025 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_21660 25003 25362 gene locus_tag LOCUS_21670 25003 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_21670 25443 25519 gene locus_tag LOCUS_t00250 25443 25519 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26353 25670 gene locus_tag LOCUS_21680 26353 25670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 27652 26360 gene locus_tag LOCUS_21690 gene amt 27652 26360 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_21690 28417 27875 gene locus_tag LOCUS_21700 28417 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_21700 29508 28420 gene locus_tag LOCUS_21710 gene purK 29508 28420 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_21710 30017 29523 gene locus_tag LOCUS_21720 gene purE 30017 29523 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_21720 32031 30202 gene locus_tag LOCUS_21730 32031 30202 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_21730 33354 32146 gene locus_tag LOCUS_21740 33354 32146 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_21740 34669 33365 gene locus_tag LOCUS_21750 34669 33365 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_21750 34896 35684 gene locus_tag LOCUS_21760 34896 35684 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_21760 35677 36264 gene locus_tag LOCUS_21770 35677 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 38295 37114 gene locus_tag LOCUS_21780 gene aspC 38295 37114 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_21780 38366 40396 gene locus_tag LOCUS_21790 gene uvrB 38366 40396 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV05 protein_id gnl|my_center|LOCUS_21790 40803 40384 gene locus_tag LOCUS_21800 40803 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 41198 40800 gene locus_tag LOCUS_21810 41198 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 42212 41235 gene locus_tag LOCUS_21820 42212 41235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_21820 42299 42847 gene locus_tag LOCUS_21830 42299 42847 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 protein_id gnl|my_center|LOCUS_21830 47813 42921 gene locus_tag LOCUS_21840 47813 42921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 49260 48049 gene locus_tag LOCUS_21850 gene fabB 49260 48049 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_21850 50141 49359 gene locus_tag LOCUS_21860 50141 49359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 51705 50131 gene locus_tag LOCUS_21870 51705 50131 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_21870 52701 51715 gene locus_tag LOCUS_21880 52701 51715 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974858.1 protein_id gnl|my_center|LOCUS_21880 53786 52866 gene locus_tag LOCUS_21890 53786 52866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 53909 54922 gene locus_tag LOCUS_21900 gene waaC 53909 54922 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_21900 55032 55985 gene locus_tag LOCUS_21910 55032 55985 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_21910 56061 56885 gene locus_tag LOCUS_21920 56061 56885 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_21920 57769 56882 gene locus_tag LOCUS_21930 57769 56882 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_21930 59128 57851 gene locus_tag LOCUS_21940 gene gltA 59128 57851 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_21940 59232 59104 gene locus_tag LOCUS_21950 59232 59104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 59574 59948 gene locus_tag LOCUS_21960 59574 59948 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_21960 59942 60292 gene locus_tag LOCUS_21970 59942 60292 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A0 protein_id gnl|my_center|LOCUS_21970 60314 62068 gene locus_tag LOCUS_21980 gene sdhA 60314 62068 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_21980 62084 62794 gene locus_tag LOCUS_21990 gene sdhB 62084 62794 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_21990 63059 65896 gene locus_tag LOCUS_22000 gene sucA 63059 65896 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_22000 65926 67152 gene locus_tag LOCUS_22010 gene sucB 65926 67152 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_22010 67182 68621 gene locus_tag LOCUS_22020 gene lpdG 67182 68621 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_22020 68723 69889 gene locus_tag LOCUS_22030 gene sucC 68723 69889 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_22030 69892 70764 gene locus_tag LOCUS_22040 gene sucD 69892 70764 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_22040 70964 71809 gene locus_tag LOCUS_22050 gene ompW 70964 71809 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17266 protein_id gnl|my_center|LOCUS_22050 71957 73468 gene locus_tag LOCUS_22060 gene gltX 71957 73468 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV02 protein_id gnl|my_center|LOCUS_22060 73609 73684 gene locus_tag LOCUS_t00260 73609 73684 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 73708 73783 gene locus_tag LOCUS_t00270 73708 73783 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 73882 74799 gene locus_tag LOCUS_22070 73882 74799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 74862 75449 gene locus_tag LOCUS_22080 74862 75449 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_22080 75446 76453 gene locus_tag LOCUS_22090 75446 76453 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_22090 76480 77247 gene locus_tag LOCUS_22100 gene kdsB 76480 77247 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E52 protein_id gnl|my_center|LOCUS_22100 77249 77845 gene locus_tag LOCUS_22110 77249 77845 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707645.1 protein_id gnl|my_center|LOCUS_22110 78780 77860 gene locus_tag LOCUS_22120 78780 77860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 79936 78761 gene locus_tag LOCUS_22130 79936 78761 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_22130 81364 80000 gene locus_tag LOCUS_22140 81364 80000 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_22140 81572 82138 gene locus_tag LOCUS_22150 81572 82138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 82982 82143 gene locus_tag LOCUS_22160 gene queD 82982 82143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_22160 83131 86079 gene locus_tag LOCUS_22170 83131 86079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 86266 88440 gene locus_tag LOCUS_22180 gene glcB 86266 88440 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_22180 88600 91509 gene locus_tag LOCUS_22190 88600 91509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 91520 92554 gene locus_tag LOCUS_22200 91520 92554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 92641 94110 gene locus_tag LOCUS_22210 92641 94110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 94110 94871 gene locus_tag LOCUS_22220 94110 94871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 94871 96967 gene locus_tag LOCUS_22230 94871 96967 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_22230 98276 97002 gene locus_tag LOCUS_22240 98276 97002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 99029 98409 gene locus_tag LOCUS_22250 99029 98409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 99230 100480 gene locus_tag LOCUS_22260 99230 100480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_22260 100473 101162 gene locus_tag LOCUS_22270 gene lolD 100473 101162 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_22270 101692 101147 gene locus_tag LOCUS_22280 101692 101147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_22280 101744 103987 gene locus_tag LOCUS_22290 101744 103987 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_22290 104081 104707 gene locus_tag LOCUS_22300 104081 104707 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_22300 104713 105141 gene locus_tag LOCUS_22310 gene exbD 104713 105141 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_22310 105143 106909 gene locus_tag LOCUS_22320 gene msbA 105143 106909 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_22320 106906 107889 gene locus_tag LOCUS_22330 gene lpxK 106906 107889 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 protein_id gnl|my_center|LOCUS_22330 107882 108094 gene locus_tag LOCUS_22340 107882 108094 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_22340 108091 108564 gene locus_tag LOCUS_22350 gene ptpA 108091 108564 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_22350 108564 109577 gene locus_tag LOCUS_22360 gene murB 108564 109577 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGJ6 protein_id gnl|my_center|LOCUS_22360 110457 109570 gene locus_tag LOCUS_22370 110457 109570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 110765 111307 gene locus_tag LOCUS_22380 110765 111307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 112246 111533 gene locus_tag LOCUS_22390 gene lpxH 112246 111533 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP2 protein_id gnl|my_center|LOCUS_22390 112759 112265 gene locus_tag LOCUS_22400 gene ppiB 112759 112265 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_22400 112952 114622 gene locus_tag LOCUS_22410 gene glnS 112952 114622 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_22410 114789 116168 gene locus_tag LOCUS_22420 gene cysS 114789 116168 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_22420 116434 117489 gene locus_tag LOCUS_22430 116434 117489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 118211 119167 gene locus_tag LOCUS_22440 118211 119167 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106295.1 protein_id gnl|my_center|LOCUS_22440 119213 120001 gene locus_tag LOCUS_22450 119213 120001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_22450 120921 120067 gene locus_tag LOCUS_22460 gene folD 120921 120067 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_22460 121129 121205 gene locus_tag LOCUS_t00280 121129 121205 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 1134 145 gene locus_tag LOCUS_22470 1134 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1305 1487 gene locus_tag LOCUS_22480 1305 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1728 3284 gene locus_tag LOCUS_22490 1728 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3259 3765 gene locus_tag LOCUS_22500 3259 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4209 3796 gene locus_tag LOCUS_22510 4209 3796 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013009321.1 protein_id gnl|my_center|LOCUS_22510 4298 5152 gene locus_tag LOCUS_22520 4298 5152 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704185.1 protein_id gnl|my_center|LOCUS_22520 5198 5854 gene locus_tag LOCUS_22530 5198 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6749 5856 gene locus_tag LOCUS_22540 gene hchA 6749 5856 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706906.1 protein_id gnl|my_center|LOCUS_22540 7417 6866 gene locus_tag LOCUS_22550 7417 6866 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_22550 7995 7564 gene locus_tag LOCUS_22560 7995 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 9086 8610 gene locus_tag LOCUS_22570 9086 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9662 9438 gene locus_tag LOCUS_22580 9662 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 10927 9971 gene locus_tag LOCUS_22590 10927 9971 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 protein_id gnl|my_center|LOCUS_22590 11614 11012 gene locus_tag LOCUS_22600 gene cysC 11614 11012 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E828 protein_id gnl|my_center|LOCUS_22600 12983 11817 gene locus_tag LOCUS_22610 12983 11817 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_22610 14350 13112 gene locus_tag LOCUS_22620 gene flgL 14350 13112 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_22620 17415 14434 gene locus_tag LOCUS_22630 17415 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 18424 17420 gene locus_tag LOCUS_22640 gene flgJ 18424 17420 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_22640 20003 19359 gene locus_tag LOCUS_22650 gene rnt 20003 19359 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP36 protein_id gnl|my_center|LOCUS_22650 21045 20008 gene locus_tag LOCUS_22660 gene pyrC 21045 20008 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_22660 21240 22193 gene locus_tag LOCUS_22670 21240 22193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268722.1 protein_id gnl|my_center|LOCUS_22670 22304 23524 gene locus_tag LOCUS_22680 gene argG 22304 23524 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_22680 24222 24713 gene locus_tag LOCUS_22690 24222 24713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 24762 25454 gene locus_tag LOCUS_22700 24762 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 25552 25776 gene locus_tag LOCUS_22710 25552 25776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 25788 26015 gene locus_tag LOCUS_22720 25788 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 26131 27606 gene locus_tag LOCUS_22730 26131 27606 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_22730 27813 28979 gene locus_tag LOCUS_22740 27813 28979 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_22740 29876 29046 gene locus_tag LOCUS_22750 29876 29046 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_22750 30001 31344 gene locus_tag LOCUS_22760 30001 31344 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_22760 32507 31662 gene locus_tag LOCUS_22770 32507 31662 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKY1 protein_id gnl|my_center|LOCUS_22770 35328 32653 gene locus_tag LOCUS_22780 gene glnD 35328 32653 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P5 protein_id gnl|my_center|LOCUS_22780 36125 35346 gene locus_tag LOCUS_22790 gene map 36125 35346 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_22790 36112 36303 gene locus_tag LOCUS_22800 36112 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 36491 37234 gene locus_tag LOCUS_22810 gene rpsB 36491 37234 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_22810 37312 38166 gene locus_tag LOCUS_22820 gene tsf 37312 38166 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82851 protein_id gnl|my_center|LOCUS_22820 38273 39004 gene locus_tag LOCUS_22830 gene pyrH 38273 39004 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS6 protein_id gnl|my_center|LOCUS_22830 39009 39566 gene locus_tag LOCUS_22840 gene frr 39009 39566 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_22840 39575 40333 gene locus_tag LOCUS_22850 gene uppS 39575 40333 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_22850 40269 41195 gene locus_tag LOCUS_22860 40269 41195 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS3 protein_id gnl|my_center|LOCUS_22860 41192 42409 gene locus_tag LOCUS_22870 gene dxr 41192 42409 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_22870 42406 43758 gene locus_tag LOCUS_22880 42406 43758 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_22880 43785 46343 gene locus_tag LOCUS_22890 gene opr86 43785 46343 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_22890 46372 46869 gene locus_tag LOCUS_22900 46372 46869 CDS product Skp-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY5 protein_id gnl|my_center|LOCUS_22900 46882 47925 gene locus_tag LOCUS_22910 gene lpxD 46882 47925 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_22910 47929 48399 gene locus_tag LOCUS_22920 gene fabZ 47929 48399 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_22920 48396 49166 gene locus_tag LOCUS_22930 gene lpxA 48396 49166 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_22930 49168 50307 gene locus_tag LOCUS_22940 gene lpxB 49168 50307 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR5 protein_id gnl|my_center|LOCUS_22940 50304 50921 gene locus_tag LOCUS_22950 gene rnhB 50304 50921 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_22950 51015 52475 gene locus_tag LOCUS_22960 51015 52475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 53276 52476 gene locus_tag LOCUS_22970 53276 52476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 53411 54604 gene locus_tag LOCUS_22980 53411 54604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_22980 54862 56460 gene locus_tag LOCUS_22990 54862 56460 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_22990 56878 57996 gene locus_tag LOCUS_23000 56878 57996 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_23000 58009 59115 gene locus_tag LOCUS_23010 58009 59115 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_23010 59254 60252 gene locus_tag LOCUS_23020 59254 60252 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GM3 protein_id gnl|my_center|LOCUS_23020 61038 60283 gene locus_tag LOCUS_23030 61038 60283 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_23030 61577 63130 gene locus_tag LOCUS_23040 gene aer 61577 63130 CDS product aerotaxis receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_23040 63670 63152 gene locus_tag LOCUS_23050 63670 63152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_23050 63831 65126 gene locus_tag LOCUS_23060 gene hom 63831 65126 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U6 protein_id gnl|my_center|LOCUS_23060 65342 66028 gene locus_tag LOCUS_23070 65342 66028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 66129 67064 gene locus_tag LOCUS_23080 gene nahR 66129 67064 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_23080 68036 67125 gene locus_tag LOCUS_23090 68036 67125 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_23090 68077 68556 gene locus_tag LOCUS_23100 68077 68556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_23100 69261 68578 gene locus_tag LOCUS_23110 69261 68578 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957870.1 protein_id gnl|my_center|LOCUS_23110 70104 69295 gene locus_tag LOCUS_23120 70104 69295 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN7 protein_id gnl|my_center|LOCUS_23120 70310 70600 gene locus_tag LOCUS_23130 70310 70600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 71313 70621 gene locus_tag LOCUS_23140 gene cobB 71313 70621 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJL6 protein_id gnl|my_center|LOCUS_23140 72515 71310 gene locus_tag LOCUS_23150 72515 71310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_23150 72591 73223 gene locus_tag LOCUS_23160 72591 73223 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_23160 73449 73210 gene locus_tag LOCUS_23170 73449 73210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 73478 74233 gene locus_tag LOCUS_23180 73478 74233 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_23180 77549 74214 gene locus_tag LOCUS_23190 77549 74214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 77977 77546 gene locus_tag LOCUS_23200 77977 77546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 78108 79712 gene locus_tag LOCUS_23210 78108 79712 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_23210 79713 79898 gene locus_tag LOCUS_23220 79713 79898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 80341 79904 gene locus_tag LOCUS_23230 gene nsrR 80341 79904 CDS product HTH-type transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2D6 protein_id gnl|my_center|LOCUS_23230 83702 80961 gene locus_tag LOCUS_23240 83702 80961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 86808 84043 gene locus_tag LOCUS_23250 86808 84043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 88395 86977 gene locus_tag LOCUS_23260 88395 86977 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_23260 88698 89993 gene locus_tag LOCUS_23270 gene fadI 88698 89993 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_23270 90313 90552 gene locus_tag LOCUS_23280 gene tusA 90313 90552 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_23280 93243 90616 gene locus_tag LOCUS_23290 93243 90616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 93200 93385 gene locus_tag LOCUS_23300 93200 93385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 93436 94455 gene locus_tag LOCUS_23310 93436 94455 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_23310 94622 96064 gene locus_tag LOCUS_23320 gene sbcB 94622 96064 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_23320 97444 96068 gene locus_tag LOCUS_23330 97444 96068 CDS product transporter NadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_23330 99727 97502 gene locus_tag LOCUS_23340 99727 97502 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_23340 101669 99717 gene locus_tag LOCUS_23350 101669 99717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 103184 101799 gene locus_tag LOCUS_23360 gene dbpA 103184 101799 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_23360 105175 103241 gene locus_tag LOCUS_23370 105175 103241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 106399 105287 gene locus_tag LOCUS_23380 gene trmA 106399 105287 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQR3 protein_id gnl|my_center|LOCUS_23380 106592 107470 gene locus_tag LOCUS_23390 gene tesB 106592 107470 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_23390 107467 108033 gene locus_tag LOCUS_23400 107467 108033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 108211 107987 gene locus_tag LOCUS_23410 108211 107987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 109068 108208 gene locus_tag LOCUS_23420 109068 108208 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064297.1 protein_id gnl|my_center|LOCUS_23420 110440 109055 gene locus_tag LOCUS_23430 gene xseA 110440 109055 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXL8 protein_id gnl|my_center|LOCUS_23430 110666 111139 gene locus_tag LOCUS_23440 110666 111139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094862.1 protein_id gnl|my_center|LOCUS_23440 111209 113086 gene locus_tag LOCUS_23450 111209 113086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_23450 113175 113951 gene locus_tag LOCUS_23460 113175 113951 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence14 1745 339 gene locus_tag LOCUS_23470 gene glnA 1745 339 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_23470 2079 3920 gene locus_tag LOCUS_23480 gene typA 2079 3920 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_23480 4792 4022 gene locus_tag LOCUS_23490 gene map 4792 4022 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_23490 6341 4959 gene locus_tag LOCUS_23500 6341 4959 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 protein_id gnl|my_center|LOCUS_23500 7435 6338 gene locus_tag LOCUS_23510 7435 6338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858304.1 protein_id gnl|my_center|LOCUS_23510 7662 7847 gene locus_tag LOCUS_23520 7662 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7847 8326 gene locus_tag LOCUS_23530 7847 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 8330 10702 gene locus_tag LOCUS_23540 8330 10702 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 protein_id gnl|my_center|LOCUS_23540 10811 11527 gene locus_tag LOCUS_23550 10811 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 11563 11976 gene locus_tag LOCUS_23560 11563 11976 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_23560 12066 12563 gene locus_tag LOCUS_23570 gene tpx 12066 12563 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 protein_id gnl|my_center|LOCUS_23570 13890 12628 gene locus_tag LOCUS_23580 13890 12628 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_23580 15369 14032 gene locus_tag LOCUS_23590 15369 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 16074 15382 gene locus_tag LOCUS_23600 gene cpxR 16074 15382 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_23600 17189 16170 gene locus_tag LOCUS_23610 gene tqsA 17189 16170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_23610 17349 17433 gene locus_tag LOCUS_t00290 17349 17433 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17546 18028 gene locus_tag LOCUS_23620 17546 18028 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_23620 18293 18625 gene locus_tag LOCUS_23630 18293 18625 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930769.1 protein_id gnl|my_center|LOCUS_23630 18625 19308 gene locus_tag LOCUS_23640 18625 19308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770108.1 protein_id gnl|my_center|LOCUS_23640 19326 19604 gene locus_tag LOCUS_23650 19326 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 20225 19611 gene locus_tag LOCUS_23660 20225 19611 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_23660 21598 20222 gene locus_tag LOCUS_23670 21598 20222 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_23670 22235 21672 gene locus_tag LOCUS_23680 gene nudE 22235 21672 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 protein_id gnl|my_center|LOCUS_23680 22286 22942 gene locus_tag LOCUS_23690 22286 22942 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_23690 22983 23381 gene locus_tag LOCUS_23700 22983 23381 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNK3 protein_id gnl|my_center|LOCUS_23700 23383 24246 gene locus_tag LOCUS_23710 gene hslO 23383 24246 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_23710 24437 25969 gene locus_tag LOCUS_23720 gene pckA 24437 25969 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_23720 27512 26037 gene locus_tag LOCUS_23730 27512 26037 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_23730 28230 27499 gene locus_tag LOCUS_23740 28230 27499 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_23740 29006 28320 gene locus_tag LOCUS_23750 29006 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_23750 29667 29017 gene locus_tag LOCUS_23760 29667 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_23760 31598 29859 gene locus_tag LOCUS_23770 31598 29859 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_23770 32548 31739 gene locus_tag LOCUS_23780 32548 31739 CDS product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_23780 32989 35361 gene locus_tag LOCUS_23790 32989 35361 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_23790 35450 36793 gene locus_tag LOCUS_23800 35450 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 36937 38496 gene locus_tag LOCUS_23810 gene gshA 36937 38496 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_23810 38922 38506 gene locus_tag LOCUS_23820 38922 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 39046 39564 gene locus_tag LOCUS_23830 gene dsbB1 39046 39564 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_23830 39683 40162 gene locus_tag LOCUS_23840 gene algQ 39683 40162 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738602.1 protein_id gnl|my_center|LOCUS_23840 40270 41238 gene locus_tag LOCUS_23850 40270 41238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 41333 42064 gene locus_tag LOCUS_23860 gene parA 41333 42064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_23860 42674 42066 gene locus_tag LOCUS_23870 42674 42066 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_23870 42837 43520 gene locus_tag LOCUS_23880 42837 43520 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_23880 43982 43536 gene locus_tag LOCUS_23890 43982 43536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 44093 45892 gene locus_tag LOCUS_23900 44093 45892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_23900 48212 46047 gene locus_tag LOCUS_23910 48212 46047 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_23910 48483 49847 gene locus_tag LOCUS_23920 48483 49847 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482874.1 protein_id gnl|my_center|LOCUS_23920 49807 50343 gene locus_tag LOCUS_23930 49807 50343 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKT3 protein_id gnl|my_center|LOCUS_23930 50482 51876 gene locus_tag LOCUS_23940 50482 51876 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267749.1 protein_id gnl|my_center|LOCUS_23940 52377 51955 gene locus_tag LOCUS_23950 52377 51955 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_23950 52915 52424 gene locus_tag LOCUS_23960 52915 52424 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_23960 53883 52930 gene locus_tag LOCUS_23970 gene pip 53883 52930 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJI8 protein_id gnl|my_center|LOCUS_23970 54279 53992 gene locus_tag LOCUS_23980 54279 53992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 55012 54290 gene locus_tag LOCUS_23990 gene trmB 55012 54290 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_23990 55460 55032 gene locus_tag LOCUS_24000 55460 55032 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_24000 55375 55566 gene locus_tag LOCUS_24010 55375 55566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 55563 57035 gene locus_tag LOCUS_24020 gene ubiD 55563 57035 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_24020 57032 58078 gene locus_tag LOCUS_24030 57032 58078 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_24030 58161 59003 gene locus_tag LOCUS_24040 58161 59003 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_24040 59097 60086 gene locus_tag LOCUS_24050 59097 60086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 60252 63035 gene locus_tag LOCUS_24060 gene acnA 60252 63035 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F5 protein_id gnl|my_center|LOCUS_24060 63765 63235 gene locus_tag LOCUS_24070 63765 63235 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464470.1 protein_id gnl|my_center|LOCUS_24070 63954 64583 gene locus_tag LOCUS_24080 63954 64583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 64583 66154 gene locus_tag LOCUS_24090 64583 66154 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464476.1 protein_id gnl|my_center|LOCUS_24090 66151 67071 gene locus_tag LOCUS_24100 66151 67071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 67086 67424 gene locus_tag LOCUS_24110 67086 67424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 67427 68347 gene locus_tag LOCUS_24120 67427 68347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 68358 69761 gene locus_tag LOCUS_24130 68358 69761 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_24130 69758 70921 gene locus_tag LOCUS_24140 gene rocD 69758 70921 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_24140 70918 72237 gene locus_tag LOCUS_24150 gene argD 70918 72237 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJU9 protein_id gnl|my_center|LOCUS_24150 73472 72297 gene locus_tag LOCUS_24160 73472 72297 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_24160 74602 73469 gene locus_tag LOCUS_24170 74602 73469 CDS product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 protein_id gnl|my_center|LOCUS_24170 75446 74661 gene locus_tag LOCUS_24180 gene hemD 75446 74661 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026057.1 protein_id gnl|my_center|LOCUS_24180 76365 75433 gene locus_tag LOCUS_24190 gene hemC 76365 75433 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_24190 77188 76463 gene locus_tag LOCUS_24200 77188 76463 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_24200 78246 77185 gene locus_tag LOCUS_24210 gene algZ 78246 77185 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_24210 78323 79519 gene locus_tag LOCUS_24220 78323 79519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_24220 80690 79461 gene locus_tag LOCUS_24230 80690 79461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 81349 80687 gene locus_tag LOCUS_24240 81349 80687 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_24240 81643 82071 gene locus_tag LOCUS_24250 gene rppH 81643 82071 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_24250 82077 84362 gene locus_tag LOCUS_24260 gene ptsP 82077 84362 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_24260 84680 85267 gene locus_tag LOCUS_24270 84680 85267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 85260 86138 gene locus_tag LOCUS_24280 85260 86138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 86232 87182 gene locus_tag LOCUS_24290 86232 87182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 87311 87433 gene locus_tag LOCUS_24300 87311 87433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 87928 87446 gene locus_tag LOCUS_24310 87928 87446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704469.1 protein_id gnl|my_center|LOCUS_24310 88545 87955 gene locus_tag LOCUS_24320 88545 87955 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_24320 91098 88642 gene locus_tag LOCUS_24330 gene fadE 91098 88642 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_24330 91350 91895 gene locus_tag LOCUS_24340 91350 91895 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708322.1 protein_id gnl|my_center|LOCUS_24340 92667 91921 gene locus_tag LOCUS_24350 92667 91921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_24350 92733 93539 gene locus_tag LOCUS_24360 92733 93539 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_24360 93558 94382 gene locus_tag LOCUS_24370 gene lgt 93558 94382 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_24370 94379 95173 gene locus_tag LOCUS_24380 gene thyA 94379 95173 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_24380 95306 96955 gene locus_tag LOCUS_24390 95306 96955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 97191 97694 gene locus_tag LOCUS_24400 97191 97694 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM58 protein_id gnl|my_center|LOCUS_24400 97739 98629 gene locus_tag LOCUS_24410 97739 98629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 100713 99406 gene locus_tag LOCUS_24420 gene argA 100713 99406 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU5 protein_id gnl|my_center|LOCUS_24420 101914 100748 gene locus_tag LOCUS_24430 gene argE 101914 100748 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_24430 101955 102875 gene locus_tag LOCUS_24440 101955 102875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 102934 104712 gene locus_tag LOCUS_24450 102934 104712 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_24450 104787 105296 gene locus_tag LOCUS_24460 104787 105296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 105293 105877 gene locus_tag LOCUS_24470 105293 105877 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_24470 106200 107492 gene locus_tag LOCUS_24480 106200 107492 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 protein_id gnl|my_center|LOCUS_24480 107632 109209 gene locus_tag LOCUS_24490 107632 109209 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_24490 109222 110379 gene locus_tag LOCUS_24500 109222 110379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_24500 110376 111140 gene locus_tag LOCUS_24510 110376 111140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969814.1 protein_id gnl|my_center|LOCUS_24510 111143 111841 gene locus_tag LOCUS_24520 111143 111841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence15 1948 566 gene locus_tag LOCUS_24530 gene ffh 1948 566 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP8 protein_id gnl|my_center|LOCUS_24530 2066 2866 gene locus_tag LOCUS_24540 2066 2866 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_24540 2969 4255 gene locus_tag LOCUS_24550 2969 4255 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_24550 4314 6419 gene locus_tag LOCUS_24560 gene metG 4314 6419 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK6 protein_id gnl|my_center|LOCUS_24560 7064 6498 gene locus_tag LOCUS_24570 gene efp 7064 6498 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ2 protein_id gnl|my_center|LOCUS_24570 8239 7118 gene locus_tag LOCUS_24580 8239 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 protein_id gnl|my_center|LOCUS_24580 8345 9151 gene locus_tag LOCUS_24590 8345 9151 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 protein_id gnl|my_center|LOCUS_24590 10104 9430 gene locus_tag LOCUS_24600 10104 9430 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_24600 11630 10122 gene locus_tag LOCUS_24610 gene der 11630 10122 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_24610 12906 11701 gene locus_tag LOCUS_24620 gene bamB 12906 11701 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_24620 13562 12906 gene locus_tag LOCUS_24630 13562 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_24630 14907 13627 gene locus_tag LOCUS_24640 gene hisS 14907 13627 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_24640 16063 14933 gene locus_tag LOCUS_24650 gene ispG 16063 14933 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_24650 16851 16060 gene locus_tag LOCUS_24660 gene pilF 16851 16060 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_24660 17981 16848 gene locus_tag LOCUS_24670 gene rlmN 17981 16848 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_24670 18469 18044 gene locus_tag LOCUS_24680 gene ndk 18469 18044 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_24680 19795 18632 gene locus_tag LOCUS_24690 gene iscS 19795 18632 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ32 protein_id gnl|my_center|LOCUS_24690 20364 19894 gene locus_tag LOCUS_24700 gene iscR 20364 19894 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_24700 21241 20450 gene locus_tag LOCUS_24710 gene cysE 21241 20450 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_24710 22017 21238 gene locus_tag LOCUS_24720 gene trmJ 22017 21238 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_24720 22165 22935 gene locus_tag LOCUS_24730 22165 22935 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_24730 23494 23006 gene locus_tag LOCUS_24740 23494 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 23758 23997 gene locus_tag LOCUS_24750 23758 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 24107 26563 gene locus_tag LOCUS_24760 gene plsB 24107 26563 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 protein_id gnl|my_center|LOCUS_24760 27385 26615 gene locus_tag LOCUS_24770 gene rsmJ 27385 26615 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG6 protein_id gnl|my_center|LOCUS_24770 28183 27386 gene locus_tag LOCUS_24780 gene uppP1 28183 27386 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_24780 28891 28199 gene locus_tag LOCUS_24790 28891 28199 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 protein_id gnl|my_center|LOCUS_24790 30110 29013 gene locus_tag LOCUS_24800 30110 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 31163 30507 gene locus_tag LOCUS_24810 gene adk 31163 30507 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWV2 protein_id gnl|my_center|LOCUS_24810 33989 31353 gene locus_tag LOCUS_24820 gene ppc 33989 31353 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI20 protein_id gnl|my_center|LOCUS_24820 34997 34185 gene locus_tag LOCUS_24830 gene mazG 34997 34185 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_24830 37245 34999 gene locus_tag LOCUS_24840 gene relA 37245 34999 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_24840 38566 37238 gene locus_tag LOCUS_24850 gene rlmD 38566 37238 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ3 protein_id gnl|my_center|LOCUS_24850 39522 38626 gene locus_tag LOCUS_24860 gene cysM 39522 38626 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_24860 39721 42531 gene locus_tag LOCUS_24870 gene gacS 39721 42531 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E319 protein_id gnl|my_center|LOCUS_24870 42908 42498 gene locus_tag LOCUS_24880 gene acpS 42908 42498 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP3 protein_id gnl|my_center|LOCUS_24880 43663 42926 gene locus_tag LOCUS_24890 gene pdxJ 43663 42926 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 protein_id gnl|my_center|LOCUS_24890 44307 43666 gene locus_tag LOCUS_24900 gene recO 44307 43666 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKK5 protein_id gnl|my_center|LOCUS_24900 45220 44336 gene locus_tag LOCUS_24910 gene era 45220 44336 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_24910 45903 45217 gene locus_tag LOCUS_24920 gene rnc 45903 45217 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX9 protein_id gnl|my_center|LOCUS_24920 46265 45900 gene locus_tag LOCUS_24930 46265 45900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 48064 46265 gene locus_tag LOCUS_24940 gene lepA 48064 46265 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_24940 49580 48183 gene locus_tag LOCUS_24950 gene mucD 49580 48183 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_24950 49775 50095 gene locus_tag LOCUS_24960 49775 50095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 50675 50079 gene locus_tag LOCUS_24970 gene mucA 50675 50079 CDS product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38107 protein_id gnl|my_center|LOCUS_24970 51348 50707 gene locus_tag LOCUS_24980 gene algU 51348 50707 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_24980 51651 53258 gene locus_tag LOCUS_24990 gene nadB 51651 53258 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_24990 53655 53269 gene locus_tag LOCUS_25000 53655 53269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 53890 53636 gene locus_tag LOCUS_25010 53890 53636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_25010 53978 54877 gene locus_tag LOCUS_25020 53978 54877 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_25020 54920 55765 gene locus_tag LOCUS_25030 54920 55765 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_25030 55793 56473 gene locus_tag LOCUS_25040 55793 56473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 56457 56948 gene locus_tag LOCUS_25050 56457 56948 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_25050 58312 57023 gene locus_tag LOCUS_25060 58312 57023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 58949 58335 gene locus_tag LOCUS_25070 58949 58335 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_25070 59361 58951 gene locus_tag LOCUS_25080 59361 58951 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_25080 59897 59379 gene locus_tag LOCUS_25090 59897 59379 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_25090 61264 59900 gene locus_tag LOCUS_25100 61264 59900 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_25100 62046 61264 gene locus_tag LOCUS_25110 62046 61264 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_25110 63734 62262 gene locus_tag LOCUS_25120 63734 62262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 protein_id gnl|my_center|LOCUS_25120 66796 63830 gene locus_tag LOCUS_25130 gene fecA 66796 63830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_25130 70380 66892 gene locus_tag LOCUS_25140 70380 66892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 71593 70547 gene locus_tag LOCUS_25150 71593 70547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_25150 71735 72430 gene locus_tag LOCUS_25160 gene rcsF 71735 72430 CDS product putative S-adenosylmethionine-dependent methyltransferase RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT0 protein_id gnl|my_center|LOCUS_25160 72700 73113 gene locus_tag LOCUS_25170 72700 73113 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_25170 73742 73176 gene locus_tag LOCUS_25180 73742 73176 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706207.1 protein_id gnl|my_center|LOCUS_25180 74991 73828 gene locus_tag LOCUS_25190 gene speC 74991 73828 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 protein_id gnl|my_center|LOCUS_25190 75233 77074 gene locus_tag LOCUS_25200 75233 77074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 protein_id gnl|my_center|LOCUS_25200 77235 79481 gene locus_tag LOCUS_25210 gene fhuA 77235 79481 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_25210 79567 80688 gene locus_tag LOCUS_25220 79567 80688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 80929 80669 gene locus_tag LOCUS_25230 80929 80669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 80990 82009 gene locus_tag LOCUS_25240 80990 82009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 82888 82070 gene locus_tag LOCUS_25250 82888 82070 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_25250 83797 82901 gene locus_tag LOCUS_25260 83797 82901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 84887 83898 gene locus_tag LOCUS_25270 gene hemH 84887 83898 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL51 protein_id gnl|my_center|LOCUS_25270 85067 88066 gene locus_tag LOCUS_25280 85067 88066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 88177 87989 gene locus_tag LOCUS_25290 88177 87989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 88192 88905 gene locus_tag LOCUS_25300 88192 88905 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_25300 90132 88924 gene locus_tag LOCUS_25310 90132 88924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 90863 90342 gene locus_tag LOCUS_25320 90863 90342 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043733.1 protein_id gnl|my_center|LOCUS_25320 91735 90935 gene locus_tag LOCUS_25330 gene bax 91735 90935 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_25330 93440 92556 gene locus_tag LOCUS_25340 93440 92556 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 protein_id gnl|my_center|LOCUS_25340 93870 93451 gene locus_tag LOCUS_25350 93870 93451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 94003 95298 gene locus_tag LOCUS_25360 94003 95298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_25360 96006 95326 gene locus_tag LOCUS_25370 96006 95326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 96406 97221 gene locus_tag LOCUS_25380 96406 97221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 97659 97243 gene locus_tag LOCUS_25390 97659 97243 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_25390 97739 98212 gene locus_tag LOCUS_25400 gene soxR 97739 98212 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51506 protein_id gnl|my_center|LOCUS_25400 98944 98258 gene locus_tag LOCUS_25410 98944 98258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 100167 99085 gene locus_tag LOCUS_25420 100167 99085 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_25420 100619 100224 gene locus_tag LOCUS_25430 100619 100224 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_25430 101274 100651 gene locus_tag LOCUS_25440 101274 100651 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_25440 101887 101423 gene locus_tag LOCUS_25450 101887 101423 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479843.1 protein_id gnl|my_center|LOCUS_25450 102064 101942 gene locus_tag LOCUS_25460 102064 101942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence16 858 253 gene locus_tag LOCUS_25470 858 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1864 863 gene locus_tag LOCUS_25480 gene msrP 1864 863 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_25480 2756 1965 gene locus_tag LOCUS_25490 gene pssA 2756 1965 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_25490 3714 2839 gene locus_tag LOCUS_25500 gene ilvY 3714 2839 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_25500 4115 5605 gene locus_tag LOCUS_25510 gene ilvC 4115 5605 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1S3 protein_id gnl|my_center|LOCUS_25510 5990 7771 gene locus_tag LOCUS_25520 5990 7771 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 protein_id gnl|my_center|LOCUS_25520 8502 7840 gene locus_tag LOCUS_25530 8502 7840 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_25530 10495 8693 gene locus_tag LOCUS_25540 gene oadA 10495 8693 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_25540 11932 10517 gene locus_tag LOCUS_25550 11932 10517 CDS product acetyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_25550 12085 13056 gene locus_tag LOCUS_25560 12085 13056 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_25560 13233 13580 gene locus_tag LOCUS_25570 13233 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 13732 14925 gene locus_tag LOCUS_25580 13732 14925 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_25580 14940 15374 gene locus_tag LOCUS_25590 14940 15374 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_25590 15887 15447 gene locus_tag LOCUS_25600 gene cynS 15887 15447 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJG2 protein_id gnl|my_center|LOCUS_25600 16458 15997 gene locus_tag LOCUS_25610 16458 15997 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_25610 16658 16470 gene locus_tag LOCUS_25620 16658 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 18050 16986 gene locus_tag LOCUS_25630 gene fba 18050 16986 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_25630 18898 18275 gene locus_tag LOCUS_25640 18898 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 19601 18975 gene locus_tag LOCUS_25650 19601 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 21364 20201 gene locus_tag LOCUS_25660 gene pgk 21364 20201 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LL1 protein_id gnl|my_center|LOCUS_25660 22425 21418 gene locus_tag LOCUS_25670 gene epd 22425 21418 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGS4 protein_id gnl|my_center|LOCUS_25670 23004 22540 gene locus_tag LOCUS_25680 23004 22540 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_25680 23227 24726 gene locus_tag LOCUS_25690 23227 24726 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8I6 protein_id gnl|my_center|LOCUS_25690 25350 24760 gene locus_tag LOCUS_25700 25350 24760 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705132.1 protein_id gnl|my_center|LOCUS_25700 25831 25388 gene locus_tag LOCUS_25710 25831 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 26077 27477 gene locus_tag LOCUS_25720 26077 27477 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_25720 29420 28128 gene locus_tag LOCUS_25730 29420 28128 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_25730 30057 29554 gene locus_tag LOCUS_25740 30057 29554 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707675.1 protein_id gnl|my_center|LOCUS_25740 30503 30159 gene locus_tag LOCUS_25750 30503 30159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 31059 30490 gene locus_tag LOCUS_25760 gene rpoE 31059 30490 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_25760 31866 31105 gene locus_tag LOCUS_25770 31866 31105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 32347 31898 gene locus_tag LOCUS_25780 32347 31898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 34248 32470 gene locus_tag LOCUS_25790 gene phoD 34248 32470 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_25790 34450 35349 gene locus_tag LOCUS_25800 34450 35349 CDS product chitin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708914.1 protein_id gnl|my_center|LOCUS_25800 35869 35444 gene locus_tag LOCUS_25810 35869 35444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 37606 36425 gene locus_tag LOCUS_25820 37606 36425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_25820 38901 37606 gene locus_tag LOCUS_25830 38901 37606 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_25830 39499 38927 gene locus_tag LOCUS_25840 gene allA 39499 38927 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J9 protein_id gnl|my_center|LOCUS_25840 39809 39465 gene locus_tag LOCUS_25850 39809 39465 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2N7 protein_id gnl|my_center|LOCUS_25850 40396 39845 gene locus_tag LOCUS_25860 40396 39845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703663.1 protein_id gnl|my_center|LOCUS_25860 41387 40365 gene locus_tag LOCUS_25870 gene alc 41387 40365 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J8 protein_id gnl|my_center|LOCUS_25870 42253 41390 gene locus_tag LOCUS_25880 42253 41390 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104656.1 protein_id gnl|my_center|LOCUS_25880 44640 42250 gene locus_tag LOCUS_25890 gene xdhB 44640 42250 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_25890 45944 44637 gene locus_tag LOCUS_25900 45944 44637 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_25900 46403 47803 gene locus_tag LOCUS_25910 46403 47803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 48004 50427 gene locus_tag LOCUS_25920 48004 50427 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_25920 50487 51248 gene locus_tag LOCUS_25930 50487 51248 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_25930 51262 52629 gene locus_tag LOCUS_25940 51262 52629 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_25940 52645 53163 gene locus_tag LOCUS_25950 52645 53163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263090.1 protein_id gnl|my_center|LOCUS_25950 53178 53585 gene locus_tag LOCUS_25960 53178 53585 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_25960 53589 54224 gene locus_tag LOCUS_25970 53589 54224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 54236 55501 gene locus_tag LOCUS_25980 54236 55501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_25980 55574 56680 gene locus_tag LOCUS_25990 55574 56680 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_25990 56772 57440 gene locus_tag LOCUS_26000 56772 57440 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_26000 57575 58939 gene locus_tag LOCUS_26010 57575 58939 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z0 protein_id gnl|my_center|LOCUS_26010 59509 59114 gene locus_tag LOCUS_26020 59509 59114 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 protein_id gnl|my_center|LOCUS_26020 60982 59606 gene locus_tag LOCUS_26030 60982 59606 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_26030 61487 60975 gene locus_tag LOCUS_26040 61487 60975 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_26040 61633 62733 gene locus_tag LOCUS_26050 61633 62733 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_26050 62820 64196 gene locus_tag LOCUS_26060 62820 64196 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_26060 64189 65469 gene locus_tag LOCUS_26070 64189 65469 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_26070 65508 66311 gene locus_tag LOCUS_26080 gene pstB 65508 66311 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_26080 66329 67045 gene locus_tag LOCUS_26090 gene phoU 66329 67045 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_26090 67391 68314 gene locus_tag LOCUS_26100 67391 68314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 69635 68376 gene locus_tag LOCUS_26110 gene phoR 69635 68376 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 protein_id gnl|my_center|LOCUS_26110 69800 69875 gene locus_tag LOCUS_t00300 69800 69875 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 70159 71349 gene locus_tag LOCUS_26120 gene int 70159 71349 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_26120 71349 72218 gene locus_tag LOCUS_26130 71349 72218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 72332 72556 gene locus_tag LOCUS_26140 72332 72556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 72553 72987 gene locus_tag LOCUS_26150 72553 72987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 72980 73873 gene locus_tag LOCUS_26160 72980 73873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 74184 74501 gene locus_tag LOCUS_26170 74184 74501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 74501 75271 gene locus_tag LOCUS_26180 74501 75271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 75619 75984 gene locus_tag LOCUS_26190 75619 75984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 76228 76091 gene locus_tag LOCUS_26200 76228 76091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 76484 76221 gene locus_tag LOCUS_26210 76484 76221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 77155 76682 gene locus_tag LOCUS_26220 77155 76682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 78403 77711 gene locus_tag LOCUS_26230 gene trmH 78403 77711 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_26230 78471 79220 gene locus_tag LOCUS_26240 gene cysZ 78471 79220 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6J3 protein_id gnl|my_center|LOCUS_26240 80525 79245 gene locus_tag LOCUS_26250 gene phoR 80525 79245 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_26250 81221 80529 gene locus_tag LOCUS_26260 gene phoB 81221 80529 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_26260 82167 81313 gene locus_tag LOCUS_26270 gene ubiA 82167 81313 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB4 protein_id gnl|my_center|LOCUS_26270 82718 82167 gene locus_tag LOCUS_26280 gene ubiC 82718 82167 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_26280 82852 83016 gene locus_tag LOCUS_26290 gene rubA2 82852 83016 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_26290 83103 84260 gene locus_tag LOCUS_26300 83103 84260 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_26300 84302 84574 gene locus_tag LOCUS_26310 gene hupA 84302 84574 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_26310 84727 86019 gene locus_tag LOCUS_26320 84727 86019 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895466.1 protein_id gnl|my_center|LOCUS_26320 87331 86033 gene locus_tag LOCUS_26330 87331 86033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769583.1 protein_id gnl|my_center|LOCUS_26330 89601 87505 gene locus_tag LOCUS_26340 gene recG 89601 87505 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZZ8 protein_id gnl|my_center|LOCUS_26340 90505 89606 gene locus_tag LOCUS_26350 90505 89606 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769579.1 protein_id gnl|my_center|LOCUS_26350 90613 91464 gene locus_tag LOCUS_26360 90613 91464 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_26360 92524 91505 gene locus_tag LOCUS_26370 92524 91505 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_26370 93693 92806 gene locus_tag LOCUS_26380 93693 92806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 94048 94230 gene locus_tag LOCUS_26390 94048 94230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 94683 94300 gene locus_tag LOCUS_26400 94683 94300 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_26400 96812 94680 gene locus_tag LOCUS_26410 gene spoT 96812 94680 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_26410 97081 96818 gene locus_tag LOCUS_26420 gene rpoZ 97081 96818 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_26420 97812 97186 gene locus_tag LOCUS_26430 gene gmk 97812 97186 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_26430 >Feature sequence17 475 1560 gene locus_tag LOCUS_26440 gene cysK1 475 1560 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338724.1 protein_id gnl|my_center|LOCUS_26440 1854 4769 gene locus_tag LOCUS_26450 1854 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4894 6483 gene locus_tag LOCUS_26460 gene prfC 4894 6483 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_26460 7103 6513 gene locus_tag LOCUS_26470 7103 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 7536 7015 gene locus_tag LOCUS_26480 7536 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 8030 8461 gene locus_tag LOCUS_26490 gene rplM 8030 8461 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_26490 8463 8858 gene locus_tag LOCUS_26500 gene rpsI 8463 8858 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_26500 9082 9678 gene locus_tag LOCUS_26510 9082 9678 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_26510 9678 10904 gene locus_tag LOCUS_26520 9678 10904 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_26520 10906 11673 gene locus_tag LOCUS_26530 10906 11673 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_26530 11759 12385 gene locus_tag LOCUS_26540 gene sspA 11759 12385 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_26540 12385 12804 gene locus_tag LOCUS_26550 gene sspB 12385 12804 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_26550 12979 14232 gene locus_tag LOCUS_26560 12979 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 15401 14274 gene locus_tag LOCUS_26570 15401 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 15518 16420 gene locus_tag LOCUS_26580 15518 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 16526 17002 gene locus_tag LOCUS_26590 16526 17002 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_26590 17433 17720 gene locus_tag LOCUS_26600 17433 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 18101 17730 gene locus_tag LOCUS_26610 18101 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 18703 18128 gene locus_tag LOCUS_26620 18703 18128 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_26620 18796 19389 gene locus_tag LOCUS_26630 18796 19389 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_26630 20402 19392 gene locus_tag LOCUS_26640 20402 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 21344 20403 gene locus_tag LOCUS_26650 gene lipA 21344 20403 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_26650 21630 22016 gene locus_tag LOCUS_26660 21630 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 22857 22087 gene locus_tag LOCUS_26670 gene truC 22857 22087 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_26670 23232 24272 gene locus_tag LOCUS_26680 23232 24272 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_26680 24375 25193 gene locus_tag LOCUS_26690 24375 25193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_26690 25195 25977 gene locus_tag LOCUS_26700 25195 25977 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_26700 26026 26763 gene locus_tag LOCUS_26710 26026 26763 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_26710 26757 27398 gene locus_tag LOCUS_26720 26757 27398 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_26720 27648 31247 gene locus_tag LOCUS_26730 27648 31247 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_26730 31316 33121 gene locus_tag LOCUS_26740 31316 33121 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268766.1 protein_id gnl|my_center|LOCUS_26740 33691 33143 gene locus_tag LOCUS_26750 33691 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 34086 34937 gene locus_tag LOCUS_26760 34086 34937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 34922 36274 gene locus_tag LOCUS_26770 34922 36274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 38509 36380 gene locus_tag LOCUS_26780 38509 36380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 39447 39184 gene locus_tag LOCUS_26790 39447 39184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 41104 39677 gene locus_tag LOCUS_26800 41104 39677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 42608 41160 gene locus_tag LOCUS_26810 gene gatB 42608 41160 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_26810 44084 42621 gene locus_tag LOCUS_26820 gene gatA 44084 42621 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_26820 44388 44101 gene locus_tag LOCUS_26830 gene gatC 44388 44101 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 protein_id gnl|my_center|LOCUS_26830 44513 45550 gene locus_tag LOCUS_26840 44513 45550 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_26840 45767 46555 gene locus_tag LOCUS_26850 45767 46555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 46552 47025 gene locus_tag LOCUS_26860 gene mreD 46552 47025 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_26860 47025 47603 gene locus_tag LOCUS_26870 47025 47603 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_26870 47597 49048 gene locus_tag LOCUS_26880 gene cafA 47597 49048 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_26880 49055 53065 gene locus_tag LOCUS_26890 49055 53065 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_26890 53058 53852 gene locus_tag LOCUS_26900 53058 53852 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261175.1 protein_id gnl|my_center|LOCUS_26900 54211 53939 gene locus_tag LOCUS_26910 54211 53939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 54917 54417 gene locus_tag LOCUS_26920 54917 54417 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_26920 56283 54928 gene locus_tag LOCUS_26930 56283 54928 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_26930 56738 56469 gene locus_tag LOCUS_26940 gene ptsH 56738 56469 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_26940 57607 56756 gene locus_tag LOCUS_26950 57607 56756 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_26950 58074 57610 gene locus_tag LOCUS_26960 gene ptsN 58074 57610 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_26960 58382 58080 gene locus_tag LOCUS_26970 58382 58080 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_26970 59983 58484 gene locus_tag LOCUS_26980 59983 58484 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU5 protein_id gnl|my_center|LOCUS_26980 60871 60146 gene locus_tag LOCUS_26990 60871 60146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_26990 61434 60871 gene locus_tag LOCUS_27000 gene lptA 61434 60871 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU2 protein_id gnl|my_center|LOCUS_27000 61975 61421 gene locus_tag LOCUS_27010 61975 61421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 62943 61975 gene locus_tag LOCUS_27020 gene kdsD 62943 61975 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_27020 63906 62947 gene locus_tag LOCUS_27030 63906 62947 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_27030 63811 64092 gene locus_tag LOCUS_27040 63811 64092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 64112 64930 gene locus_tag LOCUS_27050 64112 64930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_27050 64923 65705 gene locus_tag LOCUS_27060 64923 65705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 protein_id gnl|my_center|LOCUS_27060 65710 66165 gene locus_tag LOCUS_27070 65710 66165 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_27070 66165 66479 gene locus_tag LOCUS_27080 66165 66479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 66599 66832 gene locus_tag LOCUS_27090 66599 66832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 66836 68101 gene locus_tag LOCUS_27100 gene murA 66836 68101 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_27100 68127 68768 gene locus_tag LOCUS_27110 gene hisG 68127 68768 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_27110 68783 70075 gene locus_tag LOCUS_27120 gene hisD 68783 70075 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_27120 70715 70134 gene locus_tag LOCUS_27130 70715 70134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 71356 70775 gene locus_tag LOCUS_27140 71356 70775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 71902 71573 gene locus_tag LOCUS_27150 gene fdxA 71902 71573 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_27150 74683 72089 gene locus_tag LOCUS_27160 gene mutS 74683 72089 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP5 protein_id gnl|my_center|LOCUS_27160 74736 75053 gene locus_tag LOCUS_27170 74736 75053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 75947 75114 gene locus_tag LOCUS_27180 75947 75114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_27180 76099 76578 gene locus_tag LOCUS_27190 76099 76578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947823.1 protein_id gnl|my_center|LOCUS_27190 76617 76946 gene locus_tag LOCUS_27200 gene trxA 76617 76946 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TC5 protein_id gnl|my_center|LOCUS_27200 76939 77229 gene locus_tag LOCUS_27210 76939 77229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 77236 78153 gene locus_tag LOCUS_27220 77236 78153 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UB8 protein_id gnl|my_center|LOCUS_27220 78143 78904 gene locus_tag LOCUS_27230 78143 78904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 78935 79396 gene locus_tag LOCUS_27240 78935 79396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946402.1 protein_id gnl|my_center|LOCUS_27240 80433 79498 gene locus_tag LOCUS_27250 80433 79498 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886753.1 protein_id gnl|my_center|LOCUS_27250 80564 81112 gene locus_tag LOCUS_27260 gene mip 80564 81112 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_27260 81178 81642 gene locus_tag LOCUS_27270 81178 81642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_27270 81608 82270 gene locus_tag LOCUS_27280 81608 82270 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_27280 82435 82914 gene locus_tag LOCUS_27290 82435 82914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_27290 82997 84031 gene locus_tag LOCUS_27300 gene recA 82997 84031 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_27300 84009 84506 gene locus_tag LOCUS_27310 gene recX 84009 84506 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4D4 protein_id gnl|my_center|LOCUS_27310 84839 85774 gene locus_tag LOCUS_27320 84839 85774 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_27320 85743 85979 gene locus_tag LOCUS_27330 85743 85979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 87215 85926 gene locus_tag LOCUS_27340 87215 85926 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301763.1 protein_id gnl|my_center|LOCUS_27340 88169 87300 gene locus_tag LOCUS_27350 88169 87300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_27350 88422 88198 gene locus_tag LOCUS_27360 88422 88198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 89440 88478 gene locus_tag LOCUS_27370 89440 88478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 89639 92266 gene locus_tag LOCUS_27380 gene alaS 89639 92266 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_27380 92455 93690 gene locus_tag LOCUS_27390 gene lysC 92455 93690 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_27390 93864 94058 gene locus_tag LOCUS_27400 gene csrA 93864 94058 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_27400 94126 94215 gene locus_tag LOCUS_t00310 94126 94215 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 94291 94367 gene locus_tag LOCUS_t00320 94291 94367 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 1100 45 gene locus_tag LOCUS_27410 1100 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1182 1856 gene locus_tag LOCUS_27420 1182 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1853 2314 gene locus_tag LOCUS_27430 1853 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3252 2803 gene locus_tag LOCUS_27440 3252 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 protein_id gnl|my_center|LOCUS_27440 4351 3296 gene locus_tag LOCUS_27450 gene rsgA 4351 3296 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 protein_id gnl|my_center|LOCUS_27450 4975 4538 gene locus_tag LOCUS_27460 4975 4538 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530661.1 protein_id gnl|my_center|LOCUS_27460 5639 5172 gene locus_tag LOCUS_27470 5639 5172 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073020.1 protein_id gnl|my_center|LOCUS_27470 6776 5718 gene locus_tag LOCUS_27480 6776 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7107 8150 gene locus_tag LOCUS_27490 gene dinB 7107 8150 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 protein_id gnl|my_center|LOCUS_27490 8741 8160 gene locus_tag LOCUS_27500 8741 8160 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_27500 9906 8677 gene locus_tag LOCUS_27510 9906 8677 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_27510 11104 10079 gene locus_tag LOCUS_27520 gene oruR 11104 10079 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_27520 11327 11779 gene locus_tag LOCUS_27530 11327 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH1 protein_id gnl|my_center|LOCUS_27530 12304 11783 gene locus_tag LOCUS_27540 12304 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 12682 12437 gene locus_tag LOCUS_27550 12682 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 13020 13220 gene locus_tag LOCUS_27560 13020 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_27560 13348 13941 gene locus_tag LOCUS_27570 13348 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 14238 14936 gene locus_tag LOCUS_27580 14238 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 14975 16165 gene locus_tag LOCUS_27590 14975 16165 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_27590 16198 16503 gene locus_tag LOCUS_27600 16198 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 17344 16565 gene locus_tag LOCUS_27610 gene rlpA 17344 16565 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 protein_id gnl|my_center|LOCUS_27610 18297 17341 gene locus_tag LOCUS_27620 18297 17341 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_27620 19447 18305 gene locus_tag LOCUS_27630 gene rodA 19447 18305 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_27630 21296 19437 gene locus_tag LOCUS_27640 gene pbpA 21296 19437 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_27640 21787 21320 gene locus_tag LOCUS_27650 gene rlmH 21787 21320 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN76 protein_id gnl|my_center|LOCUS_27650 22137 21784 gene locus_tag LOCUS_27660 gene rsfS 22137 21784 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ08 protein_id gnl|my_center|LOCUS_27660 22800 22144 gene locus_tag LOCUS_27670 gene nadD 22800 22144 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_27670 24037 22781 gene locus_tag LOCUS_27680 gene proA 24037 22781 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_27680 24205 25128 gene locus_tag LOCUS_27690 24205 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 25118 26134 gene locus_tag LOCUS_27700 25118 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 26966 26124 gene locus_tag LOCUS_27710 26966 26124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_27710 27277 27020 gene locus_tag LOCUS_27720 27277 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 27439 28449 gene locus_tag LOCUS_27730 27439 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 protein_id gnl|my_center|LOCUS_27730 28565 29713 gene locus_tag LOCUS_27740 gene dacC 28565 29713 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_27740 29791 30063 gene locus_tag LOCUS_27750 29791 30063 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_27750 30063 30692 gene locus_tag LOCUS_27760 gene lipB 30063 30692 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_27760 30707 31687 gene locus_tag LOCUS_27770 gene lipA 30707 31687 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_27770 31692 31928 gene locus_tag LOCUS_27780 31692 31928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 32126 31950 gene locus_tag LOCUS_27790 32126 31950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 32275 32721 gene locus_tag LOCUS_27800 32275 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 33026 32787 gene locus_tag LOCUS_27810 33026 32787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_27810 33599 33168 gene locus_tag LOCUS_27820 gene thi3 33599 33168 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_27820 34695 33673 gene locus_tag LOCUS_27830 gene yeiR 34695 33673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_27830 34912 35082 gene locus_tag LOCUS_27840 34912 35082 CDS product UPF0391 membrane protein R00741 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RV0 protein_id gnl|my_center|LOCUS_27840 36826 35090 gene locus_tag LOCUS_27850 gene dsbD 36826 35090 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN44 protein_id gnl|my_center|LOCUS_27850 37844 36876 gene locus_tag LOCUS_27860 gene ispB 37844 36876 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381308.1 protein_id gnl|my_center|LOCUS_27860 38053 38364 gene locus_tag LOCUS_27870 gene rplU 38053 38364 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_27870 38595 38852 gene locus_tag LOCUS_27880 gene rpmA 38595 38852 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_27880 39167 40363 gene locus_tag LOCUS_27890 gene obg 39167 40363 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_27890 40356 41492 gene locus_tag LOCUS_27900 gene proB 40356 41492 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_27900 41670 42509 gene locus_tag LOCUS_27910 gene kdsA 41670 42509 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_27910 43633 43899 gene locus_tag LOCUS_27920 gene rpsT 43633 43899 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_27920 44020 45657 gene locus_tag LOCUS_27930 gene mviN 44020 45657 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_27930 45764 46717 gene locus_tag LOCUS_27940 gene ribF 45764 46717 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_27940 46732 49620 gene locus_tag LOCUS_27950 gene ileS 46732 49620 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_27950 49620 50144 gene locus_tag LOCUS_27960 gene lspA 49620 50144 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_27960 50158 50607 gene locus_tag LOCUS_27970 50158 50607 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_27970 50607 51557 gene locus_tag LOCUS_27980 gene ispH 50607 51557 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_27980 55316 51957 gene locus_tag LOCUS_27990 gene pilY 55316 51957 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_27990 55862 55341 gene locus_tag LOCUS_28000 55862 55341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 56356 55859 gene locus_tag LOCUS_28010 56356 55859 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_28010 57077 56679 gene locus_tag LOCUS_28020 gene pilE 57077 56679 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_28020 60469 57074 gene locus_tag LOCUS_28030 gene pilY 60469 57074 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_28030 60985 60482 gene locus_tag LOCUS_28040 60985 60482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 61825 60998 gene locus_tag LOCUS_28050 61825 60998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 62397 61822 gene locus_tag LOCUS_28060 gene pilV 62397 61822 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073361.1 protein_id gnl|my_center|LOCUS_28060 62888 62394 gene locus_tag LOCUS_28070 62888 62394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 63578 63012 gene locus_tag LOCUS_28080 63578 63012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 67368 63688 gene locus_tag LOCUS_28090 gene pilY 67368 63688 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_28090 67929 67381 gene locus_tag LOCUS_28100 67929 67381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 68369 67935 gene locus_tag LOCUS_28110 68369 67935 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_28110 69234 68383 gene locus_tag LOCUS_28120 69234 68383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 69835 69236 gene locus_tag LOCUS_28130 69835 69236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 70308 69829 gene locus_tag LOCUS_28140 70308 69829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 72336 70780 gene locus_tag LOCUS_28150 72336 70780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 76233 72973 gene locus_tag LOCUS_28160 gene pilY 76233 72973 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_28160 76784 76341 gene locus_tag LOCUS_28170 76784 76341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 77310 76795 gene locus_tag LOCUS_28180 77310 76795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 77755 77321 gene locus_tag LOCUS_28190 77755 77321 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_28190 78635 77781 gene locus_tag LOCUS_28200 78635 77781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 79261 78650 gene locus_tag LOCUS_28210 gene pilV 79261 78650 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073361.1 protein_id gnl|my_center|LOCUS_28210 79731 79255 gene locus_tag LOCUS_28220 79731 79255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 79985 81607 gene locus_tag LOCUS_28230 gene nadE 79985 81607 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_28230 82980 82138 gene locus_tag LOCUS_28240 gene bamD 82980 82138 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889C4 protein_id gnl|my_center|LOCUS_28240 86219 83067 gene locus_tag LOCUS_28250 86219 83067 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268123.1 protein_id gnl|my_center|LOCUS_28250 87414 86230 gene locus_tag LOCUS_28260 gene mexE 87414 86230 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_28260 87624 88583 gene locus_tag LOCUS_28270 gene rluD 87624 88583 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI4 protein_id gnl|my_center|LOCUS_28270 88586 89317 gene locus_tag LOCUS_28280 gene yfiH 88586 89317 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4J1 protein_id gnl|my_center|LOCUS_28280 89913 91637 gene locus_tag LOCUS_28290 gene ilvB 89913 91637 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888N6 protein_id gnl|my_center|LOCUS_28290 91640 92131 gene locus_tag LOCUS_28300 gene ilvH 91640 92131 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_28300 92600 92968 gene locus_tag LOCUS_28310 92600 92968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 93226 93822 gene locus_tag LOCUS_28320 93226 93822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence19 751 569 gene locus_tag LOCUS_28330 751 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 897 1961 gene locus_tag LOCUS_28340 897 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2478 3686 gene locus_tag LOCUS_28350 2478 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_28350 3689 5428 gene locus_tag LOCUS_28360 3689 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 5452 6087 gene locus_tag LOCUS_28370 5452 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 6089 8599 gene locus_tag LOCUS_28380 6089 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 8690 10240 gene locus_tag LOCUS_28390 gene leuA 8690 10240 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_28390 10243 10992 gene locus_tag LOCUS_28400 10243 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 10999 11448 gene locus_tag LOCUS_28410 gene rimI 10999 11448 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888M5 protein_id gnl|my_center|LOCUS_28410 11445 12104 gene locus_tag LOCUS_28420 11445 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_28420 12343 14706 gene locus_tag LOCUS_28430 12343 14706 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_28430 14884 16569 gene locus_tag LOCUS_28440 gene argS 14884 16569 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_28440 16598 17149 gene locus_tag LOCUS_28450 16598 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_28450 17177 17521 gene locus_tag LOCUS_28460 gene hit 17177 17521 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124235.1 protein_id gnl|my_center|LOCUS_28460 17913 19337 gene locus_tag LOCUS_28470 17913 19337 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096881.1 protein_id gnl|my_center|LOCUS_28470 20990 19761 gene locus_tag LOCUS_28480 gene serA 20990 19761 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_28480 21098 22627 gene locus_tag LOCUS_28490 21098 22627 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_28490 24121 22691 gene locus_tag LOCUS_28500 24121 22691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28500 24405 24022 gene locus_tag LOCUS_28510 24405 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 27174 24664 gene locus_tag LOCUS_28520 gene mrcA 27174 24664 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_28520 27334 28398 gene locus_tag LOCUS_28530 gene pilM 27334 28398 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_28530 28398 28955 gene locus_tag LOCUS_28540 gene pilN 28398 28955 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_28540 28957 29586 gene locus_tag LOCUS_28550 gene pilO 28957 29586 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_28550 29588 30127 gene locus_tag LOCUS_28560 gene pilP 29588 30127 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378849.1 protein_id gnl|my_center|LOCUS_28560 30130 32211 gene locus_tag LOCUS_28570 gene pilQ 30130 32211 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_28570 32218 32727 gene locus_tag LOCUS_28580 gene aroK 32218 32727 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34003 protein_id gnl|my_center|LOCUS_28580 32733 33818 gene locus_tag LOCUS_28590 gene aroB 32733 33818 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_28590 33872 35464 gene locus_tag LOCUS_28600 33872 35464 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266379.1 protein_id gnl|my_center|LOCUS_28600 35629 40080 gene locus_tag LOCUS_28610 gene gltB 35629 40080 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_28610 40111 41529 gene locus_tag LOCUS_28620 gene gltD 40111 41529 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_28620 41690 43549 gene locus_tag LOCUS_28630 41690 43549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 43635 44699 gene locus_tag LOCUS_28640 gene hemE 43635 44699 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_28640 44839 47640 gene locus_tag LOCUS_28650 44839 47640 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_28650 47640 48044 gene locus_tag LOCUS_28660 47640 48044 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_28660 48044 49561 gene locus_tag LOCUS_28670 48044 49561 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_28670 49561 50046 gene locus_tag LOCUS_28680 49561 50046 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_28680 50040 50309 gene locus_tag LOCUS_28690 50040 50309 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_28690 50302 50673 gene locus_tag LOCUS_28700 50302 50673 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_28700 52053 50683 gene locus_tag LOCUS_28710 gene radA 52053 50683 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z0T8 protein_id gnl|my_center|LOCUS_28710 52147 52800 gene locus_tag LOCUS_28720 52147 52800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022772.1 protein_id gnl|my_center|LOCUS_28720 53937 53209 gene locus_tag LOCUS_28730 53937 53209 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_28730 54568 53996 gene locus_tag LOCUS_28740 54568 53996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 55562 54579 gene locus_tag LOCUS_28750 gene motB 55562 54579 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_28750 56330 55572 gene locus_tag LOCUS_28760 56330 55572 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_28760 56548 56793 gene locus_tag LOCUS_28770 gene xseB 56548 56793 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E63 protein_id gnl|my_center|LOCUS_28770 56790 57665 gene locus_tag LOCUS_28780 gene ispA 56790 57665 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261435.1 protein_id gnl|my_center|LOCUS_28780 57740 59647 gene locus_tag LOCUS_28790 gene dxs 57740 59647 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_28790 60323 59715 gene locus_tag LOCUS_28800 gene ribA 60323 59715 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_28800 60572 61249 gene locus_tag LOCUS_28810 60572 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989841.1 protein_id gnl|my_center|LOCUS_28810 62073 61567 gene locus_tag LOCUS_28820 gene pgpA 62073 61567 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_28820 62253 63113 gene locus_tag LOCUS_28830 62253 63113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 63704 64105 gene locus_tag LOCUS_28840 63704 64105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 64102 65049 gene locus_tag LOCUS_28850 64102 65049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 65890 65039 gene locus_tag LOCUS_28860 65890 65039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 66644 65919 gene locus_tag LOCUS_28870 66644 65919 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339394.1 protein_id gnl|my_center|LOCUS_28870 69941 66648 gene locus_tag LOCUS_28880 69941 66648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 71657 70686 gene locus_tag LOCUS_28890 gene intI 71657 70686 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_28890 72009 72644 gene locus_tag LOCUS_28900 72009 72644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 72773 73090 gene locus_tag LOCUS_28910 72773 73090 CDS product insertion sequence IS3 transposase InsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_708635.1 protein_id gnl|my_center|LOCUS_28910 73084 73746 gene locus_tag LOCUS_28920 gene insF5 73084 73746 CDS product transposase InsF for insertion sequence IS3E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CF83 protein_id gnl|my_center|LOCUS_28920 >Feature sequence20 1185 694 gene locus_tag LOCUS_28930 1185 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1877 1314 gene locus_tag LOCUS_28940 1877 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_28940 2271 1888 gene locus_tag LOCUS_28950 2271 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2611 2306 gene locus_tag LOCUS_28960 2611 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_28960 3872 2739 gene locus_tag LOCUS_28970 gene cydB-2 3872 2739 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707369.1 protein_id gnl|my_center|LOCUS_28970 5466 3883 gene locus_tag LOCUS_28980 gene cydA 5466 3883 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 protein_id gnl|my_center|LOCUS_28980 5662 5456 gene locus_tag LOCUS_28990 5662 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 5898 6476 gene locus_tag LOCUS_29000 5898 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 6573 6878 gene locus_tag LOCUS_29010 6573 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 7016 7438 gene locus_tag LOCUS_29020 7016 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 8748 7738 gene locus_tag LOCUS_29030 gene cyoE2 8748 7738 CDS product protoheme IX farnesyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I423 protein_id gnl|my_center|LOCUS_29030 9088 8759 gene locus_tag LOCUS_29040 gene cyoD 9088 8759 CDS product cytochrome bo(3) ubiquinol oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I424 protein_id gnl|my_center|LOCUS_29040 9711 9085 gene locus_tag LOCUS_29050 gene cyoC 9711 9085 CDS product cytochrome bo(3) ubiquinol oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I425 protein_id gnl|my_center|LOCUS_29050 11725 9713 gene locus_tag LOCUS_29060 gene cyoB 11725 9713 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244877.1 protein_id gnl|my_center|LOCUS_29060 12706 11732 gene locus_tag LOCUS_29070 gene cyoA 12706 11732 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK33 protein_id gnl|my_center|LOCUS_29070 13257 12907 gene locus_tag LOCUS_29080 13257 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 13300 13470 gene locus_tag LOCUS_29090 13300 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 13651 15486 gene locus_tag LOCUS_29100 13651 15486 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707784.1 protein_id gnl|my_center|LOCUS_29100 15657 16901 gene locus_tag LOCUS_29110 15657 16901 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_29110 16950 19109 gene locus_tag LOCUS_29120 16950 19109 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_29120 19349 19843 gene locus_tag LOCUS_29130 19349 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 20126 23509 gene locus_tag LOCUS_29140 gene recC 20126 23509 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP4 protein_id gnl|my_center|LOCUS_29140 23506 27105 gene locus_tag LOCUS_29150 gene recB 23506 27105 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ58 protein_id gnl|my_center|LOCUS_29150 27102 28967 gene locus_tag LOCUS_29160 gene recD 27102 28967 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPB7 protein_id gnl|my_center|LOCUS_29160 28976 31879 gene locus_tag LOCUS_29170 28976 31879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 31952 32245 gene locus_tag LOCUS_29180 31952 32245 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 protein_id gnl|my_center|LOCUS_29180 32946 33022 gene locus_tag LOCUS_t00330 32946 33022 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33049 33819 gene locus_tag LOCUS_29190 gene trkA 33049 33819 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206952.1 protein_id gnl|my_center|LOCUS_29190 33816 35192 gene locus_tag LOCUS_29200 gene ktrB 33816 35192 CDS product Ktr system potassium transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070471.1 protein_id gnl|my_center|LOCUS_29200 36421 35189 gene locus_tag LOCUS_29210 36421 35189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 36892 36701 gene locus_tag LOCUS_29220 36892 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 37244 38119 gene locus_tag LOCUS_29230 37244 38119 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_29230 38264 39244 gene locus_tag LOCUS_29240 38264 39244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_29240 39382 42639 gene locus_tag LOCUS_29250 39382 42639 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_29250 43034 44338 gene locus_tag LOCUS_29260 43034 44338 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_29260 44335 45318 gene locus_tag LOCUS_29270 44335 45318 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_29270 45333 46358 gene locus_tag LOCUS_29280 45333 46358 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_29280 46360 46911 gene locus_tag LOCUS_29290 46360 46911 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_29290 47041 48927 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttggctgccgcacaggcagctaagaaa >Feature sequence21 408 2495 gene locus_tag LOCUS_29300 gene fusA2 408 2495 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 protein_id gnl|my_center|LOCUS_29300 2680 4221 gene locus_tag LOCUS_29310 2680 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_29310 4307 4540 gene locus_tag LOCUS_29320 4307 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 4595 5698 gene locus_tag LOCUS_29330 4595 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 5710 6771 gene locus_tag LOCUS_29340 5710 6771 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_29340 6786 7370 gene locus_tag LOCUS_29350 6786 7370 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_29350 7354 8055 gene locus_tag LOCUS_29360 7354 8055 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 protein_id gnl|my_center|LOCUS_29360 9227 8673 gene locus_tag LOCUS_29370 9227 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 10554 9268 gene locus_tag LOCUS_29380 10554 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 11066 10551 gene locus_tag LOCUS_29390 11066 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 12070 11063 gene locus_tag LOCUS_29400 12070 11063 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_29400 12967 12101 gene locus_tag LOCUS_29410 12967 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 16896 13141 gene locus_tag LOCUS_29420 16896 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 17652 17077 gene locus_tag LOCUS_29430 17652 17077 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_29430 18224 17670 gene locus_tag LOCUS_29440 18224 17670 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_29440 18355 19236 gene locus_tag LOCUS_29450 18355 19236 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090116.1 protein_id gnl|my_center|LOCUS_29450 19817 19251 gene locus_tag LOCUS_29460 19817 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 20080 20697 gene locus_tag LOCUS_29470 20080 20697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 21457 20666 gene locus_tag LOCUS_29480 21457 20666 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341611.1 protein_id gnl|my_center|LOCUS_29480 22226 21450 gene locus_tag LOCUS_29490 gene znuC 22226 21450 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_29490 22471 22208 gene locus_tag LOCUS_29500 22471 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 22373 22687 gene locus_tag LOCUS_29510 22373 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 22740 23591 gene locus_tag LOCUS_29520 22740 23591 CDS product high-affinity zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_456458.3 protein_id gnl|my_center|LOCUS_29520 23695 25059 gene locus_tag LOCUS_29530 gene glmU 23695 25059 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_29530 25186 25869 gene locus_tag LOCUS_29540 gene cpxR 25186 25869 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_29540 25907 27256 gene locus_tag LOCUS_29550 gene cpxA 25907 27256 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947166.1 protein_id gnl|my_center|LOCUS_29550 27399 27680 gene locus_tag LOCUS_29560 27399 27680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 27782 28816 gene locus_tag LOCUS_29570 27782 28816 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_29570 29645 28839 gene locus_tag LOCUS_29580 29645 28839 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 protein_id gnl|my_center|LOCUS_29580 29980 32715 gene locus_tag LOCUS_29590 29980 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 33300 32788 gene locus_tag LOCUS_29600 33300 32788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_29600 33780 33400 gene locus_tag LOCUS_29610 33780 33400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 34232 33777 gene locus_tag LOCUS_29620 34232 33777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 34614 34354 gene locus_tag LOCUS_29630 34614 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 35148 35579 gene locus_tag LOCUS_29640 35148 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 35592 35822 gene locus_tag LOCUS_29650 gene rpsR 35592 35822 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_29650 35968 36414 gene locus_tag LOCUS_29660 gene rplI 35968 36414 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_29660 36481 37869 gene locus_tag LOCUS_29670 gene dnaB 36481 37869 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 protein_id gnl|my_center|LOCUS_29670 37916 38524 gene locus_tag LOCUS_29680 37916 38524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 38521 39048 gene locus_tag LOCUS_29690 38521 39048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 39264 39070 gene locus_tag LOCUS_29700 39264 39070 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933047.1 protein_id gnl|my_center|LOCUS_29700 39918 39265 gene locus_tag LOCUS_29710 39918 39265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 40975 39842 gene locus_tag LOCUS_29720 40975 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 41097 42167 gene locus_tag LOCUS_29730 gene alr 41097 42167 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZW2 protein_id gnl|my_center|LOCUS_29730 42368 43276 gene locus_tag LOCUS_29740 42368 43276 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477139.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence22 1734 352 gene locus_tag LOCUS_29750 1734 352 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_29750 2195 1731 gene locus_tag LOCUS_29760 2195 1731 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_29760 2337 4133 gene locus_tag LOCUS_29770 gene ilvD 2337 4133 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 protein_id gnl|my_center|LOCUS_29770 4998 4216 gene locus_tag LOCUS_29780 4998 4216 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_29780 6771 5164 gene locus_tag LOCUS_29790 6771 5164 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483222.1 protein_id gnl|my_center|LOCUS_29790 8171 6888 gene locus_tag LOCUS_29800 8171 6888 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_29800 8458 8177 gene locus_tag LOCUS_29810 8458 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_29810 9437 8451 gene locus_tag LOCUS_29820 9437 8451 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_29820 10056 9430 gene locus_tag LOCUS_29830 10056 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 11173 10046 gene locus_tag LOCUS_29840 11173 10046 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891989.1 protein_id gnl|my_center|LOCUS_29840 12176 11166 gene locus_tag LOCUS_29850 12176 11166 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 protein_id gnl|my_center|LOCUS_29850 12668 12186 gene locus_tag LOCUS_29860 12668 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 13022 14443 gene locus_tag LOCUS_29870 13022 14443 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708519.1 protein_id gnl|my_center|LOCUS_29870 15283 14522 gene locus_tag LOCUS_29880 gene hisF 15283 14522 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_29880 16026 15286 gene locus_tag LOCUS_29890 gene hisA 16026 15286 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG3 protein_id gnl|my_center|LOCUS_29890 16805 16155 gene locus_tag LOCUS_29900 gene hisH1 16805 16155 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_29900 17407 16817 gene locus_tag LOCUS_29910 gene hisB 17407 16817 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_29910 17492 17911 gene locus_tag LOCUS_29920 17492 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 18100 18735 gene locus_tag LOCUS_29930 18100 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 18947 21358 gene locus_tag LOCUS_29940 18947 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 21405 22454 gene locus_tag LOCUS_29950 gene mutY 21405 22454 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_29950 22469 22747 gene locus_tag LOCUS_29960 22469 22747 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_29960 22822 22897 gene locus_tag LOCUS_t00340 22822 22897 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 26465 23019 gene locus_tag LOCUS_29970 26465 23019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 27904 26462 gene locus_tag LOCUS_29980 27904 26462 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055826.1 protein_id gnl|my_center|LOCUS_29980 28662 27904 gene locus_tag LOCUS_29990 28662 27904 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_29990 30863 28659 gene locus_tag LOCUS_30000 30863 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_30000 33089 30987 gene locus_tag LOCUS_30010 33089 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 34579 33278 gene locus_tag LOCUS_30020 34579 33278 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706579.1 protein_id gnl|my_center|LOCUS_30020 35162 37684 gene locus_tag LOCUS_30030 35162 37684 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_30030 37681 38175 gene locus_tag LOCUS_30040 37681 38175 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9F2 protein_id gnl|my_center|LOCUS_30040 39785 38277 gene locus_tag LOCUS_30050 39785 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 40137 39742 gene locus_tag LOCUS_30060 40137 39742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 40238 40071 gene locus_tag LOCUS_30070 40238 40071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 40672 40367 gene locus_tag LOCUS_30080 40672 40367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942213.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence23 419 892 gene locus_tag LOCUS_30090 419 892 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_30090 953 1471 gene locus_tag LOCUS_30100 953 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1873 2655 gene locus_tag LOCUS_30110 1873 2655 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_30110 2861 3235 gene locus_tag LOCUS_30120 2861 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3232 4392 gene locus_tag LOCUS_30130 3232 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071127.1 protein_id gnl|my_center|LOCUS_30130 5049 4399 gene locus_tag LOCUS_30140 5049 4399 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882612.1 protein_id gnl|my_center|LOCUS_30140 5258 6049 gene locus_tag LOCUS_30150 5258 6049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_30150 6046 8565 gene locus_tag LOCUS_30160 6046 8565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_30160 8956 9888 gene locus_tag LOCUS_30170 8956 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 9975 10601 gene locus_tag LOCUS_30180 9975 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 11554 10691 gene locus_tag LOCUS_30190 11554 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 12822 11749 gene locus_tag LOCUS_30200 12822 11749 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_30200 12987 13790 gene locus_tag LOCUS_30210 12987 13790 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_30210 15104 13857 gene locus_tag LOCUS_30220 15104 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 16461 15328 gene locus_tag LOCUS_30230 16461 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_30230 17428 16580 gene locus_tag LOCUS_30240 17428 16580 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_30240 18455 17457 gene locus_tag LOCUS_30250 18455 17457 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_30250 19896 18508 gene locus_tag LOCUS_30260 19896 18508 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_30260 20234 20070 gene locus_tag LOCUS_30270 20234 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 20323 22500 gene locus_tag LOCUS_30280 20323 22500 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_30280 22589 23389 gene locus_tag LOCUS_30290 22589 23389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099180.1 protein_id gnl|my_center|LOCUS_30290 23485 24411 gene locus_tag LOCUS_30300 23485 24411 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_30300 26639 24486 gene locus_tag LOCUS_30310 gene putA 26639 24486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072936.1 protein_id gnl|my_center|LOCUS_30310 27207 26875 gene locus_tag LOCUS_30320 27207 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 28873 27185 gene locus_tag LOCUS_30330 28873 27185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103470.1 protein_id gnl|my_center|LOCUS_30330 29226 28876 gene locus_tag LOCUS_30340 29226 28876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 29183 29362 gene locus_tag LOCUS_30350 29183 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 29415 31574 gene locus_tag LOCUS_30360 gene bfrI 29415 31574 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930660.1 protein_id gnl|my_center|LOCUS_30360 31578 32120 gene locus_tag LOCUS_30370 31578 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 32124 33539 gene locus_tag LOCUS_30380 32124 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 34072 33536 gene locus_tag LOCUS_30390 34072 33536 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_30390 34747 34202 gene locus_tag LOCUS_30400 34747 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 35351 35617 gene locus_tag LOCUS_30410 gene parD4 35351 35617 CDS product antitoxin ParD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A458 protein_id gnl|my_center|LOCUS_30410 35598 35897 gene locus_tag LOCUS_30420 35598 35897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 36420 36668 gene locus_tag LOCUS_30430 36420 36668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 36835 37605 gene locus_tag LOCUS_30440 36835 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 37953 37753 gene locus_tag LOCUS_30450 37953 37753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 38130 38399 gene locus_tag LOCUS_30460 38130 38399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 38405 38728 gene locus_tag LOCUS_30470 38405 38728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 38988 38725 gene locus_tag LOCUS_30480 38988 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 39334 39504 gene locus_tag LOCUS_30490 39334 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 39691 39605 gene locus_tag LOCUS_t00350 39691 39605 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 1220 93 gene locus_tag LOCUS_30500 1220 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1918 1271 gene locus_tag LOCUS_30510 1918 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 3490 2063 gene locus_tag LOCUS_30520 3490 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 5162 3480 gene locus_tag LOCUS_30530 gene hsdM-1 5162 3480 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_30530 5301 5573 gene locus_tag LOCUS_30540 5301 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 5570 5854 gene locus_tag LOCUS_30550 5570 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 6850 5924 gene locus_tag LOCUS_30560 6850 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 7001 8518 gene locus_tag LOCUS_30570 gene exaC 7001 8518 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 protein_id gnl|my_center|LOCUS_30570 8754 9062 gene locus_tag LOCUS_30580 8754 9062 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721013.1 protein_id gnl|my_center|LOCUS_30580 9059 9556 gene locus_tag LOCUS_30590 9059 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263492.1 protein_id gnl|my_center|LOCUS_30590 10196 9561 gene locus_tag LOCUS_30600 10196 9561 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096906.1 protein_id gnl|my_center|LOCUS_30600 10740 10354 gene locus_tag LOCUS_30610 10740 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 12433 10730 gene locus_tag LOCUS_30620 12433 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12940 12446 gene locus_tag LOCUS_30630 12940 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 13453 13145 gene locus_tag LOCUS_30640 13453 13145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405249.1 protein_id gnl|my_center|LOCUS_30640 13595 14662 gene locus_tag LOCUS_30650 13595 14662 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_30650 14670 17912 gene locus_tag LOCUS_30660 14670 17912 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882489.1 protein_id gnl|my_center|LOCUS_30660 18766 18308 gene locus_tag LOCUS_30670 18766 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 protein_id gnl|my_center|LOCUS_30670 20537 18807 gene locus_tag LOCUS_30680 20537 18807 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 protein_id gnl|my_center|LOCUS_30680 20814 20551 gene locus_tag LOCUS_30690 20814 20551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_30690 21258 24695 gene locus_tag LOCUS_30700 21258 24695 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_30700 25299 24703 gene locus_tag LOCUS_30710 gene agmR 25299 24703 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_30710 27296 25458 gene locus_tag LOCUS_30720 gene acs 27296 25458 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSC0 protein_id gnl|my_center|LOCUS_30720 27601 28734 gene locus_tag LOCUS_30730 27601 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_30730 32179 28808 gene locus_tag LOCUS_30740 32179 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 32754 34397 gene locus_tag LOCUS_30750 gene pgm 32754 34397 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_30750 34783 37170 gene locus_tag LOCUS_30760 34783 37170 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence25 2158 524 gene locus_tag LOCUS_30770 2158 524 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884185.1 protein_id gnl|my_center|LOCUS_30770 3995 2349 gene locus_tag LOCUS_30780 3995 2349 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 protein_id gnl|my_center|LOCUS_30780 4098 4481 gene locus_tag LOCUS_30790 4098 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_30790 5372 4500 gene locus_tag LOCUS_30800 gene bah 5372 4500 CDS product acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_30800 5466 7940 gene locus_tag LOCUS_30810 gene rnr 5466 7940 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_30810 7941 8681 gene locus_tag LOCUS_30820 gene rlmB 7941 8681 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_30820 8713 9801 gene locus_tag LOCUS_30830 8713 9801 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_30830 9939 10496 gene locus_tag LOCUS_30840 9939 10496 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_30840 11120 12232 gene locus_tag LOCUS_30850 11120 12232 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_30850 12473 13030 gene locus_tag LOCUS_30860 12473 13030 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_30860 13112 14665 gene locus_tag LOCUS_30870 13112 14665 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_30870 14933 16246 gene locus_tag LOCUS_30880 14933 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 17592 16231 gene locus_tag LOCUS_30890 17592 16231 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_30890 17775 19412 gene locus_tag LOCUS_30900 gene phoD 17775 19412 CDS product alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42251 protein_id gnl|my_center|LOCUS_30900 20290 19424 gene locus_tag LOCUS_30910 20290 19424 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_30910 20348 21295 gene locus_tag LOCUS_30920 20348 21295 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887606.1 protein_id gnl|my_center|LOCUS_30920 21398 22477 gene locus_tag LOCUS_30930 gene hisC1 21398 22477 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE0 protein_id gnl|my_center|LOCUS_30930 23724 22549 gene locus_tag LOCUS_30940 23724 22549 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_30940 23840 24601 gene locus_tag LOCUS_30950 23840 24601 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_30950 25882 24929 gene locus_tag LOCUS_30960 25882 24929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706409.1 protein_id gnl|my_center|LOCUS_30960 26531 25920 gene locus_tag LOCUS_30970 26531 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 27484 26528 gene locus_tag LOCUS_30980 27484 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 29651 27669 gene locus_tag LOCUS_30990 gene betT 29651 27669 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040260.1 protein_id gnl|my_center|LOCUS_30990 30733 29672 gene locus_tag LOCUS_31000 30733 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 31857 30895 gene locus_tag LOCUS_31010 31857 30895 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120175.1 protein_id gnl|my_center|LOCUS_31010 32203 33825 gene locus_tag LOCUS_31020 gene pyrG 32203 33825 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_31020 34037 35329 gene locus_tag LOCUS_31030 gene eno 34037 35329 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_31030 >Feature sequence26 647 1771 gene locus_tag LOCUS_31040 647 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2419 1838 gene locus_tag LOCUS_31050 gene azoR 2419 1838 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 protein_id gnl|my_center|LOCUS_31050 2528 3451 gene locus_tag LOCUS_31060 2528 3451 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_31060 3542 3784 gene locus_tag LOCUS_31070 3542 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3792 4631 gene locus_tag LOCUS_31080 gene sseA 3792 4631 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261980.1 protein_id gnl|my_center|LOCUS_31080 4917 4696 gene locus_tag LOCUS_31090 4917 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5161 5937 gene locus_tag LOCUS_31100 5161 5937 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_31100 6000 7283 gene locus_tag LOCUS_31110 6000 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_31110 8660 7299 gene locus_tag LOCUS_31120 gene yegD 8660 7299 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_31120 9443 8724 gene locus_tag LOCUS_31130 9443 8724 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268494.1 protein_id gnl|my_center|LOCUS_31130 9820 11202 gene locus_tag LOCUS_31140 9820 11202 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_31140 11254 11997 gene locus_tag LOCUS_31150 11254 11997 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705420.1 protein_id gnl|my_center|LOCUS_31150 12029 13075 gene locus_tag LOCUS_31160 12029 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 13142 14065 gene locus_tag LOCUS_31170 13142 14065 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_31170 14167 15627 gene locus_tag LOCUS_31180 gene pucI 14167 15627 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206510.1 protein_id gnl|my_center|LOCUS_31180 15772 16788 gene locus_tag LOCUS_31190 gene alc 15772 16788 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J8 protein_id gnl|my_center|LOCUS_31190 16897 17415 gene locus_tag LOCUS_31200 gene allA 16897 17415 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_31200 17543 17788 gene locus_tag LOCUS_31210 gene parD-4 17543 17788 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_31210 17785 18063 gene locus_tag LOCUS_31220 17785 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 18060 18656 gene locus_tag LOCUS_31230 18060 18656 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_31230 20864 18666 gene locus_tag LOCUS_31240 gene fdhF 20864 18666 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_31240 21159 23111 gene locus_tag LOCUS_31250 21159 23111 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_31250 23130 23819 gene locus_tag LOCUS_31260 23130 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 23917 24159 gene locus_tag LOCUS_31270 23917 24159 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460424.1 protein_id gnl|my_center|LOCUS_31270 27438 24487 gene locus_tag LOCUS_31280 gene valS 27438 24487 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP73 protein_id gnl|my_center|LOCUS_31280 28475 28122 gene locus_tag LOCUS_31290 28475 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 28912 28475 gene locus_tag LOCUS_31300 28912 28475 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065106.1 protein_id gnl|my_center|LOCUS_31300 29603 28920 gene locus_tag LOCUS_31310 29603 28920 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_31310 31336 30209 gene locus_tag LOCUS_31320 gene dapE 31336 30209 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4H5 protein_id gnl|my_center|LOCUS_31320 32045 31446 gene locus_tag LOCUS_31330 32045 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 32227 32790 gene locus_tag LOCUS_31340 32227 32790 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence27 272 197 gene locus_tag LOCUS_t00360 272 197 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 351 278 gene locus_tag LOCUS_t00370 351 278 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 511 428 gene locus_tag LOCUS_t00380 511 428 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1303 653 gene locus_tag LOCUS_31350 1303 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_31350 1992 1273 gene locus_tag LOCUS_31360 gene coaX 1992 1273 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_31360 2929 1973 gene locus_tag LOCUS_31370 gene birA 2929 1973 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_31370 3055 4008 gene locus_tag LOCUS_31380 3055 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_31380 6063 3898 gene locus_tag LOCUS_31390 6063 3898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_31390 6523 7515 gene locus_tag LOCUS_31400 6523 7515 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_31400 8453 8016 gene locus_tag LOCUS_31410 gene ytoQ 8453 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_31410 8773 8849 gene locus_tag LOCUS_t00390 8773 8849 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9907 9392 gene locus_tag LOCUS_31420 9907 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 10608 9910 gene locus_tag LOCUS_31430 gene rflA 10608 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_31430 12360 10618 gene locus_tag LOCUS_31440 12360 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 12584 12357 gene locus_tag LOCUS_31450 12584 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 13345 12581 gene locus_tag LOCUS_31460 13345 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 14602 13355 gene locus_tag LOCUS_31470 gene hsdS 14602 13355 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_31470 16083 14605 gene locus_tag LOCUS_31480 gene hsdM 16083 14605 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242272.1 protein_id gnl|my_center|LOCUS_31480 17882 16086 gene locus_tag LOCUS_31490 17882 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 20201 17886 gene locus_tag LOCUS_31500 gene hsdR 20201 17886 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_31500 20425 20201 gene locus_tag LOCUS_31510 20425 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 20556 20771 gene locus_tag LOCUS_31520 20556 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 20784 22016 gene locus_tag LOCUS_31530 20784 22016 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479712.1 protein_id gnl|my_center|LOCUS_31530 22009 22260 gene locus_tag LOCUS_31540 22009 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 22607 22377 gene locus_tag LOCUS_31550 22607 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 22792 23298 gene locus_tag LOCUS_31560 22792 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 23295 23681 gene locus_tag LOCUS_31570 23295 23681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 23693 23857 gene locus_tag LOCUS_31580 23693 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 26429 23865 gene locus_tag LOCUS_31590 26429 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 28548 26416 gene locus_tag LOCUS_31600 28548 26416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence28 6747 4285 gene locus_tag LOCUS_31610 6747 4285 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_31610 8362 6782 gene locus_tag LOCUS_31620 8362 6782 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_31620 9483 8464 gene locus_tag LOCUS_31630 9483 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 10767 9655 gene locus_tag LOCUS_31640 10767 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 12551 10980 gene locus_tag LOCUS_31650 gene glgA 12551 10980 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_31650 13972 12701 gene locus_tag LOCUS_31660 gene glgC 13972 12701 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_31660 16446 13969 gene locus_tag LOCUS_31670 gene glgP 16446 13969 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_31670 18580 16457 gene locus_tag LOCUS_31680 gene glgX 18580 16457 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU6 protein_id gnl|my_center|LOCUS_31680 20964 18577 gene locus_tag LOCUS_31690 gene glgB 20964 18577 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU7 protein_id gnl|my_center|LOCUS_31690 23075 20961 gene locus_tag LOCUS_31700 23075 20961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 25241 23664 gene locus_tag LOCUS_31710 gene guaA 25241 23664 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 protein_id gnl|my_center|LOCUS_31710 <26668 25352 gene locus_tag LOCUS_31720 <26668 25352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886X6:inosine-5'-monophosphate dehydrogenase >Feature sequence29 420 58 gene locus_tag LOCUS_31730 420 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1861 1448 gene locus_tag LOCUS_31740 1861 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4088 2199 gene locus_tag LOCUS_31750 gene parE 4088 2199 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_31750 4793 4173 gene locus_tag LOCUS_31760 4793 4173 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 protein_id gnl|my_center|LOCUS_31760 5255 4797 gene locus_tag LOCUS_31770 5255 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_31770 5983 5342 gene locus_tag LOCUS_31780 5983 5342 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_31780 6156 7514 gene locus_tag LOCUS_31790 6156 7514 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_31790 7944 7744 gene locus_tag LOCUS_31800 7944 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 9478 8585 gene locus_tag LOCUS_31810 9478 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 10831 9635 gene locus_tag LOCUS_31820 10831 9635 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_31820 12109 10877 gene locus_tag LOCUS_31830 gene ubiH 12109 10877 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_31830 13430 12117 gene locus_tag LOCUS_31840 gene pepP 13430 12117 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_31840 13996 13439 gene locus_tag LOCUS_31850 13996 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 14199 14411 gene locus_tag LOCUS_31860 14199 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 14404 14718 gene locus_tag LOCUS_31870 gene zapA 14404 14718 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_31870 14965 15621 gene locus_tag LOCUS_31880 14965 15621 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_31880 15726 15601 gene locus_tag LOCUS_31890 15726 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 15828 16298 gene locus_tag LOCUS_31900 15828 16298 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_31900 16312 17739 gene locus_tag LOCUS_31910 16312 17739 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_31910 17862 19328 gene locus_tag LOCUS_31920 17862 19328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_31920 19732 21213 gene locus_tag LOCUS_31930 19732 21213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_31930 22160 21207 gene locus_tag LOCUS_31940 22160 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence30 142 723 gene locus_tag LOCUS_31950 142 723 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112724.1 protein_id gnl|my_center|LOCUS_31950 729 3056 gene locus_tag LOCUS_31960 729 3056 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_31960 3053 4468 gene locus_tag LOCUS_31970 gene hxcR 3053 4468 CDS product putative type II secretion system protein HxcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5N9 protein_id gnl|my_center|LOCUS_31970 4468 5676 gene locus_tag LOCUS_31980 4468 5676 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 protein_id gnl|my_center|LOCUS_31980 6168 7415 gene locus_tag LOCUS_31990 gene phoA2 6168 7415 CDS product alkaline phosphatase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35482 protein_id gnl|my_center|LOCUS_31990 7635 20660 gene locus_tag LOCUS_32000 7635 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147216.1 protein_id gnl|my_center|LOCUS_32000 20713 21351 gene locus_tag LOCUS_32010 20713 21351 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098455.1 protein_id gnl|my_center|LOCUS_32010 21335 21520 gene locus_tag LOCUS_32020 21335 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence31 2216 3106 gene locus_tag LOCUS_32030 gene dusB 2216 3106 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_32030 3103 3408 gene locus_tag LOCUS_32040 3103 3408 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_32040 3475 5106 gene locus_tag LOCUS_32050 gene purH 3475 5106 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_32050 5444 6736 gene locus_tag LOCUS_32060 gene purD 5444 6736 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPP8 protein_id gnl|my_center|LOCUS_32060 6781 9114 gene locus_tag LOCUS_32070 6781 9114 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244646.1 protein_id gnl|my_center|LOCUS_32070 9179 9826 gene locus_tag LOCUS_32080 gene coq7 9179 9826 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_32080 10044 10280 gene locus_tag LOCUS_32090 10044 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 10683 10348 gene locus_tag LOCUS_32100 gene phnA 10683 10348 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 protein_id gnl|my_center|LOCUS_32100 10953 10735 gene locus_tag LOCUS_32110 10953 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 11594 11160 gene locus_tag LOCUS_32120 11594 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 12463 11651 gene locus_tag LOCUS_32130 12463 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 14894 12591 gene locus_tag LOCUS_32140 14894 12591 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_32140 15776 14904 gene locus_tag LOCUS_32150 15776 14904 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_32150 16785 15802 gene locus_tag LOCUS_32160 gene oleD 16785 15802 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 protein_id gnl|my_center|LOCUS_32160 18443 16782 gene locus_tag LOCUS_32170 18443 16782 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_32170 18862 18557 gene locus_tag LOCUS_32180 18862 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence32 107 32 gene locus_tag LOCUS_t00400 107 32 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 460 384 gene locus_tag LOCUS_t00410 460 384 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 540 465 gene locus_tag LOCUS_t00420 540 465 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3926 801 gene locus_tag LOCUS_32190 3926 801 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_32190 5002 3926 gene locus_tag LOCUS_32200 5002 3926 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_32200 5648 5175 gene locus_tag LOCUS_32210 5648 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 5862 5641 gene locus_tag LOCUS_32220 gene pspB 5862 5641 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388972.1 protein_id gnl|my_center|LOCUS_32220 6546 5875 gene locus_tag LOCUS_32230 6546 5875 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_32230 6783 7850 gene locus_tag LOCUS_32240 gene pspF 6783 7850 CDS product psp operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37344 protein_id gnl|my_center|LOCUS_32240 8427 10322 gene locus_tag LOCUS_32250 8427 10322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_32250 10333 10809 gene locus_tag LOCUS_32260 10333 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 11483 11028 gene locus_tag LOCUS_32270 11483 11028 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 protein_id gnl|my_center|LOCUS_32270 11847 12293 gene locus_tag LOCUS_32280 11847 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 13288 12332 gene locus_tag LOCUS_32290 gene yyaM 13288 12332 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206550.1 protein_id gnl|my_center|LOCUS_32290 13688 15835 gene locus_tag LOCUS_32300 gene fadB 13688 15835 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_32300 15860 17035 gene locus_tag LOCUS_32310 gene fadA 15860 17035 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA1 protein_id gnl|my_center|LOCUS_32310 17787 18854 gene locus_tag LOCUS_32320 17787 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 18956 19162 gene locus_tag LOCUS_32330 18956 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 19307 19131 gene locus_tag LOCUS_32340 19307 19131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence33 3094 179 gene locus_tag LOCUS_32350 3094 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3913 3209 gene locus_tag LOCUS_32360 gene prpB 3913 3209 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_32360 6258 4399 gene locus_tag LOCUS_32370 gene glnS 6258 4399 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD86 protein_id gnl|my_center|LOCUS_32370 6328 7179 gene locus_tag LOCUS_32380 6328 7179 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_32380 7304 7813 gene locus_tag LOCUS_32390 gene msrA 7304 7813 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCY5 protein_id gnl|my_center|LOCUS_32390 7899 8387 gene locus_tag LOCUS_32400 7899 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 8392 9924 gene locus_tag LOCUS_32410 8392 9924 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_32410 9961 10932 gene locus_tag LOCUS_32420 9961 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 10929 12149 gene locus_tag LOCUS_32430 10929 12149 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_32430 12182 12463 gene locus_tag LOCUS_32440 12182 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_32440 12460 13869 gene locus_tag LOCUS_32450 12460 13869 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974755.1 protein_id gnl|my_center|LOCUS_32450 13887 14495 gene locus_tag LOCUS_32460 13887 14495 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528278.1 protein_id gnl|my_center|LOCUS_32460 14488 15249 gene locus_tag LOCUS_32470 14488 15249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_32470 15271 16479 gene locus_tag LOCUS_32480 15271 16479 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_32480 16476 17453 gene locus_tag LOCUS_32490 16476 17453 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_32490 17467 18270 gene locus_tag LOCUS_32500 17467 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 18454 18302 gene locus_tag LOCUS_32510 18454 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 18527 18961 gene locus_tag LOCUS_32520 18527 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence34 1131 85 gene locus_tag LOCUS_32530 1131 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1835 1242 gene locus_tag LOCUS_32540 1835 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2532 1840 gene locus_tag LOCUS_32550 2532 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205686.1 protein_id gnl|my_center|LOCUS_32550 2930 2529 gene locus_tag LOCUS_32560 2930 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_32560 3759 3028 gene locus_tag LOCUS_32570 3759 3028 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317503.1 protein_id gnl|my_center|LOCUS_32570 5795 3762 gene locus_tag LOCUS_32580 5795 3762 CDS product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283927.1 protein_id gnl|my_center|LOCUS_32580 5767 5925 gene locus_tag LOCUS_32590 5767 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 6469 5900 gene locus_tag LOCUS_32600 6469 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 7022 6456 gene locus_tag LOCUS_32610 7022 6456 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741281.1 protein_id gnl|my_center|LOCUS_32610 7721 7026 gene locus_tag LOCUS_32620 7721 7026 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267030.1 protein_id gnl|my_center|LOCUS_32620 8115 7861 gene locus_tag LOCUS_32630 8115 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 8609 8115 gene locus_tag LOCUS_32640 8609 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946737.1 protein_id gnl|my_center|LOCUS_32640 9592 8726 gene locus_tag LOCUS_32650 9592 8726 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946714.1 protein_id gnl|my_center|LOCUS_32650 11008 10583 gene locus_tag LOCUS_32660 11008 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 11616 11101 gene locus_tag LOCUS_32670 11616 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 12149 11721 gene locus_tag LOCUS_32680 12149 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 13442 12339 gene locus_tag LOCUS_32690 13442 12339 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688504.1 protein_id gnl|my_center|LOCUS_32690 14613 13873 gene locus_tag LOCUS_32700 14613 13873 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_32700 16065 14812 gene locus_tag LOCUS_32710 16065 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267073.1 protein_id gnl|my_center|LOCUS_32710 16657 16055 gene locus_tag LOCUS_32720 16657 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 18029 16644 gene locus_tag LOCUS_32730 18029 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence35 2280 181 gene locus_tag LOCUS_32740 gene fusA1 2280 181 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L45 protein_id gnl|my_center|LOCUS_32740 2817 2347 gene locus_tag LOCUS_32750 gene rpsG 2817 2347 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X5 protein_id gnl|my_center|LOCUS_32750 3291 2917 gene locus_tag LOCUS_32760 gene rpsL 3291 2917 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_32760 7735 3509 gene locus_tag LOCUS_32770 gene rpoC 7735 3509 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_32770 11872 7799 gene locus_tag LOCUS_32780 gene rpoB 11872 7799 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_32780 12443 12069 gene locus_tag LOCUS_32790 gene rplL 12443 12069 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC8 protein_id gnl|my_center|LOCUS_32790 13005 12511 gene locus_tag LOCUS_32800 gene rplJ 13005 12511 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KQ2 protein_id gnl|my_center|LOCUS_32800 13900 13205 gene locus_tag LOCUS_32810 gene rplA 13900 13205 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_32810 14334 13900 gene locus_tag LOCUS_32820 gene rplK 14334 13900 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_32820 14960 14430 gene locus_tag LOCUS_32830 gene nusG 14960 14430 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_32830 15344 14973 gene locus_tag LOCUS_32840 gene secE 15344 14973 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN1 protein_id gnl|my_center|LOCUS_32840 15474 15399 gene locus_tag LOCUS_t00430 15474 15399 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15675 16103 gene locus_tag LOCUS_32850 gene ypeA 15675 16103 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence36 229 1149 gene locus_tag LOCUS_32860 229 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1291 2334 gene locus_tag LOCUS_32870 1291 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2334 2867 gene locus_tag LOCUS_32880 2334 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2851 3720 gene locus_tag LOCUS_32890 2851 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3955 4257 gene locus_tag LOCUS_32900 3955 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 4267 4497 gene locus_tag LOCUS_32910 4267 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 4757 4972 gene locus_tag LOCUS_32920 4757 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 5008 5388 gene locus_tag LOCUS_32930 5008 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 5360 6034 gene locus_tag LOCUS_32940 5360 6034 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319098.1 protein_id gnl|my_center|LOCUS_32940 6034 6912 gene locus_tag LOCUS_32950 6034 6912 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058700.1 protein_id gnl|my_center|LOCUS_32950 6931 8367 gene locus_tag LOCUS_32960 6931 8367 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095175.1 protein_id gnl|my_center|LOCUS_32960 8312 8770 gene locus_tag LOCUS_32970 8312 8770 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458656.1 protein_id gnl|my_center|LOCUS_32970 8780 11500 gene locus_tag LOCUS_32980 8780 11500 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_32980 12339 11512 gene locus_tag LOCUS_32990 12339 11512 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_32990 12501 12938 gene locus_tag LOCUS_33000 12501 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 12938 13960 gene locus_tag LOCUS_33010 12938 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638462.2 protein_id gnl|my_center|LOCUS_33010 13957 15297 gene locus_tag LOCUS_33020 13957 15297 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence37 3065 12 gene locus_tag LOCUS_33030 3065 12 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889695.1 protein_id gnl|my_center|LOCUS_33030 3372 3187 gene locus_tag LOCUS_33040 3372 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3829 3287 gene locus_tag LOCUS_33050 3829 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 4523 3819 gene locus_tag LOCUS_33060 4523 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485361.1 protein_id gnl|my_center|LOCUS_33060 5703 4531 gene locus_tag LOCUS_33070 5703 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 7057 5708 gene locus_tag LOCUS_33080 7057 5708 CDS product type I restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901210.1 protein_id gnl|my_center|LOCUS_33080 9491 7065 gene locus_tag LOCUS_33090 9491 7065 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_33090 10433 9543 gene locus_tag LOCUS_33100 10433 9543 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence38 96 320 gene locus_tag LOCUS_33110 96 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 422 706 gene locus_tag LOCUS_33120 422 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 804 1040 gene locus_tag LOCUS_33130 804 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1109 1426 gene locus_tag LOCUS_33140 1109 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3671 1449 gene locus_tag LOCUS_33150 gene priA 3671 1449 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_33150 3795 4007 gene locus_tag LOCUS_33160 gene rpmE 3795 4007 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_33160 4180 4701 gene locus_tag LOCUS_33170 4180 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5372 4725 gene locus_tag LOCUS_33180 5372 4725 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_33180 6819 5383 gene locus_tag LOCUS_33190 6819 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202021.1 protein_id gnl|my_center|LOCUS_33190 7426 6851 gene locus_tag LOCUS_33200 7426 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 8035 7538 gene locus_tag LOCUS_33210 8035 7538 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_33210 8209 8748 gene locus_tag LOCUS_33220 gene hslV 8209 8748 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_33220 8745 10085 gene locus_tag LOCUS_33230 gene hslU 8745 10085 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y9A6 protein_id gnl|my_center|LOCUS_33230 >Feature sequence39 1027 497 gene locus_tag LOCUS_33240 1027 497 CDS product hypothetical phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703771.1 protein_id gnl|my_center|LOCUS_33240 2111 1014 gene locus_tag LOCUS_33250 2111 1014 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_33250 4328 2139 gene locus_tag LOCUS_33260 gene uvrD 4328 2139 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_33260 4437 5294 gene locus_tag LOCUS_33270 4437 5294 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_33270 5417 5593 gene locus_tag LOCUS_33280 5417 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 6966 5692 gene locus_tag LOCUS_33290 gene amtB 6966 5692 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_33290 7350 7012 gene locus_tag LOCUS_33300 gene glnK 7350 7012 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_33300 8084 7416 gene locus_tag LOCUS_33310 8084 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_33310 8430 8666 gene locus_tag LOCUS_33320 8430 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 8794 9693 gene locus_tag LOCUS_33330 8794 9693 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence40 808 95 gene locus_tag LOCUS_33340 gene flgF 808 95 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F0 protein_id gnl|my_center|LOCUS_33340 2889 805 gene locus_tag LOCUS_33350 gene flhA 2889 805 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35620 protein_id gnl|my_center|LOCUS_33350 3959 2886 gene locus_tag LOCUS_33360 3959 2886 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477705.1 protein_id gnl|my_center|LOCUS_33360 4724 3972 gene locus_tag LOCUS_33370 4724 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 5002 4739 gene locus_tag LOCUS_33380 5002 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 5439 5197 gene locus_tag LOCUS_33390 5439 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 5576 5809 gene locus_tag LOCUS_33400 5576 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 5802 7004 gene locus_tag LOCUS_33410 5802 7004 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479712.1 protein_id gnl|my_center|LOCUS_33410 6997 7242 gene locus_tag LOCUS_33420 6997 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 7242 8171 gene locus_tag LOCUS_33430 7242 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 8341 8742 gene locus_tag LOCUS_33440 8341 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 8956 9264 gene locus_tag LOCUS_33450 8956 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 9276 9746 gene locus_tag LOCUS_33460 9276 9746 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence41 323 2017 gene locus_tag LOCUS_33470 323 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063681.1 protein_id gnl|my_center|LOCUS_33470 2313 3506 gene locus_tag LOCUS_33480 2313 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3516 4583 gene locus_tag LOCUS_33490 3516 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4580 5521 gene locus_tag LOCUS_33500 4580 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103175.1 protein_id gnl|my_center|LOCUS_33500 5518 6390 gene locus_tag LOCUS_33510 5518 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103174.1 protein_id gnl|my_center|LOCUS_33510 7008 8339 gene locus_tag LOCUS_33520 7008 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence42 121 981 gene locus_tag LOCUS_33530 gene wapR 121 981 CDS product alpha-1,3-rhamnosyltransferase WapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_33530 2114 1002 gene locus_tag LOCUS_33540 2114 1002 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_33540 2575 2111 gene locus_tag LOCUS_33550 2575 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2964 2572 gene locus_tag LOCUS_33560 2964 2572 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_33560 3833 2961 gene locus_tag LOCUS_33570 gene rffH 3833 2961 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI75 protein_id gnl|my_center|LOCUS_33570 4897 3830 gene locus_tag LOCUS_33580 gene rffG 4897 3830 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_33580 >Feature sequence43 286 417 gene locus_tag LOCUS_33590 286 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 674 468 gene locus_tag LOCUS_33600 674 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 999 697 gene locus_tag LOCUS_33610 999 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1234 1073 gene locus_tag LOCUS_33620 1234 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 1332 1886 gene locus_tag LOCUS_33630 1332 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2148 3749 gene locus_tag LOCUS_33640 2148 3749 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_33640 3762 4124 gene locus_tag LOCUS_33650 3762 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence44 1295 1525 gene locus_tag LOCUS_33660 1295 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3087 1522 gene locus_tag LOCUS_33670 3087 1522 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038855.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence45 619 1140 gene locus_tag LOCUS_33680 619 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1211 1567 gene locus_tag LOCUS_33690 1211 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2396 2761 gene locus_tag LOCUS_33700 2396 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence46 >Feature sequence47 1097 930 gene locus_tag LOCUS_33710 1097 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 2058 1261 gene locus_tag LOCUS_33720 2058 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence48 1056 877 gene locus_tag LOCUS_33730 1056 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1436 1053 gene locus_tag LOCUS_33740 1436 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1867 1565 gene locus_tag LOCUS_33750 1867 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence49 1042 29 gene locus_tag LOCUS_33760 1042 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1548 1135 gene locus_tag LOCUS_33770 1548 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence50 162 1442 gene locus_tag LOCUS_33780 162 1442 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33780 >Feature sequence51 521 246 gene locus_tag LOCUS_33790 521 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence52 797 123 gene locus_tag LOCUS_33800 gene ymfK 797 123 CDS product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859460.1 protein_id gnl|my_center|LOCUS_33800 881 1180 gene locus_tag LOCUS_33810 881 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1170 1412 gene locus_tag LOCUS_33820 1170 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence53 >Feature sequence54 894 568 gene locus_tag LOCUS_33830 894 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence55 1062 94 gene locus_tag LOCUS_33840 1062 94 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence56 321 1127 gene locus_tag LOCUS_33850 321 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence57 >Feature sequence58 3 1170 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcttagctgcctgtgcggcagccaac >Feature sequence59 >Feature sequence60 343 32 gene locus_tag LOCUS_33860 343 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 1082 831 gene locus_tag LOCUS_33870 1082 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence61 >Feature sequence62 759 950 gene locus_tag LOCUS_33880 759 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence63 >Feature sequence64 >Feature sequence65 355 978 gene locus_tag LOCUS_33890 355 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence66 >Feature sequence67