COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..71728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1041..3401) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3729..4703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 4700..5458 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(5599..6054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6421..6819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6849..8216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8377..10188) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene aepA CDS complement(10399..10929) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10942..12345) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(12342..12797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12802..13287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13312..14070) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(14211..14984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(15328..17262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17361..17756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17763..18239) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18544..24909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 25044..25799 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(25796..25990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 26360..29059 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107962.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 29264..30601 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene xylE CDS 30699..33395 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 33495..35093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(35197..35598) product flavin-containing amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(35606..36052) product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(36070..36534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 36757..38004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 38080..39144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 39148..39447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(39489..40313) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 40417..41214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 41214..42026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 42023..44074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 44289..44504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(44955..45251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 tRNA complement(45285..45361) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(45539..46369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(46432..48054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(48126..48425) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(48422..49048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(49134..49640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(49648..50988) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene pyrC1 CDS 51157..52464 product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 52509..53426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(53499..54440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(54554..56059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 56222..59128 product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene gcvP CDS 59294..59614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(59717..60454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(60451..61590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(61625..61852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(62616..63497) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene lipA CDS complement(63566..64285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 64400..64750 product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene osmC CDS complement(64816..65493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(65535..67214) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 67316..68554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 68669..68890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 69068..70810 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 70814..71434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 sequence002 source 1..69363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 415..672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 722..973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(1140..2099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(2466..2936) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(2994..3272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(3330..3572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 note possible pseudo, internal stop codon CDS complement(3576..4226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(4231..4608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 4721..6223 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 6318..6752 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 6781..7125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 7317..8567 product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rpoE CDS 8867..9289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 9390..9908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 9901..10323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 10328..11197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 11218..11706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 11703..12311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(12443..13192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 13298..13801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 13849..14319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 14339..14755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 14776..15627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 15624..16289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(17101..18072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 18224..18631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(18657..19763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(20193..22352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 22798..24024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 24026..25231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 25253..25504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 25658..27682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 27704..28315 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene bioD CDS 28308..29594 product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene bioA CDS 29770..30501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(30534..31664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 32045..35134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(35166..36191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(36212..37189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(37374..37859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(37934..38206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(38344..38583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(38594..39130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(39275..40462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(40512..41579) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(41650..42066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(42137..42496) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 42601..43248 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(43462..44019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(44158..44769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 45432..46193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(46450..46782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(46942..47805) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(47949..48344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(48345..48791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(48805..49281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(49403..50092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(50174..50812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(51096..52442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(52475..53122) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(53249..53800) product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(54016..55989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(56098..57432) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene bfmBB CDS complement(57509..58756) product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(58918..60087) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene metZ CDS 60385..60813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 60970..61347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(61349..61666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 61792..62580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(62800..64038) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene fabF CDS complement(64035..64631) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 64714..65256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(65253..65537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 65621..68005 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(68016..69053) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 sequence003 source 1..61711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 814..2121 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 2126..3091 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(3093..3953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(3955..4974) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene pheS CDS 5058..6071 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene galE CDS 6186..7499 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 7499..8482 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 8524..9930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(9931..11310) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene wcaJ CDS complement(11404..12843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 13174..13833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 13830..14510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 14507..16192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(16210..17265) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(17293..18069) product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene wecG CDS complement(18062..19204) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(19201..20346) product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(20343..21764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(21761..22663) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(22670..23692) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 23899..24684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(24671..25909) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rfbX CDS complement(26022..27092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(27097..29661) product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(29761..30888) product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 31002..32051 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene rmlB CDS 32048..32596 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene rfbC CDS 32603..33466 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rfbA CDS complement(33816..35267) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(35341..35625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(35831..36721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(36749..37750) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(37767..38759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(38759..39526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(39553..40641) product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rgpA CDS complement(40644..41549) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(41614..42600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(42597..43388) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(43474..44403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 45354..45701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(45759..46934) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(47011..48045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(48303..50879) product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(51082..51831) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(51828..52856) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJA1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene fcl CDS complement(52849..53958) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene gmd CDS complement(54286..55488) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(55489..56574) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(56564..58171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(58161..60281) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 misc_feature complement(60286..>61711) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222482.1:asparagine synthetase B locus_tag LOCUS_01870 sequence004 source 1..58560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 49..903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 911..1696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 1718..2707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 2842..3480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(3512..4516) product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 4593..5003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(5043..5849) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(5953..6951) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(7000..7773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 8013..8810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 8900..9514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 9520..10653 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(10751..11563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 11889..12464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(12522..13604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(13669..13974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(14214..14657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(14660..16414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(16419..17603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(17600..18877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(18874..19581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(19578..23327) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(23396..23767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(23850..24347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(24442..25011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(25094..25543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(25614..26171) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(26174..27334) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(27309..29036) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 29176..29961 product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene dnrN CDS 29961..30374 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 30376..30930 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene def CDS 30934..31347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 31546..31869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 31902..34520 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(34671..35507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 35740..37419 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(37491..38939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(38936..39382) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(39420..40301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(40285..40989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(41088..41360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(41360..41641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(42012..43958) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(43962..44357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(44357..45157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(45159..46187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(46184..46636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(46633..46848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(46841..48067) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(48094..49707) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(49806..50498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 50995..51750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(51962..52591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(52597..53166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(53172..53699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(53743..54084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(54229..54786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(54845..55831) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(55907..56857) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(56974..58140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 sequence005 source 1..55229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..1188 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 1406..2617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 2648..3466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 3518..5095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 5109..6101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(6134..7942) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene uvrC CDS complement(7942..10278) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene mrcA CDS complement(10284..12863) product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene sprE CDS 12968..13822 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 13848..14276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(14273..15358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(15355..16380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 16565..16759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 16792..17205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 17202..18305 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene atpB CDS 18358..18591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 18680..19174 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene atpF CDS 19184..19741 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene atpH CDS 19773..21347 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene atpA CDS 21391..22266 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene atpG CDS 22330..23142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 23139..23759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(23756..29434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(29704..36594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(36965..43306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(43505..50254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(50467..51615) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(51709..53805) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(53826..54377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 sequence006 source 1..54607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 219..575 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 640..1362 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene hisA CDS 1474..2235 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene hisF CDS 2232..2846 product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene hisI CDS 2900..3760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 3987..4763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 4876..5682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 5698..6612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 6888..7280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 7612..7878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 8133..9944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(10331..12130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(12797..14245) product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 14398..16539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 16727..16942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 16956..17720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(17724..18248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 18386..18775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 18778..21342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(21471..32021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(32071..39381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(39956..41434) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(41447..44515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 44707..46053 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(46136..46594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(46600..47904) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene dacB CDS complement(48207..48902) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 48843..49010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(49007..49570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(49644..50441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(50494..52602) product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(52734..53891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 sequence007 source 1..52794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3232 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C locus_tag LOCUS_03110 CDS 3234..4844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 5097..7199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 7196..9301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(9318..11327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 11585..12310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(12490..12888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 13604..34588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 34600..36228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(36112..36384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(36394..36774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(37105..37401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 37584..38114 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(38132..39136) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene lldD CDS complement(39426..40736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(40902..41099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 41416..42462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(42513..43490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 43995..44183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 44173..45438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 45435..46193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 46197..49280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 49488..49799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 50034..51101 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 sequence008 source 1..50801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..819) product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene satA CDS complement(934..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 2743..3876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(3854..4786) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(4783..5118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(5186..5587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(5690..6277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(6306..6908) product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(6922..7407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(7388..7795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(7980..8588) product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(8536..9222) product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(9437..11947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(11953..12240) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF4 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene gatC CDS complement(12237..12968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(13091..13747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(13782..14426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 14502..14714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(14716..15390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(15437..15823) product oxygen-binding heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene glbN CDS complement(15905..17155) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(17152..18474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene yqeZ CDS 18623..19396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 19400..20323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 20573..22105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 22242..22427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 22586..24148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 24514..24750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 24908..25516 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(25889..26521) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene pyrE CDS 26638..27324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(27312..27767) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYU5 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene coaD CDS complement(27790..28656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(28661..29251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(29330..29821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 29867..30325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 30328..31728 product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 32017..33813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 33841..37437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(37669..38091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(38135..38809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(39006..39320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(39330..40304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(40326..40703) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(40707..41387) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 41518..43071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 43076..43714 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 43714..44319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(44501..45550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(45543..46403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(46432..47313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 47488..47850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 47850..50234 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene mutS2 CDS complement(50303..50572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 sequence009 source 1..49376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(469..762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(826..2475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 tRNA 2960..3034 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(3234..3956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(4326..4886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(5101..5697) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene azoR CDS 5891..6241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(6481..7125) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(7132..7425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(7418..8320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(8386..9057) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene dhlB CDS complement(9054..9566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(9591..10580) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(10603..12078) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(12120..12851) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 13182..13754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(13941..14393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(14481..15467) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene gap CDS complement(15745..19344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(19348..21540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(21537..23327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 23776..24471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 24468..24848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 25106..25849 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 25924..27639 product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(27652..30333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(30545..33268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(33333..34502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene ycaQ CDS complement(34518..35765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(35762..38038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 38327..40381 product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 40394..41008 product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene kptA CDS 41018..41653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 41714..42646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 42732..43532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 43583..44491 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 44667..45896 product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(45893..48733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 misc_feature complement(48730..>49376) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64UE7:DNA helicase locus_tag LOCUS_04260 sequence010 source 1..47250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..4407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(4843..5256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 5338..5844 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPM8 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene aroK CDS 5875..7293 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(7301..9931) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(9934..10266) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 10388..11317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(11581..12984) product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene gndA CDS 13114..14643 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene zwf CDS 14666..15373 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 15431..15793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 16044..19226 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(19296..19874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(20035..20670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(20681..23563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(23805..24722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(24812..27472) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(27469..27801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(27923..30562) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(30572..30910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 31239..31868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 32090..32668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 32799..33533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 33643..36315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(36518..37165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 37446..38090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 38213..38575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(38657..40768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(40983..41381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(41769..42146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(42443..43222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 43513..44574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 44707..46170 product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 46247..47110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 sequence011 source 1..45423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..1558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 1555..2289 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 2297..2713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 2771..4006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 note possible pseudo, internal stop codon CDS complement(4003..4698) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(4707..6197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(6204..7148) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 7238..8251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 8332..9867 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(9925..10452) product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S70 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(10449..11621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(11882..15196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(15339..15713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(15878..18289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(18443..19414) product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene irk CDS 19544..19981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 19991..20368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 20365..22734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 22898..23527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 23541..23921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 23935..24768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 24773..25243 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 25240..27126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(27489..30032) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(30165..30656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(30786..31979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 32095..32583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 32659..33042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(33103..34287) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 34567..35307 product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene fabG CDS 35318..36304 product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 36378..37835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 37804..39303 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 39393..40262 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 40270..41706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 41990..44458 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 misc_feature complement(44736..>45423) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259450.1:potassium transporter TrkA locus_tag LOCUS_04970 sequence012 source 1..44267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4474..8073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(8115..12497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 tRNA complement(13210..13286) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(13323..13748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 13925..14596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 14593..15195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 15208..15813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(15913..16413) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(16463..17011) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(17311..19242) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YW6 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene dnaK CDS 19433..20644 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 20635..21345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 21459..22868 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 23019..23942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 24224..26575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 26575..28023 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 28023..29057 product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene pam CDS 29054..29833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 29833..31944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 32043..32954 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(32976..35579) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(35606..38206) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(38213..38548) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 38765..40294 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(40434..43346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 sequence013 source 1..42626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(1769..2323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(2346..3233) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 3796..4788 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 4826..6079 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 6084..9209 product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 9478..9678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 10473..11414 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 11546..12466 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 12658..13143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 13271..15202 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 15492..16622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 16633..16923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 16993..17250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 17422..18024 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 18180..18794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 18815..19270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 19267..19803 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 19826..20095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 20074..20595 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 20673..21497 product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 21827..23740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 23737..24474 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 24696..25073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 25076..29239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(29361..30071) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(30064..31746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 31959..34457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 34536..36929 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 37562..38764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 38799..38993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(39069..39437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 39894..40481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 misc_feature complement(40780..>42626) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG locus_tag LOCUS_05550 sequence014 source 1..42402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..2253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 2817..3317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 3861..4142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 4143..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(4580..5296) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene lspA CDS complement(5311..8616) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene ileS CDS complement(8629..11076) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(11163..12485) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene dgt CDS 12961..15900 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 15913..17409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 17566..20826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 20823..21407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 21429..24740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 24858..28043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 28148..30841 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 30938..32956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 33095..36223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 36279..37628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 37939..39633 product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 39636..41129 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHZ9 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene glpK sequence015 source 1..41883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4056..4868) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 4983..5843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(5844..7157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(7161..8144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(8152..9153) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 9253..10173 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene rbsK CDS 10179..11189 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(11281..11931) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(12005..13177) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(13179..13724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(13845..14948) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 15190..16656 product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 16747..17763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 17878..18597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(19007..19186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 19550..23317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 23310..26411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 26431..33477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 33519..35237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 35556..37265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 37432..39144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 39296..41041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 sequence016 source 1..40629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 1541..2098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(2102..3289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 3862..4035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 4121..5977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 5987..6754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(6767..7711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(7886..8470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 8708..10798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 10803..11867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 12392..15157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 15168..17513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 17527..21420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 21517..23025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 23252..24874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 24933..26546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 26602..28230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 28280..30004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(30260..30733) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMH2 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene greB CDS complement(30851..31966) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene ampH CDS 32087..32779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 33122..34075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 34142..35737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(36586..37374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(37371..37832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 tRNA complement(38058..38131) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 38297..39112 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene era CDS 39172..40479 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene der sequence017 source 1..40279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1362..1907 product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene pyrR1 CDS 1904..2833 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene pyrB CDS 2840..3811 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene ybcH CDS 3992..5368 product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(5487..6614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(7393..8568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(8706..9434) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 9713..10519 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene murI CDS 10733..11830 product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK94 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ndhA CDS 11827..12939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 12940..13467 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ndhG CDS 13457..13759 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene nuoK CDS 13756..15894 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ndhF CDS 15903..17609 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ndhD CDS 17615..19117 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB3 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ndhB CDS 19127..21013 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene purF CDS 21061..21399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(21758..22084) product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene sufA CDS complement(22084..22506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 22631..23032 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 23109..24140 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene thiL CDS complement(24610..25395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 25455..26312 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(26305..26604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(26670..27035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(27183..29756) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(29746..30078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(30348..31661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 31849..32055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(32217..32555) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(32557..33561) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(33681..34283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(34280..34912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(34906..35148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(35150..35410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(35456..36184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 36345..37121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(37169..37579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(37622..38374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 sequence018 source 1..39135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 975..1517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 2538..2873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 2904..3680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 3982..5553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 tRNA complement(5513..5587) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(5606..5691) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(5695..5937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(6193..7137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene yfkH CDS complement(7127..7537) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(7540..8553) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 8624..9247 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 9281..9907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 10013..12571 product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene clpC CDS complement(12654..13412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(13429..13638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 13775..13987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(14455..15597) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(15875..16378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(16427..17428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(18072..19256) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene mauG CDS complement(19338..19868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(19868..20206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(20259..20834) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(20949..21386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 21721..22278 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(22280..22927) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(22924..23223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(23290..24267) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(24299..24880) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(24962..25714) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(25826..26146) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(26172..27407) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 27438..28601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(28653..29249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(29246..30598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(30620..31057) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z8 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene ssb-2 CDS complement(31097..32152) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene mutY CDS 32310..32612 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 32630..33448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 33752..35188 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene cafA CDS complement(35267..36883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 misc_feature complement(36885..>39135) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_07040 sequence019 source 1..38350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2726..5356) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(5598..8156) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(8350..8691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(8853..9458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 9623..10432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 10522..11772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 11769..12698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 12973..16215 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K6 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(16888..17391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 17665..17970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(17978..18529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(18582..18833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 18741..19610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 19676..20074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 20127..20498 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(20522..20980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(20988..21257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(21382..22155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(22240..23109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(23169..24311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 24479..24937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 25049..26167 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene hisC CDS complement(26176..27648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(28054..28212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(28281..29879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(30171..32708) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(32802..35462) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(35466..35786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(35966..36808) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene menB CDS complement(36869..37507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(37577..38347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence020 source 1..37373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..2856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 2859..3290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 3335..4645 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rimO CDS 4764..6350 product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene bshC CDS 6343..6915 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene ygfA CDS complement(7132..10830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(10848..11132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(11317..11997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(11997..12473) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y7 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene ispF CDS complement(12495..13811) product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 13910..15799 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene bfmBA CDS 15818..16186 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ytxJ CDS 16220..17017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 18334..20118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(20119..20868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 20925..21476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 21547..21798 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene rpsT CDS 21926..22594 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene radC CDS 22658..23275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 23348..25762 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene pheT CDS 25762..26058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 26069..26359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 26417..27985 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rny CDS 28151..28564 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(28583..29194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(29198..29644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(29641..29979) product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene ywzG CDS complement(30286..31161) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene sucD CDS complement(31488..32369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 32548..34002 product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 34002..34730 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 34748..35416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 35489..36166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 sequence021 source 1..37309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 381..1397 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene czcB CDS 1402..4443 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(4499..4975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(4977..6131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(6198..6419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(7263..8453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(8551..9693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 10102..11997 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9B8 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene htpG CDS 12252..13226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 13378..15879 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(15912..16742) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(17192..18025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(18139..18966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(18966..21620) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(21629..21940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 22132..22542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 22619..23698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 23695..24447 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(24449..25474) product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(25481..26668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(26815..28104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(28242..28595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(28708..32694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 33222..33713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 33744..35561 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 35574..36674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(36743..36994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 sequence022 source 1..37225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(902..1984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(2172..12329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 12841..13830 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 14102..15670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 15764..18652 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene fecA CDS 18966..19871 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 19959..20663 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 20671..21327 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(21324..22604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(22670..23317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(23350..25995) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(26021..27001) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(27059..27631) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 27784..28401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 28398..28706 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 28749..29753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 30397..33204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 33201..34607 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 sequence023 source 1..36868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(703..1365) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene psd CDS complement(1382..2659) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene gdhA CDS complement(2744..3556) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(3553..3723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(3698..4690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 4726..5721 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 5721..6599 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene fjo11 CDS 6752..7588 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(7585..8436) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 8602..11001 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(11047..11238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(11241..11687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(11720..12283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(12362..12940) product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(12961..13722) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 13849..17943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 17948..23110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(23220..24692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(24770..26128) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(26169..28589) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(28747..29769) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 30201..31265 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(31316..33895) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(34080..35063) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene pfkA CDS complement(35202..35771) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 misc_feature complement(35823..>36868) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter locus_tag LOCUS_08400 sequence024 source 1..36195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1473..2252) product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene nagD CDS complement(2268..3221) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(3279..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(3997..4767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(4829..6121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(6114..6668) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(6801..7541) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 7616..10714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(10947..13349) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 13625..14086 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 14201..16594 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 16681..17490 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 17602..18753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(18850..21075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(21252..22907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 23129..24436 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 24550..26919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 27015..27485 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 27588..29729 product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(29734..30039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 30114..30764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 30810..31256 product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene crtZ CDS 31263..32168 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 32614..33126 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 33137..34612 product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene crtI CDS 34646..35482 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene crtB sequence025 source 1..35728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 471..1034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 1037..1777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(1770..4922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 5140..7746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 7976..9619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 9899..11266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 11539..12918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 12975..16418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 16418..21763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 21967..23178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 23399..23740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 23737..26325 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 26703..31160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 31351..33714 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 34053..35504 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 sequence026 source 1..35628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3456..13079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 13367..17452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(17546..17947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(19031..19627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 20101..21345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 21575..23413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(23445..24866) product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 25036..25443 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene ygcM CDS 25406..26098 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene folE2 CDS 26104..26799 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 26801..27424 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(27421..27777) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(27774..28076) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(28066..28383) product addiction module antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 28591..29391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 29649..30686 product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 30877..33069 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(33136..33687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(33872..34489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(34573..34929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(34942..35217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 sequence027 source 1..35610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2526..2993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 3230..3628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(3737..5137) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene lpdA1 CDS complement(5169..6695) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene sucB CDS complement(6709..9450) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene sucA CDS 9733..10017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 10014..11144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 11147..11353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 11456..12529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 12690..13196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 13200..13742 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene rimM CDS 13739..14419 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene trmD CDS 14507..14866 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M2 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rplS CDS 14975..15400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 15752..16525 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene dapF CDS 16631..19984 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene secA CDS 19998..20501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 20501..21694 product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(21680..22678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 22967..24574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 24616..24960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 24960..25313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 25294..26058 product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene pcrB CDS complement(26044..26967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(27103..28242) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(28403..29092) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(29100..29579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(29524..30570) product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(30577..30924) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene panD CDS complement(30953..31801) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene panC CDS 31932..32744 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 32728..34029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 sequence028 source 1..35091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..312 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene rpmA CDS complement(597..2021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(2125..3627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(3630..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(4435..5046) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene glpG CDS complement(5047..6021) product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(6014..8170) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene rnr CDS 8354..9592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(9593..10300) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(10806..11201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(11310..12422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(12419..13147) product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene lipB CDS complement(13182..13370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(13384..14373) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(14370..16022) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene pgi CDS 16096..16440 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(16437..17300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(17344..18348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(18345..21875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(22507..23742) product endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(23927..28000) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(28197..30518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(30523..31722) product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(31724..33130) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(33139..34338) product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 transl_table 11 codon_start 1 locus_tag LOCUS_09590 sequence029 source 1..34767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1271..1546) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene rpsO CDS complement(1616..3388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(3475..3870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 tRNA 4213..4287 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(4394..4738) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene rplT CDS complement(4833..5027) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rpmI CDS complement(5056..5601) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene infC CDS complement(5698..7581) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene thrS CDS complement(7788..10388) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(10404..11081) product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene trmH CDS complement(11195..12160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(12157..12450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(12457..15312) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene parC CDS complement(15374..15754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(15808..17676) product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene parE CDS complement(17821..18291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 18568..19800 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene erg3 CDS 19881..21116 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene erg3 CDS 21113..21484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(21750..22592) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 22725..23741 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 23870..24856 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 25023..25718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(25721..26398) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CI67 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene cutC CDS complement(26517..27791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(28209..28565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(28789..29019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 29164..29496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(29582..30028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(30018..31253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(31671..32057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(32057..33469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(33600..33983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 sequence030 source 1..34668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(478..1515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1680..2708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(2792..3538) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(3519..4442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(4508..5737) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(5851..6213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(6215..7231) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene murB CDS complement(7232..7687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(7684..9399) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 9685..10113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(10177..10893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(10959..11465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(11517..13406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(13471..15336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(15422..15934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(15980..16852) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 17063..17656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(17664..18449) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(18439..18900) product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene rnhA CDS complement(18973..19635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(19640..20041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(20090..20524) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene aroQ CDS 20517..21449 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene xerD CDS 21549..21914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(22015..23121) product cobalt/magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ31 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene corA CDS 23267..24313 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene pyrD CDS 24398..26950 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene ftsK CDS 26975..27613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 27614..28429 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene pyrF CDS 28452..29753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 30219..30851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 30949..31914 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837T2 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 31914..32777 product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene udp CDS complement(32780..33448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(33506..34108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 sequence031 source 1..34558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(926..1147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1253..1915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1923..2453) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene actD CDS complement(2456..3820) product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene actC CDS complement(3840..6944) product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene actB CDS complement(6976..8190) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene actA tRNA complement(9232..9303) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(9552..11528) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(11786..12319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(12346..12843) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(12840..13634) product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(13634..14101) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene smpB CDS complement(14105..14497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(14509..14823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(14829..15842) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene tsaD CDS 15842..20392 product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 20430..21740 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene phrB1 CDS 21809..22693 product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 22767..23639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(23827..25116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(25443..26225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(26231..27652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(28212..28430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 28762..30927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 31843..34293 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 sequence032 source 1..34257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2787..4958) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene dpp4 CDS complement(5041..6105) product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(6098..7351) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene dadA CDS complement(7354..8355) product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(8403..8762) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(8860..9816) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(9841..11409) product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene aldH CDS complement(11406..12320) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 12572..13432 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(13821..16436) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(16433..16765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(17511..17870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(18068..18427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 19341..21185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(21477..22799) product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene kmo CDS complement(22800..24080) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene kynU CDS complement(24077..24574) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJU0 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene ogt CDS complement(24571..25581) product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(25631..26002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(26050..26583) product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene haaO CDS 26673..27461 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 27463..28446 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 28450..29892 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 30340..30762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 31025..33433 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(33511..34125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 sequence033 source 1..34221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..802) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(811..3798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 3989..4615 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene dsbA CDS 4695..6866 product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(6908..9535) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(9525..9866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(9900..10367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(10384..12984) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(13144..15705) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(15970..18573) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(18566..18901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(19140..20129) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(20198..22813) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(22815..23153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(23390..26062) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(26059..26397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(26596..27657) product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(27829..30459) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(30456..30788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 31022..31270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 31267..31695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(31745..32305) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP0 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene frr CDS complement(32310..33020) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pyrH CDS complement(33035..33532) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene pycA tRNA 33863..33946 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 34025..34098 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 sequence034 source 1..33664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..974 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase locus_tag LOCUS_11010 CDS complement(1098..1442) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1593..2333 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 2346..2960 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 3049..3957 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(3954..4805) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene ghr CDS complement(4895..5758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 5972..8431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(8412..9140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(9208..9972) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(9972..11030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(11068..11751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(11864..12508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(12624..13235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(13402..13848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(13967..14545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(14655..16820) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(16956..17990) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 18262..19086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 19177..20193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 20373..20573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 20744..21262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 21265..21738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 21735..22259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 22423..23292 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 23403..24326 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 24360..25016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 25013..25474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(26104..28713) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(28713..29039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 29281..29925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 29922..30887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(31657..31842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 32240..32731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 32867..33427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 sequence035 source 1..33640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..926) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1091..2062 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 2040..2987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 3007..3699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 3696..4880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 4858..5850 product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 5850..7181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 7188..7595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 7628..8122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 8449..10449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 10442..11167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 11283..12476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 12646..13794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(13814..14920) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene fjo29 CDS complement(14999..15844) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 15921..16292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(16419..17723) product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene nqrF CDS complement(17979..19256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(19264..20325) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene metX CDS 21215..22633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 22630..23292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 23400..24173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 24282..25055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 25249..26535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 26582..27772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(27933..28196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 28326..28556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(28561..29340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(29576..30415) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene accD CDS 30604..31191 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 31195..32274 product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene fabH1 CDS 32491..32943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(32940..33182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 sequence036 source 1..32926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 877..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1529..2215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(2220..3740) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(3744..4841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 5005..5583 product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 5580..6380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 6447..7340 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 7531..7947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 8070..8672 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 8644..9417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 9417..11909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 11909..13408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(13600..14391) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(14425..15585) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(15604..18525) product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 18589..18945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 18962..20806 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene mutL CDS 20812..21600 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 21659..23092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 23092..24027 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(24036..26126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(26129..27184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(27322..29787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(30001..31047) product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rlmN CDS complement(31063..32100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(32178..32612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 sequence037 source 1..32761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1324 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW32:adenosylhomocysteinase locus_tag LOCUS_11960 CDS complement(1413..2216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(2220..2981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(2990..4648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67270 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(4645..5418) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 5479..6066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 6173..8593 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 8590..9615 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 9605..10312 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 10476..11456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 11628..12881 product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(13021..13191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(13497..14843) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene accC CDS complement(14896..15375) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene accB CDS complement(15392..15955) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene efp CDS complement(16002..17006) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene fabH3 CDS complement(17213..17404) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rpmF CDS complement(17441..18034) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(18145..18828) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(18842..20476) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(20563..20913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(20992..22020) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene pdxA CDS 22161..22889 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rsmA CDS 22877..24244 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene mgtE CDS 24244..25194 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 25333..25809 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene greA CDS 25811..26209 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 26287..26607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(26712..29300) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(29302..29634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(29772..30323) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ruvC CDS 30362..31525 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 31528..31782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 sequence038 source 1..32631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..1180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1254..1772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 2281..3834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 3948..4979 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 4976..6034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 6031..6810 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(6813..8222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(8321..11296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(11293..12420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(12425..12922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 13242..13391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 13513..13911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 13990..15090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 15224..16093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 16090..16917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(16929..18242) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(18232..19548) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 19710..22130 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 22364..23962 product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(23959..25194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 25343..25948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(26155..26745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(26763..27515) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(27496..28560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(28564..29436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(29442..31790) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 sequence039 source 1..32440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(266..976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1081..1866) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(2099..4279) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene pepX1 CDS 4390..4695 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(4926..5699) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(5686..7623) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene dxs CDS 7773..8525 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene scpA CDS 8522..9568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 9678..13241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(13286..13705) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene ndk CDS 13902..14927 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene fjo19 CDS 14924..15796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 15811..16299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 16384..16965 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG2 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 16992..17615 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene udk CDS 17658..18017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 18093..21152 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 21352..22644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(22885..24369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 24733..25257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(25574..26482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(26489..28405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(28795..30264) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene guaB CDS complement(30406..30834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(30837..31292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(31298..32356) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 sequence040 source 1..32140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..1060) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene nadK CDS complement(1071..1736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1733..2497) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene pcbD CDS complement(2526..3092) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(3093..3617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(3622..4074) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 4221..4934 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene pdxJ CDS 4935..5696 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 5693..6409 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 6484..7737 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene metK CDS 7821..9575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(9665..9961) product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(9988..10890) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene xerC CDS complement(10953..11147) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene rpsU CDS complement(11471..12616) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(12800..13798) product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 13954..14424 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N5 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene rimP CDS 14430..15674 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene nusA CDS 15715..18525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(18766..19983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(19994..21112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(21313..22476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(22564..23751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(23748..24740) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene asd sequence041 source 1..31890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1541..2992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(3086..3964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(5088..8984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(9213..13259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(13856..23509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 tRNA complement(24618..24692) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 24959..25534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(25542..26321) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(26325..26960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(26963..28420) product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(28353..28511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 28684..30129 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene asnS CDS complement(30178..30555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 misc_feature complement(30611..>31890) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme locus_tag LOCUS_13180 sequence042 source 1..30995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..1739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1864..3138) product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 3696..6410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(6710..7513) product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(7740..9050) product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 9425..9832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 10048..10458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(10467..10973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 11206..11757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 11764..13362 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene lig2 CDS 13359..15791 product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(16157..18253) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene pepX1 CDS 18576..20540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(20580..21332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 21473..21847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 21882..23300 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(23368..26427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 26510..27208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 27221..27517 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 27612..28424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 28514..29125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 29183..29521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(29648..30262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 sequence043 source 1..30754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(572..2350) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene asnB1 CDS complement(2440..2640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(2656..4419) product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene fadD CDS complement(4474..6219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(6674..8314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(8311..9186) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(9188..11053) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene mnmG CDS complement(11122..11556) product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ybeY CDS complement(11556..11957) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene spoIIAB CDS complement(11967..15263) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(15354..16121) product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(16129..16497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(16499..16840) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 16999..17580 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(17632..19035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 19510..20625 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 20622..21347 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene algR CDS 21355..21957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(22127..23440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(23437..25845) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(25855..26961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(27041..27922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(28851..29426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(29474..30517) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 sequence044 source 1..29232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(289..543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1481..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(2108..3247) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(3258..4874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(4879..7464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 8028..8594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(8710..9630) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene mdh CDS complement(9728..10252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(10245..11573) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene tilS CDS 11650..13131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 13240..14070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 14073..14396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 14403..15602 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 15577..16494 product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 16610..18262 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene recN CDS 18271..18936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 18962..19654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 19855..20367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 20439..21260 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 21392..22201 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA41 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene ispE CDS 22281..22895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 22949..23758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(24165..25079) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(25079..26161) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(26164..27294) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene tgt CDS 27390..28490 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 28481..29089 product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene sigW sequence045 source 1..29225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1923..3149) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(3146..3535) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y9 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene rbfA CDS 3612..4727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(4717..5145) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rpiB CDS complement(5158..5991) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene tatC CDS complement(5995..7266) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene glyA CDS complement(7418..7909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 8172..8711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 8728..9762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(9803..12793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 12963..13391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 13462..14700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(14768..17239) product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 17418..18536 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(18533..19432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 19482..20579 product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(20580..21056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 21103..21804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(21822..22868) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(22960..23553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(23555..25741) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 25967..29098 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 sequence046 source 1..29201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..1366) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1443..1853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1828..2409) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(2483..6175) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(6346..7239) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(7366..8418) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(8411..8887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(8891..10087) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(10084..10440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(10461..11228) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 11422..12405 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene mecR CDS 12745..13704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 13870..15039 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(15016..15429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 tRNA 16269..16353 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 16355..16427 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 17287..18387 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 18514..19038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 19101..19328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 19383..20816 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rtcB CDS 20901..21449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 21515..22147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 22399..23373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 23998..24972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 24983..25741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(25728..26000) product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(26130..27536) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 27684..28235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(28293..28841) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 tRNA 29055..29130 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence047 source 1..29154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(564..1979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1976..2530) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 2782..3990 product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(3991..4800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(4941..6038) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ychF CDS complement(6048..7166) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(7224..7547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 7755..8660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(8772..9116) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene fdx1 CDS 9220..10272 product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 10464..11822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 11907..13361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 14057..14494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 14677..15126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 15337..22257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(22297..22998) product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 23098..23889 product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 24129..24776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 24778..25977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(25985..26554) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(26766..27626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(27630..28400) product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(28451..29038) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 sequence048 source 1..28800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..1258 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8T2 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene ddlA CDS 1258..1794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1894..2265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 2831..3820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 3833..4519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 5170..5562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(5820..8885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(9051..9512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 9674..9994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 10024..10497 product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 10497..10901 product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 11067..11396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 11544..12308 product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U920 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 12305..13009 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 13002..13877 product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(14109..14474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 14791..15312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 15380..16588 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene queA CDS 16614..17753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 17851..19191 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 19198..20655 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(21041..21277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 21401..22621 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(23015..23275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(23268..25973) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(25957..26286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 sequence049 source 1..28159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1537..2136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 2321..2956 product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 3186..4373 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 4385..7567 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene mexF2 CDS 7588..9072 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 9194..10141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(10152..10730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(10790..11227) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD5 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene azu CDS complement(11400..11816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(12165..14342) product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(14354..14812) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(14821..15426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(15489..16163) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(16209..17024) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene yahI CDS complement(17076..17603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(17691..18497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(18494..18970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 19214..19696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 19787..22402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 22445..24004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 24108..24374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 24503..24784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 24825..25073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 25116..25370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 25506..27629 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 sequence050 source 1..27730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2668..3204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 3593..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(4371..6674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(6747..8996) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107511.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(9150..10334) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(10567..12786) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 13066..13611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(13638..13901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(14263..14553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(14594..16126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(16408..18402) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene dsbD CDS complement(18546..19934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(20083..20844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(20900..25543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(25666..26496) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene prmA CDS complement(26502..27263) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene tpiA sequence051 source 1..27626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..3394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 3435..3668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(3613..4350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(4359..4640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(5355..5861) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(5854..6903) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(6900..7757) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 7877..9943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(9944..11230) product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene nagA CDS 11501..12850 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 12936..13529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 13646..14326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 14382..15680 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(15666..17012) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(17002..18372) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 18523..19584 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 19793..22165 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 22214..24565 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 24752..27160 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 sequence052 source 1..27533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(713..1909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(2010..3137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(3184..3498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 3898..5427 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 5545..6033 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 6030..6647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(6683..7726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(7757..8080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(8109..8585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 8949..9587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 9665..13570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 13567..15240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 15248..17944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 17941..19764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(19761..20138) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(20240..20677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(20743..21435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(21760..22713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(22725..23207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(23411..24136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(24163..24630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(24771..25949) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene mauG CDS complement(26055..26459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(26465..26911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(27037..27375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 sequence053 source 1..27448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 400..705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 906..1772 product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 2099..3457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 3514..4287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 4415..5659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(5637..6035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 6208..6921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 7102..7719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(7919..8776) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 8905..9345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 9432..10091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 10207..10680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 10708..11115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 11148..11453 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 11600..11971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 11973..12356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 12353..12778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 12863..13387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 13550..14194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 14260..15324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 15438..16031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 16155..17657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 17722..18360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene ydeI CDS 18357..18833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 18830..19285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(19735..20337) product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene miaE CDS 20507..21415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 21619..22965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 23200..23955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 24100..24681 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 24728..25222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(25727..25999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(26116..26655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 sequence054 source 1..27106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..1794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 1791..2456 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 2489..3922 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 3939..4484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 4808..5029 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(5036..5458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(5458..6531) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene prfA CDS 6603..7079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(7080..7652) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene tag CDS complement(7737..7967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 8125..10410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 10407..11090 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene copR CDS 11080..12435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(12432..13190) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 13268..14377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 14494..15777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 15796..16809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 16822..17580 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 17740..18945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(19065..19976) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(20081..20665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 20855..24205 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene mfd CDS 24491..25606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 25899..26684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence055 source 1..27094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 789..3530 product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(3608..4336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(4497..5924) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene arsA CDS complement(5982..6332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(6307..6492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(6531..7442) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(7500..8006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 note possible pseudo, internal stop codon, frameshifted CDS complement(8034..8180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(8407..8964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(9160..10035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 note possible pseudo, internal stop codon CDS complement(10180..10401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(10398..10862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(10937..11842) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(12044..13198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(13548..14921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(14939..15673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(15860..16396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(16676..18058) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(18377..18859) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(18875..19447) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(19563..20057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(20318..20659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(20806..21354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 21268..21486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(21508..21888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(22008..22982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(22984..23709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(24155..24976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(25057..25284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(25294..26187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(26290..26928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 sequence056 source 1..27052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..3291) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(3288..4421) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(4542..4985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(5082..5981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 6036..6890 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(6887..7957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(8004..9077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(9175..10251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(10286..10921) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(10995..11480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(11572..11823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 11942..12412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(12434..15661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(15762..16301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(16371..16931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 17177..17347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(17369..18055) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(18126..19022) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(19266..20768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(21125..21319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 21436..21780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 21780..23081 product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(23085..23693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(23669..24250) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(24502..25359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 25525..25707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(25762..27024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 sequence057 source 1..26380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4312 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_16940 CDS 4309..4752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(4808..6259) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene leuB CDS 6423..7208 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene crt CDS 7378..8862 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 9017..10693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 10686..11435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 11422..12606 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 12779..12979 product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC14 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene tatA CDS 12983..14401 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene gatA CDS 14474..15763 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 15867..16979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 17091..17684 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene ruvA CDS 17758..24864 product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene sprA CDS 24917..25297 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene gcvH sequence058 source 1..26372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 935..2158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 2189..5284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 5309..9742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 10239..10745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 10798..11070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 11638..12075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 12162..12482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 12555..13280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 13287..13826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 14460..14726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 14893..15735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 15875..16252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 16330..16740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 16751..17218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 17274..18026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 18019..18672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 18683..18913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(18952..21126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(21312..23738) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 23897..24103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 24310..25215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 25277..25822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 25888..26364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 sequence059 source 1..26267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1312 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase locus_tag LOCUS_17330 CDS complement(1587..1925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(2894..5248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(5537..6328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(6643..7491) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(7499..8161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(8158..8829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(8862..9527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(9514..10188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(10281..11225) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene accA CDS 11436..12509 product UPF0118 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44646 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 12618..13520 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67299 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 13568..14926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 15131..16429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 16522..16992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 16989..17816 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 17817..18374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 18367..18903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 18956..19369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(19347..21188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(21198..22277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(22284..23351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(23356..24456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(24441..25505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(25508..26266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence060 source 1..26136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(812..1285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1359..1721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1827..3941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 4025..5101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 5251..5907 product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene tal CDS 5900..6163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 6166..6870 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene ftsE CDS complement(6892..7437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(7427..7885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(8108..8803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(8819..10243) product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 10406..12022 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene pyrG CDS 12037..13866 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene yidC CDS 14057..14737 product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 14746..15513 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 15522..16433 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene parB CDS 16433..17053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 17107..17823 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene dapB CDS complement(17892..18362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(18640..19302) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V6 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ung CDS 19375..19764 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene apaG CDS 19761..20543 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(20532..21122) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene tpm CDS 21234..22151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 22301..23818 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene suc1 CDS 23874..25829 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 sequence061 source 1..26045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..818) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene nlpD CDS 949..2604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 2712..5576 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 5646..6713 product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42094 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene phy CDS complement(6766..7860) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene pfk-1 CDS complement(8413..8892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(9186..9659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(9708..11513) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 11819..12286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 12415..15531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 15644..15859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 15789..17429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 17431..19119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(19125..19436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(19433..19981) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 20258..23398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 24258..25124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 sequence062 source 1..25981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1297..1530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1596..4052) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(4076..6532) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 6877..7557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 7616..7951 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 7954..9006 product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 9017..9988 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(10657..13074) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(13228..15642) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(15669..18095) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(18098..20500) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(20502..22949) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(22955..25375) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 misc_feature complement(25388..>25981) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_18150 sequence063 source 1..25819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 10..396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(409..1119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1273..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1632..1964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 2007..4790 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene leuS CDS 5062..6306 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene sbcD CDS 6303..9329 product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13458 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene sbcC CDS complement(9354..11291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(11487..12449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(13613..14365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 14597..15736 product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 15768..17222 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene cls CDS 17331..18407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 18499..20274 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 20384..21631 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 21677..22252 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 22352..23404 product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(23745..24014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(24594..24947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(24986..25195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 misc_feature complement(25197..>25819) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F1H5:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) locus_tag LOCUS_18360 sequence064 source 1..25747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1092..1586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1652..2254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(2284..3261) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene ltd CDS complement(3483..3953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(3937..5076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(5137..5466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 5745..6002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 6004..7197 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene kbl CDS 7355..8533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(8629..11580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(11577..12257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 12565..13716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 13837..14958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 14970..16118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(16165..16479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(16485..17330) product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(17327..18100) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene folP CDS 18215..18763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 18760..19755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 19755..20273 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene aroK CDS complement(20288..21817) product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(21848..23530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 23927..24397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 24407..25168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 note possible pseudo, internal stop codon CDS 25172..25408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, internal stop codon sequence065 source 1..25735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..1107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 1273..2007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 1994..2578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2568..3248 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(3254..4222) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q890D8 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene pip CDS complement(4200..4553) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(4680..5531) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene uspA CDS complement(5581..6330) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(6330..6770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(6773..8188) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene ccoG CDS complement(8214..9146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(9150..9362) product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ccoQ CDS complement(9369..11498) product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ccoN/ccoO CDS 11939..12136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 12127..12375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 12426..12761 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(12939..14711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 15106..15621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 15836..16420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 16926..17519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 17733..18341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 18399..18980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(18985..20331) product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene hemN CDS complement(20324..20497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(20499..22913) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene ccoI CDS complement(22910..23710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(23806..24525) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 misc_feature complement(24620..>25735) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122093.1:serine dehydratase locus_tag LOCUS_18890 sequence066 source 1..25613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140483.1:fused response regulator/thioredoxin-disulfide reductase locus_tag LOCUS_18900 CDS 1447..2298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2358..2960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(3011..3487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(3541..3717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 3847..4413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 4543..4965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 4969..5976 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(5998..8886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 9113..10498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 10599..11459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 11522..13120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 13126..14355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 14674..15438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 15466..17064 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 17179..18171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 18168..18818 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene pgmB2 CDS 18819..21119 product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 21475..22743 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 22751..23827 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence067 source 1..25229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 401..1300 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 1300..2037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2253..3572) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(3727..4203) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene ribH CDS complement(4414..5103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(5161..6123) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene pdhA CDS 6290..7393 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene recF CDS 7440..8060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(8072..8845) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(8838..9926) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 10101..11279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 11468..11908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 11980..13131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(13462..15729) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 15951..16970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 16967..17638 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(17639..18130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(18417..18695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 18819..19211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 19229..19555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(19793..21325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(21338..22078) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene lptB CDS complement(22253..23953) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(24054..24707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 sequence068 source 1..25197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3058 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971066.1:L-ascorbate oxidase locus_tag LOCUS_19340 CDS complement(3106..3540) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(3537..4484) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 4579..5343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene fjo14 CDS 5343..5642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 tRNA 5718..5800 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 6013..6441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(6640..11763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(11753..12793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 12780..13004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 13358..13738 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 13746..16226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 16490..17071 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 17061..17861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 17884..18819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 18848..19801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(20014..20523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 20572..21174 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 21176..22162 product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene paaA CDS 22167..22787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 22791..23543 product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 23583..24074 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 sequence069 source 1..25150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..2884) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene valS CDS complement(3203..5473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(5657..7009) product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 7082..8356 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene fahA CDS 8388..9278 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 9309..9905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 10060..10668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(11157..12335) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene bioB CDS complement(12428..15166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 15284..15769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(15845..18436) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(18429..18791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(18972..20297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(20312..21187) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene fabD CDS complement(21229..21651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene yuxK CDS complement(21630..24452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 misc_feature complement(24449..>25150) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMT2:adaptive-response sensory-kinase SasA locus_tag LOCUS_19710 sequence070 source 1..25053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 205..1131 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene hemC CDS 1133..2047 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2077..2928 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2906..3787 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 3784..4692 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 4786..6183 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 6443..6781 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene ogt2 CDS 6845..7588 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(7672..8688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(8816..9877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(9959..10603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(10623..12077) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 12160..12942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 12974..14392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 14735..15118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 15950..17458 product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 17550..18626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(18805..20343) product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene speE1 CDS complement(20533..21423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(21446..22216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(22474..23019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 misc_feature complement(23163..>25053) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121034.1:ATPase AAA locus_tag LOCUS_19930 sequence071 source 1..24875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..1727 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(1776..2147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2301..2516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2689..3309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 3418..4365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(4384..4941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(4943..6292) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 6572..7156 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 7323..7763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 7980..8801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 8804..9481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(9535..10578) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene speB CDS complement(10571..11851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(11888..12382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 12528..15026 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene topA CDS 15124..16062 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 16059..16598 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(16614..19694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 19847..20548 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene npdA CDS 20705..22114 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 22189..23169 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 23219..23881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 23888..24769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 sequence072 source 1..24867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 879..1556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 1866..2597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2743..4152 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 4173..4652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 4704..5192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 5189..5686 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 5737..6252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 6249..7085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 7168..7359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 7425..8114 product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAK6 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene vanX CDS 8111..8806 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(8822..9547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 9706..10686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(10762..11232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(11362..13935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(14006..14338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(14481..15413) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(15410..16648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(16648..17964) product cell division control protein 48 CDC48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 18141..18638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(18635..19153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(19231..19602) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(19680..20849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(20919..22094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(22303..23634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 misc_feature complement(23639..>24867) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase locus_tag LOCUS_20420 sequence073 source 1..24837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2276..2998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(3365..4015) product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(4252..5361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 5500..6213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(6266..7816) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene pcd CDS complement(8010..9443) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(9622..10377) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(10483..12795) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(12974..13330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(13507..14604) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(14629..15645) product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(15649..18075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(18088..19179) product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(19229..20500) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(20505..21737) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(21734..22960) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 sequence074 source 1..24836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1338..2552) product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2567..2812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2916..3338 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203920.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 3466..4014 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene mip CDS complement(4302..6161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 6380..7399 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene hemH CDS complement(7590..7904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(7964..9106) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(9108..10499) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(10603..10830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 10917..11726 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 11744..13519 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 14109..14597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 14609..15217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 15353..15655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(15659..16030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(16076..16735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(16827..19250) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(19386..20546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(20683..22161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 22373..23350 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene aspG CDS complement(23347..24582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 sequence075 source 1..24738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..2266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 2561..3634 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 3631..4362 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(4387..5568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(5920..7182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(7421..8944) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene aldA CDS 9153..10064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(10061..10645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 11040..15569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 15566..17656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(17722..18165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(18205..18903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 19004..20026 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 20235..23180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 sequence076 source 1..24709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1054..3537 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 3640..4845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 4857..5381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(5385..7004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 7124..8551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(8548..9840) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 9986..10441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(10415..11317) product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene miaA1 CDS 11418..12167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 12171..12551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 12557..12832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 12829..13590 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene phnP CDS 13591..15147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(16169..17605) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene pykA CDS complement(17605..18033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 18156..18392 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene acpP CDS 18415..19665 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 19668..20411 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene rnc CDS 20414..22255 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene nadE CDS 22324..23610 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 23766..24233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 24244..24654 product putative N-acetyltransferase YitI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06744 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene yitI sequence077 source 1..24422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(1151..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(1757..2056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2168..2311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2498..3223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(3227..3934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(4033..4593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(4577..5371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(5373..7706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(7823..8527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(8708..9130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(9223..9888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(9938..10651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(10658..11839) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(12128..13255) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 13475..16228 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(16232..17044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 17365..17715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(18199..20328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(20561..20839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(21082..22047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 22466..22657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 22917..24059 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 sequence078 source 1..24332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(284..1246) product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene argK CDS 1350..1886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 1890..2507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2504..2875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2926..3771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 3850..4677 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 4702..5244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 5248..5889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 5879..6346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(6343..7014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(7146..7628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(7615..8067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(8084..9334) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(9334..9966) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 10131..11318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 11320..11760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 11773..13143 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 13476..14588 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 15178..16233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(16373..16876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 17118..17327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(17328..17768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(18321..19409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(19756..20262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(20322..21953) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene pruA CDS complement(22028..22723) product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(22808..23314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(23391..23774) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 sequence079 source 1..24320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1231..2235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2253..2609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2905..4476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 4589..5404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 5401..7476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 7564..9462 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 10019..10492 product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 10479..12665 product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 12821..13171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 13233..13466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 13454..13738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 13986..15995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 16335..16889 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene mip CDS 16927..17292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 17414..17872 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 17874..18536 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 18623..19828 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(19829..20224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(20414..21661) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 misc_feature complement(21805..>24320) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter locus_tag LOCUS_21870 sequence080 source 1..24223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3690..4712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 4720..5961 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(5958..7862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(7960..8994) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene gpsA CDS complement(8987..10690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(10746..11876) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene bioF CDS 11942..12907 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 13030..14004 product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(14007..14441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(14586..14981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(15162..15743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 15858..16970 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405054.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 17242..18453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 18864..19310 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5L6 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene mraZ CDS 19310..20218 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene rsmH CDS 20334..20645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 20719..22734 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769220.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 22734..24197 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene murE sequence081 source 1..24175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(613..1152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 1327..2940 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2994..3245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 3255..3752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 3930..4601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 4740..6980 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(7037..10258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 10491..11252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 11249..11782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 11837..13342 product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N408 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene treA CDS 13357..13911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 13908..14576 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 14724..14945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 15072..15212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(15334..18480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 18783..19628 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 19699..21405 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 21934..23145 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene glpT sequence082 source 1..24076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(938..2554) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2758..3030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 3161..4366 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 4420..5499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 5565..6296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(6333..6965) product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(7060..7605) product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene ftnA CDS complement(7688..9142) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(9180..10544) product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(10549..12723) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(12727..13485) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(14406..16418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(16619..18610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 19032..21029 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 21022..21777 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 22207..22716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 22874..23332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence083 source 1..23717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(586..660) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(861..2117) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2295..2753 product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene hspC2 CDS complement(2876..3721) product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(3963..5861) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene acsA CDS complement(5866..6240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(6237..8978) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(8981..9181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(9218..10909) product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(10929..11183) product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(11210..12424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(12586..12948) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(13070..13867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(13911..14399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 14629..15102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 15384..16343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 16336..17802 product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 17818..18615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 18612..20000 product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(20037..20858) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(20871..22421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(22506..23627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 sequence084 source 1..23395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1219..1623) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(1624..3741) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene mcm3 CDS complement(3743..4912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 5180..6604 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene dnaA CDS complement(6755..7354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 7631..8518 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene mltR CDS complement(8931..9995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(10095..10622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(10727..11182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(11262..11981) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene algR CDS complement(11978..12973) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 note possible pseudo, frameshifted CDS complement(13104..13991) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 14263..14577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 14604..17258 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 17335..18603 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 18741..19259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(19256..20101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(20115..20552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(20603..21031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 21200..21901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 21938..22393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(22416..23162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 sequence085 source 1..23304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228189.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(909..3761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 tRNA complement(4314..4400) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 4541..5227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 5235..6920 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene ggtB CDS 7065..7523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(7576..8070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 8262..8726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(8741..11404) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(11401..11727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 11984..12553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(12594..13553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 13978..14607 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 14604..15704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(15694..16671) product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(16838..19489) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(19482..22139) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(22136..22534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 sequence086 source 1..22980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..2254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2464..2784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2826..4127) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(4135..4695) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(4822..5490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 5780..6400 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(6414..7241) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene lgt CDS complement(7244..7423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(7404..7910) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(7986..8687) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(8920..9915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(10289..10825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(10899..11735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(11893..12273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 12502..14220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(14221..15582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 15777..16268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(16335..17051) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene nonF CDS complement(17060..17353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(17427..18002) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(18072..19127) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 19334..19813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(19929..20363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(20412..21431) product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene rlmF CDS complement(21445..21693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(21762..22256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 misc_feature complement(22351..>22980) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764714.1:DNA-binding response regulator locus_tag LOCUS_23270 sequence087 source 1..22864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(401..1303) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(1396..2136) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2136..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 3394..3966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 3966..5165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 5307..5747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(5748..6827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(6990..8537) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 8822..9169 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 9176..11854 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 11882..12343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 12427..14109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(14232..14684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 note possible pseudo, internal stop codon CDS complement(14826..15182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 note possible pseudo, internal stop codon CDS 15282..16043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 16071..16385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 16412..16792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 16901..17512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(17954..20548) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(20545..20883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(21464..22570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 sequence088 source 1..22851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(832..1665) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(1784..2857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2944..3159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 3297..3575 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(3615..5021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(5021..7654) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(7651..7977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(8195..8653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 9624..10508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 10765..13314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 13345..13707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 13958..14659 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 14727..15095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(15236..17605) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 17883..18908 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 18905..19669 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 sequence089 source 1..22565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(555..917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(922..1275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1366..2379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2610..3383) product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(3535..4872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(5115..7790) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(7836..10526) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(10531..13128) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(13136..15754) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(15760..16092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 16280..18025 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Y5 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 18079..18417 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 18404..18721 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 19025..19321 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 19335..19697 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(19731..20447) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(20517..21005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(21139..22509) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 sequence090 source 1..22102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(783..1364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(1365..2711) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(2701..4074) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 4334..6706 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 6739..9138 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 9150..11504 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 11522..13924 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 13936..16320 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 16591..18957 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 18950..21349 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 sequence091 source 1..21567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 947..1624 product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 1635..3095 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 3097..4494 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(4692..5243) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(5233..6540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(6540..8033) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene accC CDS 8269..9444 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 9543..9719 product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(9770..10639) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene dapA CDS complement(10642..11154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(11154..13205) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene ligA CDS complement(13214..13411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(13412..14707) product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene xseA CDS complement(15139..15639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(15643..16305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(16337..16909) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 17057..17515 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(17549..18577) product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 18649..18873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 18903..19589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 19756..20367 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 sequence092 source 1..21512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 601..981 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(975..2336) product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 2464..3486 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(3491..4312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(4461..4895) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene ppi CDS complement(4986..5453) product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(5546..6454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(6529..7632) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X95 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene dinB CDS 7716..7919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 7949..8434 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(8613..9230) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 9611..10255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(10451..12802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 12964..13920 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 14059..14367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(14525..15451) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 15592..15891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 15906..16868 product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(17051..18943) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene napA CDS complement(18997..19365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(19557..20756) product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(20760..21149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 sequence093 source 1..21489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2623..3537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 3668..4312 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene upp CDS 4316..5257 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene yrbG CDS 5257..5712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(5718..6620) product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(6722..7429) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(7426..8358) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 8308..8535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 8640..9371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 9397..10434 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1W0 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene hemE CDS 10528..11829 product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene amaA CDS complement(12011..12325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(12905..13267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(13458..13781) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(13866..14531) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene dnaQ CDS complement(14532..16409) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(16492..17499) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(17499..18695) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene aspC1 CDS complement(18709..19317) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene recR CDS complement(19350..19631) product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene clpS CDS complement(19715..20515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 sequence094 source 1..21485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 9194..12034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(12036..12344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(12439..13860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 13892..14365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 14567..16099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 16074..16823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 16820..17089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 17422..17715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 18091..19704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 19833..20564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(20639..20821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(20829..21350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 sequence095 source 1..21454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1730 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 1861..3129 product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 3173..4117 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene purC CDS 4117..4500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 4509..5429 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene rnz CDS 6167..6964 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 7165..7602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 8064..8924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(8953..9687) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 9779..12151 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(12156..14261) product oxoisovalerate dehydrogenase subunits alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene pdhA/B CDS 14391..15290 product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene hemF CDS 15287..15853 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 15834..16361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 16365..16619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(16758..17390) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(17562..18653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(19360..19743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(19831..20286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(20267..21058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 sequence096 source 1..21384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..1773) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 1888..2292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2276..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(3850..5292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 5409..6269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 7011..8474 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 8560..11331 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene polA CDS 11486..12547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 12671..13618 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(13623..13859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 14076..15623 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 15718..16617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(16667..17701) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(17698..18498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 18673..21048 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 sequence097 source 1..21377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1685..2152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(2217..2906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(3019..3699) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(3705..4334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(4331..5305) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(5792..7660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 7843..8277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 8401..8916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 8904..9605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(9602..10261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 10276..11268 product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene gldB CDS complement(11234..12457) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(12504..13157) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene nth CDS complement(13223..13459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(13434..14033) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 14310..17123 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene uvrA1 CDS complement(17120..17983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(18033..18506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(18617..19474) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(19522..19896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 sequence098 source 1..21322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202701.1:histidine kinase locus_tag LOCUS_25260 CDS 965..1204 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene acpP CDS 1350..2198 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 2200..3345 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(3332..3931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 3978..5561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 5620..6603 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE02 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene selR CDS 7131..8060 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 8113..8817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(9024..11396) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene pbpC CDS complement(11396..16867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 17325..17858 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(18006..18416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(18413..19393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 19582..20361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 20358..21077 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 sequence099 source 1..21024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..2734) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2731..3336) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene tdk CDS complement(3337..3660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 3694..4728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(4768..6039) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene rodA CDS complement(6036..7862) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(7863..8378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(8378..9217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(9224..10252) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene mreB CDS complement(10337..11866) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene purH CDS complement(11909..12484) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene purN CDS complement(12481..13341) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(13385..13660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(13668..14450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(14447..15736) product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(15808..18330) product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(18366..18764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(18877..19152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(19155..19817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(19905..20588) product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 sequence100 source 1..20757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1691 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A8:Lon protease locus_tag LOCUS_25620 CDS 1756..2745 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene porQ CDS 2747..4147 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene hslU CDS complement(4673..5170) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene sixA CDS 5330..5521 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(5619..6566) product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 6908..7453 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 7450..9222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 9322..12027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 12051..13628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 13698..14750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 14758..16548 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(16621..16920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(17003..19663) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(19660..19986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 sequence101 source 1..20690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2205..4628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(4772..5857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 6091..8706 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene clpB CDS complement(8769..9014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(9137..9415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(9412..9978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene mcbG CDS complement(10052..11260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(11380..12210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(12355..12876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 12981..16103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 16105..16587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 16752..17699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 17789..20170 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 sequence102 source 1..20680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(735..2024) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2117..2563) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2611..4392) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene aepA CDS complement(4389..4802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(4846..5592) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(5643..5930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 6105..8174 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 8209..9108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 9834..10610 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(10621..11010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(11010..13190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 13294..14589 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene murF CDS 14591..15250 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(15361..16290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(16368..19052) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(19049..19948) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(19966..20457) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 sequence103 source 1..20645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1423..1881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 tRNA complement(2118..2202) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(2314..2387) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(2503..2865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(2886..5492) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene mutS CDS complement(5609..6331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(6352..7641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 7954..8874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 8984..10150 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 10151..10687 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 10763..11212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 11415..11753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 11747..14389 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(14467..15378) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 15462..16643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(16649..18316) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene malL CDS complement(18321..20270) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 sequence104 source 1..20582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 614..1342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 2490..2918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 2929..4248 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 4245..5339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 5336..6580 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene lolC CDS 6583..7263 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene lolD CDS complement(7361..7846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 8299..8727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 8877..9767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(9841..10869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(11067..13655) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(13649..13987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(14153..14662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 15100..16545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(16648..17526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 17686..18258 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8A1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 18320..18817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 misc_feature complement(18932..>20582) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein locus_tag LOCUS_26390 sequence105 source 1..20578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..1485) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(1497..2459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 2593..4179 product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene pccB CDS 4183..4881 product oxidoreductase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 4884..5954 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 5984..6754 product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene fecB CDS complement(6737..8833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(8898..10682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(10959..11471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(11620..13365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(13368..14963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(14956..15924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(16018..16677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(16919..17812) product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 17997..18947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 18953..19936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 sequence106 source 1..20485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2417..3226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 3278..3691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 3914..4741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(5048..5725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 6039..6572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 6699..7319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 7750..9153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 9255..10022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 10561..11616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(11613..13160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 13364..17839 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105670.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 17841..19268 product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene gltD CDS complement(19301..20188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 sequence107 source 1..20461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1093 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108785.1:helicase locus_tag LOCUS_26690 CDS 1093..1530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene ytoQ CDS 1852..3228 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene radA CDS 3325..3744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(3757..3984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(3890..4750) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene dcyD CDS 4883..5905 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(5967..6611) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(6604..7428) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(7532..8254) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene algR CDS complement(8277..9326) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(9416..10735) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene ndh CDS complement(11279..12325) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(12501..14471) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 note possible pseudo, internal stop codon CDS complement(14481..14918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(15136..15486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(15692..18115) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 18504..18893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 18975..19571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 19784..19999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 sequence108 source 1..20457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 1101..1706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 1755..2678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 2733..3698 product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819F1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene mtnK CDS 3700..5022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(5278..7665) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 8121..8432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 8587..9429 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 9563..10153 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene engB CDS 10219..10662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 10691..11008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(11005..13026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(13345..14340) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene fbp CDS 14411..15670 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene lysC CDS complement(15667..16329) product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(16329..17207) product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(17207..17686) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 17752..18525 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene fadB CDS complement(18591..19643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(19800..20378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 sequence109 source 1..20346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1442 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q08408:sensor protein RprX locus_tag LOCUS_27090 CDS 1435..2130 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 2274..2996 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene hisA CDS complement(2993..5377) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(5456..5848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 6101..8569 product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene mur/alr CDS complement(8570..8731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 8790..10130 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 10207..10428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 10430..12541 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene feoB CDS complement(12538..13848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(13995..14984) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(15048..15620) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 15784..17583 product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 17613..18752 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene purK CDS 18749..19243 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene purE CDS 19251..19646 product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(19654..19878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(20023..20346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 sequence110 source 1..20312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..1398 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(1395..2489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(2473..2919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(2916..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(3369..4913) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(4928..5299) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 5513..6556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(7138..8286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(8283..9437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 9665..10177 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 10161..10709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 10769..11263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 11314..11850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 11898..12803 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 12800..13609 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 13729..14460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 14594..16108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(16087..17754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 sequence111 source 1..20303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1243..1908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 2101..3312 product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 3314..4246 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 4243..5028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 5252..6382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 6487..7848 product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 8027..9754 product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(9790..12249) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene wzc CDS complement(12256..12999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 13384..13818 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 13824..16208 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 16248..17426 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 17513..19324 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(19398..20003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 sequence112 source 1..20244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..946 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087807.1:adenylate cyclase locus_tag LOCUS_27600 CDS 1183..2265 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 2453..3643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 3640..4515 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 4781..5845 product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene ilvK CDS 5883..6386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 6699..7526 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene prfB CDS 7566..8753 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene norA CDS 8758..9429 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(9534..10232) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(10267..11649) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene norM CDS complement(11646..12257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 12256..12852 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene rnhB CDS 12877..13875 product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(13911..16292) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 16512..17600 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene gcvT CDS 17610..18311 product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene comB sequence113 source 1..20207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 941..2830 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 2830..3069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 3082..3714 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y0H4 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 3765..5441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(5463..6128) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(6128..7024) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 7326..8204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 8276..8779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 8779..9501 product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 9560..9919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 9930..10334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 10474..11082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 tRNA 11407..11481 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 12031..12837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 14262..15020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 15090..15755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 15734..16537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 16518..17177 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(17185..17595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 17928..18899 product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene batB CDS 18896..19687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 sequence114 source 1..20198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(817..1767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(2091..4475) product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene pac CDS complement(4604..6916) product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(7078..7515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(7579..8208) product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene rhtB CDS complement(8350..8745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene yurT CDS complement(8768..9163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene yurT CDS complement(9196..9600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(9729..10148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(10201..11079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(11145..11456) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(11453..11701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 note possible pseudo, internal stop codon CDS complement(11941..12516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(12595..13851) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(14112..14777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(14835..15524) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 15585..17075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(17135..17641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(17713..17976) product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 18105..18701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 18804..19430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 sequence115 source 1..20114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..2257) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 2521..3642 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene dnaN CDS 3785..4198 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 4282..4527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 4532..5254 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene cysH CDS complement(5377..5838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(5942..6637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(6717..7445) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(7442..8116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(8262..9569) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene murA CDS complement(9575..10225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(10310..11161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(11171..13438) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene uvrD CDS complement(13529..14065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(14074..15216) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 15322..15915 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 15934..16227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 16229..16801 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene gmk CDS 16809..17384 product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene nadD CDS 17629..18585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 18590..19267 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 sequence116 source 1..19688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 995..2302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 2292..3080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3066..3947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3965..4651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 4928..5893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 5896..7410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 7414..8088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(8072..9235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(9466..9861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(10004..11827) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(11841..12590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(12670..13704) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 13836..14864 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene ruvB CDS 15399..16328 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene queG CDS complement(16360..16608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 16694..18151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 18151..19227 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene aroC sequence117 source 1..19590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..3988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 4003..4917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(5849..7291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(7538..8416) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene cysM CDS complement(8490..9326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(9462..9680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(9755..10543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(10684..11592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(11667..12713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(12785..14632) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(14889..19559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 sequence118 source 1..19582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(632..2281) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(2285..2689) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene rnpA CDS 2989..4665 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(4770..5765) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(5769..6944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(7021..7866) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene glpQ CDS 7966..8352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(8356..9417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 9531..11726 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 11918..12124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 12896..16561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 16730..17971 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 18153..19322 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 sequence119 source 1..19531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 515..1579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 1764..2084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 2160..3377 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 3367..4026 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CD4 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene deoC CDS 4013..4282 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene acyP CDS complement(4362..4871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(4981..7509) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 7956..11243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 11392..11832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(11848..12252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 12469..12783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(12825..13901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 14279..14944 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 14950..16146 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 16143..17096 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene argC CDS 17142..17975 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene proC CDS 17975..19102 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene argD sequence120 source 1..19529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1594..3486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3496..4131) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene queE CDS complement(4201..5082) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene folD CDS complement(5086..6873) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene lepA CDS 6966..8195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 8227..8742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 8900..10102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 note possible pseudo, internal stop codon CDS 10133..11524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 note possible pseudo, internal stop codon CDS complement(11545..12234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 12482..15007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 15118..15648 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 15652..16098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 16098..16472 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene crcB CDS complement(16829..17881) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(17942..18469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(18609..19214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 sequence121 source 1..19484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1196..1735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 note possible pseudo, internal stop codon, frameshifted CDS complement(1732..2832) product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 2914..4095 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene putA CDS complement(4097..5305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(5298..5657) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 5799..7511 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene lysS CDS complement(7973..10543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 10827..11570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 11574..12539 product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 12607..14262 product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 14266..15123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 15420..16871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(16879..17676) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene alsD CDS complement(17689..18318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 18426..19337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 sequence122 source 1..19335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(726..1451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(1468..2037) product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(2111..2527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(2984..3313) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3448..7737) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene dnaE CDS 8074..9714 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(9744..10850) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(11185..13851) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(13841..14182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(14423..15199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(15280..17484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(17561..17743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 sequence123 source 1..19224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..2501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 note possible pseudo, internal stop codon CDS 2498..3853 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(3963..4379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 4394..4588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 5111..7471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(8271..9827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(9982..10332) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(10410..11720) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene ftsA CDS complement(11805..12572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(12569..13891) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene murC CDS complement(13942..14913) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene murG CDS complement(15057..16217) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene ftsW CDS complement(16260..16634) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(16673..18019) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL9 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene murD misc_feature complement(18066..>19224) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H198:phospho-N-acetylmuramoyl-pentapeptide-transferase locus_tag LOCUS_29580 sequence124 source 1..19210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767911.1:DNA polymerase III subunit gamma/tau note possible pseudo, frameshifted locus_tag LOCUS_29590 CDS 1209..1517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(2095..3069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3115..5046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(5082..5723) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(5724..6959) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(7019..8089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 8175..9176 product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 9160..9561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 9572..10861 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene pepP CDS 10854..11297 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 11294..11563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 11571..12020 product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 12154..14517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 14694..15245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 15317..16642 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene rmuC sequence125 source 1..19184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..1189 product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene spsE CDS 1186..2292 product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 2279..3325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 3329..4045 product posttranslational modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene ptmB CDS 4042..4950 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 4961..5695 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene ptmA CDS 5699..6547 product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene hisF CDS 6525..7211 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60599 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene hisH CDS 7232..8506 product LPS biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946485.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 8508..9386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 9900..10379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 note possible pseudo, internal stop codon, frameshifted CDS 10456..11166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 11356..13149 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 13531..14661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 14778..15896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 15908..16615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 16834..18042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 18507..19172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 sequence126 source 1..19122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..962) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(1124..1552) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 1781..3283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(3359..4825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(5034..5810) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene uspA CDS 5950..6447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 6522..7199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 7705..9996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(10191..10550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(10547..11386) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene fdhD CDS complement(11482..13161) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene fhs CDS 13303..13932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(13913..14446) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 14661..15446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 15510..16043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(16045..17199) product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene solA CDS complement(17342..17890) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 18249..18518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 sequence127 source 1..19084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..1382 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(1401..2237) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(2378..3070) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(3060..4502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(4614..5162) product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(5226..6296) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(6298..7266) product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene kdsD CDS 7348..9537 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 9570..10856 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene purD CDS 10899..12260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 12257..12724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(12743..13255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(13252..15918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(16144..17226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(17539..18012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 sequence128 source 1..18992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 1043..2377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 2465..4042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(4354..4833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(4914..5330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(5580..7139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(7174..7647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 8040..10511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(10518..11003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(11094..11462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 11544..11705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(11842..12507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(12576..13286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(13373..14203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 14508..15194 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 15194..16681 product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 16674..17999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 sequence129 source 1..18902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..392 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene rpsR CDS 425..868 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene rplI CDS 1026..2669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(2795..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(3453..3647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 4029..5972 product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene glgE CDS 5987..7615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 7618..9540 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene glgB CDS 9617..11983 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 11990..12727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(12979..13401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(13705..14094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(14405..14794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(15330..17237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(17901..18716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 sequence130 source 1..18627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..1764 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 1962..2453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 2731..5577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 5759..5977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(5978..7627) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(7641..8501) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 8457..8912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 8935..10020 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(10092..10898) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene dltE CDS complement(11009..12124) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 12457..14868 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(14909..15709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 15819..16769 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 16826..17011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(17203..18357) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 sequence131 source 1..18570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..584 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene nuoB CDS 581..1066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 1067..2284 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene nuoD CDS complement(2369..3007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 tRNA 3179..3252 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 3666..6155 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 6387..6719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 6716..9334 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 9327..11978 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 12025..12915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 13036..13563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 13722..16670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(16717..17607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 misc_feature complement(17699..>18570) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase locus_tag LOCUS_30850 sequence132 source 1..18497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 602..1981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 2195..3517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3666..5048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 5319..6596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 6716..8149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(8675..8971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(8980..10866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(10870..11673) product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(11869..12105) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(12129..13223) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 13518..15452 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene dnaG CDS 15514..16641 product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene ribBA CDS 16690..17358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 17509..18192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 sequence133 source 1..18425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1623..3083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(3237..4118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(4197..5129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 5564..6508 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene gapA CDS complement(6920..9493) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(9494..10078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(10102..10854) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(10906..11640) product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene porT CDS complement(11589..12311) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A005 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene menG CDS complement(12495..13202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 13427..14056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(14167..15306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(15578..16675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(16675..16995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 note possible pseudo, internal stop codon CDS complement(17023..17214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 note possible pseudo, internal stop codon sequence134 source 1..18322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..1203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(1211..1591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 1788..3491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(3563..4849) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(4919..5806) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene thrB CDS complement(5917..6423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(6484..8916) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene thrA CDS complement(8958..10220) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene ilvA CDS complement(10326..11396) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(11413..11937) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene ilvH CDS complement(11940..13661) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene ilvB CDS complement(13675..15357) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene ilvD CDS complement(15350..16240) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene ilvE CDS 17032..18009 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 sequence135 source 1..18043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 597..854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(879..1478) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene coaE CDS complement(1471..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(2470..2778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(2796..3305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(3319..3624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(3634..4779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(4880..5983) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene vdh CDS 6137..7924 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(8011..8538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(8535..10307) product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(10312..11061) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene truA CDS complement(11102..12301) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705263.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 12517..12876 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 12948..13469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 sequence136 source 1..17420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..817) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 1064..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 1774..3591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(3645..5162) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene srfJ CDS 5359..6585 product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene folC CDS 6589..7251 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene trmB CDS 7248..7892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(7893..9494) product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 9877..10815 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 10802..11677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 11719..13572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(13573..13914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(14002..14700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(14702..15196) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(15294..15896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 16064..16522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 16530..16847 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 16849..17091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 sequence137 source 1..17226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2436..2792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 2922..3722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 3896..5026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(5055..6584) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(6760..7356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(7358..7876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(7880..9157) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 9407..10120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 10346..12037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 12077..13021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 13219..16050 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 sequence138 source 1..17159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 1167..3605 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3694..5136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 5175..6530 product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene atoE CDS 7291..7602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 7630..8886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 9205..9408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(9531..9734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 9787..10530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 10720..13533 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene acnB CDS complement(13561..14364) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 14559..15164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 15869..16225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 16423..17004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 sequence139 source 1..16985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(865..1392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(1468..2904) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(3011..3424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(3488..4930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(5019..5798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(5946..6740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(6822..7232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(7329..9293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 9459..9686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(9779..11545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 11845..13524 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(13598..14269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(15031..15420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(15956..16414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 sequence140 source 1..16925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(468..1322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(1324..1665) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(1667..2119) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene dtd CDS 2255..3454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 3478..4119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(4183..4707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 5290..8550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 8717..9310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 9375..9593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(9664..10314) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(10272..10910) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(10949..11374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(11381..11902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(12058..13077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 13331..13645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 13724..14248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 14267..15166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 misc_feature complement(15310..>16925) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203426.1:helicase locus_tag LOCUS_32200 sequence141 source 1..16779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..901 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_32210 CDS 946..1380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(1455..2459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 3468..4310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(4368..6023) product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 6225..7151 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 7308..7997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 8272..8721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(8886..9062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(9211..9957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 10097..11122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(11156..11737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(12658..13668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(13687..14583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(14746..15276) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene mogA CDS 15381..16493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 sequence142 source 1..16750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..878) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(875..2167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 2375..2539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 2542..3984 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(4494..5180) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(5186..6511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 6663..9032 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 9025..9270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(9670..12585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(13367..13735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(13713..14930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(14940..15713) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142690.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 sequence143 source 1..16694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..773) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene moaC CDS complement(777..1976) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene moeA CDS complement(2051..3040) product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ09 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene moaA CDS complement(3217..4194) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(4187..5335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(5335..6213) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(6210..6767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(6852..9245) product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(9272..9778) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(9796..10665) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(10877..11224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 11413..12411 product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 12875..13642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 13681..14817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 14911..15264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 misc_feature complement(15936..>16694) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037887.1:peptidase locus_tag LOCUS_32640 sequence144 source 1..16238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(2173..2385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 2342..2998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 3124..3996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 3986..5101 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 5089..6900 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene wbtH CDS 6876..8066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 8131..9213 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 9254..9814 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene wcgN CDS 9807..10169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 10272..10949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 10921..11556 product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 11588..12682 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 12704..14590 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(14642..15487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 tRNA complement(15739..15813) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence145 source 1..16165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 1217..2296 product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 2451..3704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(3705..4490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 4859..5545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 5725..6501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 6609..7334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 7662..10898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 11033..12457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(12440..12634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 12772..13440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 13443..15458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 sequence146 source 1..16070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 545..3820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(4060..5151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(5367..5639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(5874..7106) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 7321..8406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 8399..9115 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(9134..9835) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(9832..10863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 11065..11586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(11651..12067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(12080..13846) product L-ascorbate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(13855..14610) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(14616..15041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 15194..15529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 sequence147 source 1..15997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1870..2613) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(2614..3549) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(3557..4318) product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(4319..5722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(5873..6853) product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene dfrA CDS complement(6860..7600) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 7757..8956 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene hflX tRNA 9122..9194 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 9616..10041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 10190..11062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 11184..11675 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 11680..12336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 12737..13147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 13660..14853 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 14860..15936 product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 sequence148 source 1..15911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 784..1710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(1707..2384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(2412..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(3062..3406) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 3565..7011 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene pyc CDS 7596..7769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(8739..10247) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(10393..12789) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(12946..13335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(13394..14026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(14039..14971) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene oxyR CDS 15061..15513 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786060.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 sequence149 source 1..15863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(774..1604) product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 1756..3171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 note possible pseudo, internal stop codon CDS 3279..3959 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 4088..4300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 4403..5305 product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 5307..6638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 6698..7477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(7610..8008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710095.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(8121..9089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 9332..9994 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene nth CDS complement(10003..10461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(10624..11448) product taurine catabolism dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 11692..12240 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 12288..13109 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(13166..14002) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(14113..15021) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 sequence150 source 1..15832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1688 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KM32:polyphosphate kinase locus_tag LOCUS_33480 CDS complement(1659..2894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 3190..4053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 4102..7782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(7784..10807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 10908..11684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(11681..12571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(12691..13107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(13183..14415) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(14522..15514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 sequence151 source 1..15717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..6789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 6822..7220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(7316..7660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 7812..9398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 9450..10400 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene xerD CDS 10397..11293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 11304..11522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 11726..11968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(12026..12325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(13197..13418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 14618..15412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 sequence152 source 1..15628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(884..1510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(1822..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(2798..3724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(3738..5033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(5056..6129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(6136..8742) product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 8935..9837 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123533.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene alkA CDS 9940..12399 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(12420..13007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(13163..13411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(13408..14112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(14109..14951) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene ada CDS complement(15020..15439) product BluF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073432.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 sequence153 source 1..15573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 11019..15074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 sequence154 source 1..15530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 311..637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 646..3246 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 3290..5842 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 5835..8426 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 8470..11019 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(11107..11619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(11876..14923) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 transl_table 11 codon_start 1 locus_tag LOCUS_33890 sequence155 source 1..15499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(878..3955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(3976..4731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 5137..6339 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene mnmA CDS complement(6367..6978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(6982..8613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(8610..8951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(9106..9879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(10104..12833) product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 13275..13601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 sequence156 source 1..15455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..1424 product ammonia channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(1487..3409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(3426..5336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(5333..7279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(7564..8169) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene sodA CDS complement(8209..8655) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene tadA CDS 8749..10500 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene aspS CDS 10583..12646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 12673..13017 product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4J8 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene rsbV CDS 13007..13426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 13432..15366 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 sequence157 source 1..15409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1031 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140762.1:peptidase locus_tag LOCUS_34100 CDS 1230..1535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 1532..1819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(2410..3744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 3846..4958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(5014..5319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(5324..5620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 6181..7359 product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene tnp CDS complement(7676..7951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(8162..8605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 8960..9409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(9584..10294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(10287..10865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(10862..14227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 misc_feature complement(14556..>15409) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB locus_tag LOCUS_34240 sequence158 source 1..15384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 553..1056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 1058..1471 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(1602..2093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(2105..3490) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(3494..4096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(4097..4588) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 4842..5402 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 5466..6230 product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(6299..6898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(7198..7443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 7591..7830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 tRNA complement(7927..8009) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(8130..9512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814671.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(9496..10089) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 10271..12154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 12376..13620 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene mntH CDS 13675..14592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 tRNA 14745..14832 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence159 source 1..15237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..1254 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene ctaC CDS 1379..3148 product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene ctaD CDS 3126..4184 product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene ctaA CDS 4184..5086 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene ctaB CDS 5083..5673 product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene ctaE CDS 5688..6455 product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene coxP CDS 6469..6840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 6908..7510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 7507..8043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene yozB CDS complement(8040..8411) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(8408..8620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 8806..9030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 8990..9385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 9514..13143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 sequence160 source 1..15196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..939 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027582.1:glycosyl hydrolase locus_tag LOCUS_34550 CDS 1588..4188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 4282..5634 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(5872..6291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(6478..7581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(7789..8442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(8489..9331) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444280.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 9458..10705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 10687..11142 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(11134..11556) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(11549..12337) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 12436..14928 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 sequence161 source 1..15158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1366 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963831.1:gamma-glutamyltransferase locus_tag LOCUS_34670 CDS 1484..2827 product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(2824..3726) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene dhmA CDS complement(3733..4200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 4271..4678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932933.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 4653..6191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 6239..6724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 6792..7142 product bleomycin binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(7427..7840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(8068..9306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 9430..10968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(10972..11664) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(11807..12511) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(12516..13925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(14238..14723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 sequence162 source 1..15130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 406..2064 product phenylacetic acid degradation oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549951.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene paaZ CDS 2323..2499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(2860..3174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(3176..3967) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(3973..4476) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE6 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene folA CDS complement(4473..5393) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene fmt CDS complement(5705..6856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 6971..8125 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107808.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(8639..9415) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 9548..10072 product D-glycero-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH26 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene gmhB CDS 10207..11070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 11067..12089 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 12086..12766 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 misc_feature complement(12767..>15130) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_34950 sequence163 source 1..15082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1261..2277) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 2624..3079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 3069..3449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 3524..3976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(4001..4789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(4794..5327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(5344..6108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(6139..6330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(6361..7950) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(8287..9162) product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(9164..10465) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 10537..11616 product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(11963..13084) product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 13208..14086 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 14083..14883 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 sequence164 source 1..15025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(503..2878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(3218..4321) product tyrosinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(4333..4917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(5144..5668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(5950..6243) product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene parE1 CDS complement(6240..6488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(6675..8009) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(8009..9382) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 9558..11978 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 11981..14380 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 sequence165 source 1..15009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 6206..9598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 9564..11786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(11783..12397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(12500..12943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(13872..14483) product putative two-component response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703361.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 sequence166 source 1..15008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 441..1205 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM55 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene coaX CDS 1205..1930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(1938..3440) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(3490..5121) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(6444..6935) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene aspG CDS complement(7041..8066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 8566..12783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 12780..13667 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene cas1 CDS 13667..14005 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene cas2 repeat_region 14111..15004 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtcttcaagatcagcattcgacatcaaaccacaac sequence167 source 1..14984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 826..3024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 3133..4071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(4072..5505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 5598..7481 product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG51 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene aceB CDS 7478..9754 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729276.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene aceA CDS 10568..11332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 11333..11668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 11923..13551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 13671..13835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 13894..14742 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 sequence168 source 1..14891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2178 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_35450 CDS complement(2376..6074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(6513..7934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(8070..9488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(9692..10585) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460600.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 10811..11668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(11860..12354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(12662..13612) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 sequence169 source 1..14884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..1088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(1078..1698) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(1924..4194) product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(4302..5468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 5809..6039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(6036..7697) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(7760..9352) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 9525..10112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 10269..10850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(10847..11698) product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene cphB CDS complement(11695..12333) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 misc_feature complement(12435..>14884) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S457:chromosome partition protein Smc locus_tag LOCUS_35640 sequence170 source 1..14807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1889 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase locus_tag LOCUS_35650 CDS 1956..2180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 2147..2425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 2508..2969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(3025..3690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 3866..4681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(4771..5145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 5334..5906 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 5984..6859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(6916..9888) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 10072..12489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 12501..12833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 12868..13488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 13614..14132 product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(14199..14600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 sequence171 source 1..14756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..3809) product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene icmF CDS complement(4428..6665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(6628..7797) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene rlmL CDS 8015..8509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 8496..8753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(8758..9351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(9532..9897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(9907..10467) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(10730..12124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(12219..13601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 sequence172 source 1..14712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(808..1692) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262273.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene metR CDS 1853..2407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 3180..3875 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(3905..4285) product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 4471..5553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 5628..6695 product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 6827..7519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 7718..7909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 8047..9102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(9114..9803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(10037..11062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 11347..11790 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene cdd CDS 12184..13347 product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 13462..14505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 sequence173 source 1..14627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 1253..4717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(4770..5735) product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene hldD CDS 5807..6229 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(6271..7497) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene clpX CDS complement(7504..8172) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene clpP CDS complement(8256..9587) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 tRNA complement(9659..9741) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 9855..12083 product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene relA CDS 12133..12594 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene fur CDS 12610..12957 product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W5 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene spoIIAA CDS 12988..14256 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene purA sequence174 source 1..14493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1065..3035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(3042..4958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 5285..7495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(7646..8203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(8287..9237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 9341..10180 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(10204..10752) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene guaA CDS complement(10958..11653) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 11852..12346 product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(12467..13834) product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 misc_feature complement(13835..>14493) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860725.1:glutamate carboxypeptidase locus_tag LOCUS_36250 sequence175 source 1..14387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..643 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388877.1:MBL fold metallo-hydrolase locus_tag LOCUS_36260 CDS complement(799..1311) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 1482..2189 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122143.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 2329..2904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(2923..3729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 3882..5162 product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene pabB CDS 5201..6151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 6304..6939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 7163..7729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 7860..8471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 8703..10187 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene miaB CDS 10168..11472 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 11492..11989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 12027..13142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 13135..13503 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(13571..14290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 sequence176 source 1..14353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..1109) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268042.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 1267..2988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867182.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 3778..4473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 4503..5075 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 5065..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 6410..7021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(7025..7489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 7624..8718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 8873..9916 product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene irpA CDS 9929..11329 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 11313..13721 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene fecA sequence177 source 1..14012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..1192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(1194..2273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(2305..3414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(3416..4531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(4542..5612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(5675..6781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(6781..7896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(7896..8966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(8966..10033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(10033..11085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(11085..13550) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 sequence178 source 1..13954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..905) product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(908..1108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(1217..2146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(2191..4113) product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene kefB CDS complement(4110..4715) product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(4830..6098) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene phrB3 CDS complement(6095..7627) product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(8116..9543) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(10062..11531) product cryptochrome-like protein cry2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS67 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene cry2 CDS 11779..12951 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene hisC sequence179 source 1..13945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..739) product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(740..1846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728269.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(1840..2886) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene hypE CDS complement(2883..3989) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(3986..4243) product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(4234..6450) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene hypF CDS complement(6538..7245) product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene hypB CDS complement(7437..7778) product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462320.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(7781..9262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(9259..9573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(9570..10049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(10196..11782) product cytochrome-c3 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene hybC CDS complement(11789..12748) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene hybA CDS complement(13041..13391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 sequence180 source 1..13881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1295 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962292.1:outer membrane protein locus_tag LOCUS_36880 CDS 1702..2898 product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene kdnA CDS 2895..3629 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene kdsB CDS 3698..4777 product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene kdnB CDS 4783..5325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(5340..5786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(6038..9250) product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 9418..10005 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 10155..12656 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 12643..13032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 13022..13258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(13234..13872) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 sequence181 source 1..13861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1335..3116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(3268..3621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(3815..6427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(6526..8007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(8293..8565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(8733..10040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(10132..11820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(11937..12254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 misc_feature complement(12262..>13861) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein locus_tag LOCUS_37080 sequence182 source 1..13840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1102 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 1107..1535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 1649..1903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 1900..2490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 2534..3001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 3133..3441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 3476..3907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 4054..4473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 4470..5465 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene fadB5 CDS 5539..6822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 6848..7396 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(7400..8218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 8323..8853 product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(8955..9473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 9679..10002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 9984..10628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 note possible pseudo, frameshifted CDS 10628..11140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 11164..11910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 misc_feature complement(12316..>13840) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399759.1:kojibiose phosphorylase locus_tag LOCUS_37270 sequence183 source 1..13792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1365..2579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 2754..3053 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 3164..5122 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene gyrB CDS 5206..7353 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(7362..8255) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene ppx CDS 8419..8970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 8970..9725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 9727..10407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 10604..11620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 11639..12034 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 sequence184 source 1..13789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2321..5743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 5836..6612 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 6743..7375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(7475..8263) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 8396..9388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 9595..10935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(10938..11456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 11812..12438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(12452..13348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 sequence185 source 1..13606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(442..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(1699..2214) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(2390..2878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(3156..4427) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(4501..5886) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(5890..7551) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 7907..9808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 9805..10557 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 misc_feature complement(11474..>13606) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase locus_tag LOCUS_37550 sequence186 source 1..13500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..2579 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 2583..4958 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 4974..7385 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 7398..9767 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 9856..12285 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 misc_feature complement(12394..>13500) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:9-O-acetylesterase locus_tag LOCUS_37610 sequence187 source 1..13276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 751..1863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(2016..2936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(2933..4060) product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(4116..4838) product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(5613..7484) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(7621..8565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 8752..10065 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 10123..10566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(10563..11135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 11346..11927 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 12037..12597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 sequence188 source 1..13203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 695..2857 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene glnA CDS 2994..4952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 5041..5946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(5943..6104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(6262..7641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(7867..8466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(8468..9451) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene fabH2 CDS 9736..10500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(10528..11226) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 11438..13102 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene pdhC sequence189 source 1..13111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 1062..1445 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 1504..3012 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene gltX CDS 3024..3254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(3251..3391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(3548..4888) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(5112..5693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 5748..6701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 6727..7140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 7137..7304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 7420..7725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 7722..8456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 8453..8986 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 9185..10528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 10528..12090 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 sequence190 source 1..13057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 475..1380 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene cysD CDS 1380..2642 product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene cysN CDS 2656..3414 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene cysQ CDS 3424..4701 product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 4706..5761 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 5764..6894 product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene porR CDS 7042..7566 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 7559..8065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 8112..10751 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 10801..12135 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975609.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 12171..12932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence191 source 1..13008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2421..3029 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 3053..3718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(3726..5156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(5280..6491) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(6519..9194) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(9197..9541) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(9635..10234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(10234..11343) product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene mtnA sequence192 source 1..12980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 876..1358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 1426..1929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 1955..2503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(2522..3613) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(3664..3879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(3891..4319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(4434..6926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(6977..7897) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763536.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(7943..8473) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(8651..10102) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084170.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(10315..10893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(11020..12444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 sequence193 source 1..12908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(436..858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(941..1441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(1478..2071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(2118..2546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(2730..3083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(3192..3815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(3918..4412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(4463..5023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(5121..5888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(5961..6338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(6501..6839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(7203..7763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(7928..9064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 9530..11422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(11419..12348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(12492..12893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 sequence194 source 1..12823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2279 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:peptidase S8 locus_tag LOCUS_38470 CDS complement(2281..4185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(4182..4463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(4538..6952) product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 7043..7585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 7582..8424 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIB8 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene kdsA CDS 8436..9284 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene wza CDS 9286..11718 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene wzc sequence195 source 1..12770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(486..884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(1102..1701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(2050..2559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(2835..3647) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene dapD CDS 3686..4807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 4954..5607 product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene sirR CDS 5595..6518 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene troA CDS 6521..7312 product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene mntB CDS 7314..8600 product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene mntC CDS 8785..9663 product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene mntD CDS complement(9685..10269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(10354..11235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 11312..12691 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene mnmE sequence196 source 1..12664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(587..1354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(1621..3060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(3157..5760) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(5757..6098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(6469..6720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 6616..7032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(7124..8731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 8875..10368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(10430..11698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(11823..12638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 sequence197 source 1..12597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..1208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 1275..2009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 2019..2717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 3088..3342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(3566..4162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(4258..4839) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(4870..5460) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene azoR CDS 5611..6831 product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 6828..7277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(7325..7774) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(7801..7965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(8132..9106) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 9318..10496 product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975381.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 10838..11365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 11375..12133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 12163..12357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 sequence198 source 1..12584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 386..1090 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173233.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(1071..2825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(2985..3767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(3777..4673) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 4846..5667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(5671..6690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 6829..7797 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene trpS CDS 8114..8608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(8862..12017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 sequence199 source 1..12475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(538..1581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(2089..2835) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 3012..4406 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene lpdA2 CDS 4698..7544 product Rab family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933192.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(8308..9297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(9290..9706) product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 9791..10675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 sequence200 source 1..12461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2194 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:permease locus_tag LOCUS_39120 CDS 2347..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 2758..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 4348..5304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 5639..6073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 6099..6542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(6604..7569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(7586..9262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(9280..12420) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 sequence201 source 1..12431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..1121 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(1179..2003) product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 2346..2957 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 2974..4839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 4845..5294 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 5314..6162 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene tktA CDS 6175..7128 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene tktC CDS complement(7195..8766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 9219..9602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 9717..10904 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene argD CDS complement(10953..11480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(11559..12098) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene hslV sequence202 source 1..12429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(462..1343) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUP9 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 1559..2557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 2568..3206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 3188..3997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 3966..4619 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4951..5172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 5299..5742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(5854..6513) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(6494..8845) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(8876..9391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 9804..10172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 10615..11085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(11490..12251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 sequence203 source 1..12120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 617..1054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(1110..2564) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(2650..3693) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(3813..4745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(4781..7711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(7871..10822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(11056..12012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 sequence204 source 1..12118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..1544 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 1551..2222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 2235..3086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 3311..4207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(4387..5184) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(5195..5770) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(5777..7102) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 tRNA 7203..7276 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(7444..8268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(8325..8936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(8936..9322) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 sequence205 source 1..12106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(911..1573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(1573..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 2392..2637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 2993..4366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 4446..4901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 5004..5492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 5628..6077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(6169..8244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(8379..9398) product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZJ0 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene potA CDS complement(9455..10573) product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 sequence206 source 1..12093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2140..3468) product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(3479..4237) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(4242..4814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 5126..5602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(5626..6120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 6395..6796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 6802..8850 product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(8920..9756) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 9876..10634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 10637..11794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 sequence207 source 1..12066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(756..1094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(1105..2334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(2467..2979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(3039..4451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(4667..5116) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(5138..5506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 5768..6433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(6436..6702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(6768..7478) product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(7547..8356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(8561..9991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(10154..10498) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704429.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 10593..11192 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 11189..11587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 sequence208 source 1..12032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 703..3888 product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 3959..6121 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 6114..7391 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109189.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(7397..8608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(8839..9192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(9501..9938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 10182..10691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 sequence209 source 1..12023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2763..4085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 4127..5071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 5274..5966 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene folE2 CDS 5963..7474 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene cysS CDS 7625..8143 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene dcd CDS 8461..8700 product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 8941..9876 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 10051..10482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 10563..11207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 misc_feature complement(11209..>12023) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H213:5'-nucleotidase SurE locus_tag LOCUS_40150 sequence210 source 1..12015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108756.1:peptidase M16 locus_tag LOCUS_40160 CDS 1076..1717 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 1786..3675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 3724..4695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 5212..5541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(5871..6287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(6515..7630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 note possible pseudo, frameshifted CDS complement(7850..8338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 tmRNA 8649..9014 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 9759..10019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 misc_feature complement(10026..>12015) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962188.1:helicase locus_tag LOCUS_40250 sequence211 source 1..11993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1308..2471) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(2468..3820) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(3804..4433) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 4643..5443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 5525..5893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 6162..7817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 7822..8559 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene algR CDS 8940..11159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108745.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 sequence212 source 1..11989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..1026) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(1075..2301) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT9 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene citC CDS complement(2416..3234) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene panB CDS complement(3431..4252) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene mscS CDS complement(4288..4791) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene pyrR2 CDS complement(4811..5284) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(5364..6563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 6672..7316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 7512..10490 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(10506..11279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 sequence213 source 1..11885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..592 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962816.1:bacillithiol biosynthesis deacetylase BshB1 locus_tag LOCUS_40440 CDS 767..1360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(1372..2013) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE19 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene pdxH CDS 2167..2742 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 2800..5172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 tRNA 5274..5347 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 5424..6377 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(6383..7009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(7025..8881) product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(9036..10202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 sequence214 source 1..11808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..1950) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 2187..3806 product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene pckA1 CDS 4108..5187 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(5497..7359) product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene pckG CDS complement(8245..8856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 9135..9656 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 9828..10286 product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 sequence215 source 1..11793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..1455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403247.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 1459..1929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 1996..3279 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene tyrS CDS 3667..4950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(5217..6077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(6077..8428) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(8643..9272) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 misc_feature complement(9346..>11793) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_40670 sequence216 source 1..11766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(777..1142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 1334..1864 product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene flaR CDS 1964..2731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 2765..3283 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(3425..5788) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(6123..7082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 7189..7698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 7788..8414 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene narP CDS 8612..9091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963612.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 9088..10023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(10170..10325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 10312..10677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 10674..11360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 sequence217 source 1..11756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1300 product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene ltaE CDS 1297..1659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 1665..2846 product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(3045..4529) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene degP/Q CDS 4782..6278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 6289..7452 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene dxr CDS 7452..8777 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(8774..10804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 sequence218 source 1..11721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..2075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 2243..2752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 2804..3937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 4245..4460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 4488..7028 product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384833.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 7165..8904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(8901..9725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 9973..11343 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 11526..11660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 sequence219 source 1..11660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1335..2489 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFT4 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 2486..3082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 3079..4215 product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 4240..4482 product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene moaD CDS 4479..4895 product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531881.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 4923..6143 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 6140..6577 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 6713..7903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(7916..8959) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(8956..9879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 10007..10474 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 10542..11141 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene sigZ sequence220 source 1..11651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(876..1859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(1883..2146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(2174..2362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(2364..3623) product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(3683..6088) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 6279..6836 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 6838..7659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 7737..8234 product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(8360..9841) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 9926..10780 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene mvaB CDS complement(10777..11202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 sequence221 source 1..11567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3021 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789008.1:multidrug efflux pump protein locus_tag LOCUS_41230 CDS complement(2999..4234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 4425..5732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 sequence222 source 1..11501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(340..930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(1034..1867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(1920..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 3132..4553 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(4554..5294) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(5287..6399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(6445..7530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(7634..8698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(8688..10625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 misc_feature complement(10629..>11501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462310.1:thioether cross-link-forming SCIFF peptide maturase locus_tag LOCUS_41360 sequence223 source 1..11478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 587..832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(891..1547) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(1699..2538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(2552..3115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(3146..3574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS complement(3590..4336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(4709..4993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(4996..5553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(5847..6050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(7430..7774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(7771..8688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(8690..10936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41480 sequence224 source 1..11330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2704..3057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(3054..4454) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(4455..5504) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(5504..7165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(7355..7555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(7658..9064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 misc_feature complement(9621..>11330) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107142.1:collagen-binding protein locus_tag LOCUS_41550 sequence225 source 1..11239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(1470..1985) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 2207..3757 product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202050.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 3754..4632 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 4638..4880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 4834..6000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 6396..7124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(7193..7597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(7669..8466) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(8463..9452) product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(9452..10168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 10260..10991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 sequence226 source 1..10992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 478..1647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 1722..2087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS complement(2306..2605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 2870..3988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(4046..5335) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene eno CDS complement(5347..6450) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene carA CDS complement(6568..7587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(7723..8268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(8331..9320) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene rpoA CDS complement(9354..9806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(9978..10370) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene rpsK CDS complement(10418..10795) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene rpsM sequence227 source 1..10991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(570..1850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(2044..2700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(2918..3475) product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 gene gpmA CDS complement(3460..4251) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene cobS CDS 4883..5131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(5270..6307) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene cobT CDS complement(6310..7008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(7010..7513) product cobinamide kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 gene cobU CDS complement(7510..8076) product ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(8188..10059) product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI41 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene btuB misc_feature complement(10064..>10991) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932103.1:iron(III) ABC transporter ATP-binding protein locus_tag LOCUS_41910 sequence228 source 1..10826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..1797 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 2046..3509 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(3635..5092) product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(5309..6625) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(6618..9689) product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(9694..10773) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 sequence229 source 1..10824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1001..2302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(2528..3706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(3773..4282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 4332..4811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 note possible pseudo, internal stop codon CDS 4818..5465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 note possible pseudo, internal stop codon CDS 5494..6972 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 6969..7556 product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 8015..10477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 sequence230 source 1..10813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3673..4104) product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS complement(4101..4361) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(4425..6317) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(6324..6980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(6977..7144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(7151..7609) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(7620..8078) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(8115..9692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(9714..10520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42140 sequence231 source 1..10808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(307..3114) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(3503..3850) product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene gldC CDS complement(4322..4984) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene atoA CDS complement(4987..5685) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene atoD CDS complement(5697..6629) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene ribF CDS complement(6643..7377) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene truB CDS complement(7377..8168) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene uppP CDS complement(8172..8384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(8386..9306) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(9476..10108) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 10170..10607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 sequence232 source 1..10718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2445..5777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS 6074..8467 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 sequence233 source 1..10710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1219 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108276.1:TonB-dependent receptor locus_tag LOCUS_42280 CDS 1286..2167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 2398..3396 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(3424..5382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 5590..6237 product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(6303..8075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(8075..9715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(9844..10212) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 sequence234 source 1..10639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..1526) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene fumC CDS 1891..2613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 2749..3810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS 3807..4553 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(4559..5422) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(5489..6394) product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701395.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(6538..6897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 7037..7408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(8071..8394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(8574..9407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 sequence235 source 1..10551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(1030..1938) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(2027..2944) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(3073..4197) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(4299..4652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026986.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(4727..5302) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(5356..5964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(5985..6515) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(6663..7265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(7319..8029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639356.2 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(8132..8953) product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(9143..9583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(9685..10314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 sequence236 source 1..10497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD74:putative cytosol aminopeptidase locus_tag LOCUS_42590 CDS 1168..2367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(2667..3383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS 3421..5901 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 6194..6676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(6770..7207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 7468..9033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(9135..10340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 sequence237 source 1..10427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(866..1855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(1931..4015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(4129..5235) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene dnaJ CDS complement(5238..5828) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene grpE CDS 6116..7219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(7294..7797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(7901..8929) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene obg CDS complement(8967..9545) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 transl_table 11 codon_start 1 locus_tag LOCUS_42740 gene adk CDS complement(9589..10128) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 sequence238 source 1..10418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..1685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(1695..2792) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 2908..3891 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene lpxK CDS 3968..5833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(5953..6147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(6137..6712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(6859..7299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(7335..7766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(8209..8802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(8874..9983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 sequence239 source 1..10376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 1275..1952 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene cmk CDS 1957..2850 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene ispH CDS 2994..4361 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene nqrA CDS 4366..5550 product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene nqrB CDS 5537..6292 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 transl_table 11 codon_start 1 locus_tag LOCUS_42910 gene nqrC CDS 6313..6978 product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene nqrD CDS 6992..7603 product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene nqrE CDS complement(7684..8124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 8327..8782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(8779..9486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 sequence240 source 1..10283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..501 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_42970 CDS 513..2144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 sequence241 source 1..10275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..1165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 1218..1844 product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EY6 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(1872..4184) product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 4409..4960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 5061..5939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 6050..8755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 8780..9508 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(9697..10035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 sequence242 source 1..10270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1311..3284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(3281..5191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 5596..7215 product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KR0 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS complement(8389..8841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 misc_feature complement(8864..>10270) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_43110 sequence243 source 1..10262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(442..1311) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene ykuF CDS 1545..2501 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 2520..2813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 3011..3910 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 4073..7009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 sequence244 source 1..10215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS 839..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 2442..3299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 3325..3972 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 4314..6851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 6848..7216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 7203..9713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 sequence245 source 1..10212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2031 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203504.1:competence protein locus_tag LOCUS_43240 CDS 2028..2801 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 2895..3146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 3143..3445 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964042.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 3489..5414 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 5465..6058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 6092..6436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 6426..6980 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 7083..9857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 sequence246 source 1..10204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 588..2456 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 2526..3893 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118040.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 4033..5430 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene xylE CDS complement(5473..5922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(5965..7359) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 7595..8989 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 8999..10099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 sequence247 source 1..10189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679762.1:membrane protein locus_tag LOCUS_43400 CDS complement(1267..2646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(2646..4277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(4464..5468) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(5577..8000) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 misc_feature complement(8217..>10189) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_43450 sequence248 source 1..10183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..1675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55492 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(1830..2669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(2653..3978) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(4125..4913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 5001..6092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(6098..7129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 sequence249 source 1..10086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..1100 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 1097..1792 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 1856..2563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 3017..9427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 sequence250 source 1..10084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1736 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene hutH CDS 1738..3729 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene hutU CDS 3855..5084 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 transl_table 11 codon_start 1 locus_tag LOCUS_43580 gene hutI CDS complement(5130..7544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 8002..9858 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 sequence251 source 1..10074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 154..1536 product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 1596..1880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(1877..2431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(2467..2997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 3295..4644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 4657..5370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 5382..6428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(6435..7763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 misc_feature complement(8841..>10074) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784703.1:membrane protein locus_tag LOCUS_43690 sequence252 source 1..10067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(991..1668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(1680..2828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(2943..3215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(3485..4222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(4219..5247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701760.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(5289..6041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(6115..6792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(6806..7468) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(7472..9025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(9140..9526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 misc_feature complement(9454..>10067) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870430.1:glycosyl transferase locus_tag LOCUS_43800 sequence253 source 1..10046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..915) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 1037..2431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 2431..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 2855..4783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 4882..6399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 6530..6796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 7241..8887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 sequence254 source 1..9998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(1184..2038) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 1980..2144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(2215..4809) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(4884..5276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 5382..6158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 6237..7709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 7702..9171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 sequence255 source 1..9945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1262..4366 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(4390..4611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 4634..5785 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS 5870..7129 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 7132..8211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 sequence256 source 1..9905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1208) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene aspC3 CDS 1713..3116 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 gene trpE CDS 3189..3770 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 gene pabA CDS 3803..4789 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_44040 gene trpD CDS 4842..5645 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene trpC CDS 5720..6319 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene trpF CDS 6319..6939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 6929..7363 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 7367..8548 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 gene trpB CDS 8582..9385 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene trpA CDS 9401..9871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 sequence257 source 1..9821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 966..1937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 2015..3817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 4216..5781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 5940..6773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(6854..7684) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 gene tsf CDS complement(7793..8584) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 transl_table 11 codon_start 1 locus_tag LOCUS_44180 gene rpsB CDS complement(8610..8996) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 transl_table 11 codon_start 1 locus_tag LOCUS_44190 gene rpsI CDS complement(9009..9452) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 transl_table 11 codon_start 1 locus_tag LOCUS_44200 gene rplM sequence258 source 1..9794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1401 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582818.1:pectate lyase locus_tag LOCUS_44210 CDS complement(1562..3946) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(4113..6506) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(6510..8906) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 misc_feature complement(8910..>9794) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_44250 sequence259 source 1..9792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 913..4041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 4041..7235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 7232..8566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44280 sequence260 source 1..9790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 596..934 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 gene arsR CDS 918..1373 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(1523..2812) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene hemL CDS complement(2802..4652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(4654..6183) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 transl_table 11 codon_start 1 locus_tag LOCUS_44330 gene guaA CDS 6519..6926 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 7455..8492 product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 sequence261 source 1..9739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1929..3080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(3216..3596) product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(3593..3781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(3914..4771) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 5043..6293 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS 6293..7180 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS 7183..8007 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 8013..9113 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 sequence262 source 1..9623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..1320 product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 1322..2122 product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(2235..4820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(4835..6061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 6187..6558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS complement(6608..9022) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 sequence263 source 1..9611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..1023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 1080..1478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(1917..2402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(2992..4971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 5190..5474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44540 note possible pseudo, internal stop codon CDS 5583..5945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 note possible pseudo, internal stop codon CDS 5942..7003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(7030..7794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(7863..8414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(8473..9333) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 sequence264 source 1..9576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..824 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107753.1:transcriptional regulator locus_tag LOCUS_44600 CDS 941..2422 product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 gene citT CDS 2539..3309 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(3387..4496) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS complement(4684..5346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 5647..6345 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 6429..7100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 7200..7676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 7742..8242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44680 sequence265 source 1..9503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2982 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_44690 CDS 3193..6375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 sequence266 source 1..9482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2921..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(3491..4243) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(4245..6149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(6285..6785) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(6850..7173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 7256..7993 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene etfB CDS 8018..8971 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 gene etfA sequence267 source 1..9446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(823..1053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(1050..1568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(1659..2975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(2988..4277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(4270..4989) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 gene coaX CDS 5031..6110 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS 6151..7377 product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 7505..9058 product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 sequence268 source 1..9335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..1534) product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746478.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 1886..2653 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS complement(2632..3609) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS complement(3614..4573) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(4578..5078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(5200..5730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS complement(5720..6988) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene pyrC2 CDS complement(6990..8993) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 sequence269 source 1..9312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(1211..2083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(2080..3315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(3312..4040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(4062..5147) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 gene wbtI CDS complement(5319..6011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(6123..7349) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 gene ald CDS complement(7342..7776) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 misc_feature complement(7776..>9312) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:two-component system response regulator locus_tag LOCUS_45020 sequence270 source 1..9266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..1185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(1178..2782) product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(2970..3791) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS 3914..5020 product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(5044..5679) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAW6 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene clpP CDS complement(5692..5961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(5942..6472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(6559..8337) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31755 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene proS sequence271 source 1..9264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1584..1967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS complement(1964..2671) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 2937..3668 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS 3665..4420 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 4612..5112 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 5160..5981 product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(6059..7048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(7223..8134) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 sequence272 source 1..9232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 666..1223 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729007.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS 1279..2277 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 2347..2949 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 2946..3416 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 transl_table 11 codon_start 1 locus_tag LOCUS_45230 gene tadA CDS 3413..3652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(3708..4187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(4366..5838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 6033..7496 product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887609.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 7969..8475 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67692 transl_table 11 codon_start 1 locus_tag LOCUS_45280 gene lspA CDS 8477..9070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 sequence273 source 1..9210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS 570..2099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(2457..5699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(5976..6776) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538091.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(7050..7649) product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(7634..8095) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 tRNA complement(8544..8618) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence274 source 1..9194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..707 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000676633.1:DNA-binding protein locus_tag LOCUS_45360 CDS complement(762..1637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(1634..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS complement(2220..3284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(3424..4215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 4301..4915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(4975..6177) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(6371..6949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(7130..8533) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403039.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 gene lnt sequence275 source 1..9190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..1715) product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(1799..2845) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(3025..3675) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS 3973..4833 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965264.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(5174..5665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(5678..7894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS complement(8072..9007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 sequence276 source 1..9122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS complement(824..2092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(2089..3036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(3029..4120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(4467..5951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(5995..6945) product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543833.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 sequence277 source 1..9075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 867..1274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 1287..2024 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 2036..2383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 2499..2933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 3028..3552 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 3622..4758 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 gene pntA CDS 4762..5076 product NADP transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 gene pntA CDS 5086..6495 product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNS8 transl_table 11 codon_start 1 locus_tag LOCUS_45660 gene pntB CDS 6557..7150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 7233..8648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 8722..8952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45690 sequence278 source 1..8956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..2453 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 2455..4863 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 4898..7279 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 sequence279 source 1..8883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(949..1473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 1643..2461 product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene deoD CDS complement(2499..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS complement(3308..3622) product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 3808..4509 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 4533..5450 product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene gldA CDS 5434..7836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS 7847..8356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS complement(8359..8676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 sequence280 source 1..8751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(816..1838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(1861..2169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(2274..2618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS complement(2736..3311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(3518..4354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(4653..7022) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene nrdA CDS complement(7076..8074) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 gene nrdB sequence281 source 1..8718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..605 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_45900 CDS complement(602..1138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(1199..2266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(2247..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS complement(2788..4131) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(4139..7282) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(7282..8358) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 sequence282 source 1..8704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(346..714) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS 1003..1170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 1388..1807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS complement(2131..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(2619..3764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(3849..4052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(4681..6309) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 gene pafA sequence283 source 1..8691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1385 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971887.1:multidrug ABC transporter substrate-binding protein locus_tag LOCUS_46040 CDS 1544..3070 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(3140..4483) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A100 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 4736..5872 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 gene paaE CDS 6145..7419 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 7421..8386 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS complement(8390..8602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 sequence284 source 1..8685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2635 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_46110 CDS 2809..5883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 sequence285 source 1..8671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(520..1014) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 gene cdd CDS 1189..1518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 1584..2921 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(3295..5658) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene mrcA CDS 5782..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS 6452..7168 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210367.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(7165..7830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(7857..8228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(8269..8622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 sequence286 source 1..8635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 436..1407 product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 1429..2607 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS complement(2594..3490) product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS complement(3551..4189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS complement(4182..4697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS complement(4704..7313) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 gene bamA CDS complement(7363..8100) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 transl_table 11 codon_start 1 locus_tag LOCUS_46280 gene uppS sequence287 source 1..8617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..916 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_46290 CDS 1012..2058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(2190..2390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(2908..3981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS complement(4242..5414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46330 sequence288 source 1..8518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 1375..1614 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 transl_table 11 codon_start 1 locus_tag LOCUS_46350 gene rpmB CDS 1678..3111 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 gene pepP CDS 4295..5248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 5245..5475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS complement(5851..6228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS 6472..7086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 7118..7936 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 misc_feature complement(7957..>8518) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918286.1:oxidoreductase locus_tag LOCUS_46420 sequence289 source 1..8415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS complement(1069..1467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(1873..2745) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene brkB CDS 3165..4364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(4425..5216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 5382..6437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 6434..7195 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 7666..7842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS 7860..8033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS 8080..8250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46520 sequence290 source 1..8410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1435..2019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 2119..2607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 2607..3437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 3406..3957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(3954..4493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 4675..6219 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 transl_table 11 codon_start 1 locus_tag LOCUS_46580 gene glyS CDS complement(6243..6452) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 sequence291 source 1..8374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 524..919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 933..1649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 1807..2451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 2517..4667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 4945..5157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46640 sequence292 source 1..8332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 989..1804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 2415..3794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 4378..4779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(4832..5170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS complement(5236..6096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(6433..6891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46700 misc_feature complement(6916..>8332) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_46710 sequence293 source 1..8190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(875..2011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(2188..2829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(3074..3313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(3316..3795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS complement(3856..5070) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 gene gcdH CDS 5136..6101 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS 6234..7802 product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(7862..8158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 sequence294 source 1..8174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 5..80 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1552..2445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 2927..4570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 tRNA 4675..4750 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(5160..5501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 5559..5867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS 5920..6528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 6532..7566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 misc_feature complement(7658..>8174) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_46870 sequence295 source 1..8152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..854 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272657.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 1137..2480 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 gene xylE CDS 2485..4077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS 4162..6120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS 6235..7359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 tRNA complement(7692..7765) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence296 source 1..8111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 363..866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 868..1752 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(1755..3494) product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086547.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(3613..5340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS complement(5413..7017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46970 sequence297 source 1..8093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1006 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YW1:beta-N-acetylhexosaminidase locus_tag LOCUS_46980 CDS complement(1269..2375) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 gene smf CDS complement(2372..2710) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(2757..3791) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS complement(4054..5046) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 5161..7794 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 transl_table 11 codon_start 1 locus_tag LOCUS_47030 gene alaS sequence298 source 1..8026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..763 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66766:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B locus_tag LOCUS_47040 CDS 766..1881 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(1895..2485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(2868..3461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(3540..4013) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(4171..4824) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 gene pcm CDS 4946..5533 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 gene ribE CDS 5530..6606 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS complement(6618..7406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS complement(7587..7769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47130 sequence299 source 1..7923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 928..1584 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 transl_table 11 codon_start 1 locus_tag LOCUS_47140 gene lolD CDS complement(1577..2428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(2489..2947) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS 3064..3870 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 3867..4658 product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(4711..7773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47190 sequence300 source 1..7825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..766 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 889..2190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 2193..3188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 3250..4425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS 4764..5366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 5818..7491 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A849 transl_table 11 codon_start 1 locus_tag LOCUS_47250 sequence301 source 1..7823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(525..1274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(1287..2702) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS complement(2713..4515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 4675..5952 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS 6021..6341 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 6350..6835 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898141.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 6838..7230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 sequence302 source 1..7808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..4705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 4866..5558 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 5568..6260 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 6363..6773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS 6901..7350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 sequence303 source 1..7760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 436..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 2508..3647 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966347.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS complement(3719..4216) product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 transl_table 11 codon_start 1 locus_tag LOCUS_47410 gene tpx CDS 4308..4532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 4687..6078 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(6235..7293) product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 sequence304 source 1..7756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1495..3888) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(3893..6292) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 misc_feature complement(6312..>7756) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_47470 sequence305 source 1..7661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 580..2034 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(2035..2841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS complement(2831..3589) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 gene lpxH CDS complement(3678..5747) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 transl_table 11 codon_start 1 locus_tag LOCUS_47510 gene ftsH CDS complement(5818..6174) product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 transl_table 11 codon_start 1 locus_tag LOCUS_47520 gene rsfS CDS 6282..6989 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 sequence306 source 1..7621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS complement(652..1086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(1092..2420) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS complement(2425..5592) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS complement(5600..6712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS complement(6813..7430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47590 sequence307 source 1..7605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1182 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_47600 CDS complement(1244..2506) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067008.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(2599..3726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(4270..5487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086615.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(5554..5994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 sequence308 source 1..7593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(1849..2853) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 3255..3917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(4416..4790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(5019..6758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47690 sequence309 source 1..7577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..703 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799138.1:serine protease locus_tag LOCUS_47700 CDS 718..1371 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 transl_table 11 codon_start 1 locus_tag LOCUS_47710 gene rpe CDS complement(1372..1677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS 1878..2345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 2458..3621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS 3710..6247 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 transl_table 11 codon_start 1 locus_tag LOCUS_47750 gene gyrA CDS 6269..7465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 sequence310 source 1..7535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(675..995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(1084..1467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47790 misc_feature complement(1460..>7535) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108535.1:cell wall-associated protein locus_tag LOCUS_47800 sequence311 source 1..7483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1356 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_47810 CDS complement(1442..6943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 sequence312 source 1..7478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(759..1082) product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 1097..1735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS complement(1829..2383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 2684..3727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS complement(4830..6020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(6058..6867) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 sequence313 source 1..7472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1741..4245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(4332..5567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(5787..6299) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606654.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 sequence314 source 1..7449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 363..3461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS complement(4160..4837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS 5093..5422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 sequence315 source 1..7348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 44..547 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(597..950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS 1108..2472 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 transl_table 11 codon_start 1 locus_tag LOCUS_47980 gene hisS CDS 2677..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS 4370..4702 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 4702..5709 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(5706..5924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 sequence316 source 1..7239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 551..1999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS 2142..3062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS 3159..4013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS complement(4018..4851) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS complement(5370..5801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS 6042..6623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS 6613..6900 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 sequence317 source 1..7190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2035..2295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS complement(2553..3071) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023850.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(3152..4006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(4006..4956) product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 transl_table 11 codon_start 1 locus_tag LOCUS_48130 gene ftsY CDS complement(5046..5201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(5204..5386) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 transl_table 11 codon_start 1 locus_tag LOCUS_48150 gene rpmG CDS complement(5971..6735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 sequence318 source 1..7127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(1586..2044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS 2427..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 2929..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 4424..4927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 4947..5492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS 5665..6189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 sequence319 source 1..7073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..676 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KE72:peptide chain release factor 3 locus_tag LOCUS_48240 CDS complement(695..2602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 2683..3405 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS 3548..4876 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 4915..5613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(5614..6198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(6310..6558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 misc_feature complement(6570..>7073) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta locus_tag LOCUS_48310 sequence320 source 1..7032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..1473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(1686..4079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 4244..5167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 sequence321 source 1..6997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(571..1260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(1257..1943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(1940..2278) product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 transl_table 11 codon_start 1 locus_tag LOCUS_48370 gene ywzG CDS 2461..3018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS 3100..3810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 3894..4331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(4491..5051) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene pth CDS complement(5250..5843) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 gene rplY CDS complement(5854..6786) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 gene prsA sequence322 source 1..6960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 823..1386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 1390..2382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 2409..3008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 2992..3912 product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS 3915..4757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(4809..5771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS complement(5976..6356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48500 sequence323 source 1..6951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..1168) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 gene sdhB CDS complement(1195..3204) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 gene sdhA CDS complement(3206..3829) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 gene sdhC sequence324 source 1..6948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1796 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein locus_tag LOCUS_48540 CDS 1797..3116 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 3274..3630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 3576..3830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS 3827..4516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS 4567..6846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48590 sequence325 source 1..6861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence326 source 1..6844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 1113..1736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS complement(1834..2721) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 2781..3902 product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 gene gfo CDS complement(3916..4275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(4217..4372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 4416..5081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 5087..5485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48670 misc_feature complement(5916..>6844) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KBZ2:phosphoenolpyruvate carboxylase locus_tag LOCUS_48680 sequence327 source 1..6818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS 986..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 1262..1453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS 1735..1926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS complement(1947..2471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS complement(2474..4636) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS complement(4689..6314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48750 sequence328 source 1..6802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(998..2284) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS 2794..4134 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_48770 gene amt-2 CDS 4272..5303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS 5347..6375 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 transl_table 11 codon_start 1 locus_tag LOCUS_48790 gene glnII sequence329 source 1..6773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1878 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 locus_tag LOCUS_48800 CDS 2595..3779 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 3873..5597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS complement(5692..6249) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH4 transl_table 11 codon_start 1 locus_tag LOCUS_48830 gene ppiA sequence330 source 1..6704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase locus_tag LOCUS_48840 CDS complement(2139..3188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(3472..4146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(4495..5103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS complement(5163..5591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS complement(5773..6384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48890 sequence331 source 1..6681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1197 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease locus_tag LOCUS_48900 CDS complement(1266..2282) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 transl_table 11 codon_start 1 locus_tag LOCUS_48910 gene recA CDS 2392..3426 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 3498..4277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 4362..5054 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 gene phoP CDS 5058..6134 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403627.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 sequence332 source 1..6620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1403..2194 product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109883.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 2204..3310 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 3311..4540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(4856..5326) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 sequence333 source 1..6590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1180..1860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS 2020..3339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS 3433..4581 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS 4671..5351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108665.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS 5489..6385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 sequence334 source 1..6492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1427 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_49050 CDS 1553..4396 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS complement(4460..5197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(5330..5980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 sequence335 source 1..6478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 924..2135 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141933.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS complement(2136..2864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(2881..4983) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(4985..6280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 sequence336 source 1..6477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1906..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 2647..2922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS 2913..3287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(3374..3688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 3785..4552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 4559..5353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49180 misc_feature complement(5350..>6477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:coproporphyrinogen III oxidase locus_tag LOCUS_49190 sequence337 source 1..6471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..741 product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS complement(751..1416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(1455..2033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(2141..3967) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(4101..5324) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 transl_table 11 codon_start 1 locus_tag LOCUS_49240 gene aroA CDS complement(5321..6361) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 gene aroB sequence338 source 1..6469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 646..867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS 915..1085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 1279..2496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 2509..4326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 4334..6151 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 sequence339 source 1..6438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..518) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(520..1134) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(1186..1548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS complement(1570..2364) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 tRNA complement(2552..2640) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(2731..3792) product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene ansA CDS complement(3770..4552) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 gene tatD CDS complement(4558..5664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS complement(5661..6281) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 sequence340 source 1..6415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1304..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS complement(1969..2382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(3093..3461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS complement(3454..3624) product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(3627..3773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(3777..4625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS 4774..5883 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 sequence341 source 1..6400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(951..2279) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene xylA CDS complement(2290..3780) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 misc_feature complement(3836..>6400) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933192.1:Rab family protein locus_tag LOCUS_49490 sequence342 source 1..6384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..729 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP02 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene gmhA CDS 719..2260 product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(2347..2709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS 2825..3430 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS 3427..3810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS 3897..4616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS complement(4605..5249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS 5332..6051 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 sequence343 source 1..6301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1113..2099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS 2122..3456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS 3468..4640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS 5142..5975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49610 sequence344 source 1..6242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(705..1958) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(2214..3464) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS 4049..5425 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 sequence345 source 1..6237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1356 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865056.1:KamA family radical SAM protein locus_tag LOCUS_49650 CDS 1622..4237 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 sequence346 source 1..6236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 836..1735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS complement(1770..2645) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 gene modC CDS complement(2642..3313) product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(3313..3711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(3708..4475) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 gene modA CDS 4721..5077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49720 sequence347 source 1..6229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS 1032..3044 product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS complement(3084..3632) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(3715..3936) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS 4057..4299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49770 sequence348 source 1..6222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 843..2981 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS 2984..4303 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS complement(4306..5985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 sequence349 source 1..6218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 448..1218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 1553..1888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423827.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 1924..2952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 2972..3568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 3624..3854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 3874..4143 product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 4201..4467 product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS 4881..5150 product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423837.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS 5256..5525 product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS 5579..5845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49900 sequence350 source 1..6155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5961..6134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 sequence351 source 1..6133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1295..2356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49920 sequence352 source 1..6121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2249..3592 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFT0 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS 3838..5085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49940 sequence353 source 1..6053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1151..1603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(1830..3128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS complement(3142..3486) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(3620..4282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 sequence354 source 1..6052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..1108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS complement(1189..1641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(1759..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS complement(3101..4087) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083422.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(4180..4698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(4711..5868) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 sequence355 source 1..6050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(700..1230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS complement(1312..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918754.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS complement(2853..3845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(4133..5488) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 misc_feature complement(5551..>6050) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107494.1:sigma-54-dependent Fis family transcriptional regulator locus_tag LOCUS_50090 sequence356 source 1..6050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase locus_tag LOCUS_50100 CDS 773..1555 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035626.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS 1558..2619 product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(2607..3572) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 transl_table 11 codon_start 1 locus_tag LOCUS_50130 gene hemB CDS complement(3599..3796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(3831..4040) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS complement(4042..4671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50160 sequence357 source 1..6047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..1272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS complement(1407..2447) product adenylate cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52915 transl_table 11 codon_start 1 locus_tag LOCUS_50180 gene cya2 CDS complement(2444..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962246.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 misc_feature complement(3129..>6047) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:multidrug transporter AcrB locus_tag LOCUS_50200 sequence358 source 1..5982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(359..1789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141302.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS complement(1796..3202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS complement(3213..3911) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(4073..4501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS complement(4555..5754) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258650.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 sequence359 source 1..5956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS complement(798..1277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS complement(1274..2368) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS complement(2416..3969) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 gene gltB2 CDS complement(4101..5678) product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 sequence360 source 1..5924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2284..3108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(3105..3995) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS 4195..5253 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 sequence361 source 1..5920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS 431..1099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(1112..1342) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS 1685..2260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS 2335..3228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 3221..4060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 sequence362 source 1..5871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 462..1613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS complement(1638..3707) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS complement(3760..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50420 sequence363 source 1..5869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 891..3182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(3191..3583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(3709..4680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50450 sequence364 source 1..5784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(562..1188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 1246..1671 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS 1668..2897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS 2894..4585 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 transl_table 11 codon_start 1 locus_tag LOCUS_50490 gene menD sequence365 source 1..5780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..2553) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A451 transl_table 11 codon_start 1 locus_tag LOCUS_50500 gene priA CDS complement(2684..4711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 transl_table 11 codon_start 1 locus_tag LOCUS_50510 gene yyaL CDS complement(4713..5690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 sequence366 source 1..5714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..947 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868529.1:MATE family efflux transporter locus_tag LOCUS_50530 CDS 1004..1732 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109262.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 1744..2160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS 2157..2933 product tRNA pseudouridine synthase A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813Z9 transl_table 11 codon_start 1 locus_tag LOCUS_50560 gene truA2 CDS 3016..3498 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 3485..3952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 3952..4518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50590 misc_feature complement(4513..>5714) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001253926.1:C4-dicarboxylate transporter locus_tag LOCUS_50600 sequence367 source 1..5667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 422..658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS complement(819..2243) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS complement(2319..3557) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS 3710..5005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(5012..5497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50650 sequence368 source 1..5609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..1181 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 transl_table 11 codon_start 1 locus_tag LOCUS_50660 gene hisC CDS 1178..2278 product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 transl_table 11 codon_start 1 locus_tag LOCUS_50670 gene hisB CDS complement(2426..2812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS 3022..3939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS 4073..4396 product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 transl_table 11 codon_start 1 locus_tag LOCUS_50700 gene ywzG sequence369 source 1..5574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..528 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087972.1:enoyl-CoA hydratase locus_tag LOCUS_50710 CDS 550..1017 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS 1095..1538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS complement(1591..4272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(4278..4637) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS 5129..5503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50760 sequence370 source 1..5530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1653..2540 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 sequence371 source 1..5487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..1011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS complement(1135..1464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS 1690..2628 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889034.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS 2713..3276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 3432..3950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS 3984..4223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS 4298..5416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 sequence372 source 1..5385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..1525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS 1662..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 2867..3199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 3304..5361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50880 sequence373 source 1..5322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2291..4999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50890 sequence374 source 1..5305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS 1193..1756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 1811..2407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS 2445..3122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 3275..3634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS complement(3837..4727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS 5009..5278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50960 sequence375 source 1..5263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1213..2322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(2379..2561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(2597..2878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 2968..3192 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 3300..3524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(3659..4618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51020 repeat_region 4884..5248 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgatgtcgaatgctgatcttgaagact sequence376 source 1..5247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1111..1407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS complement(1409..2725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS complement(2915..4183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51050 misc_feature complement(4265..>5247) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase locus_tag LOCUS_51060 sequence377 source 1..5212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(731..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(1021..1629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(1785..2912) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 gene hppD CDS complement(3004..3483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(3565..4455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51110 sequence378 source 1..5211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 848..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS 2083..2514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS complement(2516..3001) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS complement(3028..4056) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEE2 transl_table 11 codon_start 1 locus_tag LOCUS_51150 gene ribD CDS 4107..4958 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 transl_table 11 codon_start 1 locus_tag LOCUS_51160 gene prmC sequence379 source 1..5207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1255 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889715.1:peptidase M23 locus_tag LOCUS_51170 CDS complement(1332..1577) product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 transl_table 11 codon_start 1 locus_tag LOCUS_51180 gene rpmE2 CDS 1740..3401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51190 sequence380 source 1..5200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 496..2580 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 2643..2915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS 2918..3610 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143374.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 3614..3844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS 3844..4515 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 transl_table 11 codon_start 1 locus_tag LOCUS_51240 gene rsmI misc_feature complement(4516..>5200) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A1G3:cysteine desulfurase locus_tag LOCUS_51250 sequence381 source 1..5199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(1499..3232) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS 3560..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 misc_feature complement(4455..>5199) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:isoquinoline 1-oxidoreductase subunit beta locus_tag LOCUS_51290 sequence382 source 1..5141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(953..2224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 2589..3557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS complement(3614..4609) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS complement(4643..4927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 sequence383 source 1..5134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 484..1659 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS 1781..2932 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 2974..4233 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 4230..5042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 sequence384 source 1..5109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 855..1346 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 1336..2217 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS 2278..4710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51400 sequence385 source 1..5095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..469 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 CDS 648..1904 product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS 1930..3150 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 gene porY CDS 3618..3965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51440 sequence386 source 1..5051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1401..1913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS 1917..3146 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930602.1 transl_table 11 codon_start 1 locus_tag LOCUS_51460 gene amaB CDS 3152..4042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51470 sequence387 source 1..5048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 gene yqiW CDS complement(528..854) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(851..1288) product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 gene sufE CDS complement(1291..2532) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 transl_table 11 codon_start 1 locus_tag LOCUS_51510 gene sufS CDS complement(2534..3859) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 gene sufD CDS complement(3864..4622) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 gene sufC sequence388 source 1..5040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..1460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS complement(1587..2141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS 2702..3265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 3290..4507 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 transl_table 11 codon_start 1 locus_tag LOCUS_51570 gene dinB CDS 4614..4976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51580 sequence389 source 1..5018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..1744 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728377.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 1899..3284 product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 misc_feature complement(3624..>5018) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257647.1:two-component sensor histidine kinase locus_tag LOCUS_51610 sequence390 source 1..5003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1138 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MP7:methionine--tRNA ligase locus_tag LOCUS_51620 CDS 1454..2050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS 2051..3052 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 3056..4285 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS complement(4293..4979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51660 sequence391 source 1..4995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..2516) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS complement(2650..3927) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 gene rocD CDS 4332..4694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51690 sequence392 source 1..4993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS complement(1149..1952) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS complement(1973..2896) product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 transl_table 11 codon_start 1 locus_tag LOCUS_51720 gene rsgA2 CDS complement(2877..4205) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 sequence393 source 1..4983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..1073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(1463..2227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS complement(2340..3482) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529200.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS complement(3479..3898) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481479.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 4045..4878 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269240.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 sequence394 source 1..4975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..1227 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 transl_table 11 codon_start 1 locus_tag LOCUS_51790 gene queA CDS 1301..1972 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 transl_table 11 codon_start 1 locus_tag LOCUS_51800 gene ispD CDS 2020..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS 2890..4122 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 transl_table 11 codon_start 1 locus_tag LOCUS_51820 gene yegT sequence395 source 1..4969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS 1011..1820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS 1817..2389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS 2386..3177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS 3195..3719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 sequence396 source 1..4959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2952..4298 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 sequence397 source 1..4925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1058 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943764.1:3-deoxy-7-phosphoheptulonate synthase locus_tag LOCUS_51890 CDS complement(1115..1831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS complement(2123..2542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS complement(2616..3434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS 4018..4596 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109260.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 sequence398 source 1..4896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 829..3198 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS 3198..3683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51950 sequence399 source 1..4893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS complement(1050..1361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS complement(1718..1972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS 2036..2971 product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 sequence400 source 1..4884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..1027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS 1092..1610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 1620..2495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS 2535..3008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS 3110..3970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52040 sequence401 source 1..4873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 728..1894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS 1991..3187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(3193..3567) product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 gene groES-2 sequence402 source 1..4864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1543) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS complement(1674..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS 2741..3556 product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 transl_table 11 codon_start 1 locus_tag LOCUS_52100 gene kce CDS 3553..4236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52110 sequence403 source 1..4831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..1084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS complement(1292..3919) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS complement(3916..4248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52140 sequence404 source 1..4806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 449..907 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 1029..2489 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS 2496..2999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 2999..3502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS 3549..4067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS 4124..4783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52200 sequence405 source 1..4800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1745..2320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS complement(2426..3469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS complement(3982..4419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52230 sequence406 source 1..4748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 481..804 product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 gene tfoX CDS 1784..2533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS complement(2545..2817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 3154..4593 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 sequence407 source 1..4707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(985..1572) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS complement(1574..2968) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 transl_table 11 codon_start 1 locus_tag LOCUS_52290 gene leuC CDS complement(2970..4133) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 transl_table 11 codon_start 1 locus_tag LOCUS_52300 gene leuA sequence408 source 1..4647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 503..1372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 1477..3894 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 sequence409 source 1..4609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(579..1910) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 transl_table 11 codon_start 1 locus_tag LOCUS_52340 gene argH CDS complement(1962..3020) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(3017..3808) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 transl_table 11 codon_start 1 locus_tag LOCUS_52360 gene argB misc_feature complement(3808..>4609) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1E9:N-acetylornithine carbamoyltransferase locus_tag LOCUS_52370 sequence410 source 1..4585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..1029 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS 2119..2760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS 2797..3450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 3523..4167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52410 sequence411 source 1..4573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..1431) product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS complement(1767..2132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(2129..2788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS complement(2881..3465) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 misc_feature complement(3688..>4573) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122637.1:sulfate permease locus_tag LOCUS_52460 sequence412 source 1..4546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 693..2078 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 transl_table 11 codon_start 1 locus_tag LOCUS_52470 gene speA CDS 2125..3129 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108892.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(3134..3589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS complement(3690..4034) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 gene arsC sequence413 source 1..4527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1200) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS complement(1203..2075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691887.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS complement(2112..2504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52530 sequence414 source 1..4515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 991..1152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS 1293..2438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 2475..3875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52560 sequence415 source 1..4492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS 918..1742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 1851..3137 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 transl_table 11 codon_start 1 locus_tag LOCUS_52590 gene gltA sequence416 source 1..4486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..2998 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 sequence417 source 1..4472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..1069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS 1383..2648 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 gene hemA sequence418 source 1..4470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..1054) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS complement(1062..1886) product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 gene yyaK CDS complement(1889..3154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52650 misc_feature complement(3416..>4470) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin locus_tag LOCUS_52660 sequence419 source 1..4462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS 923..1828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS 1839..2738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS 3029..3805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 sequence420 source 1..4432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..912 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein locus_tag LOCUS_52710 CDS 983..1570 product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS 1685..2365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS 2564..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS 3482..4024 product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 sequence421 source 1..4369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(684..1049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS 1228..1671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS 1668..2693 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 transl_table 11 codon_start 1 locus_tag LOCUS_52780 gene apbE CDS 2690..2917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS 2902..4134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 sequence422 source 1..4358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(550..1245) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS complement(1238..2311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS complement(2323..2910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS 3172..4089 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 gene mrsF sequence423 source 1..4355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6Z2:phosphoribosylformylglycinamidine synthase locus_tag LOCUS_52850 sequence424 source 1..4331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..702 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_52860 CDS 801..1409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS complement(1833..4256) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 sequence425 source 1..4312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 250..1101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS complement(1271..1456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS 1554..3392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS 3398..4147 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 sequence426 source 1..4288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 641..1183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS 1502..1849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52950 sequence427 source 1..4259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 691..966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS 1024..2823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 sequence428 source 1..4255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..2855) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 sequence429 source 1..4253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..2582 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 2589..3674 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 sequence430 source 1..4221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..710 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS complement(829..1185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS 1340..1900 product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 1897..2307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS complement(2304..3377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS complement(3539..3688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 sequence431 source 1..4092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..574 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107493.1:sensor histidine kinase locus_tag LOCUS_53070 CDS 1644..2027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44075 transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 2125..3015 product homocysteine S-methyltransferase YbgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31463 transl_table 11 codon_start 1 locus_tag LOCUS_53090 gene ybgG CDS 3008..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53100 sequence432 source 1..4068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53110 misc_feature complement(724..>4068) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:alkaline phosphatase locus_tag LOCUS_53120 sequence433 source 1..4048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1624..1836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS complement(2038..2817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53140 sequence434 source 1..4039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence435 source 1..4024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS complement(1197..2879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS complement(2872..3246) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS 3549..3881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53180 sequence436 source 1..3990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1701..2618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53190 sequence437 source 1..3966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..629 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797789.1:isochorismatase locus_tag LOCUS_53200 CDS 689..1546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53210 tRNA 2070..2142 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(2420..3427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 sequence438 source 1..3938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(691..1641) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083082.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 gene mocA sequence439 source 1..3901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 721..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS 1054..3651 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 sequence440 source 1..3853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309936.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS complement(1178..2080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS complement(2162..3001) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 misc_feature complement(3135..>3853) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464393.1:alpha/beta hydrolase locus_tag LOCUS_53290 sequence441 source 1..3846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(1261..1950) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(1943..3478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53320 sequence442 source 1..3817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS 911..2371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55908 transl_table 11 codon_start 1 locus_tag LOCUS_53340 gene ycgA CDS complement(2368..3699) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 sequence443 source 1..3781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..1171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS complement(1202..1654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53370 sequence444 source 1..3725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 652..1629 product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 gene pdhB CDS 1691..2188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS 2248..2958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53400 misc_feature complement(2955..>3725) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RB9:signal recognition particle protein locus_tag LOCUS_53410 sequence445 source 1..3689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1276..2898 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 transl_table 11 codon_start 1 locus_tag LOCUS_53420 gene dnaB sequence446 source 1..3685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS 1031..2134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS 2765..3529 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 sequence447 source 1..3654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..2636) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 sequence448 source 1..3634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1425) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 transl_table 11 codon_start 1 locus_tag LOCUS_53470 gene natB CDS complement(1422..2342) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 gene natA CDS complement(2483..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53490 sequence449 source 1..3621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(337..1230) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 transl_table 11 codon_start 1 locus_tag LOCUS_53500 gene menA CDS complement(1232..1744) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 transl_table 11 codon_start 1 locus_tag LOCUS_53510 misc_feature complement(1746..>3621) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A3X5:arginine--tRNA ligase locus_tag LOCUS_53520 sequence450 source 1..3603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1565 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490383.1:peptidase M23 locus_tag LOCUS_53530 CDS complement(1675..2229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS complement(2419..2646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 sequence451 source 1..3586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1136..1705 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 transl_table 11 codon_start 1 locus_tag LOCUS_53560 CDS 1770..3221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53570 sequence452 source 1..3581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 617..1291 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS 1546..1803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS complement(1865..2494) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 transl_table 11 codon_start 1 locus_tag LOCUS_53600 gene fkpA CDS complement(2646..3350) product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 transl_table 11 codon_start 1 locus_tag LOCUS_53610 gene crtO sequence453 source 1..3578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1634..2656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53620 sequence454 source 1..3577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..668 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957837.1:radical SAM protein locus_tag LOCUS_53630 CDS complement(1106..1282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS complement(1343..2131) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS 2223..2996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53660 sequence455 source 1..3569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS 303..890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS complement(887..1786) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 1966..2292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS complement(2298..2978) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 sequence456 source 1..3549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1836 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108758.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_53720 sequence457 source 1..3538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q45585:ECF RNA polymerase sigma factor SigW locus_tag LOCUS_53730 CDS 1370..1996 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 transl_table 11 codon_start 1 locus_tag LOCUS_53740 gene rsmG CDS complement(1990..2385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53750 misc_feature complement(2463..>3538) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964122.1:ABC transporter permease locus_tag LOCUS_53760 sequence458 source 1..3507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(853..1221) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 1371..2525 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 transl_table 11 codon_start 1 locus_tag LOCUS_53780 sequence459 source 1..3474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 735..1883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS 1987..2808 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 transl_table 11 codon_start 1 locus_tag LOCUS_53800 sequence460 source 1..3458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 433..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS 1330..1548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS 1627..2034 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS 2170..2622 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 sequence461 source 1..3434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence462 source 1..3419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS complement(1578..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS complement(2005..2742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 sequence463 source 1..3401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(521..3127) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 sequence464 source 1..3399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 sequence465 source 1..3375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1032..1439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS complement(1451..2620) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 misc_feature complement(2641..>3375) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765880.1:glycosyl transferase locus_tag LOCUS_53920 sequence466 source 1..3345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..2897 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 gene acnA sequence467 source 1..3335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 308..1942 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS 1942..2664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53950 sequence468 source 1..3326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..821 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000755373.1:PAS domain-containing sensor histidine kinase locus_tag LOCUS_53960 sequence469 source 1..3282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864662.1:prephenate dehydrogenase locus_tag LOCUS_53970 CDS 880..1725 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS 1807..2151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53990 misc_feature complement(2207..>3282) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_54000 sequence470 source 1..3258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1272 product secretion protein HylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919655.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 sequence471 source 1..3247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1445..2782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS complement(2788..3108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 sequence472 source 1..3198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54040 note possible pseudo, internal stop codon CDS 820..1371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 1390..2412 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 transl_table 11 codon_start 1 locus_tag LOCUS_54060 gene lpxD sequence473 source 1..3184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1306 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963916.1:multidrug transporter AcrB locus_tag LOCUS_54070 CDS 1454..1642 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS complement(1746..2333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54090 sequence474 source 1..3182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..1173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(1252..1998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54110 misc_feature complement(2098..>3182) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:multidrug transporter AcrB locus_tag LOCUS_54120 sequence475 source 1..3144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 386..1570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 1646..1783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54140 sequence476 source 1..3111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS 618..1148 product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 1183..1623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS 1648..2445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54180 sequence477 source 1..3099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1301..1810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS complement(1807..2442) product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 transl_table 11 codon_start 1 locus_tag LOCUS_54200 gene pnuC CDS 2553..3023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54210 sequence478 source 1..3063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1025..2563 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 transl_table 11 codon_start 1 locus_tag LOCUS_54220 sequence479 source 1..3026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(989..2137) product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 sequence480 source 1..3011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..2006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS 2003..2701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54250 sequence481 source 1..3000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..1627) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS 2178..2927 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NN63 transl_table 11 codon_start 1 locus_tag LOCUS_54270 gene rhmA sequence482 source 1..2985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(733..1509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54280 sequence483 source 1..2973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS 826..2652 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602099.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 sequence484 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..990 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS 1073..1627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS 1741..2826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54330 sequence485 source 1..2850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..919) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035514.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS 1040..1423 product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS 1423..2361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54360 sequence486 source 1..2822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..1473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54370 CDS complement(2031..2432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54380 sequence487 source 1..2817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..2130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54390 sequence488 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(538..>2787) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_54400 sequence489 source 1..2648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..1118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS complement(1245..1754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54420 sequence490 source 1..2634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 misc_feature complement(761..>2634) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_54440 sequence491 source 1..2628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..1165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54450 sequence492 source 1..2623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence493 source 1..2617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..1477 product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(1507..2193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54470 sequence494 source 1..2610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 710..2152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54480 sequence495 source 1..2590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(939..1475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS complement(1877..2524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54500 sequence496 source 1..2581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..1171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS complement(1673..2539) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 sequence497 source 1..2580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS 1505..2527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54540 sequence498 source 1..2573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..1168) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 transl_table 11 codon_start 1 locus_tag LOCUS_54550 sequence499 source 1..2537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..673 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876079.1:sensory transduction regulatory protein locus_tag LOCUS_54560 sequence500 source 1..2508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence501 source 1..2493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1653 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 sequence502 source 1..2476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence503 source 1..2448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1431 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_54580 CDS complement(1508..2446) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 transl_table 11 codon_start 1 locus_tag LOCUS_54590 sequence504 source 1..2437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS complement(965..1990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54610 sequence505 source 1..2435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS complement(495..2228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54630 sequence506 source 1..2378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence507 source 1..2377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 sequence508 source 1..2316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS 665..1438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS 1595..2044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54670 sequence509 source 1..2315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS 653..1300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS complement(1312..1827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54700 sequence510 source 1..2291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence511 source 1..2254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..880) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS complement(882..1664) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 transl_table 11 codon_start 1 locus_tag LOCUS_54720 gene lpxA misc_feature complement(1661..>2254) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A015:bifunctional enzyme LpxC/FabZ locus_tag LOCUS_54730 sequence512 source 1..2250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..1124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS complement(1148..1864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54750 sequence513 source 1..2218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(449..>2218) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein locus_tag LOCUS_54760 sequence514 source 1..2209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence515 source 1..2192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(408..920) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS 1039..1833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS complement(1830..2132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54790 sequence516 source 1..2150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(664..>2150) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_54800 sequence517 source 1..2132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(992..1852) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE6 transl_table 11 codon_start 1 locus_tag LOCUS_54810 gene hisG sequence518 source 1..2126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..1657 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 sequence519 source 1..2115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..1108 product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(1164..1580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54840 sequence520 source 1..2104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038548.1:tail-specific protease locus_tag LOCUS_54850 sequence521 source 1..2051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1337 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_54860 CDS complement(1453..2049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54870 sequence522 source 1..2041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(545..1507) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 transl_table 11 codon_start 1 locus_tag LOCUS_54880 sequence523 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS 771..1232 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 transl_table 11 codon_start 1 locus_tag LOCUS_54900 sequence524 source 1..2013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..384) product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727587.1 transl_table 11 codon_start 1 locus_tag LOCUS_54910 sequence525 source 1..1988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54920 sequence526 source 1..1910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence527 source 1..1826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..695 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 transl_table 11 codon_start 1 locus_tag LOCUS_54930 gene mrsA CDS complement(1055..1573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54940 sequence528 source 1..1818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..689 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 gene folB CDS 686..1546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881733.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 sequence529 source 1..1807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..1314 product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 sequence530 source 1..1806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 763..837 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1011..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS complement(1162..1590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54990 sequence531 source 1..1722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence532 source 1..1706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(720..1622) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 sequence533 source 1..1699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 760..1539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 sequence534 source 1..1684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDJ0:phosphoribosylglycinamide formyltransferase 2 locus_tag LOCUS_55020 sequence535 source 1..1624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..823 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920196.1:short-chain dehydrogenase locus_tag LOCUS_55030 sequence536 source 1..1521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..904 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_55040