>Feature sequence001 1031 201 gene locus_tag LOCUS_00010 1031 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3401 1041 gene locus_tag LOCUS_00020 3401 1041 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_00020 3729 4703 gene locus_tag LOCUS_00030 3729 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4700 5458 gene locus_tag LOCUS_00040 4700 5458 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_00040 6054 5599 gene locus_tag LOCUS_00050 6054 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6819 6421 gene locus_tag LOCUS_00060 6819 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8216 6849 gene locus_tag LOCUS_00070 8216 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10188 8377 gene locus_tag LOCUS_00080 gene aepA 10188 8377 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_00080 10929 10399 gene locus_tag LOCUS_00090 10929 10399 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_00090 12345 10942 gene locus_tag LOCUS_00100 12345 10942 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_00100 12797 12342 gene locus_tag LOCUS_00110 12797 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 protein_id gnl|my_center|LOCUS_00110 13287 12802 gene locus_tag LOCUS_00120 13287 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_00120 14070 13312 gene locus_tag LOCUS_00130 14070 13312 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037323.1 protein_id gnl|my_center|LOCUS_00130 14984 14211 gene locus_tag LOCUS_00140 14984 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17262 15328 gene locus_tag LOCUS_00150 17262 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17756 17361 gene locus_tag LOCUS_00160 17756 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18239 17763 gene locus_tag LOCUS_00170 18239 17763 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_00170 18544 24909 gene locus_tag LOCUS_00180 18544 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25044 25799 gene locus_tag LOCUS_00190 25044 25799 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673995.1 protein_id gnl|my_center|LOCUS_00190 25990 25796 gene locus_tag LOCUS_00200 25990 25796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26360 29059 gene locus_tag LOCUS_00210 26360 29059 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107962.1 protein_id gnl|my_center|LOCUS_00210 29264 30601 gene locus_tag LOCUS_00220 gene xylE 29264 30601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_00220 30699 33395 gene locus_tag LOCUS_00230 30699 33395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_00230 33495 35093 gene locus_tag LOCUS_00240 33495 35093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 35598 35197 gene locus_tag LOCUS_00250 35598 35197 CDS product flavin-containing amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 protein_id gnl|my_center|LOCUS_00250 36052 35606 gene locus_tag LOCUS_00260 36052 35606 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709458.1 protein_id gnl|my_center|LOCUS_00260 36534 36070 gene locus_tag LOCUS_00270 36534 36070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_00270 36757 38004 gene locus_tag LOCUS_00280 36757 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38080 39144 gene locus_tag LOCUS_00290 38080 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39148 39447 gene locus_tag LOCUS_00300 39148 39447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40313 39489 gene locus_tag LOCUS_00310 40313 39489 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388004.1 protein_id gnl|my_center|LOCUS_00310 40417 41214 gene locus_tag LOCUS_00320 40417 41214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41214 42026 gene locus_tag LOCUS_00330 41214 42026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42023 44074 gene locus_tag LOCUS_00340 42023 44074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108865.1 protein_id gnl|my_center|LOCUS_00340 44289 44504 gene locus_tag LOCUS_00350 44289 44504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45251 44955 gene locus_tag LOCUS_00360 45251 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45361 45285 gene locus_tag LOCUS_t00010 45361 45285 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 46369 45539 gene locus_tag LOCUS_00370 46369 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48054 46432 gene locus_tag LOCUS_00380 48054 46432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 48425 48126 gene locus_tag LOCUS_00390 48425 48126 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_00390 49048 48422 gene locus_tag LOCUS_00400 49048 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_00400 49640 49134 gene locus_tag LOCUS_00410 49640 49134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50988 49648 gene locus_tag LOCUS_00420 gene pyrC1 50988 49648 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_00420 51157 52464 gene locus_tag LOCUS_00430 51157 52464 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_00430 52509 53426 gene locus_tag LOCUS_00440 52509 53426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54440 53499 gene locus_tag LOCUS_00450 54440 53499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56059 54554 gene locus_tag LOCUS_00460 56059 54554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56222 59128 gene locus_tag LOCUS_00470 gene gcvP 56222 59128 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_00470 59294 59614 gene locus_tag LOCUS_00480 59294 59614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 60454 59717 gene locus_tag LOCUS_00490 60454 59717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 61590 60451 gene locus_tag LOCUS_00500 61590 60451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61852 61625 gene locus_tag LOCUS_00510 61852 61625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63497 62616 gene locus_tag LOCUS_00520 gene lipA 63497 62616 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_00520 64285 63566 gene locus_tag LOCUS_00530 64285 63566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64400 64750 gene locus_tag LOCUS_00540 gene osmC 64400 64750 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_00540 65493 64816 gene locus_tag LOCUS_00550 65493 64816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67214 65535 gene locus_tag LOCUS_00560 67214 65535 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_00560 67316 68554 gene locus_tag LOCUS_00570 67316 68554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68669 68890 gene locus_tag LOCUS_00580 68669 68890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_00580 69068 70810 gene locus_tag LOCUS_00590 69068 70810 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_00590 70814 71434 gene locus_tag LOCUS_00600 70814 71434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence002 119 382 gene locus_tag LOCUS_00610 119 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 415 672 gene locus_tag LOCUS_00620 415 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 722 973 gene locus_tag LOCUS_00630 722 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2099 1140 gene locus_tag LOCUS_00640 2099 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 2936 2466 gene locus_tag LOCUS_00650 2936 2466 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_00650 3272 2994 gene locus_tag LOCUS_00660 3272 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3572 3330 gene locus_tag LOCUS_00670 3572 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00670 4226 3576 gene locus_tag LOCUS_00680 4226 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_00680 4608 4231 gene locus_tag LOCUS_00690 4608 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4721 6223 gene locus_tag LOCUS_00700 4721 6223 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_00700 6318 6752 gene locus_tag LOCUS_00710 6318 6752 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_00710 6781 7125 gene locus_tag LOCUS_00720 6781 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_00720 7317 8567 gene locus_tag LOCUS_00730 gene rpoE 7317 8567 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_00730 8867 9289 gene locus_tag LOCUS_00740 8867 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9390 9908 gene locus_tag LOCUS_00750 9390 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9901 10323 gene locus_tag LOCUS_00760 9901 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10328 11197 gene locus_tag LOCUS_00770 10328 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11218 11706 gene locus_tag LOCUS_00780 11218 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11703 12311 gene locus_tag LOCUS_00790 11703 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_00790 13192 12443 gene locus_tag LOCUS_00800 13192 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_00800 13298 13801 gene locus_tag LOCUS_00810 13298 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 13849 14319 gene locus_tag LOCUS_00820 13849 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14339 14755 gene locus_tag LOCUS_00830 14339 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 14776 15627 gene locus_tag LOCUS_00840 14776 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 15624 16289 gene locus_tag LOCUS_00850 15624 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 18072 17101 gene locus_tag LOCUS_00860 18072 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 18224 18631 gene locus_tag LOCUS_00870 18224 18631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_00870 19763 18657 gene locus_tag LOCUS_00880 19763 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 22352 20193 gene locus_tag LOCUS_00890 22352 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 22798 24024 gene locus_tag LOCUS_00900 22798 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 24026 25231 gene locus_tag LOCUS_00910 24026 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_00910 25253 25504 gene locus_tag LOCUS_00920 25253 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 25658 27682 gene locus_tag LOCUS_00930 25658 27682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 27704 28315 gene locus_tag LOCUS_00940 gene bioD 27704 28315 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_00940 28308 29594 gene locus_tag LOCUS_00950 gene bioA 28308 29594 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_00950 29770 30501 gene locus_tag LOCUS_00960 29770 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 31664 30534 gene locus_tag LOCUS_00970 31664 30534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 32045 35134 gene locus_tag LOCUS_00980 32045 35134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00980 36191 35166 gene locus_tag LOCUS_00990 36191 35166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_00990 37189 36212 gene locus_tag LOCUS_01000 37189 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_01000 37859 37374 gene locus_tag LOCUS_01010 37859 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 38206 37934 gene locus_tag LOCUS_01020 38206 37934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 38583 38344 gene locus_tag LOCUS_01030 38583 38344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 39130 38594 gene locus_tag LOCUS_01040 39130 38594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 40462 39275 gene locus_tag LOCUS_01050 40462 39275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41579 40512 gene locus_tag LOCUS_01060 41579 40512 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_01060 42066 41650 gene locus_tag LOCUS_01070 42066 41650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 42496 42137 gene locus_tag LOCUS_01080 42496 42137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_01080 42601 43248 gene locus_tag LOCUS_01090 42601 43248 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_01090 44019 43462 gene locus_tag LOCUS_01100 44019 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030373.1 protein_id gnl|my_center|LOCUS_01100 44769 44158 gene locus_tag LOCUS_01110 44769 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_01110 45432 46193 gene locus_tag LOCUS_01120 45432 46193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 46782 46450 gene locus_tag LOCUS_01130 46782 46450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 47805 46942 gene locus_tag LOCUS_01140 47805 46942 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_01140 48344 47949 gene locus_tag LOCUS_01150 48344 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 48791 48345 gene locus_tag LOCUS_01160 48791 48345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 49281 48805 gene locus_tag LOCUS_01170 49281 48805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 50092 49403 gene locus_tag LOCUS_01180 50092 49403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 50812 50174 gene locus_tag LOCUS_01190 50812 50174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 52442 51096 gene locus_tag LOCUS_01200 52442 51096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 53122 52475 gene locus_tag LOCUS_01210 53122 52475 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_01210 53800 53249 gene locus_tag LOCUS_01220 53800 53249 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_01220 55989 54016 gene locus_tag LOCUS_01230 55989 54016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 57432 56098 gene locus_tag LOCUS_01240 gene bfmBB 57432 56098 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_01240 58756 57509 gene locus_tag LOCUS_01250 58756 57509 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_01250 60087 58918 gene locus_tag LOCUS_01260 gene metZ 60087 58918 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_01260 60385 60813 gene locus_tag LOCUS_01270 60385 60813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 60970 61347 gene locus_tag LOCUS_01280 60970 61347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 61666 61349 gene locus_tag LOCUS_01290 61666 61349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 61792 62580 gene locus_tag LOCUS_01300 61792 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 64038 62800 gene locus_tag LOCUS_01310 gene fabF 64038 62800 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_01310 64631 64035 gene locus_tag LOCUS_01320 64631 64035 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886682.1 protein_id gnl|my_center|LOCUS_01320 64714 65256 gene locus_tag LOCUS_01330 64714 65256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 65537 65253 gene locus_tag LOCUS_01340 65537 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 65621 68005 gene locus_tag LOCUS_01350 65621 68005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_01350 69053 68016 gene locus_tag LOCUS_01360 69053 68016 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968959.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence003 814 2121 gene locus_tag LOCUS_01370 814 2121 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_01370 2126 3091 gene locus_tag LOCUS_01380 2126 3091 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_01380 3953 3093 gene locus_tag LOCUS_01390 3953 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4974 3955 gene locus_tag LOCUS_01400 gene pheS 4974 3955 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_01400 5058 6071 gene locus_tag LOCUS_01410 gene galE 5058 6071 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_01410 6186 7499 gene locus_tag LOCUS_01420 6186 7499 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_01420 7499 8482 gene locus_tag LOCUS_01430 7499 8482 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_01430 8524 9930 gene locus_tag LOCUS_01440 8524 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_01440 11310 9931 gene locus_tag LOCUS_01450 gene wcaJ 11310 9931 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_01450 12843 11404 gene locus_tag LOCUS_01460 12843 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13174 13833 gene locus_tag LOCUS_01470 13174 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_01470 13830 14510 gene locus_tag LOCUS_01480 13830 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14507 16192 gene locus_tag LOCUS_01490 14507 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 17265 16210 gene locus_tag LOCUS_01500 17265 16210 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_01500 18069 17293 gene locus_tag LOCUS_01510 gene wecG 18069 17293 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 protein_id gnl|my_center|LOCUS_01510 19204 18062 gene locus_tag LOCUS_01520 19204 18062 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_01520 20346 19201 gene locus_tag LOCUS_01530 20346 19201 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_01530 21764 20343 gene locus_tag LOCUS_01540 21764 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 22663 21761 gene locus_tag LOCUS_01550 22663 21761 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_01550 23692 22670 gene locus_tag LOCUS_01560 23692 22670 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 protein_id gnl|my_center|LOCUS_01560 23899 24684 gene locus_tag LOCUS_01570 23899 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 25909 24671 gene locus_tag LOCUS_01580 gene rfbX 25909 24671 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739384.1 protein_id gnl|my_center|LOCUS_01580 27092 26022 gene locus_tag LOCUS_01590 27092 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 29661 27097 gene locus_tag LOCUS_01600 29661 27097 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_01600 30888 29761 gene locus_tag LOCUS_01610 30888 29761 CDS product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_01610 31002 32051 gene locus_tag LOCUS_01620 gene rmlB 31002 32051 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_01620 32048 32596 gene locus_tag LOCUS_01630 gene rfbC 32048 32596 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_01630 32603 33466 gene locus_tag LOCUS_01640 gene rfbA 32603 33466 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_01640 35267 33816 gene locus_tag LOCUS_01650 35267 33816 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312011.1 protein_id gnl|my_center|LOCUS_01650 35625 35341 gene locus_tag LOCUS_01660 35625 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 36721 35831 gene locus_tag LOCUS_01670 36721 35831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 37750 36749 gene locus_tag LOCUS_01680 37750 36749 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_01680 38759 37767 gene locus_tag LOCUS_01690 38759 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 39526 38759 gene locus_tag LOCUS_01700 39526 38759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 40641 39553 gene locus_tag LOCUS_01710 gene rgpA 40641 39553 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905197.1 protein_id gnl|my_center|LOCUS_01710 41549 40644 gene locus_tag LOCUS_01720 41549 40644 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_01720 42600 41614 gene locus_tag LOCUS_01730 42600 41614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 43388 42597 gene locus_tag LOCUS_01740 43388 42597 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_01740 44403 43474 gene locus_tag LOCUS_01750 44403 43474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 45354 45701 gene locus_tag LOCUS_01760 45354 45701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 46934 45759 gene locus_tag LOCUS_01770 46934 45759 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022165.1 protein_id gnl|my_center|LOCUS_01770 48045 47011 gene locus_tag LOCUS_01780 48045 47011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 50879 48303 gene locus_tag LOCUS_01790 50879 48303 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_01790 51831 51082 gene locus_tag LOCUS_01800 51831 51082 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_01800 52856 51828 gene locus_tag LOCUS_01810 gene fcl 52856 51828 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJA1 protein_id gnl|my_center|LOCUS_01810 53958 52849 gene locus_tag LOCUS_01820 gene gmd 53958 52849 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 protein_id gnl|my_center|LOCUS_01820 55488 54286 gene locus_tag LOCUS_01830 55488 54286 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_01830 56574 55489 gene locus_tag LOCUS_01840 56574 55489 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_01840 58171 56564 gene locus_tag LOCUS_01850 58171 56564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039947.1 protein_id gnl|my_center|LOCUS_01850 60281 58161 gene locus_tag LOCUS_01860 60281 58161 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_01860 <61711 60286 gene locus_tag LOCUS_01870 <61711 60286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222482.1:asparagine synthetase B >Feature sequence004 49 903 gene locus_tag LOCUS_01880 49 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 911 1696 gene locus_tag LOCUS_01890 911 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1718 2707 gene locus_tag LOCUS_01900 1718 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 2842 3480 gene locus_tag LOCUS_01910 2842 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4516 3512 gene locus_tag LOCUS_01920 4516 3512 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_01920 4593 5003 gene locus_tag LOCUS_01930 4593 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5849 5043 gene locus_tag LOCUS_01940 5849 5043 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_01940 6951 5953 gene locus_tag LOCUS_01950 6951 5953 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_01950 7773 7000 gene locus_tag LOCUS_01960 7773 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_01960 8013 8810 gene locus_tag LOCUS_01970 8013 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8900 9514 gene locus_tag LOCUS_01980 8900 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9520 10653 gene locus_tag LOCUS_01990 9520 10653 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_01990 11563 10751 gene locus_tag LOCUS_02000 11563 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11889 12464 gene locus_tag LOCUS_02010 11889 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 13604 12522 gene locus_tag LOCUS_02020 13604 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_02020 13974 13669 gene locus_tag LOCUS_02030 13974 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 14657 14214 gene locus_tag LOCUS_02040 14657 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 16414 14660 gene locus_tag LOCUS_02050 16414 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 17603 16419 gene locus_tag LOCUS_02060 17603 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_02060 18877 17600 gene locus_tag LOCUS_02070 18877 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 19581 18874 gene locus_tag LOCUS_02080 19581 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 23327 19578 gene locus_tag LOCUS_02090 23327 19578 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_02090 23767 23396 gene locus_tag LOCUS_02100 23767 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 24347 23850 gene locus_tag LOCUS_02110 24347 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 25011 24442 gene locus_tag LOCUS_02120 25011 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 25543 25094 gene locus_tag LOCUS_02130 25543 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 26171 25614 gene locus_tag LOCUS_02140 26171 25614 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771481.1 protein_id gnl|my_center|LOCUS_02140 27334 26174 gene locus_tag LOCUS_02150 27334 26174 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_02150 29036 27309 gene locus_tag LOCUS_02160 29036 27309 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_02160 29176 29961 gene locus_tag LOCUS_02170 gene dnrN 29176 29961 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_02170 29961 30374 gene locus_tag LOCUS_02180 29961 30374 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_02180 30376 30930 gene locus_tag LOCUS_02190 gene def 30376 30930 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_02190 30934 31347 gene locus_tag LOCUS_02200 30934 31347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 31546 31869 gene locus_tag LOCUS_02210 31546 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 31902 34520 gene locus_tag LOCUS_02220 31902 34520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_02220 35507 34671 gene locus_tag LOCUS_02230 35507 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 35740 37419 gene locus_tag LOCUS_02240 35740 37419 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_02240 38939 37491 gene locus_tag LOCUS_02250 38939 37491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 39382 38936 gene locus_tag LOCUS_02260 39382 38936 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705203.1 protein_id gnl|my_center|LOCUS_02260 40301 39420 gene locus_tag LOCUS_02270 40301 39420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 40989 40285 gene locus_tag LOCUS_02280 40989 40285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 41360 41088 gene locus_tag LOCUS_02290 41360 41088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 41641 41360 gene locus_tag LOCUS_02300 41641 41360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_02300 43958 42012 gene locus_tag LOCUS_02310 43958 42012 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_02310 44357 43962 gene locus_tag LOCUS_02320 44357 43962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 45157 44357 gene locus_tag LOCUS_02330 45157 44357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 46187 45159 gene locus_tag LOCUS_02340 46187 45159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 46636 46184 gene locus_tag LOCUS_02350 46636 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 46848 46633 gene locus_tag LOCUS_02360 46848 46633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 48067 46841 gene locus_tag LOCUS_02370 48067 46841 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_02370 49707 48094 gene locus_tag LOCUS_02380 49707 48094 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_02380 50498 49806 gene locus_tag LOCUS_02390 50498 49806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230948.1 protein_id gnl|my_center|LOCUS_02390 50995 51750 gene locus_tag LOCUS_02400 50995 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 52591 51962 gene locus_tag LOCUS_02410 52591 51962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 53166 52597 gene locus_tag LOCUS_02420 53166 52597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 53699 53172 gene locus_tag LOCUS_02430 53699 53172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182396.1 protein_id gnl|my_center|LOCUS_02430 54084 53743 gene locus_tag LOCUS_02440 54084 53743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 54786 54229 gene locus_tag LOCUS_02450 54786 54229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 55831 54845 gene locus_tag LOCUS_02460 55831 54845 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_02460 56857 55907 gene locus_tag LOCUS_02470 56857 55907 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_02470 58140 56974 gene locus_tag LOCUS_02480 58140 56974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence005 217 1188 gene locus_tag LOCUS_02490 217 1188 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02490 1406 2617 gene locus_tag LOCUS_02500 1406 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2648 3466 gene locus_tag LOCUS_02510 2648 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3518 5095 gene locus_tag LOCUS_02520 3518 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5109 6101 gene locus_tag LOCUS_02530 5109 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 7942 6134 gene locus_tag LOCUS_02540 gene uvrC 7942 6134 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_02540 10278 7942 gene locus_tag LOCUS_02550 gene mrcA 10278 7942 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_02550 12863 10284 gene locus_tag LOCUS_02560 gene sprE 12863 10284 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_02560 12968 13822 gene locus_tag LOCUS_02570 12968 13822 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_02570 13848 14276 gene locus_tag LOCUS_02580 13848 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 15358 14273 gene locus_tag LOCUS_02590 15358 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_02590 16380 15355 gene locus_tag LOCUS_02600 16380 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 16565 16759 gene locus_tag LOCUS_02610 16565 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 16792 17205 gene locus_tag LOCUS_02620 16792 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 17202 18305 gene locus_tag LOCUS_02630 gene atpB 17202 18305 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_02630 18358 18591 gene locus_tag LOCUS_02640 18358 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 18680 19174 gene locus_tag LOCUS_02650 gene atpF 18680 19174 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_02650 19184 19741 gene locus_tag LOCUS_02660 gene atpH 19184 19741 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_02660 19773 21347 gene locus_tag LOCUS_02670 gene atpA 19773 21347 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_02670 21391 22266 gene locus_tag LOCUS_02680 gene atpG 21391 22266 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_02680 22330 23142 gene locus_tag LOCUS_02690 22330 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499927.1 protein_id gnl|my_center|LOCUS_02690 23139 23759 gene locus_tag LOCUS_02700 23139 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 29434 23756 gene locus_tag LOCUS_02710 29434 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 36594 29704 gene locus_tag LOCUS_02720 36594 29704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 43306 36965 gene locus_tag LOCUS_02730 43306 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 50254 43505 gene locus_tag LOCUS_02740 50254 43505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 51615 50467 gene locus_tag LOCUS_02750 51615 50467 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_02750 53805 51709 gene locus_tag LOCUS_02760 53805 51709 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_02760 54377 53826 gene locus_tag LOCUS_02770 54377 53826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence006 22 186 gene locus_tag LOCUS_02780 22 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 219 575 gene locus_tag LOCUS_02790 219 575 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_02790 640 1362 gene locus_tag LOCUS_02800 gene hisA 640 1362 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_02800 1474 2235 gene locus_tag LOCUS_02810 gene hisF 1474 2235 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_02810 2232 2846 gene locus_tag LOCUS_02820 gene hisI 2232 2846 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_02820 2900 3760 gene locus_tag LOCUS_02830 2900 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3987 4763 gene locus_tag LOCUS_02840 3987 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4876 5682 gene locus_tag LOCUS_02850 4876 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5698 6612 gene locus_tag LOCUS_02860 5698 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_02860 6888 7280 gene locus_tag LOCUS_02870 6888 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7612 7878 gene locus_tag LOCUS_02880 7612 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 8133 9944 gene locus_tag LOCUS_02890 8133 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12130 10331 gene locus_tag LOCUS_02900 12130 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 protein_id gnl|my_center|LOCUS_02900 14245 12797 gene locus_tag LOCUS_02910 14245 12797 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_02910 14398 16539 gene locus_tag LOCUS_02920 14398 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 16727 16942 gene locus_tag LOCUS_02930 16727 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 16956 17720 gene locus_tag LOCUS_02940 16956 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_02940 18248 17724 gene locus_tag LOCUS_02950 18248 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 18386 18775 gene locus_tag LOCUS_02960 18386 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 18778 21342 gene locus_tag LOCUS_02970 18778 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 32021 21471 gene locus_tag LOCUS_02980 32021 21471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 39381 32071 gene locus_tag LOCUS_02990 39381 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 41434 39956 gene locus_tag LOCUS_03000 41434 39956 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_03000 44515 41447 gene locus_tag LOCUS_03010 44515 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03010 44707 46053 gene locus_tag LOCUS_03020 44707 46053 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_03020 46594 46136 gene locus_tag LOCUS_03030 46594 46136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 47904 46600 gene locus_tag LOCUS_03040 gene dacB 47904 46600 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_03040 48902 48207 gene locus_tag LOCUS_03050 48902 48207 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_03050 48843 49010 gene locus_tag LOCUS_03060 48843 49010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 49570 49007 gene locus_tag LOCUS_03070 49570 49007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 50441 49644 gene locus_tag LOCUS_03080 50441 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836738.1 protein_id gnl|my_center|LOCUS_03080 52602 50494 gene locus_tag LOCUS_03090 52602 50494 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_03090 53891 52734 gene locus_tag LOCUS_03100 53891 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence007 <1 3232 gene locus_tag LOCUS_03110 <1 3232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C 3234 4844 gene locus_tag LOCUS_03120 3234 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5097 7199 gene locus_tag LOCUS_03130 5097 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7196 9301 gene locus_tag LOCUS_03140 7196 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 11327 9318 gene locus_tag LOCUS_03150 11327 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11585 12310 gene locus_tag LOCUS_03160 11585 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 12888 12490 gene locus_tag LOCUS_03170 12888 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 13604 34588 gene locus_tag LOCUS_03180 13604 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 34600 36228 gene locus_tag LOCUS_03190 34600 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 36384 36112 gene locus_tag LOCUS_03200 36384 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 36774 36394 gene locus_tag LOCUS_03210 36774 36394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 37401 37105 gene locus_tag LOCUS_03220 37401 37105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 37584 38114 gene locus_tag LOCUS_03230 37584 38114 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 protein_id gnl|my_center|LOCUS_03230 39136 38132 gene locus_tag LOCUS_03240 gene lldD 39136 38132 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_03240 40736 39426 gene locus_tag LOCUS_03250 40736 39426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 41099 40902 gene locus_tag LOCUS_03260 41099 40902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 41416 42462 gene locus_tag LOCUS_03270 41416 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 43490 42513 gene locus_tag LOCUS_03280 43490 42513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 43995 44183 gene locus_tag LOCUS_03290 43995 44183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 44173 45438 gene locus_tag LOCUS_03300 44173 45438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 45435 46193 gene locus_tag LOCUS_03310 45435 46193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 46197 49280 gene locus_tag LOCUS_03320 46197 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 49488 49799 gene locus_tag LOCUS_03330 49488 49799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 50034 51101 gene locus_tag LOCUS_03340 50034 51101 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence008 819 199 gene locus_tag LOCUS_03350 gene satA 819 199 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_03350 2682 934 gene locus_tag LOCUS_03360 2682 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2743 3876 gene locus_tag LOCUS_03370 2743 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_03370 4786 3854 gene locus_tag LOCUS_03380 4786 3854 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_03380 5118 4783 gene locus_tag LOCUS_03390 5118 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5587 5186 gene locus_tag LOCUS_03400 5587 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6277 5690 gene locus_tag LOCUS_03410 6277 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6908 6306 gene locus_tag LOCUS_03420 6908 6306 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 protein_id gnl|my_center|LOCUS_03420 7407 6922 gene locus_tag LOCUS_03430 7407 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705485.1 protein_id gnl|my_center|LOCUS_03430 7795 7388 gene locus_tag LOCUS_03440 7795 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8588 7980 gene locus_tag LOCUS_03450 8588 7980 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_03450 9222 8536 gene locus_tag LOCUS_03460 9222 8536 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_03460 11947 9437 gene locus_tag LOCUS_03470 11947 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12240 11953 gene locus_tag LOCUS_03480 gene gatC 12240 11953 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF4 protein_id gnl|my_center|LOCUS_03480 12968 12237 gene locus_tag LOCUS_03490 12968 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 13747 13091 gene locus_tag LOCUS_03500 13747 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 14426 13782 gene locus_tag LOCUS_03510 14426 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14502 14714 gene locus_tag LOCUS_03520 14502 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 15390 14716 gene locus_tag LOCUS_03530 15390 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 15823 15437 gene locus_tag LOCUS_03540 gene glbN 15823 15437 CDS product oxygen-binding heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228592.1 protein_id gnl|my_center|LOCUS_03540 17155 15905 gene locus_tag LOCUS_03550 17155 15905 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_03550 18474 17152 gene locus_tag LOCUS_03560 gene yqeZ 18474 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_03560 18623 19396 gene locus_tag LOCUS_03570 18623 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 19400 20323 gene locus_tag LOCUS_03580 19400 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20573 22105 gene locus_tag LOCUS_03590 20573 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 22242 22427 gene locus_tag LOCUS_03600 22242 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 22586 24148 gene locus_tag LOCUS_03610 22586 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 24514 24750 gene locus_tag LOCUS_03620 24514 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 24908 25516 gene locus_tag LOCUS_03630 24908 25516 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_03630 26521 25889 gene locus_tag LOCUS_03640 gene pyrE 26521 25889 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 protein_id gnl|my_center|LOCUS_03640 26638 27324 gene locus_tag LOCUS_03650 26638 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 27767 27312 gene locus_tag LOCUS_03660 gene coaD 27767 27312 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYU5 protein_id gnl|my_center|LOCUS_03660 28656 27790 gene locus_tag LOCUS_03670 28656 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 29251 28661 gene locus_tag LOCUS_03680 29251 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 29821 29330 gene locus_tag LOCUS_03690 29821 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 29867 30325 gene locus_tag LOCUS_03700 29867 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 30328 31728 gene locus_tag LOCUS_03710 30328 31728 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_03710 32017 33813 gene locus_tag LOCUS_03720 32017 33813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 33841 37437 gene locus_tag LOCUS_03730 33841 37437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 38091 37669 gene locus_tag LOCUS_03740 38091 37669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_03740 38809 38135 gene locus_tag LOCUS_03750 38809 38135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 39320 39006 gene locus_tag LOCUS_03760 39320 39006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 40304 39330 gene locus_tag LOCUS_03770 40304 39330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 40703 40326 gene locus_tag LOCUS_03780 40703 40326 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_03780 41387 40707 gene locus_tag LOCUS_03790 41387 40707 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_03790 41518 43071 gene locus_tag LOCUS_03800 41518 43071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_03800 43076 43714 gene locus_tag LOCUS_03810 43076 43714 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_03810 43714 44319 gene locus_tag LOCUS_03820 43714 44319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 45550 44501 gene locus_tag LOCUS_03830 45550 44501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_03830 46403 45543 gene locus_tag LOCUS_03840 46403 45543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 47313 46432 gene locus_tag LOCUS_03850 47313 46432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_03850 47488 47850 gene locus_tag LOCUS_03860 47488 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 47850 50234 gene locus_tag LOCUS_03870 gene mutS2 47850 50234 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_03870 50572 50303 gene locus_tag LOCUS_03880 50572 50303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence009 762 469 gene locus_tag LOCUS_03890 762 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2475 826 gene locus_tag LOCUS_03900 2475 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2960 3034 gene locus_tag LOCUS_t00020 2960 3034 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3956 3234 gene locus_tag LOCUS_03910 3956 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4886 4326 gene locus_tag LOCUS_03920 4886 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5697 5101 gene locus_tag LOCUS_03930 gene azoR 5697 5101 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 protein_id gnl|my_center|LOCUS_03930 5891 6241 gene locus_tag LOCUS_03940 5891 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7125 6481 gene locus_tag LOCUS_03950 7125 6481 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_03950 7425 7132 gene locus_tag LOCUS_03960 7425 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 8320 7418 gene locus_tag LOCUS_03970 8320 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 9057 8386 gene locus_tag LOCUS_03980 gene dhlB 9057 8386 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 protein_id gnl|my_center|LOCUS_03980 9566 9054 gene locus_tag LOCUS_03990 9566 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 10580 9591 gene locus_tag LOCUS_04000 10580 9591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 protein_id gnl|my_center|LOCUS_04000 12078 10603 gene locus_tag LOCUS_04010 12078 10603 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 protein_id gnl|my_center|LOCUS_04010 12851 12120 gene locus_tag LOCUS_04020 12851 12120 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227458.1 protein_id gnl|my_center|LOCUS_04020 13182 13754 gene locus_tag LOCUS_04030 13182 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14393 13941 gene locus_tag LOCUS_04040 14393 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_04040 15467 14481 gene locus_tag LOCUS_04050 gene gap 15467 14481 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_04050 19344 15745 gene locus_tag LOCUS_04060 19344 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 21540 19348 gene locus_tag LOCUS_04070 21540 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 23327 21537 gene locus_tag LOCUS_04080 23327 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 23776 24471 gene locus_tag LOCUS_04090 23776 24471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 24468 24848 gene locus_tag LOCUS_04100 24468 24848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 25106 25849 gene locus_tag LOCUS_04110 25106 25849 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_04110 25924 27639 gene locus_tag LOCUS_04120 25924 27639 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 protein_id gnl|my_center|LOCUS_04120 30333 27652 gene locus_tag LOCUS_04130 30333 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 33268 30545 gene locus_tag LOCUS_04140 33268 30545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 34502 33333 gene locus_tag LOCUS_04150 gene ycaQ 34502 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_04150 35765 34518 gene locus_tag LOCUS_04160 35765 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_04160 38038 35762 gene locus_tag LOCUS_04170 38038 35762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 38327 40381 gene locus_tag LOCUS_04180 38327 40381 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_04180 40394 41008 gene locus_tag LOCUS_04190 gene kptA 40394 41008 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_04190 41018 41653 gene locus_tag LOCUS_04200 41018 41653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 41714 42646 gene locus_tag LOCUS_04210 41714 42646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 42732 43532 gene locus_tag LOCUS_04220 42732 43532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 43583 44491 gene locus_tag LOCUS_04230 43583 44491 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_04230 44667 45896 gene locus_tag LOCUS_04240 44667 45896 CDS product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_04240 48733 45893 gene locus_tag LOCUS_04250 48733 45893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_04250 <49376 48730 gene locus_tag LOCUS_04260 <49376 48730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64UE7:DNA helicase >Feature sequence010 4407 349 gene locus_tag LOCUS_04270 4407 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5256 4843 gene locus_tag LOCUS_04280 5256 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5338 5844 gene locus_tag LOCUS_04290 gene aroK 5338 5844 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPM8 protein_id gnl|my_center|LOCUS_04290 5875 7293 gene locus_tag LOCUS_04300 5875 7293 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_04300 9931 7301 gene locus_tag LOCUS_04310 9931 7301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_04310 10266 9934 gene locus_tag LOCUS_04320 10266 9934 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_04320 10388 11317 gene locus_tag LOCUS_04330 10388 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 12984 11581 gene locus_tag LOCUS_04340 gene gndA 12984 11581 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_04340 13114 14643 gene locus_tag LOCUS_04350 gene zwf 13114 14643 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_04350 14666 15373 gene locus_tag LOCUS_04360 14666 15373 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_04360 15431 15793 gene locus_tag LOCUS_04370 15431 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 16044 19226 gene locus_tag LOCUS_04380 16044 19226 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_04380 19874 19296 gene locus_tag LOCUS_04390 19874 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20670 20035 gene locus_tag LOCUS_04400 20670 20035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23563 20681 gene locus_tag LOCUS_04410 23563 20681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 24722 23805 gene locus_tag LOCUS_04420 24722 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 27472 24812 gene locus_tag LOCUS_04430 27472 24812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_04430 27801 27469 gene locus_tag LOCUS_04440 27801 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 30562 27923 gene locus_tag LOCUS_04450 30562 27923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_04450 30910 30572 gene locus_tag LOCUS_04460 30910 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 31239 31868 gene locus_tag LOCUS_04470 31239 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_04470 32090 32668 gene locus_tag LOCUS_04480 32090 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 32799 33533 gene locus_tag LOCUS_04490 32799 33533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 33643 36315 gene locus_tag LOCUS_04500 33643 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 37165 36518 gene locus_tag LOCUS_04510 37165 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 37446 38090 gene locus_tag LOCUS_04520 37446 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 38213 38575 gene locus_tag LOCUS_04530 38213 38575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 40768 38657 gene locus_tag LOCUS_04540 40768 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 41381 40983 gene locus_tag LOCUS_04550 41381 40983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 42146 41769 gene locus_tag LOCUS_04560 42146 41769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_04560 43222 42443 gene locus_tag LOCUS_04570 43222 42443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 43513 44574 gene locus_tag LOCUS_04580 43513 44574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_04580 44707 46170 gene locus_tag LOCUS_04590 44707 46170 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_04590 46247 47110 gene locus_tag LOCUS_04600 46247 47110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence011 296 1558 gene locus_tag LOCUS_04610 296 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 1555 2289 gene locus_tag LOCUS_04620 1555 2289 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 protein_id gnl|my_center|LOCUS_04620 2297 2713 gene locus_tag LOCUS_04630 2297 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2771 4006 gene locus_tag LOCUS_04640 2771 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 4698 4003 gene locus_tag LOCUS_04650 4698 4003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_04650 6197 4707 gene locus_tag LOCUS_04660 6197 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785346.1 protein_id gnl|my_center|LOCUS_04660 7148 6204 gene locus_tag LOCUS_04670 7148 6204 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_04670 7238 8251 gene locus_tag LOCUS_04680 7238 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8332 9867 gene locus_tag LOCUS_04690 8332 9867 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_04690 10452 9925 gene locus_tag LOCUS_04700 10452 9925 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S70 protein_id gnl|my_center|LOCUS_04700 11621 10449 gene locus_tag LOCUS_04710 11621 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 15196 11882 gene locus_tag LOCUS_04720 15196 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_04720 15713 15339 gene locus_tag LOCUS_04730 15713 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 18289 15878 gene locus_tag LOCUS_04740 18289 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_04740 19414 18443 gene locus_tag LOCUS_04750 gene irk 19414 18443 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_04750 19544 19981 gene locus_tag LOCUS_04760 19544 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 19991 20368 gene locus_tag LOCUS_04770 19991 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 20365 22734 gene locus_tag LOCUS_04780 20365 22734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22898 23527 gene locus_tag LOCUS_04790 22898 23527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 23541 23921 gene locus_tag LOCUS_04800 23541 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 23935 24768 gene locus_tag LOCUS_04810 23935 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 24773 25243 gene locus_tag LOCUS_04820 24773 25243 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_04820 25240 27126 gene locus_tag LOCUS_04830 25240 27126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 30032 27489 gene locus_tag LOCUS_04840 30032 27489 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_04840 30656 30165 gene locus_tag LOCUS_04850 30656 30165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 31979 30786 gene locus_tag LOCUS_04860 31979 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 32095 32583 gene locus_tag LOCUS_04870 32095 32583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 protein_id gnl|my_center|LOCUS_04870 32659 33042 gene locus_tag LOCUS_04880 32659 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 34287 33103 gene locus_tag LOCUS_04890 34287 33103 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_04890 34567 35307 gene locus_tag LOCUS_04900 gene fabG 34567 35307 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_04900 35318 36304 gene locus_tag LOCUS_04910 35318 36304 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_04910 36378 37835 gene locus_tag LOCUS_04920 36378 37835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 37804 39303 gene locus_tag LOCUS_04930 37804 39303 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_04930 39393 40262 gene locus_tag LOCUS_04940 39393 40262 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_04940 40270 41706 gene locus_tag LOCUS_04950 40270 41706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 41990 44458 gene locus_tag LOCUS_04960 41990 44458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403170.1 protein_id gnl|my_center|LOCUS_04960 <45423 44736 gene locus_tag LOCUS_04970 <45423 44736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259450.1:potassium transporter TrkA >Feature sequence012 8073 4474 gene locus_tag LOCUS_04980 8073 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 12497 8115 gene locus_tag LOCUS_04990 12497 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 13286 13210 gene locus_tag LOCUS_t00030 13286 13210 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13748 13323 gene locus_tag LOCUS_05000 13748 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 13925 14596 gene locus_tag LOCUS_05010 13925 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14593 15195 gene locus_tag LOCUS_05020 14593 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15208 15813 gene locus_tag LOCUS_05030 15208 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 16413 15913 gene locus_tag LOCUS_05040 16413 15913 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_05040 17011 16463 gene locus_tag LOCUS_05050 17011 16463 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 protein_id gnl|my_center|LOCUS_05050 19242 17311 gene locus_tag LOCUS_05060 gene dnaK 19242 17311 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YW6 protein_id gnl|my_center|LOCUS_05060 19433 20644 gene locus_tag LOCUS_05070 19433 20644 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_05070 20635 21345 gene locus_tag LOCUS_05080 20635 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 21459 22868 gene locus_tag LOCUS_05090 21459 22868 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461658.1 protein_id gnl|my_center|LOCUS_05090 23019 23942 gene locus_tag LOCUS_05100 23019 23942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 24224 26575 gene locus_tag LOCUS_05110 24224 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 26575 28023 gene locus_tag LOCUS_05120 26575 28023 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_05120 28023 29057 gene locus_tag LOCUS_05130 gene pam 28023 29057 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_05130 29054 29833 gene locus_tag LOCUS_05140 29054 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 29833 31944 gene locus_tag LOCUS_05150 29833 31944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 32043 32954 gene locus_tag LOCUS_05160 32043 32954 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_05160 35579 32976 gene locus_tag LOCUS_05170 35579 32976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05170 38206 35606 gene locus_tag LOCUS_05180 38206 35606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05180 38548 38213 gene locus_tag LOCUS_05190 38548 38213 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_05190 38765 40294 gene locus_tag LOCUS_05200 38765 40294 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_05200 43346 40434 gene locus_tag LOCUS_05210 43346 40434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence013 1765 641 gene locus_tag LOCUS_05220 1765 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2323 1769 gene locus_tag LOCUS_05230 2323 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3233 2346 gene locus_tag LOCUS_05240 3233 2346 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_05240 3796 4788 gene locus_tag LOCUS_05250 3796 4788 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_05250 4826 6079 gene locus_tag LOCUS_05260 4826 6079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107684.1 protein_id gnl|my_center|LOCUS_05260 6084 9209 gene locus_tag LOCUS_05270 6084 9209 CDS product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974633.1 protein_id gnl|my_center|LOCUS_05270 9478 9678 gene locus_tag LOCUS_05280 9478 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10473 11414 gene locus_tag LOCUS_05290 10473 11414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464393.1 protein_id gnl|my_center|LOCUS_05290 11546 12466 gene locus_tag LOCUS_05300 11546 12466 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_05300 12658 13143 gene locus_tag LOCUS_05310 12658 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 13271 15202 gene locus_tag LOCUS_05320 13271 15202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05320 15492 16622 gene locus_tag LOCUS_05330 15492 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 16633 16923 gene locus_tag LOCUS_05340 16633 16923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16993 17250 gene locus_tag LOCUS_05350 16993 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17422 18024 gene locus_tag LOCUS_05360 17422 18024 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_05360 18180 18794 gene locus_tag LOCUS_05370 18180 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 18815 19270 gene locus_tag LOCUS_05380 18815 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_05380 19267 19803 gene locus_tag LOCUS_05390 19267 19803 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_05390 19826 20095 gene locus_tag LOCUS_05400 19826 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 20074 20595 gene locus_tag LOCUS_05410 20074 20595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 protein_id gnl|my_center|LOCUS_05410 20673 21497 gene locus_tag LOCUS_05420 20673 21497 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_05420 21827 23740 gene locus_tag LOCUS_05430 21827 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 23737 24474 gene locus_tag LOCUS_05440 23737 24474 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_05440 24696 25073 gene locus_tag LOCUS_05450 24696 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 25076 29239 gene locus_tag LOCUS_05460 25076 29239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 30071 29361 gene locus_tag LOCUS_05470 30071 29361 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_05470 31746 30064 gene locus_tag LOCUS_05480 31746 30064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 31959 34457 gene locus_tag LOCUS_05490 31959 34457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 34536 36929 gene locus_tag LOCUS_05500 34536 36929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05500 37562 38764 gene locus_tag LOCUS_05510 37562 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 38799 38993 gene locus_tag LOCUS_05520 38799 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 39437 39069 gene locus_tag LOCUS_05530 39437 39069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 39894 40481 gene locus_tag LOCUS_05540 39894 40481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 <42626 40780 gene locus_tag LOCUS_05550 <42626 40780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG >Feature sequence014 2253 103 gene locus_tag LOCUS_05560 2253 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2817 3317 gene locus_tag LOCUS_05570 2817 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3861 4142 gene locus_tag LOCUS_05580 3861 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4143 4406 gene locus_tag LOCUS_05590 4143 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5296 4580 gene locus_tag LOCUS_05600 gene lspA 5296 4580 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_05600 8616 5311 gene locus_tag LOCUS_05610 gene ileS 8616 5311 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_05610 11076 8629 gene locus_tag LOCUS_05620 11076 8629 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_05620 12485 11163 gene locus_tag LOCUS_05630 gene dgt 12485 11163 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_05630 12961 15900 gene locus_tag LOCUS_05640 12961 15900 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_05640 15913 17409 gene locus_tag LOCUS_05650 15913 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_05650 17566 20826 gene locus_tag LOCUS_05660 17566 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 20823 21407 gene locus_tag LOCUS_05670 20823 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 21429 24740 gene locus_tag LOCUS_05680 21429 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 24858 28043 gene locus_tag LOCUS_05690 24858 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 28148 30841 gene locus_tag LOCUS_05700 28148 30841 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_05700 30938 32956 gene locus_tag LOCUS_05710 30938 32956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 33095 36223 gene locus_tag LOCUS_05720 33095 36223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 36279 37628 gene locus_tag LOCUS_05730 36279 37628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 37939 39633 gene locus_tag LOCUS_05740 37939 39633 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_05740 39636 41129 gene locus_tag LOCUS_05750 gene glpK 39636 41129 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHZ9 protein_id gnl|my_center|LOCUS_05750 >Feature sequence015 4868 4056 gene locus_tag LOCUS_05760 4868 4056 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_05760 4983 5843 gene locus_tag LOCUS_05770 4983 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7157 5844 gene locus_tag LOCUS_05780 7157 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8144 7161 gene locus_tag LOCUS_05790 8144 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9153 8152 gene locus_tag LOCUS_05800 9153 8152 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061254.1 protein_id gnl|my_center|LOCUS_05800 9253 10173 gene locus_tag LOCUS_05810 gene rbsK 9253 10173 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_05810 10179 11189 gene locus_tag LOCUS_05820 10179 11189 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_05820 11931 11281 gene locus_tag LOCUS_05830 11931 11281 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144011.1 protein_id gnl|my_center|LOCUS_05830 13177 12005 gene locus_tag LOCUS_05840 13177 12005 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_05840 13724 13179 gene locus_tag LOCUS_05850 13724 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14948 13845 gene locus_tag LOCUS_05860 14948 13845 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_05860 15190 16656 gene locus_tag LOCUS_05870 15190 16656 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255358.1 protein_id gnl|my_center|LOCUS_05870 16747 17763 gene locus_tag LOCUS_05880 16747 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 17878 18597 gene locus_tag LOCUS_05890 17878 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 19186 19007 gene locus_tag LOCUS_05900 19186 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 19550 23317 gene locus_tag LOCUS_05910 19550 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 23310 26411 gene locus_tag LOCUS_05920 23310 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 26431 33477 gene locus_tag LOCUS_05930 26431 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 33519 35237 gene locus_tag LOCUS_05940 33519 35237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 35556 37265 gene locus_tag LOCUS_05950 35556 37265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 37432 39144 gene locus_tag LOCUS_05960 37432 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 39296 41041 gene locus_tag LOCUS_05970 39296 41041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence016 4 1530 gene locus_tag LOCUS_05980 4 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1541 2098 gene locus_tag LOCUS_05990 1541 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3289 2102 gene locus_tag LOCUS_06000 3289 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3862 4035 gene locus_tag LOCUS_06010 3862 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4121 5977 gene locus_tag LOCUS_06020 4121 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5987 6754 gene locus_tag LOCUS_06030 5987 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7711 6767 gene locus_tag LOCUS_06040 7711 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8470 7886 gene locus_tag LOCUS_06050 8470 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8708 10798 gene locus_tag LOCUS_06060 8708 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10803 11867 gene locus_tag LOCUS_06070 10803 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12392 15157 gene locus_tag LOCUS_06080 12392 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 15168 17513 gene locus_tag LOCUS_06090 15168 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 17527 21420 gene locus_tag LOCUS_06100 17527 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 21517 23025 gene locus_tag LOCUS_06110 21517 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 23252 24874 gene locus_tag LOCUS_06120 23252 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 24933 26546 gene locus_tag LOCUS_06130 24933 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 26602 28230 gene locus_tag LOCUS_06140 26602 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 28280 30004 gene locus_tag LOCUS_06150 28280 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30733 30260 gene locus_tag LOCUS_06160 gene greB 30733 30260 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMH2 protein_id gnl|my_center|LOCUS_06160 31966 30851 gene locus_tag LOCUS_06170 gene ampH 31966 30851 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228026.1 protein_id gnl|my_center|LOCUS_06170 32087 32779 gene locus_tag LOCUS_06180 32087 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 33122 34075 gene locus_tag LOCUS_06190 33122 34075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 34142 35737 gene locus_tag LOCUS_06200 34142 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 37374 36586 gene locus_tag LOCUS_06210 37374 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 37832 37371 gene locus_tag LOCUS_06220 37832 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 38131 38058 gene locus_tag LOCUS_t00040 38131 38058 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38297 39112 gene locus_tag LOCUS_06230 gene era 38297 39112 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_06230 39172 40479 gene locus_tag LOCUS_06240 gene der 39172 40479 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_06240 >Feature sequence017 1362 1907 gene locus_tag LOCUS_06250 gene pyrR1 1362 1907 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_06250 1904 2833 gene locus_tag LOCUS_06260 gene pyrB 1904 2833 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_06260 2840 3811 gene locus_tag LOCUS_06270 gene ybcH 2840 3811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 protein_id gnl|my_center|LOCUS_06270 3992 5368 gene locus_tag LOCUS_06280 3992 5368 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_06280 6614 5487 gene locus_tag LOCUS_06290 6614 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8568 7393 gene locus_tag LOCUS_06300 8568 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 9434 8706 gene locus_tag LOCUS_06310 9434 8706 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_06310 9713 10519 gene locus_tag LOCUS_06320 gene murI 9713 10519 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_06320 10733 11830 gene locus_tag LOCUS_06330 gene ndhA 10733 11830 CDS product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK94 protein_id gnl|my_center|LOCUS_06330 11827 12939 gene locus_tag LOCUS_06340 11827 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 12940 13467 gene locus_tag LOCUS_06350 gene ndhG 12940 13467 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_06350 13457 13759 gene locus_tag LOCUS_06360 gene nuoK 13457 13759 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_06360 13756 15894 gene locus_tag LOCUS_06370 gene ndhF 13756 15894 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932456.1 protein_id gnl|my_center|LOCUS_06370 15903 17609 gene locus_tag LOCUS_06380 gene ndhD 15903 17609 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_06380 17615 19117 gene locus_tag LOCUS_06390 gene ndhB 17615 19117 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB3 protein_id gnl|my_center|LOCUS_06390 19127 21013 gene locus_tag LOCUS_06400 gene purF 19127 21013 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_06400 21061 21399 gene locus_tag LOCUS_06410 21061 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 22084 21758 gene locus_tag LOCUS_06420 gene sufA 22084 21758 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_06420 22506 22084 gene locus_tag LOCUS_06430 22506 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 22631 23032 gene locus_tag LOCUS_06440 22631 23032 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_06440 23109 24140 gene locus_tag LOCUS_06450 gene thiL 23109 24140 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_06450 25395 24610 gene locus_tag LOCUS_06460 25395 24610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 25455 26312 gene locus_tag LOCUS_06470 25455 26312 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 protein_id gnl|my_center|LOCUS_06470 26604 26305 gene locus_tag LOCUS_06480 26604 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 27035 26670 gene locus_tag LOCUS_06490 27035 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 29756 27183 gene locus_tag LOCUS_06500 29756 27183 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107498.1 protein_id gnl|my_center|LOCUS_06500 30078 29746 gene locus_tag LOCUS_06510 30078 29746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 31661 30348 gene locus_tag LOCUS_06520 31661 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_06520 31849 32055 gene locus_tag LOCUS_06530 31849 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 32555 32217 gene locus_tag LOCUS_06540 32555 32217 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_06540 33561 32557 gene locus_tag LOCUS_06550 33561 32557 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_06550 34283 33681 gene locus_tag LOCUS_06560 34283 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 34912 34280 gene locus_tag LOCUS_06570 34912 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 35148 34906 gene locus_tag LOCUS_06580 35148 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 35410 35150 gene locus_tag LOCUS_06590 35410 35150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 36184 35456 gene locus_tag LOCUS_06600 36184 35456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 36345 37121 gene locus_tag LOCUS_06610 36345 37121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 37579 37169 gene locus_tag LOCUS_06620 37579 37169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_06620 38374 37622 gene locus_tag LOCUS_06630 38374 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence018 839 450 gene locus_tag LOCUS_06640 839 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 975 1517 gene locus_tag LOCUS_06650 975 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2538 2873 gene locus_tag LOCUS_06660 2538 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2904 3680 gene locus_tag LOCUS_06670 2904 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3982 5553 gene locus_tag LOCUS_06680 3982 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5587 5513 gene locus_tag LOCUS_t00050 5587 5513 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5691 5606 gene locus_tag LOCUS_t00060 5691 5606 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5937 5695 gene locus_tag LOCUS_06690 5937 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7137 6193 gene locus_tag LOCUS_06700 gene yfkH 7137 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_06700 7537 7127 gene locus_tag LOCUS_06710 7537 7127 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06710 8553 7540 gene locus_tag LOCUS_06720 8553 7540 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_06720 8624 9247 gene locus_tag LOCUS_06730 8624 9247 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_06730 9281 9907 gene locus_tag LOCUS_06740 9281 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_06740 10013 12571 gene locus_tag LOCUS_06750 gene clpC 10013 12571 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_06750 13412 12654 gene locus_tag LOCUS_06760 13412 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13638 13429 gene locus_tag LOCUS_06770 13638 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 13775 13987 gene locus_tag LOCUS_06780 13775 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 15597 14455 gene locus_tag LOCUS_06790 15597 14455 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_06790 16378 15875 gene locus_tag LOCUS_06800 16378 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_06800 17428 16427 gene locus_tag LOCUS_06810 17428 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19256 18072 gene locus_tag LOCUS_06820 gene mauG 19256 18072 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_06820 19868 19338 gene locus_tag LOCUS_06830 19868 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 20206 19868 gene locus_tag LOCUS_06840 20206 19868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 20834 20259 gene locus_tag LOCUS_06850 20834 20259 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_06850 21386 20949 gene locus_tag LOCUS_06860 21386 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 21721 22278 gene locus_tag LOCUS_06870 21721 22278 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_06870 22927 22280 gene locus_tag LOCUS_06880 22927 22280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057411.1 protein_id gnl|my_center|LOCUS_06880 23223 22924 gene locus_tag LOCUS_06890 23223 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 24267 23290 gene locus_tag LOCUS_06900 24267 23290 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_06900 24880 24299 gene locus_tag LOCUS_06910 24880 24299 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_06910 25714 24962 gene locus_tag LOCUS_06920 25714 24962 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_06920 26146 25826 gene locus_tag LOCUS_06930 26146 25826 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022200.1 protein_id gnl|my_center|LOCUS_06930 27407 26172 gene locus_tag LOCUS_06940 27407 26172 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_06940 27438 28601 gene locus_tag LOCUS_06950 27438 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 29249 28653 gene locus_tag LOCUS_06960 29249 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 30598 29246 gene locus_tag LOCUS_06970 30598 29246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 31057 30620 gene locus_tag LOCUS_06980 gene ssb-2 31057 30620 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z8 protein_id gnl|my_center|LOCUS_06980 32152 31097 gene locus_tag LOCUS_06990 gene mutY 32152 31097 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_06990 32310 32612 gene locus_tag LOCUS_07000 32310 32612 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_07000 32630 33448 gene locus_tag LOCUS_07010 32630 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 33752 35188 gene locus_tag LOCUS_07020 gene cafA 33752 35188 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_07020 36883 35267 gene locus_tag LOCUS_07030 36883 35267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 <39135 36885 gene locus_tag LOCUS_07040 <39135 36885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence019 5356 2726 gene locus_tag LOCUS_07050 5356 2726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_07050 8156 5598 gene locus_tag LOCUS_07060 8156 5598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_07060 8691 8350 gene locus_tag LOCUS_07070 8691 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9458 8853 gene locus_tag LOCUS_07080 9458 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9623 10432 gene locus_tag LOCUS_07090 9623 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10522 11772 gene locus_tag LOCUS_07100 10522 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 11769 12698 gene locus_tag LOCUS_07110 11769 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 12973 16215 gene locus_tag LOCUS_07120 12973 16215 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K6 protein_id gnl|my_center|LOCUS_07120 17391 16888 gene locus_tag LOCUS_07130 17391 16888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 17665 17970 gene locus_tag LOCUS_07140 17665 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 18529 17978 gene locus_tag LOCUS_07150 18529 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 18833 18582 gene locus_tag LOCUS_07160 18833 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18741 19610 gene locus_tag LOCUS_07170 18741 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 19676 20074 gene locus_tag LOCUS_07180 19676 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 20127 20498 gene locus_tag LOCUS_07190 20127 20498 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_07190 20980 20522 gene locus_tag LOCUS_07200 20980 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 21257 20988 gene locus_tag LOCUS_07210 21257 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 22155 21382 gene locus_tag LOCUS_07220 22155 21382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 23109 22240 gene locus_tag LOCUS_07230 23109 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24311 23169 gene locus_tag LOCUS_07240 24311 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_07240 24479 24937 gene locus_tag LOCUS_07250 24479 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 25049 26167 gene locus_tag LOCUS_07260 gene hisC 25049 26167 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_07260 27648 26176 gene locus_tag LOCUS_07270 27648 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 28212 28054 gene locus_tag LOCUS_07280 28212 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 29879 28281 gene locus_tag LOCUS_07290 29879 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940630.1 protein_id gnl|my_center|LOCUS_07290 32708 30171 gene locus_tag LOCUS_07300 32708 30171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_07300 35462 32802 gene locus_tag LOCUS_07310 35462 32802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07310 35786 35466 gene locus_tag LOCUS_07320 35786 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 36808 35966 gene locus_tag LOCUS_07330 gene menB 36808 35966 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_07330 37507 36869 gene locus_tag LOCUS_07340 37507 36869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 38347 37577 gene locus_tag LOCUS_07350 38347 37577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence020 7 2856 gene locus_tag LOCUS_07360 7 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2859 3290 gene locus_tag LOCUS_07370 2859 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3335 4645 gene locus_tag LOCUS_07380 gene rimO 3335 4645 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_07380 4764 6350 gene locus_tag LOCUS_07390 gene bshC 4764 6350 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_07390 6343 6915 gene locus_tag LOCUS_07400 gene ygfA 6343 6915 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_07400 10830 7132 gene locus_tag LOCUS_07410 10830 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11132 10848 gene locus_tag LOCUS_07420 11132 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11997 11317 gene locus_tag LOCUS_07430 11997 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_07430 12473 11997 gene locus_tag LOCUS_07440 gene ispF 12473 11997 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y7 protein_id gnl|my_center|LOCUS_07440 13811 12495 gene locus_tag LOCUS_07450 13811 12495 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_07450 13910 15799 gene locus_tag LOCUS_07460 gene bfmBA 13910 15799 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_07460 15818 16186 gene locus_tag LOCUS_07470 gene ytxJ 15818 16186 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_07470 16220 17017 gene locus_tag LOCUS_07480 16220 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 18334 20118 gene locus_tag LOCUS_07490 18334 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 20868 20119 gene locus_tag LOCUS_07500 20868 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20925 21476 gene locus_tag LOCUS_07510 20925 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 21547 21798 gene locus_tag LOCUS_07520 gene rpsT 21547 21798 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_07520 21926 22594 gene locus_tag LOCUS_07530 gene radC 21926 22594 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_07530 22658 23275 gene locus_tag LOCUS_07540 22658 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_07540 23348 25762 gene locus_tag LOCUS_07550 gene pheT 23348 25762 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_07550 25762 26058 gene locus_tag LOCUS_07560 25762 26058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 26069 26359 gene locus_tag LOCUS_07570 26069 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 26417 27985 gene locus_tag LOCUS_07580 gene rny 26417 27985 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_07580 28151 28564 gene locus_tag LOCUS_07590 28151 28564 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_07590 29194 28583 gene locus_tag LOCUS_07600 29194 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 29644 29198 gene locus_tag LOCUS_07610 29644 29198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 29979 29641 gene locus_tag LOCUS_07620 gene ywzG 29979 29641 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_07620 31161 30286 gene locus_tag LOCUS_07630 gene sucD 31161 30286 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_07630 32369 31488 gene locus_tag LOCUS_07640 32369 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 32548 34002 gene locus_tag LOCUS_07650 32548 34002 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_07650 34002 34730 gene locus_tag LOCUS_07660 34002 34730 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_07660 34748 35416 gene locus_tag LOCUS_07670 34748 35416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 35489 36166 gene locus_tag LOCUS_07680 35489 36166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence021 381 1397 gene locus_tag LOCUS_07690 gene czcB 381 1397 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_07690 1402 4443 gene locus_tag LOCUS_07700 1402 4443 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_07700 4975 4499 gene locus_tag LOCUS_07710 4975 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6131 4977 gene locus_tag LOCUS_07720 6131 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6419 6198 gene locus_tag LOCUS_07730 6419 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8453 7263 gene locus_tag LOCUS_07740 8453 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 9693 8551 gene locus_tag LOCUS_07750 9693 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10102 11997 gene locus_tag LOCUS_07760 gene htpG 10102 11997 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9B8 protein_id gnl|my_center|LOCUS_07760 12252 13226 gene locus_tag LOCUS_07770 12252 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 13378 15879 gene locus_tag LOCUS_07780 13378 15879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07780 16742 15912 gene locus_tag LOCUS_07790 16742 15912 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 protein_id gnl|my_center|LOCUS_07790 18025 17192 gene locus_tag LOCUS_07800 18025 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18966 18139 gene locus_tag LOCUS_07810 18966 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 21620 18966 gene locus_tag LOCUS_07820 21620 18966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_07820 21940 21629 gene locus_tag LOCUS_07830 21940 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 22132 22542 gene locus_tag LOCUS_07840 22132 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 22619 23698 gene locus_tag LOCUS_07850 22619 23698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23695 24447 gene locus_tag LOCUS_07860 23695 24447 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_07860 25474 24449 gene locus_tag LOCUS_07870 25474 24449 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_07870 26668 25481 gene locus_tag LOCUS_07880 26668 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 28104 26815 gene locus_tag LOCUS_07890 28104 26815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 28595 28242 gene locus_tag LOCUS_07900 28595 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 32694 28708 gene locus_tag LOCUS_07910 32694 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 33222 33713 gene locus_tag LOCUS_07920 33222 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970771.1 protein_id gnl|my_center|LOCUS_07920 33744 35561 gene locus_tag LOCUS_07930 33744 35561 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 protein_id gnl|my_center|LOCUS_07930 35574 36674 gene locus_tag LOCUS_07940 35574 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_07940 36994 36743 gene locus_tag LOCUS_07950 36994 36743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence022 1984 902 gene locus_tag LOCUS_07960 1984 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 12329 2172 gene locus_tag LOCUS_07970 12329 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 12841 13830 gene locus_tag LOCUS_07980 12841 13830 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_07980 14102 15670 gene locus_tag LOCUS_07990 14102 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 15764 18652 gene locus_tag LOCUS_08000 gene fecA 15764 18652 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_08000 18966 19871 gene locus_tag LOCUS_08010 18966 19871 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_08010 19959 20663 gene locus_tag LOCUS_08020 19959 20663 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_08020 20671 21327 gene locus_tag LOCUS_08030 20671 21327 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707127.1 protein_id gnl|my_center|LOCUS_08030 22604 21324 gene locus_tag LOCUS_08040 22604 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 23317 22670 gene locus_tag LOCUS_08050 23317 22670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 25995 23350 gene locus_tag LOCUS_08060 25995 23350 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_08060 27001 26021 gene locus_tag LOCUS_08070 27001 26021 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_08070 27631 27059 gene locus_tag LOCUS_08080 27631 27059 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_08080 27784 28401 gene locus_tag LOCUS_08090 27784 28401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_08090 28398 28706 gene locus_tag LOCUS_08100 28398 28706 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_08100 28749 29753 gene locus_tag LOCUS_08110 28749 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 30397 33204 gene locus_tag LOCUS_08120 30397 33204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 33201 34607 gene locus_tag LOCUS_08130 33201 34607 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence023 604 152 gene locus_tag LOCUS_08140 604 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1365 703 gene locus_tag LOCUS_08150 gene psd 1365 703 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08150 2659 1382 gene locus_tag LOCUS_08160 gene gdhA 2659 1382 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_08160 3556 2744 gene locus_tag LOCUS_08170 3556 2744 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_08170 3723 3553 gene locus_tag LOCUS_08180 3723 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4690 3698 gene locus_tag LOCUS_08190 4690 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4726 5721 gene locus_tag LOCUS_08200 4726 5721 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_08200 5721 6599 gene locus_tag LOCUS_08210 gene fjo11 5721 6599 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_08210 6752 7588 gene locus_tag LOCUS_08220 6752 7588 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_08220 8436 7585 gene locus_tag LOCUS_08230 8436 7585 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_08230 8602 11001 gene locus_tag LOCUS_08240 8602 11001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08240 11238 11047 gene locus_tag LOCUS_08250 11238 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 11687 11241 gene locus_tag LOCUS_08260 11687 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 12283 11720 gene locus_tag LOCUS_08270 12283 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12940 12362 gene locus_tag LOCUS_08280 12940 12362 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_08280 13722 12961 gene locus_tag LOCUS_08290 13722 12961 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_08290 13849 17943 gene locus_tag LOCUS_08300 13849 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 17948 23110 gene locus_tag LOCUS_08310 17948 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 24692 23220 gene locus_tag LOCUS_08320 24692 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 26128 24770 gene locus_tag LOCUS_08330 26128 24770 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_08330 28589 26169 gene locus_tag LOCUS_08340 28589 26169 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_08340 29769 28747 gene locus_tag LOCUS_08350 29769 28747 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_08350 30201 31265 gene locus_tag LOCUS_08360 30201 31265 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 protein_id gnl|my_center|LOCUS_08360 33895 31316 gene locus_tag LOCUS_08370 33895 31316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_08370 35063 34080 gene locus_tag LOCUS_08380 gene pfkA 35063 34080 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_08380 35771 35202 gene locus_tag LOCUS_08390 35771 35202 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_08390 <36868 35823 gene locus_tag LOCUS_08400 <36868 35823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter >Feature sequence024 2252 1473 gene locus_tag LOCUS_08410 gene nagD 2252 1473 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_08410 3221 2268 gene locus_tag LOCUS_08420 3221 2268 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_08420 3887 3279 gene locus_tag LOCUS_08430 3887 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4767 3997 gene locus_tag LOCUS_08440 4767 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6121 4829 gene locus_tag LOCUS_08450 6121 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6668 6114 gene locus_tag LOCUS_08460 6668 6114 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08460 7541 6801 gene locus_tag LOCUS_08470 7541 6801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 protein_id gnl|my_center|LOCUS_08470 7616 10714 gene locus_tag LOCUS_08480 7616 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13349 10947 gene locus_tag LOCUS_08490 13349 10947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08490 13625 14086 gene locus_tag LOCUS_08500 13625 14086 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_08500 14201 16594 gene locus_tag LOCUS_08510 14201 16594 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_08510 16681 17490 gene locus_tag LOCUS_08520 16681 17490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_08520 17602 18753 gene locus_tag LOCUS_08530 17602 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_08530 21075 18850 gene locus_tag LOCUS_08540 21075 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 22907 21252 gene locus_tag LOCUS_08550 22907 21252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 23129 24436 gene locus_tag LOCUS_08560 23129 24436 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_08560 24550 26919 gene locus_tag LOCUS_08570 24550 26919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 27015 27485 gene locus_tag LOCUS_08580 27015 27485 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_08580 27588 29729 gene locus_tag LOCUS_08590 27588 29729 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_08590 30039 29734 gene locus_tag LOCUS_08600 30039 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_08600 30114 30764 gene locus_tag LOCUS_08610 30114 30764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 30810 31256 gene locus_tag LOCUS_08620 gene crtZ 30810 31256 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_08620 31263 32168 gene locus_tag LOCUS_08630 31263 32168 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_08630 32614 33126 gene locus_tag LOCUS_08640 32614 33126 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 protein_id gnl|my_center|LOCUS_08640 33137 34612 gene locus_tag LOCUS_08650 gene crtI 33137 34612 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_08650 34646 35482 gene locus_tag LOCUS_08660 gene crtB 34646 35482 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence025 471 1034 gene locus_tag LOCUS_08670 471 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1037 1777 gene locus_tag LOCUS_08680 1037 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4922 1770 gene locus_tag LOCUS_08690 4922 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_08690 5140 7746 gene locus_tag LOCUS_08700 5140 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7976 9619 gene locus_tag LOCUS_08710 7976 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9899 11266 gene locus_tag LOCUS_08720 9899 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11539 12918 gene locus_tag LOCUS_08730 11539 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 12975 16418 gene locus_tag LOCUS_08740 12975 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16418 21763 gene locus_tag LOCUS_08750 16418 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 21967 23178 gene locus_tag LOCUS_08760 21967 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_08760 23399 23740 gene locus_tag LOCUS_08770 23399 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 23737 26325 gene locus_tag LOCUS_08780 23737 26325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08780 26703 31160 gene locus_tag LOCUS_08790 26703 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 31351 33714 gene locus_tag LOCUS_08800 31351 33714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_08800 34053 35504 gene locus_tag LOCUS_08810 34053 35504 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence026 13079 3456 gene locus_tag LOCUS_08820 13079 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 13367 17452 gene locus_tag LOCUS_08830 13367 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 17947 17546 gene locus_tag LOCUS_08840 17947 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19627 19031 gene locus_tag LOCUS_08850 19627 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20101 21345 gene locus_tag LOCUS_08860 20101 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 21575 23413 gene locus_tag LOCUS_08870 21575 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098151.1 protein_id gnl|my_center|LOCUS_08870 24866 23445 gene locus_tag LOCUS_08880 24866 23445 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125869.1 protein_id gnl|my_center|LOCUS_08880 25036 25443 gene locus_tag LOCUS_08890 gene ygcM 25036 25443 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_08890 25406 26098 gene locus_tag LOCUS_08900 gene folE2 25406 26098 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_08900 26104 26799 gene locus_tag LOCUS_08910 26104 26799 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_08910 26801 27424 gene locus_tag LOCUS_08920 26801 27424 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_08920 27777 27421 gene locus_tag LOCUS_08930 27777 27421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_08930 28076 27774 gene locus_tag LOCUS_08940 28076 27774 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_08940 28383 28066 gene locus_tag LOCUS_08950 28383 28066 CDS product addiction module antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388216.1 protein_id gnl|my_center|LOCUS_08950 28591 29391 gene locus_tag LOCUS_08960 28591 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 29649 30686 gene locus_tag LOCUS_08970 29649 30686 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_08970 30877 33069 gene locus_tag LOCUS_08980 30877 33069 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_08980 33687 33136 gene locus_tag LOCUS_08990 33687 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 34489 33872 gene locus_tag LOCUS_09000 34489 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 34929 34573 gene locus_tag LOCUS_09010 34929 34573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 35217 34942 gene locus_tag LOCUS_09020 35217 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence027 2526 2993 gene locus_tag LOCUS_09030 2526 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3230 3628 gene locus_tag LOCUS_09040 3230 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5137 3737 gene locus_tag LOCUS_09050 gene lpdA1 5137 3737 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_09050 6695 5169 gene locus_tag LOCUS_09060 gene sucB 6695 5169 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_09060 9450 6709 gene locus_tag LOCUS_09070 gene sucA 9450 6709 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_09070 9733 10017 gene locus_tag LOCUS_09080 9733 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10014 11144 gene locus_tag LOCUS_09090 10014 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 11147 11353 gene locus_tag LOCUS_09100 11147 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11456 12529 gene locus_tag LOCUS_09110 11456 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12690 13196 gene locus_tag LOCUS_09120 12690 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13200 13742 gene locus_tag LOCUS_09130 gene rimM 13200 13742 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_09130 13739 14419 gene locus_tag LOCUS_09140 gene trmD 13739 14419 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_09140 14507 14866 gene locus_tag LOCUS_09150 gene rplS 14507 14866 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M2 protein_id gnl|my_center|LOCUS_09150 14975 15400 gene locus_tag LOCUS_09160 14975 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15752 16525 gene locus_tag LOCUS_09170 gene dapF 15752 16525 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_09170 16631 19984 gene locus_tag LOCUS_09180 gene secA 16631 19984 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_09180 19998 20501 gene locus_tag LOCUS_09190 19998 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 20501 21694 gene locus_tag LOCUS_09200 20501 21694 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_09200 22678 21680 gene locus_tag LOCUS_09210 22678 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_09210 22967 24574 gene locus_tag LOCUS_09220 22967 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 24616 24960 gene locus_tag LOCUS_09230 24616 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 24960 25313 gene locus_tag LOCUS_09240 24960 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 25294 26058 gene locus_tag LOCUS_09250 gene pcrB 25294 26058 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_09250 26967 26044 gene locus_tag LOCUS_09260 26967 26044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 28242 27103 gene locus_tag LOCUS_09270 28242 27103 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09270 29092 28403 gene locus_tag LOCUS_09280 29092 28403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_09280 29579 29100 gene locus_tag LOCUS_09290 29579 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 30570 29524 gene locus_tag LOCUS_09300 30570 29524 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_09300 30924 30577 gene locus_tag LOCUS_09310 gene panD 30924 30577 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_09310 31801 30953 gene locus_tag LOCUS_09320 gene panC 31801 30953 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_09320 31932 32744 gene locus_tag LOCUS_09330 31932 32744 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_09330 32728 34029 gene locus_tag LOCUS_09340 32728 34029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence028 40 312 gene locus_tag LOCUS_09350 gene rpmA 40 312 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_09350 2021 597 gene locus_tag LOCUS_09360 2021 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3627 2125 gene locus_tag LOCUS_09370 3627 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4373 3630 gene locus_tag LOCUS_09380 4373 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5046 4435 gene locus_tag LOCUS_09390 gene glpG 5046 4435 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_09390 6021 5047 gene locus_tag LOCUS_09400 6021 5047 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_09400 8170 6014 gene locus_tag LOCUS_09410 gene rnr 8170 6014 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_09410 8354 9592 gene locus_tag LOCUS_09420 8354 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10300 9593 gene locus_tag LOCUS_09430 10300 9593 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_09430 11201 10806 gene locus_tag LOCUS_09440 11201 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 12422 11310 gene locus_tag LOCUS_09450 12422 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_09450 13147 12419 gene locus_tag LOCUS_09460 gene lipB 13147 12419 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_09460 13370 13182 gene locus_tag LOCUS_09470 13370 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 14373 13384 gene locus_tag LOCUS_09480 14373 13384 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_09480 16022 14370 gene locus_tag LOCUS_09490 gene pgi 16022 14370 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 protein_id gnl|my_center|LOCUS_09490 16096 16440 gene locus_tag LOCUS_09500 16096 16440 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_09500 17300 16437 gene locus_tag LOCUS_09510 17300 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18348 17344 gene locus_tag LOCUS_09520 18348 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 21875 18345 gene locus_tag LOCUS_09530 21875 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23742 22507 gene locus_tag LOCUS_09540 23742 22507 CDS product endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_09540 28000 23927 gene locus_tag LOCUS_09550 28000 23927 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_09550 30518 28197 gene locus_tag LOCUS_09560 30518 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 31722 30523 gene locus_tag LOCUS_09570 31722 30523 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_09570 33130 31724 gene locus_tag LOCUS_09580 33130 31724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 protein_id gnl|my_center|LOCUS_09580 34338 33139 gene locus_tag LOCUS_09590 34338 33139 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 protein_id gnl|my_center|LOCUS_09590 >Feature sequence029 1546 1271 gene locus_tag LOCUS_09600 gene rpsO 1546 1271 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_09600 3388 1616 gene locus_tag LOCUS_09610 3388 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3870 3475 gene locus_tag LOCUS_09620 3870 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4213 4287 gene locus_tag LOCUS_t00070 4213 4287 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4738 4394 gene locus_tag LOCUS_09630 gene rplT 4738 4394 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_09630 5027 4833 gene locus_tag LOCUS_09640 gene rpmI 5027 4833 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_09640 5601 5056 gene locus_tag LOCUS_09650 gene infC 5601 5056 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_09650 7581 5698 gene locus_tag LOCUS_09660 gene thrS 7581 5698 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_09660 10388 7788 gene locus_tag LOCUS_09670 10388 7788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_09670 11081 10404 gene locus_tag LOCUS_09680 gene trmH 11081 10404 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_09680 12160 11195 gene locus_tag LOCUS_09690 12160 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 12450 12157 gene locus_tag LOCUS_09700 12450 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 15312 12457 gene locus_tag LOCUS_09710 gene parC 15312 12457 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_09710 15754 15374 gene locus_tag LOCUS_09720 15754 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_09720 17676 15808 gene locus_tag LOCUS_09730 gene parE 17676 15808 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_09730 18291 17821 gene locus_tag LOCUS_09740 18291 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 18568 19800 gene locus_tag LOCUS_09750 gene erg3 18568 19800 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_09750 19881 21116 gene locus_tag LOCUS_09760 gene erg3 19881 21116 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_09760 21113 21484 gene locus_tag LOCUS_09770 21113 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 22592 21750 gene locus_tag LOCUS_09780 22592 21750 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_09780 22725 23741 gene locus_tag LOCUS_09790 22725 23741 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 protein_id gnl|my_center|LOCUS_09790 23870 24856 gene locus_tag LOCUS_09800 23870 24856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027148.1 protein_id gnl|my_center|LOCUS_09800 25023 25718 gene locus_tag LOCUS_09810 25023 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 26398 25721 gene locus_tag LOCUS_09820 gene cutC 26398 25721 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CI67 protein_id gnl|my_center|LOCUS_09820 27791 26517 gene locus_tag LOCUS_09830 27791 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 28565 28209 gene locus_tag LOCUS_09840 28565 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 29019 28789 gene locus_tag LOCUS_09850 29019 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 29164 29496 gene locus_tag LOCUS_09860 29164 29496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 30028 29582 gene locus_tag LOCUS_09870 30028 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 31253 30018 gene locus_tag LOCUS_09880 31253 30018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 32057 31671 gene locus_tag LOCUS_09890 32057 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 33469 32057 gene locus_tag LOCUS_09900 33469 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 33983 33600 gene locus_tag LOCUS_09910 33983 33600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence030 1515 478 gene locus_tag LOCUS_09920 1515 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2708 1680 gene locus_tag LOCUS_09930 2708 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3538 2792 gene locus_tag LOCUS_09940 3538 2792 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_09940 4442 3519 gene locus_tag LOCUS_09950 4442 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_09950 5737 4508 gene locus_tag LOCUS_09960 5737 4508 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_09960 6213 5851 gene locus_tag LOCUS_09970 6213 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7231 6215 gene locus_tag LOCUS_09980 gene murB 7231 6215 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_09980 7687 7232 gene locus_tag LOCUS_09990 7687 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9399 7684 gene locus_tag LOCUS_10000 9399 7684 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_10000 9685 10113 gene locus_tag LOCUS_10010 9685 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10893 10177 gene locus_tag LOCUS_10020 10893 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11465 10959 gene locus_tag LOCUS_10030 11465 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13406 11517 gene locus_tag LOCUS_10040 13406 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15336 13471 gene locus_tag LOCUS_10050 15336 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 15934 15422 gene locus_tag LOCUS_10060 15934 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16852 15980 gene locus_tag LOCUS_10070 16852 15980 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_10070 17063 17656 gene locus_tag LOCUS_10080 17063 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 18449 17664 gene locus_tag LOCUS_10090 18449 17664 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_10090 18900 18439 gene locus_tag LOCUS_10100 gene rnhA 18900 18439 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_10100 19635 18973 gene locus_tag LOCUS_10110 19635 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 20041 19640 gene locus_tag LOCUS_10120 20041 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 20524 20090 gene locus_tag LOCUS_10130 gene aroQ 20524 20090 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_10130 20517 21449 gene locus_tag LOCUS_10140 gene xerD 20517 21449 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_10140 21549 21914 gene locus_tag LOCUS_10150 21549 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 23121 22015 gene locus_tag LOCUS_10160 gene corA 23121 22015 CDS product cobalt/magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ31 protein_id gnl|my_center|LOCUS_10160 23267 24313 gene locus_tag LOCUS_10170 gene pyrD 23267 24313 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_10170 24398 26950 gene locus_tag LOCUS_10180 gene ftsK 24398 26950 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_10180 26975 27613 gene locus_tag LOCUS_10190 26975 27613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 27614 28429 gene locus_tag LOCUS_10200 gene pyrF 27614 28429 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_10200 28452 29753 gene locus_tag LOCUS_10210 28452 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_10210 30219 30851 gene locus_tag LOCUS_10220 30219 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 30949 31914 gene locus_tag LOCUS_10230 30949 31914 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837T2 protein_id gnl|my_center|LOCUS_10230 31914 32777 gene locus_tag LOCUS_10240 gene udp 31914 32777 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_10240 33448 32780 gene locus_tag LOCUS_10250 33448 32780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 34108 33506 gene locus_tag LOCUS_10260 34108 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence031 1147 926 gene locus_tag LOCUS_10270 1147 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1915 1253 gene locus_tag LOCUS_10280 1915 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2453 1923 gene locus_tag LOCUS_10290 gene actD 2453 1923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_10290 3820 2456 gene locus_tag LOCUS_10300 gene actC 3820 2456 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_10300 6944 3840 gene locus_tag LOCUS_10310 gene actB 6944 3840 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_10310 8190 6976 gene locus_tag LOCUS_10320 gene actA 8190 6976 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_10320 9303 9232 gene locus_tag LOCUS_t00080 9303 9232 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11528 9552 gene locus_tag LOCUS_10330 11528 9552 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_10330 12319 11786 gene locus_tag LOCUS_10340 12319 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 12843 12346 gene locus_tag LOCUS_10350 12843 12346 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_10350 13634 12840 gene locus_tag LOCUS_10360 13634 12840 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_10360 14101 13634 gene locus_tag LOCUS_10370 gene smpB 14101 13634 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_10370 14497 14105 gene locus_tag LOCUS_10380 14497 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 14823 14509 gene locus_tag LOCUS_10390 14823 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15842 14829 gene locus_tag LOCUS_10400 gene tsaD 15842 14829 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_10400 15842 20392 gene locus_tag LOCUS_10410 15842 20392 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 protein_id gnl|my_center|LOCUS_10410 20430 21740 gene locus_tag LOCUS_10420 gene phrB1 20430 21740 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_10420 21809 22693 gene locus_tag LOCUS_10430 21809 22693 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_10430 22767 23639 gene locus_tag LOCUS_10440 22767 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 25116 23827 gene locus_tag LOCUS_10450 25116 23827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 26225 25443 gene locus_tag LOCUS_10460 26225 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 27652 26231 gene locus_tag LOCUS_10470 27652 26231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 28430 28212 gene locus_tag LOCUS_10480 28430 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 28762 30927 gene locus_tag LOCUS_10490 28762 30927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 31843 34293 gene locus_tag LOCUS_10500 31843 34293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence032 4958 2787 gene locus_tag LOCUS_10510 gene dpp4 4958 2787 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_10510 6105 5041 gene locus_tag LOCUS_10520 6105 5041 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_10520 7351 6098 gene locus_tag LOCUS_10530 gene dadA 7351 6098 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_10530 8355 7354 gene locus_tag LOCUS_10540 8355 7354 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_10540 8762 8403 gene locus_tag LOCUS_10550 8762 8403 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_10550 9816 8860 gene locus_tag LOCUS_10560 9816 8860 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_10560 11409 9841 gene locus_tag LOCUS_10570 gene aldH 11409 9841 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206391.1 protein_id gnl|my_center|LOCUS_10570 12320 11406 gene locus_tag LOCUS_10580 12320 11406 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_10580 12572 13432 gene locus_tag LOCUS_10590 12572 13432 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205074.1 protein_id gnl|my_center|LOCUS_10590 16436 13821 gene locus_tag LOCUS_10600 16436 13821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10600 16765 16433 gene locus_tag LOCUS_10610 16765 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 17870 17511 gene locus_tag LOCUS_10620 17870 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 18427 18068 gene locus_tag LOCUS_10630 18427 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 19341 21185 gene locus_tag LOCUS_10640 19341 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 22799 21477 gene locus_tag LOCUS_10650 gene kmo 22799 21477 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_10650 24080 22800 gene locus_tag LOCUS_10660 gene kynU 24080 22800 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_10660 24574 24077 gene locus_tag LOCUS_10670 gene ogt 24574 24077 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJU0 protein_id gnl|my_center|LOCUS_10670 25581 24571 gene locus_tag LOCUS_10680 25581 24571 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_10680 26002 25631 gene locus_tag LOCUS_10690 26002 25631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_10690 26583 26050 gene locus_tag LOCUS_10700 gene haaO 26583 26050 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_10700 26673 27461 gene locus_tag LOCUS_10710 26673 27461 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_10710 27463 28446 gene locus_tag LOCUS_10720 27463 28446 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882917.1 protein_id gnl|my_center|LOCUS_10720 28450 29892 gene locus_tag LOCUS_10730 28450 29892 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_10730 30340 30762 gene locus_tag LOCUS_10740 30340 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 31025 33433 gene locus_tag LOCUS_10750 31025 33433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_10750 34125 33511 gene locus_tag LOCUS_10760 34125 33511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence033 802 65 gene locus_tag LOCUS_10770 802 65 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_10770 3798 811 gene locus_tag LOCUS_10780 3798 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3989 4615 gene locus_tag LOCUS_10790 gene dsbA 3989 4615 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 protein_id gnl|my_center|LOCUS_10790 4695 6866 gene locus_tag LOCUS_10800 4695 6866 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_10800 9535 6908 gene locus_tag LOCUS_10810 9535 6908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_10810 9866 9525 gene locus_tag LOCUS_10820 9866 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10367 9900 gene locus_tag LOCUS_10830 10367 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12984 10384 gene locus_tag LOCUS_10840 12984 10384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10840 15705 13144 gene locus_tag LOCUS_10850 15705 13144 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10850 18573 15970 gene locus_tag LOCUS_10860 18573 15970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10860 18901 18566 gene locus_tag LOCUS_10870 18901 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 20129 19140 gene locus_tag LOCUS_10880 20129 19140 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_10880 22813 20198 gene locus_tag LOCUS_10890 22813 20198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_10890 23153 22815 gene locus_tag LOCUS_10900 23153 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 26062 23390 gene locus_tag LOCUS_10910 26062 23390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_10910 26397 26059 gene locus_tag LOCUS_10920 26397 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 27657 26596 gene locus_tag LOCUS_10930 27657 26596 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203282.1 protein_id gnl|my_center|LOCUS_10930 30459 27829 gene locus_tag LOCUS_10940 30459 27829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_10940 30788 30456 gene locus_tag LOCUS_10950 30788 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 31022 31270 gene locus_tag LOCUS_10960 31022 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 31267 31695 gene locus_tag LOCUS_10970 31267 31695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 32305 31745 gene locus_tag LOCUS_10980 gene frr 32305 31745 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP0 protein_id gnl|my_center|LOCUS_10980 33020 32310 gene locus_tag LOCUS_10990 gene pyrH 33020 32310 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_10990 33532 33035 gene locus_tag LOCUS_11000 gene pycA 33532 33035 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_11000 33863 33946 gene locus_tag LOCUS_t00090 33863 33946 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 34025 34098 gene locus_tag LOCUS_t00100 34025 34098 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 <1 974 gene locus_tag LOCUS_11010 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase 1442 1098 gene locus_tag LOCUS_11020 1442 1098 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_11020 1593 2333 gene locus_tag LOCUS_11030 1593 2333 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_11030 2346 2960 gene locus_tag LOCUS_11040 2346 2960 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_11040 3049 3957 gene locus_tag LOCUS_11050 3049 3957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_11050 4805 3954 gene locus_tag LOCUS_11060 gene ghr 4805 3954 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_11060 5758 4895 gene locus_tag LOCUS_11070 5758 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5972 8431 gene locus_tag LOCUS_11080 5972 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9140 8412 gene locus_tag LOCUS_11090 9140 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9972 9208 gene locus_tag LOCUS_11100 9972 9208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_11100 11030 9972 gene locus_tag LOCUS_11110 11030 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 11751 11068 gene locus_tag LOCUS_11120 11751 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12508 11864 gene locus_tag LOCUS_11130 12508 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 13235 12624 gene locus_tag LOCUS_11140 13235 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 13848 13402 gene locus_tag LOCUS_11150 13848 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_11150 14545 13967 gene locus_tag LOCUS_11160 14545 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 16820 14655 gene locus_tag LOCUS_11170 16820 14655 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_11170 17990 16956 gene locus_tag LOCUS_11180 17990 16956 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_11180 18262 19086 gene locus_tag LOCUS_11190 18262 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 19177 20193 gene locus_tag LOCUS_11200 19177 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705518.1 protein_id gnl|my_center|LOCUS_11200 20373 20573 gene locus_tag LOCUS_11210 20373 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 20744 21262 gene locus_tag LOCUS_11220 20744 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 21265 21738 gene locus_tag LOCUS_11230 21265 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 21735 22259 gene locus_tag LOCUS_11240 21735 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 22423 23292 gene locus_tag LOCUS_11250 22423 23292 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038804.1 protein_id gnl|my_center|LOCUS_11250 23403 24326 gene locus_tag LOCUS_11260 23403 24326 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_11260 24360 25016 gene locus_tag LOCUS_11270 24360 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 25013 25474 gene locus_tag LOCUS_11280 25013 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 28713 26104 gene locus_tag LOCUS_11290 28713 26104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_11290 29039 28713 gene locus_tag LOCUS_11300 29039 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 29281 29925 gene locus_tag LOCUS_11310 29281 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368615.1 protein_id gnl|my_center|LOCUS_11310 29922 30887 gene locus_tag LOCUS_11320 29922 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 31842 31657 gene locus_tag LOCUS_11330 31842 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 32240 32731 gene locus_tag LOCUS_11340 32240 32731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 32867 33427 gene locus_tag LOCUS_11350 32867 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence035 926 225 gene locus_tag LOCUS_11360 926 225 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_11360 1091 2062 gene locus_tag LOCUS_11370 1091 2062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_11370 2040 2987 gene locus_tag LOCUS_11380 2040 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3007 3699 gene locus_tag LOCUS_11390 3007 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3696 4880 gene locus_tag LOCUS_11400 3696 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_11400 4858 5850 gene locus_tag LOCUS_11410 4858 5850 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_11410 5850 7181 gene locus_tag LOCUS_11420 5850 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_11420 7188 7595 gene locus_tag LOCUS_11430 7188 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7628 8122 gene locus_tag LOCUS_11440 7628 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 8449 10449 gene locus_tag LOCUS_11450 8449 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 10442 11167 gene locus_tag LOCUS_11460 10442 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 11283 12476 gene locus_tag LOCUS_11470 11283 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12646 13794 gene locus_tag LOCUS_11480 12646 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14920 13814 gene locus_tag LOCUS_11490 gene fjo29 14920 13814 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_11490 15844 14999 gene locus_tag LOCUS_11500 15844 14999 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_11500 15921 16292 gene locus_tag LOCUS_11510 15921 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 17723 16419 gene locus_tag LOCUS_11520 gene nqrF 17723 16419 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_11520 19256 17979 gene locus_tag LOCUS_11530 19256 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 20325 19264 gene locus_tag LOCUS_11540 gene metX 20325 19264 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_11540 21215 22633 gene locus_tag LOCUS_11550 21215 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 22630 23292 gene locus_tag LOCUS_11560 22630 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 23400 24173 gene locus_tag LOCUS_11570 23400 24173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 24282 25055 gene locus_tag LOCUS_11580 24282 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 25249 26535 gene locus_tag LOCUS_11590 25249 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 26582 27772 gene locus_tag LOCUS_11600 26582 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 28196 27933 gene locus_tag LOCUS_11610 28196 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 28326 28556 gene locus_tag LOCUS_11620 28326 28556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 29340 28561 gene locus_tag LOCUS_11630 29340 28561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 30415 29576 gene locus_tag LOCUS_11640 gene accD 30415 29576 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_11640 30604 31191 gene locus_tag LOCUS_11650 30604 31191 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_11650 31195 32274 gene locus_tag LOCUS_11660 gene fabH1 31195 32274 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_11660 32491 32943 gene locus_tag LOCUS_11670 32491 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 33182 32940 gene locus_tag LOCUS_11680 33182 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence036 303 884 gene locus_tag LOCUS_11690 303 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 877 1575 gene locus_tag LOCUS_11700 877 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2215 1529 gene locus_tag LOCUS_11710 2215 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3740 2220 gene locus_tag LOCUS_11720 3740 2220 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_11720 4841 3744 gene locus_tag LOCUS_11730 4841 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_11730 5005 5583 gene locus_tag LOCUS_11740 5005 5583 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_11740 5580 6380 gene locus_tag LOCUS_11750 5580 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6447 7340 gene locus_tag LOCUS_11760 6447 7340 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_11760 7531 7947 gene locus_tag LOCUS_11770 7531 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_11770 8070 8672 gene locus_tag LOCUS_11780 8070 8672 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 protein_id gnl|my_center|LOCUS_11780 8644 9417 gene locus_tag LOCUS_11790 8644 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9417 11909 gene locus_tag LOCUS_11800 9417 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 11909 13408 gene locus_tag LOCUS_11810 11909 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 14391 13600 gene locus_tag LOCUS_11820 14391 13600 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_11820 15585 14425 gene locus_tag LOCUS_11830 15585 14425 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_11830 18525 15604 gene locus_tag LOCUS_11840 18525 15604 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_11840 18589 18945 gene locus_tag LOCUS_11850 18589 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 18962 20806 gene locus_tag LOCUS_11860 gene mutL 18962 20806 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_11860 20812 21600 gene locus_tag LOCUS_11870 20812 21600 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_11870 21659 23092 gene locus_tag LOCUS_11880 21659 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 23092 24027 gene locus_tag LOCUS_11890 23092 24027 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_11890 26126 24036 gene locus_tag LOCUS_11900 26126 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 27184 26129 gene locus_tag LOCUS_11910 27184 26129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 29787 27322 gene locus_tag LOCUS_11920 29787 27322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 31047 30001 gene locus_tag LOCUS_11930 gene rlmN 31047 30001 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_11930 32100 31063 gene locus_tag LOCUS_11940 32100 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_11940 32612 32178 gene locus_tag LOCUS_11950 32612 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence037 <1 1324 gene locus_tag LOCUS_11960 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW32:adenosylhomocysteinase 2216 1413 gene locus_tag LOCUS_11970 2216 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2981 2220 gene locus_tag LOCUS_11980 2981 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4648 2990 gene locus_tag LOCUS_11990 4648 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67270 protein_id gnl|my_center|LOCUS_11990 5418 4645 gene locus_tag LOCUS_12000 5418 4645 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_12000 5479 6066 gene locus_tag LOCUS_12010 5479 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_12010 6173 8593 gene locus_tag LOCUS_12020 6173 8593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_12020 8590 9615 gene locus_tag LOCUS_12030 8590 9615 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_12030 9605 10312 gene locus_tag LOCUS_12040 9605 10312 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_12040 10476 11456 gene locus_tag LOCUS_12050 10476 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 11628 12881 gene locus_tag LOCUS_12060 11628 12881 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948596.1 protein_id gnl|my_center|LOCUS_12060 13191 13021 gene locus_tag LOCUS_12070 13191 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 14843 13497 gene locus_tag LOCUS_12080 gene accC 14843 13497 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_12080 15375 14896 gene locus_tag LOCUS_12090 gene accB 15375 14896 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_12090 15955 15392 gene locus_tag LOCUS_12100 gene efp 15955 15392 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_12100 17006 16002 gene locus_tag LOCUS_12110 gene fabH3 17006 16002 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_12110 17404 17213 gene locus_tag LOCUS_12120 gene rpmF 17404 17213 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_12120 18034 17441 gene locus_tag LOCUS_12130 18034 17441 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_12130 18828 18145 gene locus_tag LOCUS_12140 18828 18145 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_12140 20476 18842 gene locus_tag LOCUS_12150 20476 18842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_12150 20913 20563 gene locus_tag LOCUS_12160 20913 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 22020 20992 gene locus_tag LOCUS_12170 gene pdxA 22020 20992 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_12170 22161 22889 gene locus_tag LOCUS_12180 gene rsmA 22161 22889 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 protein_id gnl|my_center|LOCUS_12180 22877 24244 gene locus_tag LOCUS_12190 gene mgtE 22877 24244 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_12190 24244 25194 gene locus_tag LOCUS_12200 24244 25194 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_12200 25333 25809 gene locus_tag LOCUS_12210 gene greA 25333 25809 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_12210 25811 26209 gene locus_tag LOCUS_12220 25811 26209 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_12220 26287 26607 gene locus_tag LOCUS_12230 26287 26607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 29300 26712 gene locus_tag LOCUS_12240 29300 26712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_12240 29634 29302 gene locus_tag LOCUS_12250 29634 29302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 30323 29772 gene locus_tag LOCUS_12260 gene ruvC 30323 29772 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_12260 30362 31525 gene locus_tag LOCUS_12270 30362 31525 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_12270 31528 31782 gene locus_tag LOCUS_12280 31528 31782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence038 1180 542 gene locus_tag LOCUS_12290 1180 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1772 1254 gene locus_tag LOCUS_12300 1772 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2281 3834 gene locus_tag LOCUS_12310 2281 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3948 4979 gene locus_tag LOCUS_12320 3948 4979 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107610.1 protein_id gnl|my_center|LOCUS_12320 4976 6034 gene locus_tag LOCUS_12330 4976 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6031 6810 gene locus_tag LOCUS_12340 6031 6810 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_12340 8222 6813 gene locus_tag LOCUS_12350 8222 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 11296 8321 gene locus_tag LOCUS_12360 11296 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12420 11293 gene locus_tag LOCUS_12370 12420 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 12922 12425 gene locus_tag LOCUS_12380 12922 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13242 13391 gene locus_tag LOCUS_12390 13242 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 13513 13911 gene locus_tag LOCUS_12400 13513 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 13990 15090 gene locus_tag LOCUS_12410 13990 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 15224 16093 gene locus_tag LOCUS_12420 15224 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 16090 16917 gene locus_tag LOCUS_12430 16090 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 18242 16929 gene locus_tag LOCUS_12440 18242 16929 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 protein_id gnl|my_center|LOCUS_12440 19548 18232 gene locus_tag LOCUS_12450 19548 18232 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_12450 19710 22130 gene locus_tag LOCUS_12460 19710 22130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_12460 22364 23962 gene locus_tag LOCUS_12470 22364 23962 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_12470 25194 23959 gene locus_tag LOCUS_12480 25194 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 25343 25948 gene locus_tag LOCUS_12490 25343 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 26745 26155 gene locus_tag LOCUS_12500 26745 26155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 27515 26763 gene locus_tag LOCUS_12510 27515 26763 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_12510 28560 27496 gene locus_tag LOCUS_12520 28560 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 29436 28564 gene locus_tag LOCUS_12530 29436 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_12530 31790 29442 gene locus_tag LOCUS_12540 31790 29442 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence039 976 266 gene locus_tag LOCUS_12550 976 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1866 1081 gene locus_tag LOCUS_12560 1866 1081 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_12560 4279 2099 gene locus_tag LOCUS_12570 gene pepX1 4279 2099 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_12570 4390 4695 gene locus_tag LOCUS_12580 4390 4695 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_12580 5699 4926 gene locus_tag LOCUS_12590 5699 4926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_12590 7623 5686 gene locus_tag LOCUS_12600 gene dxs 7623 5686 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 protein_id gnl|my_center|LOCUS_12600 7773 8525 gene locus_tag LOCUS_12610 gene scpA 7773 8525 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_12610 8522 9568 gene locus_tag LOCUS_12620 8522 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_12620 9678 13241 gene locus_tag LOCUS_12630 9678 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13705 13286 gene locus_tag LOCUS_12640 gene ndk 13705 13286 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_12640 13902 14927 gene locus_tag LOCUS_12650 gene fjo19 13902 14927 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_12650 14924 15796 gene locus_tag LOCUS_12660 14924 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 15811 16299 gene locus_tag LOCUS_12670 15811 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 16384 16965 gene locus_tag LOCUS_12680 16384 16965 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG2 protein_id gnl|my_center|LOCUS_12680 16992 17615 gene locus_tag LOCUS_12690 gene udk 16992 17615 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_12690 17658 18017 gene locus_tag LOCUS_12700 17658 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 18093 21152 gene locus_tag LOCUS_12710 18093 21152 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_12710 21352 22644 gene locus_tag LOCUS_12720 21352 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 24369 22885 gene locus_tag LOCUS_12730 24369 22885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 protein_id gnl|my_center|LOCUS_12730 24733 25257 gene locus_tag LOCUS_12740 24733 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 26482 25574 gene locus_tag LOCUS_12750 26482 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 28405 26489 gene locus_tag LOCUS_12760 28405 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_12760 30264 28795 gene locus_tag LOCUS_12770 gene guaB 30264 28795 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_12770 30834 30406 gene locus_tag LOCUS_12780 30834 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 31292 30837 gene locus_tag LOCUS_12790 31292 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 32356 31298 gene locus_tag LOCUS_12800 32356 31298 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence040 1060 185 gene locus_tag LOCUS_12810 gene nadK 1060 185 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_12810 1736 1071 gene locus_tag LOCUS_12820 1736 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2497 1733 gene locus_tag LOCUS_12830 gene pcbD 2497 1733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_12830 3092 2526 gene locus_tag LOCUS_12840 3092 2526 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_12840 3617 3093 gene locus_tag LOCUS_12850 3617 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4074 3622 gene locus_tag LOCUS_12860 4074 3622 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_12860 4221 4934 gene locus_tag LOCUS_12870 gene pdxJ 4221 4934 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_12870 4935 5696 gene locus_tag LOCUS_12880 4935 5696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_12880 5693 6409 gene locus_tag LOCUS_12890 5693 6409 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_12890 6484 7737 gene locus_tag LOCUS_12900 gene metK 6484 7737 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_12900 7821 9575 gene locus_tag LOCUS_12910 7821 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9961 9665 gene locus_tag LOCUS_12920 9961 9665 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_12920 10890 9988 gene locus_tag LOCUS_12930 gene xerC 10890 9988 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_12930 11147 10953 gene locus_tag LOCUS_12940 gene rpsU 11147 10953 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_12940 12616 11471 gene locus_tag LOCUS_12950 12616 11471 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_12950 13798 12800 gene locus_tag LOCUS_12960 13798 12800 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_12960 13954 14424 gene locus_tag LOCUS_12970 gene rimP 13954 14424 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N5 protein_id gnl|my_center|LOCUS_12970 14430 15674 gene locus_tag LOCUS_12980 gene nusA 14430 15674 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_12980 15715 18525 gene locus_tag LOCUS_12990 15715 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 19983 18766 gene locus_tag LOCUS_13000 19983 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 21112 19994 gene locus_tag LOCUS_13010 21112 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22476 21313 gene locus_tag LOCUS_13020 22476 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23751 22564 gene locus_tag LOCUS_13030 23751 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_13030 24740 23748 gene locus_tag LOCUS_13040 gene asd 24740 23748 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_13040 >Feature sequence041 1432 755 gene locus_tag LOCUS_13050 1432 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2992 1541 gene locus_tag LOCUS_13060 2992 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3964 3086 gene locus_tag LOCUS_13070 3964 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 8984 5088 gene locus_tag LOCUS_13080 8984 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 13259 9213 gene locus_tag LOCUS_13090 13259 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 23509 13856 gene locus_tag LOCUS_13100 23509 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 24692 24618 gene locus_tag LOCUS_t00110 24692 24618 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24959 25534 gene locus_tag LOCUS_13110 24959 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 26321 25542 gene locus_tag LOCUS_13120 26321 25542 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 protein_id gnl|my_center|LOCUS_13120 26960 26325 gene locus_tag LOCUS_13130 26960 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 28420 26963 gene locus_tag LOCUS_13140 28420 26963 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_13140 28511 28353 gene locus_tag LOCUS_13150 28511 28353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 28684 30129 gene locus_tag LOCUS_13160 gene asnS 28684 30129 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_13160 30555 30178 gene locus_tag LOCUS_13170 30555 30178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <31890 30611 gene locus_tag LOCUS_13180 <31890 30611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme >Feature sequence042 1739 474 gene locus_tag LOCUS_13190 1739 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3138 1864 gene locus_tag LOCUS_13200 3138 1864 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_13200 3696 6410 gene locus_tag LOCUS_13210 3696 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7513 6710 gene locus_tag LOCUS_13220 7513 6710 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_13220 9050 7740 gene locus_tag LOCUS_13230 9050 7740 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 protein_id gnl|my_center|LOCUS_13230 9425 9832 gene locus_tag LOCUS_13240 9425 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 10048 10458 gene locus_tag LOCUS_13250 10048 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 10973 10467 gene locus_tag LOCUS_13260 10973 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 11206 11757 gene locus_tag LOCUS_13270 11206 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 11764 13362 gene locus_tag LOCUS_13280 gene lig2 11764 13362 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_13280 13359 15791 gene locus_tag LOCUS_13290 13359 15791 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_13290 18253 16157 gene locus_tag LOCUS_13300 gene pepX1 18253 16157 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_13300 18576 20540 gene locus_tag LOCUS_13310 18576 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 21332 20580 gene locus_tag LOCUS_13320 21332 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 21473 21847 gene locus_tag LOCUS_13330 21473 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 21882 23300 gene locus_tag LOCUS_13340 21882 23300 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_13340 26427 23368 gene locus_tag LOCUS_13350 26427 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_13350 26510 27208 gene locus_tag LOCUS_13360 26510 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 27221 27517 gene locus_tag LOCUS_13370 27221 27517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_13370 27612 28424 gene locus_tag LOCUS_13380 27612 28424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 28514 29125 gene locus_tag LOCUS_13390 28514 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 29183 29521 gene locus_tag LOCUS_13400 29183 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 30262 29648 gene locus_tag LOCUS_13410 30262 29648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence043 2350 572 gene locus_tag LOCUS_13420 gene asnB1 2350 572 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101239.1 protein_id gnl|my_center|LOCUS_13420 2640 2440 gene locus_tag LOCUS_13430 2640 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4419 2656 gene locus_tag LOCUS_13440 gene fadD 4419 2656 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_13440 6219 4474 gene locus_tag LOCUS_13450 6219 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8314 6674 gene locus_tag LOCUS_13460 8314 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_13460 9186 8311 gene locus_tag LOCUS_13470 9186 8311 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_13470 11053 9188 gene locus_tag LOCUS_13480 gene mnmG 11053 9188 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_13480 11556 11122 gene locus_tag LOCUS_13490 gene ybeY 11556 11122 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_13490 11957 11556 gene locus_tag LOCUS_13500 gene spoIIAB 11957 11556 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_13500 15263 11967 gene locus_tag LOCUS_13510 15263 11967 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_13510 16121 15354 gene locus_tag LOCUS_13520 16121 15354 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_13520 16497 16129 gene locus_tag LOCUS_13530 16497 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_13530 16840 16499 gene locus_tag LOCUS_13540 16840 16499 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_13540 16999 17580 gene locus_tag LOCUS_13550 16999 17580 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 protein_id gnl|my_center|LOCUS_13550 19035 17632 gene locus_tag LOCUS_13560 19035 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 19510 20625 gene locus_tag LOCUS_13570 19510 20625 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_13570 20622 21347 gene locus_tag LOCUS_13580 gene algR 20622 21347 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_13580 21355 21957 gene locus_tag LOCUS_13590 21355 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 23440 22127 gene locus_tag LOCUS_13600 23440 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 25845 23437 gene locus_tag LOCUS_13610 25845 23437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_13610 26961 25855 gene locus_tag LOCUS_13620 26961 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 27922 27041 gene locus_tag LOCUS_13630 27922 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 29426 28851 gene locus_tag LOCUS_13640 29426 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 30517 29474 gene locus_tag LOCUS_13650 30517 29474 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence044 543 289 gene locus_tag LOCUS_13660 543 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1894 1481 gene locus_tag LOCUS_13670 1894 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3247 2108 gene locus_tag LOCUS_13680 3247 2108 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_13680 4874 3258 gene locus_tag LOCUS_13690 4874 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7464 4879 gene locus_tag LOCUS_13700 7464 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 8028 8594 gene locus_tag LOCUS_13710 8028 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9630 8710 gene locus_tag LOCUS_13720 gene mdh 9630 8710 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_13720 10252 9728 gene locus_tag LOCUS_13730 10252 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11573 10245 gene locus_tag LOCUS_13740 gene tilS 11573 10245 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_13740 11650 13131 gene locus_tag LOCUS_13750 11650 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_13750 13240 14070 gene locus_tag LOCUS_13760 13240 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 14073 14396 gene locus_tag LOCUS_13770 14073 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_13770 14403 15602 gene locus_tag LOCUS_13780 14403 15602 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_13780 15577 16494 gene locus_tag LOCUS_13790 15577 16494 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_13790 16610 18262 gene locus_tag LOCUS_13800 gene recN 16610 18262 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_13800 18271 18936 gene locus_tag LOCUS_13810 18271 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18962 19654 gene locus_tag LOCUS_13820 18962 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 19855 20367 gene locus_tag LOCUS_13830 19855 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 20439 21260 gene locus_tag LOCUS_13840 20439 21260 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_13840 21392 22201 gene locus_tag LOCUS_13850 gene ispE 21392 22201 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA41 protein_id gnl|my_center|LOCUS_13850 22281 22895 gene locus_tag LOCUS_13860 22281 22895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22949 23758 gene locus_tag LOCUS_13870 22949 23758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 25079 24165 gene locus_tag LOCUS_13880 25079 24165 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_13880 26161 25079 gene locus_tag LOCUS_13890 26161 25079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_13890 27294 26164 gene locus_tag LOCUS_13900 gene tgt 27294 26164 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_13900 27390 28490 gene locus_tag LOCUS_13910 27390 28490 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_13910 28481 29089 gene locus_tag LOCUS_13920 gene sigW 28481 29089 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_13920 >Feature sequence045 3149 1923 gene locus_tag LOCUS_13930 3149 1923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_13930 3535 3146 gene locus_tag LOCUS_13940 gene rbfA 3535 3146 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y9 protein_id gnl|my_center|LOCUS_13940 3612 4727 gene locus_tag LOCUS_13950 3612 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5145 4717 gene locus_tag LOCUS_13960 gene rpiB 5145 4717 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_13960 5991 5158 gene locus_tag LOCUS_13970 gene tatC 5991 5158 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_13970 7266 5995 gene locus_tag LOCUS_13980 gene glyA 7266 5995 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_13980 7909 7418 gene locus_tag LOCUS_13990 7909 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 8172 8711 gene locus_tag LOCUS_14000 8172 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8728 9762 gene locus_tag LOCUS_14010 8728 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 12793 9803 gene locus_tag LOCUS_14020 12793 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 12963 13391 gene locus_tag LOCUS_14030 12963 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 13462 14700 gene locus_tag LOCUS_14040 13462 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17239 14768 gene locus_tag LOCUS_14050 17239 14768 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_14050 17418 18536 gene locus_tag LOCUS_14060 17418 18536 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_14060 19432 18533 gene locus_tag LOCUS_14070 19432 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 19482 20579 gene locus_tag LOCUS_14080 19482 20579 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_14080 21056 20580 gene locus_tag LOCUS_14090 21056 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 21103 21804 gene locus_tag LOCUS_14100 21103 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_14100 22868 21822 gene locus_tag LOCUS_14110 22868 21822 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_14110 23553 22960 gene locus_tag LOCUS_14120 23553 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 25741 23555 gene locus_tag LOCUS_14130 25741 23555 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_14130 25967 29098 gene locus_tag LOCUS_14140 25967 29098 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence046 1366 638 gene locus_tag LOCUS_14150 1366 638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_14150 1853 1443 gene locus_tag LOCUS_14160 1853 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2409 1828 gene locus_tag LOCUS_14170 2409 1828 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_14170 6175 2483 gene locus_tag LOCUS_14180 6175 2483 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_14180 7239 6346 gene locus_tag LOCUS_14190 7239 6346 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_14190 8418 7366 gene locus_tag LOCUS_14200 8418 7366 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_14200 8887 8411 gene locus_tag LOCUS_14210 8887 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10087 8891 gene locus_tag LOCUS_14220 10087 8891 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_14220 10440 10084 gene locus_tag LOCUS_14230 10440 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 11228 10461 gene locus_tag LOCUS_14240 11228 10461 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_14240 11422 12405 gene locus_tag LOCUS_14250 gene mecR 11422 12405 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_14250 12745 13704 gene locus_tag LOCUS_14260 12745 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 13870 15039 gene locus_tag LOCUS_14270 13870 15039 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_14270 15429 15016 gene locus_tag LOCUS_14280 15429 15016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 16269 16353 gene locus_tag LOCUS_t00120 16269 16353 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16355 16427 gene locus_tag LOCUS_t00130 16355 16427 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17287 18387 gene locus_tag LOCUS_14290 17287 18387 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_14290 18514 19038 gene locus_tag LOCUS_14300 18514 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 19101 19328 gene locus_tag LOCUS_14310 19101 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 19383 20816 gene locus_tag LOCUS_14320 gene rtcB 19383 20816 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_14320 20901 21449 gene locus_tag LOCUS_14330 20901 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 21515 22147 gene locus_tag LOCUS_14340 21515 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 22399 23373 gene locus_tag LOCUS_14350 22399 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23998 24972 gene locus_tag LOCUS_14360 23998 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 24983 25741 gene locus_tag LOCUS_14370 24983 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 26000 25728 gene locus_tag LOCUS_14380 26000 25728 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 protein_id gnl|my_center|LOCUS_14380 27536 26130 gene locus_tag LOCUS_14390 27536 26130 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_14390 27684 28235 gene locus_tag LOCUS_14400 27684 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 28841 28293 gene locus_tag LOCUS_14410 28841 28293 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107163.1 protein_id gnl|my_center|LOCUS_14410 29055 29130 gene locus_tag LOCUS_t00140 29055 29130 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 2 535 gene locus_tag LOCUS_14420 2 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1979 564 gene locus_tag LOCUS_14430 1979 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2530 1976 gene locus_tag LOCUS_14440 2530 1976 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_14440 2782 3990 gene locus_tag LOCUS_14450 2782 3990 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_14450 4800 3991 gene locus_tag LOCUS_14460 4800 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6038 4941 gene locus_tag LOCUS_14470 gene ychF 6038 4941 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_14470 7166 6048 gene locus_tag LOCUS_14480 7166 6048 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_14480 7547 7224 gene locus_tag LOCUS_14490 7547 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7755 8660 gene locus_tag LOCUS_14500 7755 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_14500 9116 8772 gene locus_tag LOCUS_14510 gene fdx1 9116 8772 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_14510 9220 10272 gene locus_tag LOCUS_14520 9220 10272 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_14520 10464 11822 gene locus_tag LOCUS_14530 10464 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 11907 13361 gene locus_tag LOCUS_14540 11907 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14057 14494 gene locus_tag LOCUS_14550 14057 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14677 15126 gene locus_tag LOCUS_14560 14677 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 15337 22257 gene locus_tag LOCUS_14570 15337 22257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 22998 22297 gene locus_tag LOCUS_14580 22998 22297 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_14580 23098 23889 gene locus_tag LOCUS_14590 23098 23889 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_14590 24129 24776 gene locus_tag LOCUS_14600 24129 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 24778 25977 gene locus_tag LOCUS_14610 24778 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 26554 25985 gene locus_tag LOCUS_14620 26554 25985 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 protein_id gnl|my_center|LOCUS_14620 27626 26766 gene locus_tag LOCUS_14630 27626 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_14630 28400 27630 gene locus_tag LOCUS_14640 28400 27630 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_14640 29038 28451 gene locus_tag LOCUS_14650 29038 28451 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence048 185 1258 gene locus_tag LOCUS_14660 gene ddlA 185 1258 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8T2 protein_id gnl|my_center|LOCUS_14660 1258 1794 gene locus_tag LOCUS_14670 1258 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1894 2265 gene locus_tag LOCUS_14680 1894 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2831 3820 gene locus_tag LOCUS_14690 2831 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121034.1 protein_id gnl|my_center|LOCUS_14690 3833 4519 gene locus_tag LOCUS_14700 3833 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 5170 5562 gene locus_tag LOCUS_14710 5170 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8885 5820 gene locus_tag LOCUS_14720 8885 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14720 9512 9051 gene locus_tag LOCUS_14730 9512 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9674 9994 gene locus_tag LOCUS_14740 9674 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10024 10497 gene locus_tag LOCUS_14750 10024 10497 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_14750 10497 10901 gene locus_tag LOCUS_14760 10497 10901 CDS product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_14760 11067 11396 gene locus_tag LOCUS_14770 11067 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11544 12308 gene locus_tag LOCUS_14780 11544 12308 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U920 protein_id gnl|my_center|LOCUS_14780 12305 13009 gene locus_tag LOCUS_14790 12305 13009 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_14790 13002 13877 gene locus_tag LOCUS_14800 13002 13877 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 protein_id gnl|my_center|LOCUS_14800 14474 14109 gene locus_tag LOCUS_14810 14474 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 14791 15312 gene locus_tag LOCUS_14820 14791 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15380 16588 gene locus_tag LOCUS_14830 gene queA 15380 16588 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_14830 16614 17753 gene locus_tag LOCUS_14840 16614 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 17851 19191 gene locus_tag LOCUS_14850 17851 19191 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_14850 19198 20655 gene locus_tag LOCUS_14860 19198 20655 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_14860 21277 21041 gene locus_tag LOCUS_14870 21277 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 21401 22621 gene locus_tag LOCUS_14880 21401 22621 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_14880 23275 23015 gene locus_tag LOCUS_14890 23275 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 25973 23268 gene locus_tag LOCUS_14900 25973 23268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_14900 26286 25957 gene locus_tag LOCUS_14910 26286 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence049 190 1533 gene locus_tag LOCUS_14920 190 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142978.1 protein_id gnl|my_center|LOCUS_14920 1537 2136 gene locus_tag LOCUS_14930 1537 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2321 2956 gene locus_tag LOCUS_14940 2321 2956 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_14940 3186 4373 gene locus_tag LOCUS_14950 3186 4373 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_14950 4385 7567 gene locus_tag LOCUS_14960 gene mexF2 4385 7567 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_14960 7588 9072 gene locus_tag LOCUS_14970 7588 9072 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813969.1 protein_id gnl|my_center|LOCUS_14970 9194 10141 gene locus_tag LOCUS_14980 9194 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10730 10152 gene locus_tag LOCUS_14990 10730 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_14990 11227 10790 gene locus_tag LOCUS_15000 gene azu 11227 10790 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD5 protein_id gnl|my_center|LOCUS_15000 11816 11400 gene locus_tag LOCUS_15010 11816 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 14342 12165 gene locus_tag LOCUS_15020 14342 12165 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_15020 14812 14354 gene locus_tag LOCUS_15030 14812 14354 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 protein_id gnl|my_center|LOCUS_15030 15426 14821 gene locus_tag LOCUS_15040 15426 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_15040 16163 15489 gene locus_tag LOCUS_15050 16163 15489 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_15050 17024 16209 gene locus_tag LOCUS_15060 gene yahI 17024 16209 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 protein_id gnl|my_center|LOCUS_15060 17603 17076 gene locus_tag LOCUS_15070 17603 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 18497 17691 gene locus_tag LOCUS_15080 18497 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 18970 18494 gene locus_tag LOCUS_15090 18970 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 19214 19696 gene locus_tag LOCUS_15100 19214 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 19787 22402 gene locus_tag LOCUS_15110 19787 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402852.1 protein_id gnl|my_center|LOCUS_15110 22445 24004 gene locus_tag LOCUS_15120 22445 24004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 24108 24374 gene locus_tag LOCUS_15130 24108 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 24503 24784 gene locus_tag LOCUS_15140 24503 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 24825 25073 gene locus_tag LOCUS_15150 24825 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 25116 25370 gene locus_tag LOCUS_15160 25116 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 25506 27629 gene locus_tag LOCUS_15170 25506 27629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence050 3204 2668 gene locus_tag LOCUS_15180 3204 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3593 4369 gene locus_tag LOCUS_15190 3593 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6674 4371 gene locus_tag LOCUS_15200 6674 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 8996 6747 gene locus_tag LOCUS_15210 8996 6747 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107511.1 protein_id gnl|my_center|LOCUS_15210 10334 9150 gene locus_tag LOCUS_15220 10334 9150 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_15220 12786 10567 gene locus_tag LOCUS_15230 12786 10567 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_15230 13066 13611 gene locus_tag LOCUS_15240 13066 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13901 13638 gene locus_tag LOCUS_15250 13901 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 14553 14263 gene locus_tag LOCUS_15260 14553 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 16126 14594 gene locus_tag LOCUS_15270 16126 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 18402 16408 gene locus_tag LOCUS_15280 gene dsbD 18402 16408 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_15280 19934 18546 gene locus_tag LOCUS_15290 19934 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_15290 20844 20083 gene locus_tag LOCUS_15300 20844 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 25543 20900 gene locus_tag LOCUS_15310 25543 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 26496 25666 gene locus_tag LOCUS_15320 gene prmA 26496 25666 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_15320 27263 26502 gene locus_tag LOCUS_15330 gene tpiA 27263 26502 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_15330 >Feature sequence051 80 3394 gene locus_tag LOCUS_15340 80 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3435 3668 gene locus_tag LOCUS_15350 3435 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4350 3613 gene locus_tag LOCUS_15360 4350 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4640 4359 gene locus_tag LOCUS_15370 4640 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5861 5355 gene locus_tag LOCUS_15380 5861 5355 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948450.1 protein_id gnl|my_center|LOCUS_15380 6903 5854 gene locus_tag LOCUS_15390 6903 5854 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_15390 7757 6900 gene locus_tag LOCUS_15400 7757 6900 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_15400 7877 9943 gene locus_tag LOCUS_15410 7877 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 11230 9944 gene locus_tag LOCUS_15420 gene nagA 11230 9944 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_15420 11501 12850 gene locus_tag LOCUS_15430 11501 12850 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_15430 12936 13529 gene locus_tag LOCUS_15440 12936 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 13646 14326 gene locus_tag LOCUS_15450 13646 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 14382 15680 gene locus_tag LOCUS_15460 14382 15680 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_15460 17012 15666 gene locus_tag LOCUS_15470 17012 15666 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_15470 18372 17002 gene locus_tag LOCUS_15480 18372 17002 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_15480 18523 19584 gene locus_tag LOCUS_15490 18523 19584 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_15490 19793 22165 gene locus_tag LOCUS_15500 19793 22165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_15500 22214 24565 gene locus_tag LOCUS_15510 22214 24565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_15510 24752 27160 gene locus_tag LOCUS_15520 24752 27160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence052 1909 713 gene locus_tag LOCUS_15530 1909 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3137 2010 gene locus_tag LOCUS_15540 3137 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3498 3184 gene locus_tag LOCUS_15550 3498 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3898 5427 gene locus_tag LOCUS_15560 3898 5427 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 protein_id gnl|my_center|LOCUS_15560 5545 6033 gene locus_tag LOCUS_15570 5545 6033 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_15570 6030 6647 gene locus_tag LOCUS_15580 6030 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7726 6683 gene locus_tag LOCUS_15590 7726 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8080 7757 gene locus_tag LOCUS_15600 8080 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8585 8109 gene locus_tag LOCUS_15610 8585 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8949 9587 gene locus_tag LOCUS_15620 8949 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9665 13570 gene locus_tag LOCUS_15630 9665 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 13567 15240 gene locus_tag LOCUS_15640 13567 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 15248 17944 gene locus_tag LOCUS_15650 15248 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 17941 19764 gene locus_tag LOCUS_15660 17941 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 20138 19761 gene locus_tag LOCUS_15670 20138 19761 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_15670 20677 20240 gene locus_tag LOCUS_15680 20677 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 21435 20743 gene locus_tag LOCUS_15690 21435 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 22713 21760 gene locus_tag LOCUS_15700 22713 21760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 23207 22725 gene locus_tag LOCUS_15710 23207 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 24136 23411 gene locus_tag LOCUS_15720 24136 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 24630 24163 gene locus_tag LOCUS_15730 24630 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 25949 24771 gene locus_tag LOCUS_15740 gene mauG 25949 24771 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_15740 26459 26055 gene locus_tag LOCUS_15750 26459 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 26911 26465 gene locus_tag LOCUS_15760 26911 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 27375 27037 gene locus_tag LOCUS_15770 27375 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence053 224 412 gene locus_tag LOCUS_15780 224 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 400 705 gene locus_tag LOCUS_15790 400 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 906 1772 gene locus_tag LOCUS_15800 906 1772 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_15800 2099 3457 gene locus_tag LOCUS_15810 2099 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3514 4287 gene locus_tag LOCUS_15820 3514 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4415 5659 gene locus_tag LOCUS_15830 4415 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 6035 5637 gene locus_tag LOCUS_15840 6035 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6208 6921 gene locus_tag LOCUS_15850 6208 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 7102 7719 gene locus_tag LOCUS_15860 7102 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8776 7919 gene locus_tag LOCUS_15870 8776 7919 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_15870 8905 9345 gene locus_tag LOCUS_15880 8905 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 9432 10091 gene locus_tag LOCUS_15890 9432 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 10207 10680 gene locus_tag LOCUS_15900 10207 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10708 11115 gene locus_tag LOCUS_15910 10708 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 11148 11453 gene locus_tag LOCUS_15920 11148 11453 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_15920 11600 11971 gene locus_tag LOCUS_15930 11600 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11973 12356 gene locus_tag LOCUS_15940 11973 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12353 12778 gene locus_tag LOCUS_15950 12353 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 12863 13387 gene locus_tag LOCUS_15960 12863 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 13550 14194 gene locus_tag LOCUS_15970 13550 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 14260 15324 gene locus_tag LOCUS_15980 14260 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 15438 16031 gene locus_tag LOCUS_15990 15438 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 16155 17657 gene locus_tag LOCUS_16000 16155 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 17722 18360 gene locus_tag LOCUS_16010 gene ydeI 17722 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_16010 18357 18833 gene locus_tag LOCUS_16020 18357 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 18830 19285 gene locus_tag LOCUS_16030 18830 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 20337 19735 gene locus_tag LOCUS_16040 gene miaE 20337 19735 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_16040 20507 21415 gene locus_tag LOCUS_16050 20507 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_16050 21619 22965 gene locus_tag LOCUS_16060 21619 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 23200 23955 gene locus_tag LOCUS_16070 23200 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 24100 24681 gene locus_tag LOCUS_16080 24100 24681 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_16080 24728 25222 gene locus_tag LOCUS_16090 24728 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 25999 25727 gene locus_tag LOCUS_16100 25999 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 26655 26116 gene locus_tag LOCUS_16110 26655 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence054 325 1794 gene locus_tag LOCUS_16120 325 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1791 2456 gene locus_tag LOCUS_16130 1791 2456 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_16130 2489 3922 gene locus_tag LOCUS_16140 2489 3922 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_16140 3939 4484 gene locus_tag LOCUS_16150 3939 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4808 5029 gene locus_tag LOCUS_16160 4808 5029 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176232.1 protein_id gnl|my_center|LOCUS_16160 5458 5036 gene locus_tag LOCUS_16170 5458 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_16170 6531 5458 gene locus_tag LOCUS_16180 gene prfA 6531 5458 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_16180 6603 7079 gene locus_tag LOCUS_16190 6603 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 7652 7080 gene locus_tag LOCUS_16200 gene tag 7652 7080 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_16200 7967 7737 gene locus_tag LOCUS_16210 7967 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 8125 10410 gene locus_tag LOCUS_16220 8125 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 10407 11090 gene locus_tag LOCUS_16230 gene copR 10407 11090 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_16230 11080 12435 gene locus_tag LOCUS_16240 11080 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 13190 12432 gene locus_tag LOCUS_16250 13190 12432 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_16250 13268 14377 gene locus_tag LOCUS_16260 13268 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 14494 15777 gene locus_tag LOCUS_16270 14494 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 15796 16809 gene locus_tag LOCUS_16280 15796 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 16822 17580 gene locus_tag LOCUS_16290 16822 17580 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_16290 17740 18945 gene locus_tag LOCUS_16300 17740 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 19976 19065 gene locus_tag LOCUS_16310 19976 19065 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 protein_id gnl|my_center|LOCUS_16310 20665 20081 gene locus_tag LOCUS_16320 20665 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 20855 24205 gene locus_tag LOCUS_16330 gene mfd 20855 24205 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_16330 24491 25606 gene locus_tag LOCUS_16340 24491 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 25899 26684 gene locus_tag LOCUS_16350 25899 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence055 789 3530 gene locus_tag LOCUS_16360 789 3530 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 protein_id gnl|my_center|LOCUS_16360 4336 3608 gene locus_tag LOCUS_16370 4336 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5924 4497 gene locus_tag LOCUS_16380 gene arsA 5924 4497 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_16380 6332 5982 gene locus_tag LOCUS_16390 6332 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6492 6307 gene locus_tag LOCUS_16400 6492 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7442 6531 gene locus_tag LOCUS_16410 7442 6531 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_16410 8006 7500 gene locus_tag LOCUS_16420 8006 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16420 8180 8034 gene locus_tag LOCUS_16430 8180 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8964 8407 gene locus_tag LOCUS_16440 8964 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10035 9160 gene locus_tag LOCUS_16450 10035 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16450 10401 10180 gene locus_tag LOCUS_16460 10401 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 10862 10398 gene locus_tag LOCUS_16470 10862 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 11842 10937 gene locus_tag LOCUS_16480 11842 10937 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_16480 13198 12044 gene locus_tag LOCUS_16490 13198 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 14921 13548 gene locus_tag LOCUS_16500 14921 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 15673 14939 gene locus_tag LOCUS_16510 15673 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 16396 15860 gene locus_tag LOCUS_16520 16396 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 18058 16676 gene locus_tag LOCUS_16530 18058 16676 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405165.1 protein_id gnl|my_center|LOCUS_16530 18859 18377 gene locus_tag LOCUS_16540 18859 18377 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 protein_id gnl|my_center|LOCUS_16540 19447 18875 gene locus_tag LOCUS_16550 19447 18875 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_16550 20057 19563 gene locus_tag LOCUS_16560 20057 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 20659 20318 gene locus_tag LOCUS_16570 20659 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 21354 20806 gene locus_tag LOCUS_16580 21354 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 21268 21486 gene locus_tag LOCUS_16590 21268 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 21888 21508 gene locus_tag LOCUS_16600 21888 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121337.1 protein_id gnl|my_center|LOCUS_16600 22982 22008 gene locus_tag LOCUS_16610 22982 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_16610 23709 22984 gene locus_tag LOCUS_16620 23709 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_16620 24976 24155 gene locus_tag LOCUS_16630 24976 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 25284 25057 gene locus_tag LOCUS_16640 25284 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 26187 25294 gene locus_tag LOCUS_16650 26187 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 26928 26290 gene locus_tag LOCUS_16660 26928 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence056 3291 91 gene locus_tag LOCUS_16670 3291 91 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_16670 4421 3288 gene locus_tag LOCUS_16680 4421 3288 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106260.1 protein_id gnl|my_center|LOCUS_16680 4985 4542 gene locus_tag LOCUS_16690 4985 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5981 5082 gene locus_tag LOCUS_16700 5981 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6036 6890 gene locus_tag LOCUS_16710 6036 6890 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_16710 7957 6887 gene locus_tag LOCUS_16720 7957 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 9077 8004 gene locus_tag LOCUS_16730 9077 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10251 9175 gene locus_tag LOCUS_16740 10251 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 10921 10286 gene locus_tag LOCUS_16750 10921 10286 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_16750 11480 10995 gene locus_tag LOCUS_16760 11480 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 11823 11572 gene locus_tag LOCUS_16770 11823 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 11942 12412 gene locus_tag LOCUS_16780 11942 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 15661 12434 gene locus_tag LOCUS_16790 15661 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 16301 15762 gene locus_tag LOCUS_16800 16301 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 16931 16371 gene locus_tag LOCUS_16810 16931 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 17177 17347 gene locus_tag LOCUS_16820 17177 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 18055 17369 gene locus_tag LOCUS_16830 18055 17369 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_16830 19022 18126 gene locus_tag LOCUS_16840 19022 18126 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_16840 20768 19266 gene locus_tag LOCUS_16850 20768 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 21319 21125 gene locus_tag LOCUS_16860 21319 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 21436 21780 gene locus_tag LOCUS_16870 21436 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 21780 23081 gene locus_tag LOCUS_16880 21780 23081 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_16880 23693 23085 gene locus_tag LOCUS_16890 23693 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 24250 23669 gene locus_tag LOCUS_16900 24250 23669 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_16900 25359 24502 gene locus_tag LOCUS_16910 25359 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 25525 25707 gene locus_tag LOCUS_16920 25525 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 27024 25762 gene locus_tag LOCUS_16930 27024 25762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence057 <1 4312 gene locus_tag LOCUS_16940 <1 4312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein 4309 4752 gene locus_tag LOCUS_16950 4309 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6259 4808 gene locus_tag LOCUS_16960 gene leuB 6259 4808 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_16960 6423 7208 gene locus_tag LOCUS_16970 gene crt 6423 7208 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_16970 7378 8862 gene locus_tag LOCUS_16980 7378 8862 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_16980 9017 10693 gene locus_tag LOCUS_16990 9017 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10686 11435 gene locus_tag LOCUS_17000 10686 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11422 12606 gene locus_tag LOCUS_17010 11422 12606 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_17010 12779 12979 gene locus_tag LOCUS_17020 gene tatA 12779 12979 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC14 protein_id gnl|my_center|LOCUS_17020 12983 14401 gene locus_tag LOCUS_17030 gene gatA 12983 14401 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_17030 14474 15763 gene locus_tag LOCUS_17040 14474 15763 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_17040 15867 16979 gene locus_tag LOCUS_17050 15867 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 17091 17684 gene locus_tag LOCUS_17060 gene ruvA 17091 17684 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_17060 17758 24864 gene locus_tag LOCUS_17070 gene sprA 17758 24864 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_17070 24917 25297 gene locus_tag LOCUS_17080 gene gcvH 24917 25297 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_17080 >Feature sequence058 232 915 gene locus_tag LOCUS_17090 232 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 935 2158 gene locus_tag LOCUS_17100 935 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2189 5284 gene locus_tag LOCUS_17110 2189 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5309 9742 gene locus_tag LOCUS_17120 5309 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10239 10745 gene locus_tag LOCUS_17130 10239 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10798 11070 gene locus_tag LOCUS_17140 10798 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 11638 12075 gene locus_tag LOCUS_17150 11638 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12162 12482 gene locus_tag LOCUS_17160 12162 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12555 13280 gene locus_tag LOCUS_17170 12555 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 13287 13826 gene locus_tag LOCUS_17180 13287 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 14460 14726 gene locus_tag LOCUS_17190 14460 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 14893 15735 gene locus_tag LOCUS_17200 14893 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 15875 16252 gene locus_tag LOCUS_17210 15875 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 16330 16740 gene locus_tag LOCUS_17220 16330 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 16751 17218 gene locus_tag LOCUS_17230 16751 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 17274 18026 gene locus_tag LOCUS_17240 17274 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 18019 18672 gene locus_tag LOCUS_17250 18019 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 18683 18913 gene locus_tag LOCUS_17260 18683 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 21126 18952 gene locus_tag LOCUS_17270 21126 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 23738 21312 gene locus_tag LOCUS_17280 23738 21312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_17280 23897 24103 gene locus_tag LOCUS_17290 23897 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 24310 25215 gene locus_tag LOCUS_17300 24310 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 25277 25822 gene locus_tag LOCUS_17310 25277 25822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 25888 26364 gene locus_tag LOCUS_17320 25888 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence059 <1 1312 gene locus_tag LOCUS_17330 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase 1925 1587 gene locus_tag LOCUS_17340 1925 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5248 2894 gene locus_tag LOCUS_17350 5248 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6328 5537 gene locus_tag LOCUS_17360 6328 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_17360 7491 6643 gene locus_tag LOCUS_17370 7491 6643 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_17370 8161 7499 gene locus_tag LOCUS_17380 8161 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 8829 8158 gene locus_tag LOCUS_17390 8829 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 9527 8862 gene locus_tag LOCUS_17400 9527 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 10188 9514 gene locus_tag LOCUS_17410 10188 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 11225 10281 gene locus_tag LOCUS_17420 gene accA 11225 10281 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_17420 11436 12509 gene locus_tag LOCUS_17430 11436 12509 CDS product UPF0118 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44646 protein_id gnl|my_center|LOCUS_17430 12618 13520 gene locus_tag LOCUS_17440 12618 13520 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67299 protein_id gnl|my_center|LOCUS_17440 13568 14926 gene locus_tag LOCUS_17450 13568 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 15131 16429 gene locus_tag LOCUS_17460 15131 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 16522 16992 gene locus_tag LOCUS_17470 16522 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 16989 17816 gene locus_tag LOCUS_17480 16989 17816 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_17480 17817 18374 gene locus_tag LOCUS_17490 17817 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 18367 18903 gene locus_tag LOCUS_17500 18367 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 18956 19369 gene locus_tag LOCUS_17510 18956 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 21188 19347 gene locus_tag LOCUS_17520 21188 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 22277 21198 gene locus_tag LOCUS_17530 22277 21198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 23351 22284 gene locus_tag LOCUS_17540 23351 22284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 24456 23356 gene locus_tag LOCUS_17550 24456 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 25505 24441 gene locus_tag LOCUS_17560 25505 24441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 26266 25508 gene locus_tag LOCUS_17570 26266 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence060 1285 812 gene locus_tag LOCUS_17580 1285 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1359 1721 gene locus_tag LOCUS_17590 1359 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_17590 1827 3941 gene locus_tag LOCUS_17600 1827 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4025 5101 gene locus_tag LOCUS_17610 4025 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5251 5907 gene locus_tag LOCUS_17620 gene tal 5251 5907 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_17620 5900 6163 gene locus_tag LOCUS_17630 5900 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6166 6870 gene locus_tag LOCUS_17640 gene ftsE 6166 6870 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_17640 7437 6892 gene locus_tag LOCUS_17650 7437 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7885 7427 gene locus_tag LOCUS_17660 7885 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 8803 8108 gene locus_tag LOCUS_17670 8803 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 10243 8819 gene locus_tag LOCUS_17680 10243 8819 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_17680 10406 12022 gene locus_tag LOCUS_17690 gene pyrG 10406 12022 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_17690 12037 13866 gene locus_tag LOCUS_17700 gene yidC 12037 13866 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_17700 14057 14737 gene locus_tag LOCUS_17710 14057 14737 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_17710 14746 15513 gene locus_tag LOCUS_17720 14746 15513 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_17720 15522 16433 gene locus_tag LOCUS_17730 gene parB 15522 16433 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_17730 16433 17053 gene locus_tag LOCUS_17740 16433 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 17107 17823 gene locus_tag LOCUS_17750 gene dapB 17107 17823 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_17750 18362 17892 gene locus_tag LOCUS_17760 18362 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 19302 18640 gene locus_tag LOCUS_17770 gene ung 19302 18640 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V6 protein_id gnl|my_center|LOCUS_17770 19375 19764 gene locus_tag LOCUS_17780 gene apaG 19375 19764 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_17780 19761 20543 gene locus_tag LOCUS_17790 19761 20543 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_17790 21122 20532 gene locus_tag LOCUS_17800 gene tpm 21122 20532 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_17800 21234 22151 gene locus_tag LOCUS_17810 21234 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 22301 23818 gene locus_tag LOCUS_17820 gene suc1 22301 23818 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_17820 23874 25829 gene locus_tag LOCUS_17830 23874 25829 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence061 818 291 gene locus_tag LOCUS_17840 gene nlpD 818 291 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162902.1 protein_id gnl|my_center|LOCUS_17840 949 2604 gene locus_tag LOCUS_17850 949 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2712 5576 gene locus_tag LOCUS_17860 2712 5576 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_17860 5646 6713 gene locus_tag LOCUS_17870 gene phy 5646 6713 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42094 protein_id gnl|my_center|LOCUS_17870 7860 6766 gene locus_tag LOCUS_17880 gene pfk-1 7860 6766 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 protein_id gnl|my_center|LOCUS_17880 8892 8413 gene locus_tag LOCUS_17890 8892 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9659 9186 gene locus_tag LOCUS_17900 9659 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 11513 9708 gene locus_tag LOCUS_17910 11513 9708 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_17910 11819 12286 gene locus_tag LOCUS_17920 11819 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 12415 15531 gene locus_tag LOCUS_17930 12415 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_17930 15644 15859 gene locus_tag LOCUS_17940 15644 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 15789 17429 gene locus_tag LOCUS_17950 15789 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 17431 19119 gene locus_tag LOCUS_17960 17431 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 19436 19125 gene locus_tag LOCUS_17970 19436 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 19981 19433 gene locus_tag LOCUS_17980 19981 19433 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186966.1 protein_id gnl|my_center|LOCUS_17980 20258 23398 gene locus_tag LOCUS_17990 20258 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 24258 25124 gene locus_tag LOCUS_18000 24258 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence062 1395 217 gene locus_tag LOCUS_18010 1395 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1297 1530 gene locus_tag LOCUS_18020 1297 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4052 1596 gene locus_tag LOCUS_18030 4052 1596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_18030 6532 4076 gene locus_tag LOCUS_18040 6532 4076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18040 6877 7557 gene locus_tag LOCUS_18050 6877 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7616 7951 gene locus_tag LOCUS_18060 7616 7951 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_18060 7954 9006 gene locus_tag LOCUS_18070 7954 9006 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_18070 9017 9988 gene locus_tag LOCUS_18080 9017 9988 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_18080 13074 10657 gene locus_tag LOCUS_18090 13074 10657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18090 15642 13228 gene locus_tag LOCUS_18100 15642 13228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18100 18095 15669 gene locus_tag LOCUS_18110 18095 15669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18110 20500 18098 gene locus_tag LOCUS_18120 20500 18098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18120 22949 20502 gene locus_tag LOCUS_18130 22949 20502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18130 25375 22955 gene locus_tag LOCUS_18140 25375 22955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18140 <25981 25388 gene locus_tag LOCUS_18150 <25981 25388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence063 10 396 gene locus_tag LOCUS_18160 10 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1119 409 gene locus_tag LOCUS_18170 1119 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_18170 1273 1575 gene locus_tag LOCUS_18180 1273 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1964 1632 gene locus_tag LOCUS_18190 1964 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2007 4790 gene locus_tag LOCUS_18200 gene leuS 2007 4790 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_18200 5062 6306 gene locus_tag LOCUS_18210 gene sbcD 5062 6306 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_18210 6303 9329 gene locus_tag LOCUS_18220 gene sbcC 6303 9329 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13458 protein_id gnl|my_center|LOCUS_18220 11291 9354 gene locus_tag LOCUS_18230 11291 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 12449 11487 gene locus_tag LOCUS_18240 12449 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 14365 13613 gene locus_tag LOCUS_18250 14365 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 14597 15736 gene locus_tag LOCUS_18260 14597 15736 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_18260 15768 17222 gene locus_tag LOCUS_18270 gene cls 15768 17222 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT1 protein_id gnl|my_center|LOCUS_18270 17331 18407 gene locus_tag LOCUS_18280 17331 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 18499 20274 gene locus_tag LOCUS_18290 18499 20274 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 protein_id gnl|my_center|LOCUS_18290 20384 21631 gene locus_tag LOCUS_18300 20384 21631 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_18300 21677 22252 gene locus_tag LOCUS_18310 21677 22252 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_18310 22352 23404 gene locus_tag LOCUS_18320 22352 23404 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918623.1 protein_id gnl|my_center|LOCUS_18320 24014 23745 gene locus_tag LOCUS_18330 24014 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 24947 24594 gene locus_tag LOCUS_18340 24947 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_18340 25195 24986 gene locus_tag LOCUS_18350 25195 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 <25819 25197 gene locus_tag LOCUS_18360 <25819 25197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F1H5:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) >Feature sequence064 1586 1092 gene locus_tag LOCUS_18370 1586 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2254 1652 gene locus_tag LOCUS_18380 2254 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3261 2284 gene locus_tag LOCUS_18390 gene ltd 3261 2284 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_18390 3953 3483 gene locus_tag LOCUS_18400 3953 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5076 3937 gene locus_tag LOCUS_18410 5076 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5466 5137 gene locus_tag LOCUS_18420 5466 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5745 6002 gene locus_tag LOCUS_18430 5745 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6004 7197 gene locus_tag LOCUS_18440 gene kbl 6004 7197 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_18440 7355 8533 gene locus_tag LOCUS_18450 7355 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 11580 8629 gene locus_tag LOCUS_18460 11580 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 12257 11577 gene locus_tag LOCUS_18470 12257 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 12565 13716 gene locus_tag LOCUS_18480 12565 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 13837 14958 gene locus_tag LOCUS_18490 13837 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 14970 16118 gene locus_tag LOCUS_18500 14970 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 16479 16165 gene locus_tag LOCUS_18510 16479 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 17330 16485 gene locus_tag LOCUS_18520 17330 16485 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_18520 18100 17327 gene locus_tag LOCUS_18530 gene folP 18100 17327 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_18530 18215 18763 gene locus_tag LOCUS_18540 18215 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_18540 18760 19755 gene locus_tag LOCUS_18550 18760 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_18550 19755 20273 gene locus_tag LOCUS_18560 gene aroK 19755 20273 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_18560 21817 20288 gene locus_tag LOCUS_18570 21817 20288 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_18570 23530 21848 gene locus_tag LOCUS_18580 23530 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 23927 24397 gene locus_tag LOCUS_18590 23927 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 24407 25168 gene locus_tag LOCUS_18600 24407 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18600 25172 25408 gene locus_tag LOCUS_18610 25172 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18610 >Feature sequence065 1107 373 gene locus_tag LOCUS_18620 1107 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1273 2007 gene locus_tag LOCUS_18630 1273 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1994 2578 gene locus_tag LOCUS_18640 1994 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2568 3248 gene locus_tag LOCUS_18650 2568 3248 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_18650 4222 3254 gene locus_tag LOCUS_18660 gene pip 4222 3254 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q890D8 protein_id gnl|my_center|LOCUS_18660 4553 4200 gene locus_tag LOCUS_18670 4553 4200 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_18670 5531 4680 gene locus_tag LOCUS_18680 gene uspA 5531 4680 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_18680 6330 5581 gene locus_tag LOCUS_18690 6330 5581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_18690 6770 6330 gene locus_tag LOCUS_18700 6770 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 8188 6773 gene locus_tag LOCUS_18710 gene ccoG 8188 6773 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_18710 9146 8214 gene locus_tag LOCUS_18720 9146 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9362 9150 gene locus_tag LOCUS_18730 gene ccoQ 9362 9150 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_18730 11498 9369 gene locus_tag LOCUS_18740 gene ccoN/ccoO 11498 9369 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_18740 11939 12136 gene locus_tag LOCUS_18750 11939 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12127 12375 gene locus_tag LOCUS_18760 12127 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 12426 12761 gene locus_tag LOCUS_18770 12426 12761 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_18770 14711 12939 gene locus_tag LOCUS_18780 14711 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 15106 15621 gene locus_tag LOCUS_18790 15106 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 15836 16420 gene locus_tag LOCUS_18800 15836 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 16926 17519 gene locus_tag LOCUS_18810 16926 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 17733 18341 gene locus_tag LOCUS_18820 17733 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 18399 18980 gene locus_tag LOCUS_18830 18399 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 20331 18985 gene locus_tag LOCUS_18840 gene hemN 20331 18985 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_18840 20497 20324 gene locus_tag LOCUS_18850 20497 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 22913 20499 gene locus_tag LOCUS_18860 gene ccoI 22913 20499 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_18860 23710 22910 gene locus_tag LOCUS_18870 23710 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 24525 23806 gene locus_tag LOCUS_18880 24525 23806 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_18880 <25735 24620 gene locus_tag LOCUS_18890 <25735 24620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122093.1:serine dehydratase >Feature sequence066 <1 1230 gene locus_tag LOCUS_18900 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140483.1:fused response regulator/thioredoxin-disulfide reductase 1447 2298 gene locus_tag LOCUS_18910 1447 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2358 2960 gene locus_tag LOCUS_18920 2358 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3487 3011 gene locus_tag LOCUS_18930 3487 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3717 3541 gene locus_tag LOCUS_18940 3717 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3847 4413 gene locus_tag LOCUS_18950 3847 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4543 4965 gene locus_tag LOCUS_18960 4543 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4969 5976 gene locus_tag LOCUS_18970 4969 5976 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_18970 8886 5998 gene locus_tag LOCUS_18980 8886 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_18980 9113 10498 gene locus_tag LOCUS_18990 9113 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10599 11459 gene locus_tag LOCUS_19000 10599 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11522 13120 gene locus_tag LOCUS_19010 11522 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 13126 14355 gene locus_tag LOCUS_19020 13126 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 14674 15438 gene locus_tag LOCUS_19030 14674 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 15466 17064 gene locus_tag LOCUS_19040 15466 17064 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_19040 17179 18171 gene locus_tag LOCUS_19050 17179 18171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 18168 18818 gene locus_tag LOCUS_19060 gene pgmB2 18168 18818 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_19060 18819 21119 gene locus_tag LOCUS_19070 18819 21119 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_19070 21475 22743 gene locus_tag LOCUS_19080 21475 22743 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_19080 22751 23827 gene locus_tag LOCUS_19090 22751 23827 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence067 401 1300 gene locus_tag LOCUS_19100 401 1300 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 protein_id gnl|my_center|LOCUS_19100 1300 2037 gene locus_tag LOCUS_19110 1300 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3572 2253 gene locus_tag LOCUS_19120 3572 2253 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_19120 4203 3727 gene locus_tag LOCUS_19130 gene ribH 4203 3727 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_19130 5103 4414 gene locus_tag LOCUS_19140 5103 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6123 5161 gene locus_tag LOCUS_19150 gene pdhA 6123 5161 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_19150 6290 7393 gene locus_tag LOCUS_19160 gene recF 6290 7393 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_19160 7440 8060 gene locus_tag LOCUS_19170 7440 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8845 8072 gene locus_tag LOCUS_19180 8845 8072 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_19180 9926 8838 gene locus_tag LOCUS_19190 9926 8838 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_19190 10101 11279 gene locus_tag LOCUS_19200 10101 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11468 11908 gene locus_tag LOCUS_19210 11468 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 11980 13131 gene locus_tag LOCUS_19220 11980 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 15729 13462 gene locus_tag LOCUS_19230 15729 13462 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_19230 15951 16970 gene locus_tag LOCUS_19240 15951 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 16967 17638 gene locus_tag LOCUS_19250 16967 17638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_19250 18130 17639 gene locus_tag LOCUS_19260 18130 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 18695 18417 gene locus_tag LOCUS_19270 18695 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 18819 19211 gene locus_tag LOCUS_19280 18819 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 19229 19555 gene locus_tag LOCUS_19290 19229 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 21325 19793 gene locus_tag LOCUS_19300 21325 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_19300 22078 21338 gene locus_tag LOCUS_19310 gene lptB 22078 21338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_19310 23953 22253 gene locus_tag LOCUS_19320 23953 22253 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_19320 24707 24054 gene locus_tag LOCUS_19330 24707 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence068 <1 3058 gene locus_tag LOCUS_19340 <1 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971066.1:L-ascorbate oxidase 3540 3106 gene locus_tag LOCUS_19350 3540 3106 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_19350 4484 3537 gene locus_tag LOCUS_19360 4484 3537 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_19360 4579 5343 gene locus_tag LOCUS_19370 gene fjo14 4579 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_19370 5343 5642 gene locus_tag LOCUS_19380 5343 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5718 5800 gene locus_tag LOCUS_t00150 5718 5800 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6013 6441 gene locus_tag LOCUS_19390 6013 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 11763 6640 gene locus_tag LOCUS_19400 11763 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 12793 11753 gene locus_tag LOCUS_19410 12793 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_19410 12780 13004 gene locus_tag LOCUS_19420 12780 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 13358 13738 gene locus_tag LOCUS_19430 13358 13738 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_19430 13746 16226 gene locus_tag LOCUS_19440 13746 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 16490 17071 gene locus_tag LOCUS_19450 16490 17071 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19450 17061 17861 gene locus_tag LOCUS_19460 17061 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 17884 18819 gene locus_tag LOCUS_19470 17884 18819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 18848 19801 gene locus_tag LOCUS_19480 18848 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 20523 20014 gene locus_tag LOCUS_19490 20523 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 20572 21174 gene locus_tag LOCUS_19500 20572 21174 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_19500 21176 22162 gene locus_tag LOCUS_19510 gene paaA 21176 22162 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_19510 22167 22787 gene locus_tag LOCUS_19520 22167 22787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 22791 23543 gene locus_tag LOCUS_19530 22791 23543 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_19530 23583 24074 gene locus_tag LOCUS_19540 23583 24074 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889009.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence069 2884 203 gene locus_tag LOCUS_19550 gene valS 2884 203 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_19550 5473 3203 gene locus_tag LOCUS_19560 5473 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 7009 5657 gene locus_tag LOCUS_19570 7009 5657 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_19570 7082 8356 gene locus_tag LOCUS_19580 gene fahA 7082 8356 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_19580 8388 9278 gene locus_tag LOCUS_19590 8388 9278 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_19590 9309 9905 gene locus_tag LOCUS_19600 9309 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 10060 10668 gene locus_tag LOCUS_19610 10060 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12335 11157 gene locus_tag LOCUS_19620 gene bioB 12335 11157 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_19620 15166 12428 gene locus_tag LOCUS_19630 15166 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 15284 15769 gene locus_tag LOCUS_19640 15284 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18436 15845 gene locus_tag LOCUS_19650 18436 15845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_19650 18791 18429 gene locus_tag LOCUS_19660 18791 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 20297 18972 gene locus_tag LOCUS_19670 20297 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 21187 20312 gene locus_tag LOCUS_19680 gene fabD 21187 20312 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_19680 21651 21229 gene locus_tag LOCUS_19690 gene yuxK 21651 21229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_19690 24452 21630 gene locus_tag LOCUS_19700 24452 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 <25150 24449 gene locus_tag LOCUS_19710 <25150 24449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMT2:adaptive-response sensory-kinase SasA >Feature sequence070 205 1131 gene locus_tag LOCUS_19720 gene hemC 205 1131 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_19720 1133 2047 gene locus_tag LOCUS_19730 1133 2047 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_19730 2077 2928 gene locus_tag LOCUS_19740 2077 2928 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_19740 2906 3787 gene locus_tag LOCUS_19750 2906 3787 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_19750 3784 4692 gene locus_tag LOCUS_19760 3784 4692 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_19760 4786 6183 gene locus_tag LOCUS_19770 4786 6183 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_19770 6443 6781 gene locus_tag LOCUS_19780 gene ogt2 6443 6781 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_19780 6845 7588 gene locus_tag LOCUS_19790 6845 7588 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_19790 8688 7672 gene locus_tag LOCUS_19800 8688 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 9877 8816 gene locus_tag LOCUS_19810 9877 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 10603 9959 gene locus_tag LOCUS_19820 10603 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 12077 10623 gene locus_tag LOCUS_19830 12077 10623 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 protein_id gnl|my_center|LOCUS_19830 12160 12942 gene locus_tag LOCUS_19840 12160 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 12974 14392 gene locus_tag LOCUS_19850 12974 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 14735 15118 gene locus_tag LOCUS_19860 14735 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_19860 15950 17458 gene locus_tag LOCUS_19870 15950 17458 CDS product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_19870 17550 18626 gene locus_tag LOCUS_19880 17550 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 20343 18805 gene locus_tag LOCUS_19890 gene speE1 20343 18805 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_19890 21423 20533 gene locus_tag LOCUS_19900 21423 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 22216 21446 gene locus_tag LOCUS_19910 22216 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 23019 22474 gene locus_tag LOCUS_19920 23019 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 <25053 23163 gene locus_tag LOCUS_19930 <25053 23163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121034.1:ATPase AAA >Feature sequence071 483 1727 gene locus_tag LOCUS_19940 483 1727 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_19940 2147 1776 gene locus_tag LOCUS_19950 2147 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204941.1 protein_id gnl|my_center|LOCUS_19950 2516 2301 gene locus_tag LOCUS_19960 2516 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2689 3309 gene locus_tag LOCUS_19970 2689 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_19970 3418 4365 gene locus_tag LOCUS_19980 3418 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4941 4384 gene locus_tag LOCUS_19990 4941 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6292 4943 gene locus_tag LOCUS_20000 6292 4943 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_20000 6572 7156 gene locus_tag LOCUS_20010 6572 7156 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_20010 7323 7763 gene locus_tag LOCUS_20020 7323 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7980 8801 gene locus_tag LOCUS_20030 7980 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8804 9481 gene locus_tag LOCUS_20040 8804 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10578 9535 gene locus_tag LOCUS_20050 gene speB 10578 9535 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_20050 11851 10571 gene locus_tag LOCUS_20060 11851 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 12382 11888 gene locus_tag LOCUS_20070 12382 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 12528 15026 gene locus_tag LOCUS_20080 gene topA 12528 15026 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_20080 15124 16062 gene locus_tag LOCUS_20090 15124 16062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_20090 16059 16598 gene locus_tag LOCUS_20100 16059 16598 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_20100 19694 16614 gene locus_tag LOCUS_20110 19694 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 19847 20548 gene locus_tag LOCUS_20120 gene npdA 19847 20548 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_20120 20705 22114 gene locus_tag LOCUS_20130 20705 22114 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_20130 22189 23169 gene locus_tag LOCUS_20140 22189 23169 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_20140 23219 23881 gene locus_tag LOCUS_20150 23219 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 23888 24769 gene locus_tag LOCUS_20160 23888 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence072 879 1556 gene locus_tag LOCUS_20170 879 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1866 2597 gene locus_tag LOCUS_20180 1866 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2743 4152 gene locus_tag LOCUS_20190 2743 4152 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_20190 4173 4652 gene locus_tag LOCUS_20200 4173 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4704 5192 gene locus_tag LOCUS_20210 4704 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5189 5686 gene locus_tag LOCUS_20220 5189 5686 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_20220 5737 6252 gene locus_tag LOCUS_20230 5737 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6249 7085 gene locus_tag LOCUS_20240 6249 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7168 7359 gene locus_tag LOCUS_20250 7168 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 7425 8114 gene locus_tag LOCUS_20260 gene vanX 7425 8114 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAK6 protein_id gnl|my_center|LOCUS_20260 8111 8806 gene locus_tag LOCUS_20270 8111 8806 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_20270 9547 8822 gene locus_tag LOCUS_20280 9547 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 9706 10686 gene locus_tag LOCUS_20290 9706 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11232 10762 gene locus_tag LOCUS_20300 11232 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 13935 11362 gene locus_tag LOCUS_20310 13935 11362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_20310 14338 14006 gene locus_tag LOCUS_20320 14338 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 15413 14481 gene locus_tag LOCUS_20330 15413 14481 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_20330 16648 15410 gene locus_tag LOCUS_20340 16648 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 17964 16648 gene locus_tag LOCUS_20350 17964 16648 CDS product cell division control protein 48 CDC48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701100.1 protein_id gnl|my_center|LOCUS_20350 18141 18638 gene locus_tag LOCUS_20360 18141 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 19153 18635 gene locus_tag LOCUS_20370 19153 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 19602 19231 gene locus_tag LOCUS_20380 19602 19231 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370120.1 protein_id gnl|my_center|LOCUS_20380 20849 19680 gene locus_tag LOCUS_20390 20849 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 22094 20919 gene locus_tag LOCUS_20400 22094 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 23634 22303 gene locus_tag LOCUS_20410 23634 22303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 <24867 23639 gene locus_tag LOCUS_20420 <24867 23639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase >Feature sequence073 2998 2276 gene locus_tag LOCUS_20430 2998 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_20430 4015 3365 gene locus_tag LOCUS_20440 4015 3365 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070580.1 protein_id gnl|my_center|LOCUS_20440 5361 4252 gene locus_tag LOCUS_20450 5361 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 5500 6213 gene locus_tag LOCUS_20460 5500 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 7816 6266 gene locus_tag LOCUS_20470 gene pcd 7816 6266 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_20470 9443 8010 gene locus_tag LOCUS_20480 9443 8010 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_20480 10377 9622 gene locus_tag LOCUS_20490 10377 9622 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_20490 12795 10483 gene locus_tag LOCUS_20500 12795 10483 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_20500 13330 12974 gene locus_tag LOCUS_20510 13330 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 14604 13507 gene locus_tag LOCUS_20520 14604 13507 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 protein_id gnl|my_center|LOCUS_20520 15645 14629 gene locus_tag LOCUS_20530 15645 14629 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_20530 18075 15649 gene locus_tag LOCUS_20540 18075 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20540 19179 18088 gene locus_tag LOCUS_20550 19179 18088 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_20550 20500 19229 gene locus_tag LOCUS_20560 20500 19229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_20560 21737 20505 gene locus_tag LOCUS_20570 21737 20505 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_20570 22960 21734 gene locus_tag LOCUS_20580 22960 21734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence074 2552 1338 gene locus_tag LOCUS_20590 2552 1338 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_20590 2812 2567 gene locus_tag LOCUS_20600 2812 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2916 3338 gene locus_tag LOCUS_20610 2916 3338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203920.1 protein_id gnl|my_center|LOCUS_20610 3466 4014 gene locus_tag LOCUS_20620 gene mip 3466 4014 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_20620 6161 4302 gene locus_tag LOCUS_20630 6161 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 6380 7399 gene locus_tag LOCUS_20640 gene hemH 6380 7399 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_20640 7904 7590 gene locus_tag LOCUS_20650 7904 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9106 7964 gene locus_tag LOCUS_20660 9106 7964 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_20660 10499 9108 gene locus_tag LOCUS_20670 10499 9108 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_20670 10830 10603 gene locus_tag LOCUS_20680 10830 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 10917 11726 gene locus_tag LOCUS_20690 10917 11726 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_20690 11744 13519 gene locus_tag LOCUS_20700 11744 13519 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_20700 14109 14597 gene locus_tag LOCUS_20710 14109 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 14609 15217 gene locus_tag LOCUS_20720 14609 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 15353 15655 gene locus_tag LOCUS_20730 15353 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 16030 15659 gene locus_tag LOCUS_20740 16030 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_20740 16735 16076 gene locus_tag LOCUS_20750 16735 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 19250 16827 gene locus_tag LOCUS_20760 19250 16827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_20760 20546 19386 gene locus_tag LOCUS_20770 20546 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 22161 20683 gene locus_tag LOCUS_20780 22161 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 22373 23350 gene locus_tag LOCUS_20790 gene aspG 22373 23350 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_20790 24582 23347 gene locus_tag LOCUS_20800 24582 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence075 2266 50 gene locus_tag LOCUS_20810 2266 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2561 3634 gene locus_tag LOCUS_20820 2561 3634 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_20820 3631 4362 gene locus_tag LOCUS_20830 3631 4362 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_20830 5568 4387 gene locus_tag LOCUS_20840 5568 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 7182 5920 gene locus_tag LOCUS_20850 7182 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 8944 7421 gene locus_tag LOCUS_20860 gene aldA 8944 7421 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_20860 9153 10064 gene locus_tag LOCUS_20870 9153 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 10645 10061 gene locus_tag LOCUS_20880 10645 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 11040 15569 gene locus_tag LOCUS_20890 11040 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 15566 17656 gene locus_tag LOCUS_20900 15566 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 18165 17722 gene locus_tag LOCUS_20910 18165 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 18903 18205 gene locus_tag LOCUS_20920 18903 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 19004 20026 gene locus_tag LOCUS_20930 19004 20026 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_20930 20235 23180 gene locus_tag LOCUS_20940 20235 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence076 1054 3537 gene locus_tag LOCUS_20950 1054 3537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_20950 3640 4845 gene locus_tag LOCUS_20960 3640 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4857 5381 gene locus_tag LOCUS_20970 4857 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 7004 5385 gene locus_tag LOCUS_20980 7004 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 7124 8551 gene locus_tag LOCUS_20990 7124 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 9840 8548 gene locus_tag LOCUS_21000 9840 8548 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21000 9986 10441 gene locus_tag LOCUS_21010 9986 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11317 10415 gene locus_tag LOCUS_21020 gene miaA1 11317 10415 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_21020 11418 12167 gene locus_tag LOCUS_21030 11418 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 12171 12551 gene locus_tag LOCUS_21040 12171 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 12557 12832 gene locus_tag LOCUS_21050 12557 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 12829 13590 gene locus_tag LOCUS_21060 gene phnP 12829 13590 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_21060 13591 15147 gene locus_tag LOCUS_21070 13591 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 17605 16169 gene locus_tag LOCUS_21080 gene pykA 17605 16169 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_21080 18033 17605 gene locus_tag LOCUS_21090 18033 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 18156 18392 gene locus_tag LOCUS_21100 gene acpP 18156 18392 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_21100 18415 19665 gene locus_tag LOCUS_21110 18415 19665 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_21110 19668 20411 gene locus_tag LOCUS_21120 gene rnc 19668 20411 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_21120 20414 22255 gene locus_tag LOCUS_21130 gene nadE 20414 22255 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_21130 22324 23610 gene locus_tag LOCUS_21140 22324 23610 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_21140 23766 24233 gene locus_tag LOCUS_21150 23766 24233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 24244 24654 gene locus_tag LOCUS_21160 gene yitI 24244 24654 CDS product putative N-acetyltransferase YitI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06744 protein_id gnl|my_center|LOCUS_21160 >Feature sequence077 239 958 gene locus_tag LOCUS_21170 239 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1426 1151 gene locus_tag LOCUS_21180 1426 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2056 1757 gene locus_tag LOCUS_21190 2056 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2311 2168 gene locus_tag LOCUS_21200 2311 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3223 2498 gene locus_tag LOCUS_21210 3223 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3934 3227 gene locus_tag LOCUS_21220 3934 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4593 4033 gene locus_tag LOCUS_21230 4593 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5371 4577 gene locus_tag LOCUS_21240 5371 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 7706 5373 gene locus_tag LOCUS_21250 7706 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8527 7823 gene locus_tag LOCUS_21260 8527 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 9130 8708 gene locus_tag LOCUS_21270 9130 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 9888 9223 gene locus_tag LOCUS_21280 9888 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 10651 9938 gene locus_tag LOCUS_21290 10651 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 11839 10658 gene locus_tag LOCUS_21300 11839 10658 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 protein_id gnl|my_center|LOCUS_21300 13255 12128 gene locus_tag LOCUS_21310 13255 12128 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_21310 13475 16228 gene locus_tag LOCUS_21320 13475 16228 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_21320 17044 16232 gene locus_tag LOCUS_21330 17044 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 17365 17715 gene locus_tag LOCUS_21340 17365 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 20328 18199 gene locus_tag LOCUS_21350 20328 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 20839 20561 gene locus_tag LOCUS_21360 20839 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 22047 21082 gene locus_tag LOCUS_21370 22047 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 22466 22657 gene locus_tag LOCUS_21380 22466 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 22917 24059 gene locus_tag LOCUS_21390 22917 24059 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence078 1246 284 gene locus_tag LOCUS_21400 gene argK 1246 284 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_21400 1350 1886 gene locus_tag LOCUS_21410 1350 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1890 2507 gene locus_tag LOCUS_21420 1890 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_21420 2875 2504 gene locus_tag LOCUS_21430 2875 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2926 3771 gene locus_tag LOCUS_21440 2926 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3850 4677 gene locus_tag LOCUS_21450 3850 4677 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_21450 4702 5244 gene locus_tag LOCUS_21460 4702 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_21460 5248 5889 gene locus_tag LOCUS_21470 5248 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5879 6346 gene locus_tag LOCUS_21480 5879 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 7014 6343 gene locus_tag LOCUS_21490 7014 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 7628 7146 gene locus_tag LOCUS_21500 7628 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 8067 7615 gene locus_tag LOCUS_21510 8067 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 9334 8084 gene locus_tag LOCUS_21520 9334 8084 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_21520 9966 9334 gene locus_tag LOCUS_21530 9966 9334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_21530 10131 11318 gene locus_tag LOCUS_21540 10131 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 11320 11760 gene locus_tag LOCUS_21550 11320 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 11773 13143 gene locus_tag LOCUS_21560 11773 13143 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_21560 13476 14588 gene locus_tag LOCUS_21570 13476 14588 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_21570 15178 16233 gene locus_tag LOCUS_21580 15178 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_21580 16876 16373 gene locus_tag LOCUS_21590 16876 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 17118 17327 gene locus_tag LOCUS_21600 17118 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 17768 17328 gene locus_tag LOCUS_21610 17768 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 19409 18321 gene locus_tag LOCUS_21620 19409 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 20262 19756 gene locus_tag LOCUS_21630 20262 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 21953 20322 gene locus_tag LOCUS_21640 gene pruA 21953 20322 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_21640 22723 22028 gene locus_tag LOCUS_21650 22723 22028 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_21650 23314 22808 gene locus_tag LOCUS_21660 23314 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 23774 23391 gene locus_tag LOCUS_21670 23774 23391 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence079 2235 1231 gene locus_tag LOCUS_21680 2235 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2609 2253 gene locus_tag LOCUS_21690 2609 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4476 2905 gene locus_tag LOCUS_21700 4476 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4589 5404 gene locus_tag LOCUS_21710 4589 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 5401 7476 gene locus_tag LOCUS_21720 5401 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_21720 7564 9462 gene locus_tag LOCUS_21730 7564 9462 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_21730 10019 10492 gene locus_tag LOCUS_21740 10019 10492 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_21740 10479 12665 gene locus_tag LOCUS_21750 10479 12665 CDS product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888272.1 protein_id gnl|my_center|LOCUS_21750 12821 13171 gene locus_tag LOCUS_21760 12821 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_21760 13233 13466 gene locus_tag LOCUS_21770 13233 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 13454 13738 gene locus_tag LOCUS_21780 13454 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 13986 15995 gene locus_tag LOCUS_21790 13986 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 16335 16889 gene locus_tag LOCUS_21800 gene mip 16335 16889 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_21800 16927 17292 gene locus_tag LOCUS_21810 16927 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 17414 17872 gene locus_tag LOCUS_21820 17414 17872 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_21820 17874 18536 gene locus_tag LOCUS_21830 17874 18536 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 protein_id gnl|my_center|LOCUS_21830 18623 19828 gene locus_tag LOCUS_21840 18623 19828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_21840 20224 19829 gene locus_tag LOCUS_21850 20224 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 21661 20414 gene locus_tag LOCUS_21860 21661 20414 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_21860 <24320 21805 gene locus_tag LOCUS_21870 <24320 21805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter >Feature sequence080 3690 4712 gene locus_tag LOCUS_21880 3690 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 4720 5961 gene locus_tag LOCUS_21890 4720 5961 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_21890 7862 5958 gene locus_tag LOCUS_21900 7862 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 8994 7960 gene locus_tag LOCUS_21910 gene gpsA 8994 7960 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_21910 10690 8987 gene locus_tag LOCUS_21920 10690 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 11876 10746 gene locus_tag LOCUS_21930 gene bioF 11876 10746 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_21930 11942 12907 gene locus_tag LOCUS_21940 11942 12907 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881620.1 protein_id gnl|my_center|LOCUS_21940 13030 14004 gene locus_tag LOCUS_21950 13030 14004 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_21950 14441 14007 gene locus_tag LOCUS_21960 14441 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 14981 14586 gene locus_tag LOCUS_21970 14981 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 15743 15162 gene locus_tag LOCUS_21980 15743 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 15858 16970 gene locus_tag LOCUS_21990 15858 16970 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405054.1 protein_id gnl|my_center|LOCUS_21990 17242 18453 gene locus_tag LOCUS_22000 17242 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 18864 19310 gene locus_tag LOCUS_22010 gene mraZ 18864 19310 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5L6 protein_id gnl|my_center|LOCUS_22010 19310 20218 gene locus_tag LOCUS_22020 gene rsmH 19310 20218 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_22020 20334 20645 gene locus_tag LOCUS_22030 20334 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 20719 22734 gene locus_tag LOCUS_22040 20719 22734 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769220.1 protein_id gnl|my_center|LOCUS_22040 22734 24197 gene locus_tag LOCUS_22050 gene murE 22734 24197 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_22050 >Feature sequence081 1152 613 gene locus_tag LOCUS_22060 1152 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1327 2940 gene locus_tag LOCUS_22070 1327 2940 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_22070 2994 3245 gene locus_tag LOCUS_22080 2994 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3255 3752 gene locus_tag LOCUS_22090 3255 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3930 4601 gene locus_tag LOCUS_22100 3930 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4740 6980 gene locus_tag LOCUS_22110 4740 6980 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_22110 10258 7037 gene locus_tag LOCUS_22120 10258 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 10491 11252 gene locus_tag LOCUS_22130 10491 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 11249 11782 gene locus_tag LOCUS_22140 11249 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 11837 13342 gene locus_tag LOCUS_22150 gene treA 11837 13342 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N408 protein_id gnl|my_center|LOCUS_22150 13357 13911 gene locus_tag LOCUS_22160 13357 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 13908 14576 gene locus_tag LOCUS_22170 13908 14576 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_22170 14724 14945 gene locus_tag LOCUS_22180 14724 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 15072 15212 gene locus_tag LOCUS_22190 15072 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 18480 15334 gene locus_tag LOCUS_22200 18480 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 18783 19628 gene locus_tag LOCUS_22210 18783 19628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 protein_id gnl|my_center|LOCUS_22210 19699 21405 gene locus_tag LOCUS_22220 19699 21405 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_22220 21934 23145 gene locus_tag LOCUS_22230 gene glpT 21934 23145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence082 2554 938 gene locus_tag LOCUS_22240 2554 938 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_22240 3030 2758 gene locus_tag LOCUS_22250 3030 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 protein_id gnl|my_center|LOCUS_22250 3161 4366 gene locus_tag LOCUS_22260 3161 4366 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_22260 4420 5499 gene locus_tag LOCUS_22270 4420 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5565 6296 gene locus_tag LOCUS_22280 5565 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6965 6333 gene locus_tag LOCUS_22290 6965 6333 CDS product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817200.1 protein_id gnl|my_center|LOCUS_22290 7605 7060 gene locus_tag LOCUS_22300 gene ftnA 7605 7060 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_22300 9142 7688 gene locus_tag LOCUS_22310 9142 7688 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_22310 10544 9180 gene locus_tag LOCUS_22320 10544 9180 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_22320 12723 10549 gene locus_tag LOCUS_22330 12723 10549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_22330 13485 12727 gene locus_tag LOCUS_22340 13485 12727 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_22340 16418 14406 gene locus_tag LOCUS_22350 16418 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 18610 16619 gene locus_tag LOCUS_22360 18610 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 19032 21029 gene locus_tag LOCUS_22370 19032 21029 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_22370 21022 21777 gene locus_tag LOCUS_22380 21022 21777 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_22380 22207 22716 gene locus_tag LOCUS_22390 22207 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 22874 23332 gene locus_tag LOCUS_22400 22874 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence083 660 586 gene locus_tag LOCUS_t00160 660 586 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2117 861 gene locus_tag LOCUS_22410 2117 861 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_22410 2295 2753 gene locus_tag LOCUS_22420 gene hspC2 2295 2753 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 protein_id gnl|my_center|LOCUS_22420 3721 2876 gene locus_tag LOCUS_22430 3721 2876 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_22430 5861 3963 gene locus_tag LOCUS_22440 gene acsA 5861 3963 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_22440 6240 5866 gene locus_tag LOCUS_22450 6240 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8978 6237 gene locus_tag LOCUS_22460 8978 6237 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_22460 9181 8981 gene locus_tag LOCUS_22470 9181 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10909 9218 gene locus_tag LOCUS_22480 10909 9218 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_22480 11183 10929 gene locus_tag LOCUS_22490 11183 10929 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_22490 12424 11210 gene locus_tag LOCUS_22500 12424 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 12948 12586 gene locus_tag LOCUS_22510 12948 12586 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_22510 13867 13070 gene locus_tag LOCUS_22520 13867 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 14399 13911 gene locus_tag LOCUS_22530 14399 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 14629 15102 gene locus_tag LOCUS_22540 14629 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 15384 16343 gene locus_tag LOCUS_22550 15384 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 16336 17802 gene locus_tag LOCUS_22560 16336 17802 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_22560 17818 18615 gene locus_tag LOCUS_22570 17818 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 18612 20000 gene locus_tag LOCUS_22580 18612 20000 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_22580 20858 20037 gene locus_tag LOCUS_22590 20858 20037 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_22590 22421 20871 gene locus_tag LOCUS_22600 22421 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 23627 22506 gene locus_tag LOCUS_22610 23627 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence084 1623 1219 gene locus_tag LOCUS_22620 1623 1219 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_22620 3741 1624 gene locus_tag LOCUS_22630 gene mcm3 3741 1624 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_22630 4912 3743 gene locus_tag LOCUS_22640 4912 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5180 6604 gene locus_tag LOCUS_22650 gene dnaA 5180 6604 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_22650 7354 6755 gene locus_tag LOCUS_22660 7354 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7631 8518 gene locus_tag LOCUS_22670 gene mltR 7631 8518 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_22670 9995 8931 gene locus_tag LOCUS_22680 9995 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 10622 10095 gene locus_tag LOCUS_22690 10622 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_22690 11182 10727 gene locus_tag LOCUS_22700 11182 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 11981 11262 gene locus_tag LOCUS_22710 gene algR 11981 11262 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_22710 12973 11978 gene locus_tag LOCUS_22720 12973 11978 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 13991 13104 gene locus_tag LOCUS_22730 13991 13104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920091.1 protein_id gnl|my_center|LOCUS_22730 14263 14577 gene locus_tag LOCUS_22740 14263 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 14604 17258 gene locus_tag LOCUS_22750 14604 17258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_22750 17335 18603 gene locus_tag LOCUS_22760 17335 18603 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_22760 18741 19259 gene locus_tag LOCUS_22770 18741 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 20101 19256 gene locus_tag LOCUS_22780 20101 19256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 20552 20115 gene locus_tag LOCUS_22790 20552 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 21031 20603 gene locus_tag LOCUS_22800 21031 20603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 21200 21901 gene locus_tag LOCUS_22810 21200 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 21938 22393 gene locus_tag LOCUS_22820 21938 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 23162 22416 gene locus_tag LOCUS_22830 23162 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence085 899 60 gene locus_tag LOCUS_22840 899 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228189.1 protein_id gnl|my_center|LOCUS_22840 3761 909 gene locus_tag LOCUS_22850 3761 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4400 4314 gene locus_tag LOCUS_t00170 4400 4314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4541 5227 gene locus_tag LOCUS_22860 4541 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837472.1 protein_id gnl|my_center|LOCUS_22860 5235 6920 gene locus_tag LOCUS_22870 gene ggtB 5235 6920 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_22870 7065 7523 gene locus_tag LOCUS_22880 7065 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 8070 7576 gene locus_tag LOCUS_22890 8070 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 8262 8726 gene locus_tag LOCUS_22900 8262 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 11404 8741 gene locus_tag LOCUS_22910 11404 8741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_22910 11727 11401 gene locus_tag LOCUS_22920 11727 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 11984 12553 gene locus_tag LOCUS_22930 11984 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 13553 12594 gene locus_tag LOCUS_22940 13553 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 13978 14607 gene locus_tag LOCUS_22950 13978 14607 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249116.1 protein_id gnl|my_center|LOCUS_22950 14604 15704 gene locus_tag LOCUS_22960 14604 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 16671 15694 gene locus_tag LOCUS_22970 16671 15694 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_22970 19489 16838 gene locus_tag LOCUS_22980 19489 16838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_22980 22139 19482 gene locus_tag LOCUS_22990 22139 19482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_22990 22534 22136 gene locus_tag LOCUS_23000 22534 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence086 431 2254 gene locus_tag LOCUS_23010 431 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2464 2784 gene locus_tag LOCUS_23020 2464 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4127 2826 gene locus_tag LOCUS_23030 4127 2826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021364.1 protein_id gnl|my_center|LOCUS_23030 4695 4135 gene locus_tag LOCUS_23040 4695 4135 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142521.1 protein_id gnl|my_center|LOCUS_23040 5490 4822 gene locus_tag LOCUS_23050 5490 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5780 6400 gene locus_tag LOCUS_23060 5780 6400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_23060 7241 6414 gene locus_tag LOCUS_23070 gene lgt 7241 6414 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_23070 7423 7244 gene locus_tag LOCUS_23080 7423 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7910 7404 gene locus_tag LOCUS_23090 7910 7404 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_23090 8687 7986 gene locus_tag LOCUS_23100 8687 7986 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_23100 9915 8920 gene locus_tag LOCUS_23110 9915 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 10825 10289 gene locus_tag LOCUS_23120 10825 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 11735 10899 gene locus_tag LOCUS_23130 11735 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 12273 11893 gene locus_tag LOCUS_23140 12273 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 12502 14220 gene locus_tag LOCUS_23150 12502 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 15582 14221 gene locus_tag LOCUS_23160 15582 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 15777 16268 gene locus_tag LOCUS_23170 15777 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 17051 16335 gene locus_tag LOCUS_23180 gene nonF 17051 16335 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035300.1 protein_id gnl|my_center|LOCUS_23180 17353 17060 gene locus_tag LOCUS_23190 17353 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 18002 17427 gene locus_tag LOCUS_23200 18002 17427 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_23200 19127 18072 gene locus_tag LOCUS_23210 19127 18072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956722.1 protein_id gnl|my_center|LOCUS_23210 19334 19813 gene locus_tag LOCUS_23220 19334 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 20363 19929 gene locus_tag LOCUS_23230 20363 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 21431 20412 gene locus_tag LOCUS_23240 gene rlmF 21431 20412 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 protein_id gnl|my_center|LOCUS_23240 21693 21445 gene locus_tag LOCUS_23250 21693 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_23250 22256 21762 gene locus_tag LOCUS_23260 22256 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 <22980 22351 gene locus_tag LOCUS_23270 <22980 22351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764714.1:DNA-binding response regulator >Feature sequence087 1303 401 gene locus_tag LOCUS_23280 1303 401 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_23280 2136 1396 gene locus_tag LOCUS_23290 2136 1396 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_23290 3173 2136 gene locus_tag LOCUS_23300 3173 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3394 3966 gene locus_tag LOCUS_23310 3394 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3966 5165 gene locus_tag LOCUS_23320 3966 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5307 5747 gene locus_tag LOCUS_23330 5307 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 6827 5748 gene locus_tag LOCUS_23340 6827 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8537 6990 gene locus_tag LOCUS_23350 8537 6990 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_23350 8822 9169 gene locus_tag LOCUS_23360 8822 9169 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_23360 9176 11854 gene locus_tag LOCUS_23370 9176 11854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23370 11882 12343 gene locus_tag LOCUS_23380 11882 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 12427 14109 gene locus_tag LOCUS_23390 12427 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 14684 14232 gene locus_tag LOCUS_23400 14684 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23400 15182 14826 gene locus_tag LOCUS_23410 15182 14826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23410 15282 16043 gene locus_tag LOCUS_23420 15282 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 16071 16385 gene locus_tag LOCUS_23430 16071 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 16412 16792 gene locus_tag LOCUS_23440 16412 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 16901 17512 gene locus_tag LOCUS_23450 16901 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 20548 17954 gene locus_tag LOCUS_23460 20548 17954 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_23460 20883 20545 gene locus_tag LOCUS_23470 20883 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 22570 21464 gene locus_tag LOCUS_23480 22570 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence088 1665 832 gene locus_tag LOCUS_23490 1665 832 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_23490 2857 1784 gene locus_tag LOCUS_23500 2857 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3159 2944 gene locus_tag LOCUS_23510 3159 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3297 3575 gene locus_tag LOCUS_23520 3297 3575 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 protein_id gnl|my_center|LOCUS_23520 5021 3615 gene locus_tag LOCUS_23530 5021 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7654 5021 gene locus_tag LOCUS_23540 7654 5021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_23540 7977 7651 gene locus_tag LOCUS_23550 7977 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8653 8195 gene locus_tag LOCUS_23560 8653 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 9624 10508 gene locus_tag LOCUS_23570 9624 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 10765 13314 gene locus_tag LOCUS_23580 10765 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 13345 13707 gene locus_tag LOCUS_23590 13345 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 13958 14659 gene locus_tag LOCUS_23600 13958 14659 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_23600 14727 15095 gene locus_tag LOCUS_23610 14727 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 17605 15236 gene locus_tag LOCUS_23620 17605 15236 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_23620 17883 18908 gene locus_tag LOCUS_23630 17883 18908 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_23630 18905 19669 gene locus_tag LOCUS_23640 18905 19669 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence089 536 75 gene locus_tag LOCUS_23650 536 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 917 555 gene locus_tag LOCUS_23660 917 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1275 922 gene locus_tag LOCUS_23670 1275 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2379 1366 gene locus_tag LOCUS_23680 2379 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3383 2610 gene locus_tag LOCUS_23690 3383 2610 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119768.1 protein_id gnl|my_center|LOCUS_23690 4872 3535 gene locus_tag LOCUS_23700 4872 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 7790 5115 gene locus_tag LOCUS_23710 7790 5115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23710 10526 7836 gene locus_tag LOCUS_23720 10526 7836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23720 13128 10531 gene locus_tag LOCUS_23730 13128 10531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23730 15754 13136 gene locus_tag LOCUS_23740 15754 13136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23740 16092 15760 gene locus_tag LOCUS_23750 16092 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 16280 18025 gene locus_tag LOCUS_23760 16280 18025 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Y5 protein_id gnl|my_center|LOCUS_23760 18079 18417 gene locus_tag LOCUS_23770 18079 18417 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_23770 18404 18721 gene locus_tag LOCUS_23780 18404 18721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_23780 19025 19321 gene locus_tag LOCUS_23790 19025 19321 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_23790 19335 19697 gene locus_tag LOCUS_23800 19335 19697 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_23800 20447 19731 gene locus_tag LOCUS_23810 20447 19731 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_23810 21005 20517 gene locus_tag LOCUS_23820 21005 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 22509 21139 gene locus_tag LOCUS_23830 22509 21139 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence090 1364 783 gene locus_tag LOCUS_23840 1364 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2711 1365 gene locus_tag LOCUS_23850 2711 1365 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786408.1 protein_id gnl|my_center|LOCUS_23850 4074 2701 gene locus_tag LOCUS_23860 4074 2701 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_23860 4334 6706 gene locus_tag LOCUS_23870 4334 6706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23870 6739 9138 gene locus_tag LOCUS_23880 6739 9138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23880 9150 11504 gene locus_tag LOCUS_23890 9150 11504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_23890 11522 13924 gene locus_tag LOCUS_23900 11522 13924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23900 13936 16320 gene locus_tag LOCUS_23910 13936 16320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23910 16591 18957 gene locus_tag LOCUS_23920 16591 18957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_23920 18950 21349 gene locus_tag LOCUS_23930 18950 21349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence091 681 43 gene locus_tag LOCUS_23940 681 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 947 1624 gene locus_tag LOCUS_23950 947 1624 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987176.1 protein_id gnl|my_center|LOCUS_23950 1635 3095 gene locus_tag LOCUS_23960 1635 3095 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_23960 3097 4494 gene locus_tag LOCUS_23970 3097 4494 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_23970 5243 4692 gene locus_tag LOCUS_23980 5243 4692 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_23980 6540 5233 gene locus_tag LOCUS_23990 6540 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_23990 8033 6540 gene locus_tag LOCUS_24000 gene accC 8033 6540 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_24000 8269 9444 gene locus_tag LOCUS_24010 8269 9444 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_24010 9543 9719 gene locus_tag LOCUS_24020 9543 9719 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_24020 10639 9770 gene locus_tag LOCUS_24030 gene dapA 10639 9770 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_24030 11154 10642 gene locus_tag LOCUS_24040 11154 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 13205 11154 gene locus_tag LOCUS_24050 gene ligA 13205 11154 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_24050 13411 13214 gene locus_tag LOCUS_24060 13411 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 14707 13412 gene locus_tag LOCUS_24070 gene xseA 14707 13412 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_24070 15639 15139 gene locus_tag LOCUS_24080 15639 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 16305 15643 gene locus_tag LOCUS_24090 16305 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 16909 16337 gene locus_tag LOCUS_24100 16909 16337 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_24100 17057 17515 gene locus_tag LOCUS_24110 17057 17515 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_24110 18577 17549 gene locus_tag LOCUS_24120 18577 17549 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_24120 18649 18873 gene locus_tag LOCUS_24130 18649 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 18903 19589 gene locus_tag LOCUS_24140 18903 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 19756 20367 gene locus_tag LOCUS_24150 19756 20367 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence092 601 981 gene locus_tag LOCUS_24160 601 981 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389152.1 protein_id gnl|my_center|LOCUS_24160 2336 975 gene locus_tag LOCUS_24170 2336 975 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_24170 2464 3486 gene locus_tag LOCUS_24180 2464 3486 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_24180 4312 3491 gene locus_tag LOCUS_24190 4312 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 4895 4461 gene locus_tag LOCUS_24200 gene ppi 4895 4461 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_24200 5453 4986 gene locus_tag LOCUS_24210 5453 4986 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_24210 6454 5546 gene locus_tag LOCUS_24220 6454 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 7632 6529 gene locus_tag LOCUS_24230 gene dinB 7632 6529 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X95 protein_id gnl|my_center|LOCUS_24230 7716 7919 gene locus_tag LOCUS_24240 7716 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7949 8434 gene locus_tag LOCUS_24250 7949 8434 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_24250 9230 8613 gene locus_tag LOCUS_24260 9230 8613 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_24260 9611 10255 gene locus_tag LOCUS_24270 9611 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 12802 10451 gene locus_tag LOCUS_24280 12802 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_24280 12964 13920 gene locus_tag LOCUS_24290 12964 13920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_24290 14059 14367 gene locus_tag LOCUS_24300 14059 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 15451 14525 gene locus_tag LOCUS_24310 15451 14525 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_24310 15592 15891 gene locus_tag LOCUS_24320 15592 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 15906 16868 gene locus_tag LOCUS_24330 15906 16868 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_24330 18943 17051 gene locus_tag LOCUS_24340 gene napA 18943 17051 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_24340 19365 18997 gene locus_tag LOCUS_24350 19365 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 20756 19557 gene locus_tag LOCUS_24360 20756 19557 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_24360 21149 20760 gene locus_tag LOCUS_24370 21149 20760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence093 3537 2623 gene locus_tag LOCUS_24380 3537 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3668 4312 gene locus_tag LOCUS_24390 gene upp 3668 4312 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_24390 4316 5257 gene locus_tag LOCUS_24400 gene yrbG 4316 5257 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_24400 5257 5712 gene locus_tag LOCUS_24410 5257 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 6620 5718 gene locus_tag LOCUS_24420 6620 5718 CDS product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_24420 7429 6722 gene locus_tag LOCUS_24430 7429 6722 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_24430 8358 7426 gene locus_tag LOCUS_24440 8358 7426 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_24440 8308 8535 gene locus_tag LOCUS_24450 8308 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8640 9371 gene locus_tag LOCUS_24460 8640 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 9397 10434 gene locus_tag LOCUS_24470 gene hemE 9397 10434 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1W0 protein_id gnl|my_center|LOCUS_24470 10528 11829 gene locus_tag LOCUS_24480 gene amaA 10528 11829 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_24480 12325 12011 gene locus_tag LOCUS_24490 12325 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 13267 12905 gene locus_tag LOCUS_24500 13267 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 13781 13458 gene locus_tag LOCUS_24510 13781 13458 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_24510 14531 13866 gene locus_tag LOCUS_24520 gene dnaQ 14531 13866 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_24520 16409 14532 gene locus_tag LOCUS_24530 16409 14532 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_24530 17499 16492 gene locus_tag LOCUS_24540 17499 16492 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_24540 18695 17499 gene locus_tag LOCUS_24550 gene aspC1 18695 17499 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_24550 19317 18709 gene locus_tag LOCUS_24560 gene recR 19317 18709 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_24560 19631 19350 gene locus_tag LOCUS_24570 gene clpS 19631 19350 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_24570 20515 19715 gene locus_tag LOCUS_24580 20515 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence094 9194 12034 gene locus_tag LOCUS_24590 9194 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 12344 12036 gene locus_tag LOCUS_24600 12344 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 13860 12439 gene locus_tag LOCUS_24610 13860 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 13892 14365 gene locus_tag LOCUS_24620 13892 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 14567 16099 gene locus_tag LOCUS_24630 14567 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 16074 16823 gene locus_tag LOCUS_24640 16074 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 16820 17089 gene locus_tag LOCUS_24650 16820 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 17422 17715 gene locus_tag LOCUS_24660 17422 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 18091 19704 gene locus_tag LOCUS_24670 18091 19704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 19833 20564 gene locus_tag LOCUS_24680 19833 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 20821 20639 gene locus_tag LOCUS_24690 20821 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 21350 20829 gene locus_tag LOCUS_24700 21350 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence095 552 1730 gene locus_tag LOCUS_24710 552 1730 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_24710 1861 3129 gene locus_tag LOCUS_24720 1861 3129 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015643.1 protein_id gnl|my_center|LOCUS_24720 3173 4117 gene locus_tag LOCUS_24730 gene purC 3173 4117 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_24730 4117 4500 gene locus_tag LOCUS_24740 4117 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4509 5429 gene locus_tag LOCUS_24750 gene rnz 4509 5429 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_24750 6167 6964 gene locus_tag LOCUS_24760 6167 6964 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_24760 7165 7602 gene locus_tag LOCUS_24770 7165 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8064 8924 gene locus_tag LOCUS_24780 8064 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 9687 8953 gene locus_tag LOCUS_24790 9687 8953 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_24790 9779 12151 gene locus_tag LOCUS_24800 9779 12151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_24800 14261 12156 gene locus_tag LOCUS_24810 gene pdhA/B 14261 12156 CDS product oxoisovalerate dehydrogenase subunits alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 protein_id gnl|my_center|LOCUS_24810 14391 15290 gene locus_tag LOCUS_24820 gene hemF 14391 15290 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_24820 15287 15853 gene locus_tag LOCUS_24830 15287 15853 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_24830 15834 16361 gene locus_tag LOCUS_24840 15834 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 16365 16619 gene locus_tag LOCUS_24850 16365 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 17390 16758 gene locus_tag LOCUS_24860 17390 16758 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_24860 18653 17562 gene locus_tag LOCUS_24870 18653 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 19743 19360 gene locus_tag LOCUS_24880 19743 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 20286 19831 gene locus_tag LOCUS_24890 20286 19831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 21058 20267 gene locus_tag LOCUS_24900 21058 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence096 1773 82 gene locus_tag LOCUS_24910 1773 82 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_24910 1888 2292 gene locus_tag LOCUS_24920 1888 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3655 2276 gene locus_tag LOCUS_24930 3655 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5292 3850 gene locus_tag LOCUS_24940 5292 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5409 6269 gene locus_tag LOCUS_24950 5409 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 7011 8474 gene locus_tag LOCUS_24960 7011 8474 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_24960 8560 11331 gene locus_tag LOCUS_24970 gene polA 8560 11331 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_24970 11486 12547 gene locus_tag LOCUS_24980 11486 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 12671 13618 gene locus_tag LOCUS_24990 12671 13618 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_24990 13859 13623 gene locus_tag LOCUS_25000 13859 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 14076 15623 gene locus_tag LOCUS_25010 14076 15623 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_25010 15718 16617 gene locus_tag LOCUS_25020 15718 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_25020 17701 16667 gene locus_tag LOCUS_25030 17701 16667 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_25030 18498 17698 gene locus_tag LOCUS_25040 18498 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 18673 21048 gene locus_tag LOCUS_25050 18673 21048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence097 2152 1685 gene locus_tag LOCUS_25060 2152 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_25060 2906 2217 gene locus_tag LOCUS_25070 2906 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3699 3019 gene locus_tag LOCUS_25080 3699 3019 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_25080 4334 3705 gene locus_tag LOCUS_25090 4334 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 5305 4331 gene locus_tag LOCUS_25100 5305 4331 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_25100 7660 5792 gene locus_tag LOCUS_25110 7660 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7843 8277 gene locus_tag LOCUS_25120 7843 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_25120 8401 8916 gene locus_tag LOCUS_25130 8401 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_25130 8904 9605 gene locus_tag LOCUS_25140 8904 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_25140 10261 9602 gene locus_tag LOCUS_25150 10261 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 10276 11268 gene locus_tag LOCUS_25160 gene gldB 10276 11268 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_25160 12457 11234 gene locus_tag LOCUS_25170 12457 11234 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_25170 13157 12504 gene locus_tag LOCUS_25180 gene nth 13157 12504 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_25180 13459 13223 gene locus_tag LOCUS_25190 13459 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 14033 13434 gene locus_tag LOCUS_25200 14033 13434 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_25200 14310 17123 gene locus_tag LOCUS_25210 gene uvrA1 14310 17123 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_25210 17983 17120 gene locus_tag LOCUS_25220 17983 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 18506 18033 gene locus_tag LOCUS_25230 18506 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 19474 18617 gene locus_tag LOCUS_25240 19474 18617 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_25240 19896 19522 gene locus_tag LOCUS_25250 19896 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence098 <1 710 gene locus_tag LOCUS_25260 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202701.1:histidine kinase 965 1204 gene locus_tag LOCUS_25270 gene acpP 965 1204 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_25270 1350 2198 gene locus_tag LOCUS_25280 1350 2198 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_25280 2200 3345 gene locus_tag LOCUS_25290 2200 3345 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_25290 3931 3332 gene locus_tag LOCUS_25300 3931 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3978 5561 gene locus_tag LOCUS_25310 3978 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 5620 6603 gene locus_tag LOCUS_25320 gene selR 5620 6603 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE02 protein_id gnl|my_center|LOCUS_25320 7131 8060 gene locus_tag LOCUS_25330 7131 8060 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_25330 8113 8817 gene locus_tag LOCUS_25340 8113 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 11396 9024 gene locus_tag LOCUS_25350 gene pbpC 11396 9024 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_25350 16867 11396 gene locus_tag LOCUS_25360 16867 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_25360 17325 17858 gene locus_tag LOCUS_25370 17325 17858 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_25370 18416 18006 gene locus_tag LOCUS_25380 18416 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 19393 18413 gene locus_tag LOCUS_25390 19393 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 19582 20361 gene locus_tag LOCUS_25400 19582 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 20358 21077 gene locus_tag LOCUS_25410 20358 21077 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence099 2734 476 gene locus_tag LOCUS_25420 2734 476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_25420 3336 2731 gene locus_tag LOCUS_25430 gene tdk 3336 2731 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_25430 3660 3337 gene locus_tag LOCUS_25440 3660 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3694 4728 gene locus_tag LOCUS_25450 3694 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 6039 4768 gene locus_tag LOCUS_25460 gene rodA 6039 4768 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_25460 7862 6036 gene locus_tag LOCUS_25470 7862 6036 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_25470 8378 7863 gene locus_tag LOCUS_25480 8378 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 9217 8378 gene locus_tag LOCUS_25490 9217 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 10252 9224 gene locus_tag LOCUS_25500 gene mreB 10252 9224 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_25500 11866 10337 gene locus_tag LOCUS_25510 gene purH 11866 10337 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_25510 12484 11909 gene locus_tag LOCUS_25520 gene purN 12484 11909 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_25520 13341 12481 gene locus_tag LOCUS_25530 13341 12481 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_25530 13660 13385 gene locus_tag LOCUS_25540 13660 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 14450 13668 gene locus_tag LOCUS_25550 14450 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_25550 15736 14447 gene locus_tag LOCUS_25560 15736 14447 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_25560 18330 15808 gene locus_tag LOCUS_25570 18330 15808 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_25570 18764 18366 gene locus_tag LOCUS_25580 18764 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 19152 18877 gene locus_tag LOCUS_25590 19152 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 19817 19155 gene locus_tag LOCUS_25600 19817 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 20588 19905 gene locus_tag LOCUS_25610 20588 19905 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence100 <1 1691 gene locus_tag LOCUS_25620 <1 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A8:Lon protease 1756 2745 gene locus_tag LOCUS_25630 gene porQ 1756 2745 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_25630 2747 4147 gene locus_tag LOCUS_25640 gene hslU 2747 4147 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_25640 5170 4673 gene locus_tag LOCUS_25650 gene sixA 5170 4673 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_25650 5330 5521 gene locus_tag LOCUS_25660 5330 5521 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_25660 6566 5619 gene locus_tag LOCUS_25670 6566 5619 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_25670 6908 7453 gene locus_tag LOCUS_25680 6908 7453 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_25680 7450 9222 gene locus_tag LOCUS_25690 7450 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 9322 12027 gene locus_tag LOCUS_25700 9322 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 12051 13628 gene locus_tag LOCUS_25710 12051 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 13698 14750 gene locus_tag LOCUS_25720 13698 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 14758 16548 gene locus_tag LOCUS_25730 14758 16548 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119811.1 protein_id gnl|my_center|LOCUS_25730 16920 16621 gene locus_tag LOCUS_25740 16920 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 19663 17003 gene locus_tag LOCUS_25750 19663 17003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_25750 19986 19660 gene locus_tag LOCUS_25760 19986 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence101 4628 2205 gene locus_tag LOCUS_25770 4628 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 5857 4772 gene locus_tag LOCUS_25780 5857 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_25780 6091 8706 gene locus_tag LOCUS_25790 gene clpB 6091 8706 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 protein_id gnl|my_center|LOCUS_25790 9014 8769 gene locus_tag LOCUS_25800 9014 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 9415 9137 gene locus_tag LOCUS_25810 9415 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 9978 9412 gene locus_tag LOCUS_25820 gene mcbG 9978 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_25820 11260 10052 gene locus_tag LOCUS_25830 11260 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 12210 11380 gene locus_tag LOCUS_25840 12210 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 12876 12355 gene locus_tag LOCUS_25850 12876 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 12981 16103 gene locus_tag LOCUS_25860 12981 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_25860 16105 16587 gene locus_tag LOCUS_25870 16105 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 16752 17699 gene locus_tag LOCUS_25880 16752 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 17789 20170 gene locus_tag LOCUS_25890 17789 20170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence102 2024 735 gene locus_tag LOCUS_25900 2024 735 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_25900 2563 2117 gene locus_tag LOCUS_25910 2563 2117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_25910 4392 2611 gene locus_tag LOCUS_25920 gene aepA 4392 2611 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_25920 4802 4389 gene locus_tag LOCUS_25930 4802 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5592 4846 gene locus_tag LOCUS_25940 5592 4846 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967961.1 protein_id gnl|my_center|LOCUS_25940 5930 5643 gene locus_tag LOCUS_25950 5930 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 6105 8174 gene locus_tag LOCUS_25960 6105 8174 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931802.1 protein_id gnl|my_center|LOCUS_25960 8209 9108 gene locus_tag LOCUS_25970 8209 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_25970 9834 10610 gene locus_tag LOCUS_25980 9834 10610 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_25980 11010 10621 gene locus_tag LOCUS_25990 11010 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 13190 11010 gene locus_tag LOCUS_26000 13190 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 13294 14589 gene locus_tag LOCUS_26010 gene murF 13294 14589 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_26010 14591 15250 gene locus_tag LOCUS_26020 14591 15250 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_26020 16290 15361 gene locus_tag LOCUS_26030 16290 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 19052 16368 gene locus_tag LOCUS_26040 19052 16368 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_26040 19948 19049 gene locus_tag LOCUS_26050 19948 19049 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_26050 20457 19966 gene locus_tag LOCUS_26060 20457 19966 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence103 1423 1881 gene locus_tag LOCUS_26070 1423 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2202 2118 gene locus_tag LOCUS_t00180 2202 2118 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2387 2314 gene locus_tag LOCUS_t00190 2387 2314 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2865 2503 gene locus_tag LOCUS_26080 2865 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 5492 2886 gene locus_tag LOCUS_26090 gene mutS 5492 2886 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_26090 6331 5609 gene locus_tag LOCUS_26100 6331 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 7641 6352 gene locus_tag LOCUS_26110 7641 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 7954 8874 gene locus_tag LOCUS_26120 7954 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_26120 8984 10150 gene locus_tag LOCUS_26130 8984 10150 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_26130 10151 10687 gene locus_tag LOCUS_26140 10151 10687 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_26140 10763 11212 gene locus_tag LOCUS_26150 10763 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 11415 11753 gene locus_tag LOCUS_26160 11415 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 11747 14389 gene locus_tag LOCUS_26170 11747 14389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26170 15378 14467 gene locus_tag LOCUS_26180 15378 14467 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_26180 15462 16643 gene locus_tag LOCUS_26190 15462 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 18316 16649 gene locus_tag LOCUS_26200 gene malL 18316 16649 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_26200 20270 18321 gene locus_tag LOCUS_26210 20270 18321 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120322.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence104 614 1342 gene locus_tag LOCUS_26220 614 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2490 2918 gene locus_tag LOCUS_26230 2490 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2929 4248 gene locus_tag LOCUS_26240 2929 4248 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_26240 4245 5339 gene locus_tag LOCUS_26250 4245 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5336 6580 gene locus_tag LOCUS_26260 gene lolC 5336 6580 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_26260 6583 7263 gene locus_tag LOCUS_26270 gene lolD 6583 7263 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_26270 7846 7361 gene locus_tag LOCUS_26280 7846 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 8299 8727 gene locus_tag LOCUS_26290 8299 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8877 9767 gene locus_tag LOCUS_26300 8877 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 10869 9841 gene locus_tag LOCUS_26310 10869 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 13655 11067 gene locus_tag LOCUS_26320 13655 11067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_26320 13987 13649 gene locus_tag LOCUS_26330 13987 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 14662 14153 gene locus_tag LOCUS_26340 14662 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 15100 16545 gene locus_tag LOCUS_26350 15100 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 17526 16648 gene locus_tag LOCUS_26360 17526 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 17686 18258 gene locus_tag LOCUS_26370 17686 18258 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8A1 protein_id gnl|my_center|LOCUS_26370 18320 18817 gene locus_tag LOCUS_26380 18320 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 <20582 18932 gene locus_tag LOCUS_26390 <20582 18932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein >Feature sequence105 1485 409 gene locus_tag LOCUS_26400 1485 409 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_26400 2459 1497 gene locus_tag LOCUS_26410 2459 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2593 4179 gene locus_tag LOCUS_26420 gene pccB 2593 4179 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_26420 4183 4881 gene locus_tag LOCUS_26430 4183 4881 CDS product oxidoreductase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524799.1 protein_id gnl|my_center|LOCUS_26430 4884 5954 gene locus_tag LOCUS_26440 4884 5954 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_26440 5984 6754 gene locus_tag LOCUS_26450 gene fecB 5984 6754 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_26450 8833 6737 gene locus_tag LOCUS_26460 8833 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10682 8898 gene locus_tag LOCUS_26470 10682 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 11471 10959 gene locus_tag LOCUS_26480 11471 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 13365 11620 gene locus_tag LOCUS_26490 13365 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 14963 13368 gene locus_tag LOCUS_26500 14963 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 15924 14956 gene locus_tag LOCUS_26510 15924 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 16677 16018 gene locus_tag LOCUS_26520 16677 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 17812 16919 gene locus_tag LOCUS_26530 17812 16919 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528420.1 protein_id gnl|my_center|LOCUS_26530 17997 18947 gene locus_tag LOCUS_26540 17997 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 18953 19936 gene locus_tag LOCUS_26550 18953 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence106 2417 3226 gene locus_tag LOCUS_26560 2417 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3278 3691 gene locus_tag LOCUS_26570 3278 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3914 4741 gene locus_tag LOCUS_26580 3914 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5725 5048 gene locus_tag LOCUS_26590 5725 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6039 6572 gene locus_tag LOCUS_26600 6039 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 6699 7319 gene locus_tag LOCUS_26610 6699 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 7750 9153 gene locus_tag LOCUS_26620 7750 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 9255 10022 gene locus_tag LOCUS_26630 9255 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 10561 11616 gene locus_tag LOCUS_26640 10561 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 13160 11613 gene locus_tag LOCUS_26650 13160 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 13364 17839 gene locus_tag LOCUS_26660 13364 17839 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105670.1 protein_id gnl|my_center|LOCUS_26660 17841 19268 gene locus_tag LOCUS_26670 gene gltD 17841 19268 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_26670 20188 19301 gene locus_tag LOCUS_26680 20188 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104227.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence107 <1 1093 gene locus_tag LOCUS_26690 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108785.1:helicase 1093 1530 gene locus_tag LOCUS_26700 gene ytoQ 1093 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_26700 1852 3228 gene locus_tag LOCUS_26710 gene radA 1852 3228 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_26710 3325 3744 gene locus_tag LOCUS_26720 3325 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3984 3757 gene locus_tag LOCUS_26730 3984 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 4750 3890 gene locus_tag LOCUS_26740 gene dcyD 4750 3890 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_26740 4883 5905 gene locus_tag LOCUS_26750 4883 5905 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_26750 6611 5967 gene locus_tag LOCUS_26760 6611 5967 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_26760 7428 6604 gene locus_tag LOCUS_26770 7428 6604 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_26770 8254 7532 gene locus_tag LOCUS_26780 gene algR 8254 7532 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_26780 9326 8277 gene locus_tag LOCUS_26790 9326 8277 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_26790 10735 9416 gene locus_tag LOCUS_26800 gene ndh 10735 9416 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_26800 12325 11279 gene locus_tag LOCUS_26810 12325 11279 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_26810 14471 12501 gene locus_tag LOCUS_26820 14471 12501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26820 14918 14481 gene locus_tag LOCUS_26830 14918 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 15486 15136 gene locus_tag LOCUS_26840 15486 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 18115 15692 gene locus_tag LOCUS_26850 18115 15692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_26850 18504 18893 gene locus_tag LOCUS_26860 18504 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 18975 19571 gene locus_tag LOCUS_26870 18975 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 19784 19999 gene locus_tag LOCUS_26880 19784 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence108 706 254 gene locus_tag LOCUS_26890 706 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1101 1706 gene locus_tag LOCUS_26900 1101 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1755 2678 gene locus_tag LOCUS_26910 1755 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2733 3698 gene locus_tag LOCUS_26920 gene mtnK 2733 3698 CDS product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819F1 protein_id gnl|my_center|LOCUS_26920 3700 5022 gene locus_tag LOCUS_26930 3700 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_26930 7665 5278 gene locus_tag LOCUS_26940 7665 5278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_26940 8121 8432 gene locus_tag LOCUS_26950 8121 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 8587 9429 gene locus_tag LOCUS_26960 8587 9429 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_26960 9563 10153 gene locus_tag LOCUS_26970 gene engB 9563 10153 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_26970 10219 10662 gene locus_tag LOCUS_26980 10219 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_26980 10691 11008 gene locus_tag LOCUS_26990 10691 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 13026 11005 gene locus_tag LOCUS_27000 13026 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14340 13345 gene locus_tag LOCUS_27010 gene fbp 14340 13345 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 protein_id gnl|my_center|LOCUS_27010 14411 15670 gene locus_tag LOCUS_27020 gene lysC 14411 15670 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_27020 16329 15667 gene locus_tag LOCUS_27030 16329 15667 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_27030 17207 16329 gene locus_tag LOCUS_27040 17207 16329 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_27040 17686 17207 gene locus_tag LOCUS_27050 17686 17207 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_27050 17752 18525 gene locus_tag LOCUS_27060 gene fadB 17752 18525 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970819.1 protein_id gnl|my_center|LOCUS_27060 19643 18591 gene locus_tag LOCUS_27070 19643 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404733.1 protein_id gnl|my_center|LOCUS_27070 20378 19800 gene locus_tag LOCUS_27080 20378 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence109 <1 1442 gene locus_tag LOCUS_27090 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q08408:sensor protein RprX 1435 2130 gene locus_tag LOCUS_27100 1435 2130 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_27100 2274 2996 gene locus_tag LOCUS_27110 gene hisA 2274 2996 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_27110 5377 2993 gene locus_tag LOCUS_27120 5377 2993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_27120 5848 5456 gene locus_tag LOCUS_27130 5848 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 6101 8569 gene locus_tag LOCUS_27140 gene mur/alr 6101 8569 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_27140 8731 8570 gene locus_tag LOCUS_27150 8731 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 8790 10130 gene locus_tag LOCUS_27160 8790 10130 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_27160 10207 10428 gene locus_tag LOCUS_27170 10207 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 10430 12541 gene locus_tag LOCUS_27180 gene feoB 10430 12541 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_27180 13848 12538 gene locus_tag LOCUS_27190 13848 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 14984 13995 gene locus_tag LOCUS_27200 14984 13995 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_27200 15620 15048 gene locus_tag LOCUS_27210 15620 15048 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_27210 15784 17583 gene locus_tag LOCUS_27220 15784 17583 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_27220 17613 18752 gene locus_tag LOCUS_27230 gene purK 17613 18752 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_27230 18749 19243 gene locus_tag LOCUS_27240 gene purE 18749 19243 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_27240 19251 19646 gene locus_tag LOCUS_27250 19251 19646 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706598.1 protein_id gnl|my_center|LOCUS_27250 19878 19654 gene locus_tag LOCUS_27260 19878 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 20346 20023 gene locus_tag LOCUS_27270 20346 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence110 79 1398 gene locus_tag LOCUS_27280 79 1398 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_27280 2489 1395 gene locus_tag LOCUS_27290 2489 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2919 2473 gene locus_tag LOCUS_27300 2919 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3338 2916 gene locus_tag LOCUS_27310 3338 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4913 3369 gene locus_tag LOCUS_27320 4913 3369 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_27320 5299 4928 gene locus_tag LOCUS_27330 5299 4928 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_27330 5513 6556 gene locus_tag LOCUS_27340 5513 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 8286 7138 gene locus_tag LOCUS_27350 8286 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 9437 8283 gene locus_tag LOCUS_27360 9437 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 9665 10177 gene locus_tag LOCUS_27370 9665 10177 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_27370 10161 10709 gene locus_tag LOCUS_27380 10161 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796794.1 protein_id gnl|my_center|LOCUS_27380 10769 11263 gene locus_tag LOCUS_27390 10769 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 11314 11850 gene locus_tag LOCUS_27400 11314 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 11898 12803 gene locus_tag LOCUS_27410 11898 12803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_27410 12800 13609 gene locus_tag LOCUS_27420 12800 13609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_27420 13729 14460 gene locus_tag LOCUS_27430 13729 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 14594 16108 gene locus_tag LOCUS_27440 14594 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 17754 16087 gene locus_tag LOCUS_27450 17754 16087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence111 1243 1908 gene locus_tag LOCUS_27460 1243 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2101 3312 gene locus_tag LOCUS_27470 2101 3312 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_27470 3314 4246 gene locus_tag LOCUS_27480 3314 4246 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_27480 4243 5028 gene locus_tag LOCUS_27490 4243 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 5252 6382 gene locus_tag LOCUS_27500 5252 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6487 7848 gene locus_tag LOCUS_27510 6487 7848 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898540.1 protein_id gnl|my_center|LOCUS_27510 8027 9754 gene locus_tag LOCUS_27520 8027 9754 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_27520 12249 9790 gene locus_tag LOCUS_27530 gene wzc 12249 9790 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_27530 12999 12256 gene locus_tag LOCUS_27540 12999 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 13384 13818 gene locus_tag LOCUS_27550 13384 13818 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_27550 13824 16208 gene locus_tag LOCUS_27560 13824 16208 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_27560 16248 17426 gene locus_tag LOCUS_27570 16248 17426 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_27570 17513 19324 gene locus_tag LOCUS_27580 17513 19324 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_27580 20003 19398 gene locus_tag LOCUS_27590 20003 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence112 <1 946 gene locus_tag LOCUS_27600 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087807.1:adenylate cyclase 1183 2265 gene locus_tag LOCUS_27610 1183 2265 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_27610 2453 3643 gene locus_tag LOCUS_27620 2453 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3640 4515 gene locus_tag LOCUS_27630 3640 4515 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_27630 4781 5845 gene locus_tag LOCUS_27640 gene ilvK 4781 5845 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_27640 5883 6386 gene locus_tag LOCUS_27650 5883 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 6699 7526 gene locus_tag LOCUS_27660 gene prfB 6699 7526 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_27660 7566 8753 gene locus_tag LOCUS_27670 gene norA 7566 8753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 protein_id gnl|my_center|LOCUS_27670 8758 9429 gene locus_tag LOCUS_27680 8758 9429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_27680 10232 9534 gene locus_tag LOCUS_27690 10232 9534 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_27690 11649 10267 gene locus_tag LOCUS_27700 gene norM 11649 10267 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_27700 12257 11646 gene locus_tag LOCUS_27710 12257 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 12256 12852 gene locus_tag LOCUS_27720 gene rnhB 12256 12852 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 protein_id gnl|my_center|LOCUS_27720 12877 13875 gene locus_tag LOCUS_27730 12877 13875 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_27730 16292 13911 gene locus_tag LOCUS_27740 16292 13911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_27740 16512 17600 gene locus_tag LOCUS_27750 gene gcvT 16512 17600 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_27750 17610 18311 gene locus_tag LOCUS_27760 gene comB 17610 18311 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_27760 >Feature sequence113 941 2830 gene locus_tag LOCUS_27770 941 2830 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_27770 2830 3069 gene locus_tag LOCUS_27780 2830 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3082 3714 gene locus_tag LOCUS_27790 3082 3714 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y0H4 protein_id gnl|my_center|LOCUS_27790 3765 5441 gene locus_tag LOCUS_27800 3765 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 6128 5463 gene locus_tag LOCUS_27810 6128 5463 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_27810 7024 6128 gene locus_tag LOCUS_27820 7024 6128 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_27820 7326 8204 gene locus_tag LOCUS_27830 7326 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 8276 8779 gene locus_tag LOCUS_27840 8276 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 8779 9501 gene locus_tag LOCUS_27850 8779 9501 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268248.1 protein_id gnl|my_center|LOCUS_27850 9560 9919 gene locus_tag LOCUS_27860 9560 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 9930 10334 gene locus_tag LOCUS_27870 9930 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 10474 11082 gene locus_tag LOCUS_27880 10474 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 11407 11481 gene locus_tag LOCUS_t00200 11407 11481 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12031 12837 gene locus_tag LOCUS_27890 12031 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 14262 15020 gene locus_tag LOCUS_27900 14262 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 15090 15755 gene locus_tag LOCUS_27910 15090 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 15734 16537 gene locus_tag LOCUS_27920 15734 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 16518 17177 gene locus_tag LOCUS_27930 16518 17177 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_27930 17595 17185 gene locus_tag LOCUS_27940 17595 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_27940 17928 18899 gene locus_tag LOCUS_27950 gene batB 17928 18899 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_27950 18896 19687 gene locus_tag LOCUS_27960 18896 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence114 765 238 gene locus_tag LOCUS_27970 765 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1767 817 gene locus_tag LOCUS_27980 1767 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 4475 2091 gene locus_tag LOCUS_27990 gene pac 4475 2091 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_27990 6916 4604 gene locus_tag LOCUS_28000 6916 4604 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405469.1 protein_id gnl|my_center|LOCUS_28000 7515 7078 gene locus_tag LOCUS_28010 7515 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 8208 7579 gene locus_tag LOCUS_28020 gene rhtB 8208 7579 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_28020 8745 8350 gene locus_tag LOCUS_28030 gene yurT 8745 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 protein_id gnl|my_center|LOCUS_28030 9163 8768 gene locus_tag LOCUS_28040 gene yurT 9163 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 protein_id gnl|my_center|LOCUS_28040 9600 9196 gene locus_tag LOCUS_28050 9600 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 10148 9729 gene locus_tag LOCUS_28060 10148 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 11079 10201 gene locus_tag LOCUS_28070 11079 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_28070 11456 11145 gene locus_tag LOCUS_28080 11456 11145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_28080 11701 11453 gene locus_tag LOCUS_28090 11701 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28090 12516 11941 gene locus_tag LOCUS_28100 12516 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 13851 12595 gene locus_tag LOCUS_28110 13851 12595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_28110 14777 14112 gene locus_tag LOCUS_28120 14777 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 15524 14835 gene locus_tag LOCUS_28130 15524 14835 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_28130 15585 17075 gene locus_tag LOCUS_28140 15585 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 17641 17135 gene locus_tag LOCUS_28150 17641 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 17976 17713 gene locus_tag LOCUS_28160 17976 17713 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_28160 18105 18701 gene locus_tag LOCUS_28170 18105 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 18804 19430 gene locus_tag LOCUS_28180 18804 19430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence115 2257 125 gene locus_tag LOCUS_28190 2257 125 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_28190 2521 3642 gene locus_tag LOCUS_28200 gene dnaN 2521 3642 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_28200 3785 4198 gene locus_tag LOCUS_28210 3785 4198 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_28210 4282 4527 gene locus_tag LOCUS_28220 4282 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 4532 5254 gene locus_tag LOCUS_28230 gene cysH 4532 5254 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_28230 5838 5377 gene locus_tag LOCUS_28240 5838 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 6637 5942 gene locus_tag LOCUS_28250 6637 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 7445 6717 gene locus_tag LOCUS_28260 7445 6717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_28260 8116 7442 gene locus_tag LOCUS_28270 8116 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 9569 8262 gene locus_tag LOCUS_28280 gene murA 9569 8262 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_28280 10225 9575 gene locus_tag LOCUS_28290 10225 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 11161 10310 gene locus_tag LOCUS_28300 11161 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 13438 11171 gene locus_tag LOCUS_28310 gene uvrD 13438 11171 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_28310 14065 13529 gene locus_tag LOCUS_28320 14065 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 15216 14074 gene locus_tag LOCUS_28330 15216 14074 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_28330 15322 15915 gene locus_tag LOCUS_28340 15322 15915 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_28340 15934 16227 gene locus_tag LOCUS_28350 15934 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 16229 16801 gene locus_tag LOCUS_28360 gene gmk 16229 16801 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_28360 16809 17384 gene locus_tag LOCUS_28370 gene nadD 16809 17384 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_28370 17629 18585 gene locus_tag LOCUS_28380 17629 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 18590 19267 gene locus_tag LOCUS_28390 18590 19267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence116 937 749 gene locus_tag LOCUS_28400 937 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 995 2302 gene locus_tag LOCUS_28410 995 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 2292 3080 gene locus_tag LOCUS_28420 2292 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3947 3066 gene locus_tag LOCUS_28430 3947 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 4651 3965 gene locus_tag LOCUS_28440 4651 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4928 5893 gene locus_tag LOCUS_28450 4928 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 5896 7410 gene locus_tag LOCUS_28460 5896 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 7414 8088 gene locus_tag LOCUS_28470 7414 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 9235 8072 gene locus_tag LOCUS_28480 9235 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 9861 9466 gene locus_tag LOCUS_28490 9861 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 11827 10004 gene locus_tag LOCUS_28500 11827 10004 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_28500 12590 11841 gene locus_tag LOCUS_28510 12590 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_28510 13704 12670 gene locus_tag LOCUS_28520 13704 12670 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_28520 13836 14864 gene locus_tag LOCUS_28530 gene ruvB 13836 14864 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_28530 15399 16328 gene locus_tag LOCUS_28540 gene queG 15399 16328 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_28540 16608 16360 gene locus_tag LOCUS_28550 16608 16360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 16694 18151 gene locus_tag LOCUS_28560 16694 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 18151 19227 gene locus_tag LOCUS_28570 gene aroC 18151 19227 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_28570 >Feature sequence117 263 3988 gene locus_tag LOCUS_28580 263 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 4003 4917 gene locus_tag LOCUS_28590 4003 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 7291 5849 gene locus_tag LOCUS_28600 7291 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 8416 7538 gene locus_tag LOCUS_28610 gene cysM 8416 7538 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_28610 9326 8490 gene locus_tag LOCUS_28620 9326 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 9680 9462 gene locus_tag LOCUS_28630 9680 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10543 9755 gene locus_tag LOCUS_28640 10543 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 11592 10684 gene locus_tag LOCUS_28650 11592 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 12713 11667 gene locus_tag LOCUS_28660 12713 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 14632 12785 gene locus_tag LOCUS_28670 14632 12785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_28670 19559 14889 gene locus_tag LOCUS_28680 19559 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence118 2281 632 gene locus_tag LOCUS_28690 2281 632 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_28690 2689 2285 gene locus_tag LOCUS_28700 gene rnpA 2689 2285 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_28700 2989 4665 gene locus_tag LOCUS_28710 2989 4665 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_28710 5765 4770 gene locus_tag LOCUS_28720 5765 4770 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_28720 6944 5769 gene locus_tag LOCUS_28730 6944 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_28730 7866 7021 gene locus_tag LOCUS_28740 gene glpQ 7866 7021 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_28740 7966 8352 gene locus_tag LOCUS_28750 7966 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 9417 8356 gene locus_tag LOCUS_28760 9417 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 9531 11726 gene locus_tag LOCUS_28770 9531 11726 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_28770 11918 12124 gene locus_tag LOCUS_28780 11918 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 12896 16561 gene locus_tag LOCUS_28790 12896 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 16730 17971 gene locus_tag LOCUS_28800 16730 17971 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681602.1 protein_id gnl|my_center|LOCUS_28800 18153 19322 gene locus_tag LOCUS_28810 18153 19322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence119 175 408 gene locus_tag LOCUS_28820 175 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 515 1579 gene locus_tag LOCUS_28830 515 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1764 2084 gene locus_tag LOCUS_28840 1764 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2160 3377 gene locus_tag LOCUS_28850 2160 3377 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_28850 3367 4026 gene locus_tag LOCUS_28860 gene deoC 3367 4026 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CD4 protein_id gnl|my_center|LOCUS_28860 4013 4282 gene locus_tag LOCUS_28870 gene acyP 4013 4282 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 protein_id gnl|my_center|LOCUS_28870 4871 4362 gene locus_tag LOCUS_28880 4871 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 7509 4981 gene locus_tag LOCUS_28890 7509 4981 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_28890 7956 11243 gene locus_tag LOCUS_28900 7956 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_28900 11392 11832 gene locus_tag LOCUS_28910 11392 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 12252 11848 gene locus_tag LOCUS_28920 12252 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 12469 12783 gene locus_tag LOCUS_28930 12469 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 13901 12825 gene locus_tag LOCUS_28940 13901 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 14279 14944 gene locus_tag LOCUS_28950 14279 14944 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_28950 14950 16146 gene locus_tag LOCUS_28960 14950 16146 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_28960 16143 17096 gene locus_tag LOCUS_28970 gene argC 16143 17096 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_28970 17142 17975 gene locus_tag LOCUS_28980 gene proC 17142 17975 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_28980 17975 19102 gene locus_tag LOCUS_28990 gene argD 17975 19102 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_28990 >Feature sequence120 3486 1594 gene locus_tag LOCUS_29000 3486 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 4131 3496 gene locus_tag LOCUS_29010 gene queE 4131 3496 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_29010 5082 4201 gene locus_tag LOCUS_29020 gene folD 5082 4201 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_29020 6873 5086 gene locus_tag LOCUS_29030 gene lepA 6873 5086 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_29030 6966 8195 gene locus_tag LOCUS_29040 6966 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_29040 8227 8742 gene locus_tag LOCUS_29050 8227 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 8900 10102 gene locus_tag LOCUS_29060 8900 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29060 10133 11524 gene locus_tag LOCUS_29070 10133 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29070 12234 11545 gene locus_tag LOCUS_29080 12234 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 12482 15007 gene locus_tag LOCUS_29090 12482 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 15118 15648 gene locus_tag LOCUS_29100 15118 15648 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_29100 15652 16098 gene locus_tag LOCUS_29110 15652 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 16098 16472 gene locus_tag LOCUS_29120 gene crcB 16098 16472 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_29120 17881 16829 gene locus_tag LOCUS_29130 17881 16829 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_29130 18469 17942 gene locus_tag LOCUS_29140 18469 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 19214 18609 gene locus_tag LOCUS_29150 19214 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence121 1735 1196 gene locus_tag LOCUS_29160 1735 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29160 2832 1732 gene locus_tag LOCUS_29170 2832 1732 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_29170 2914 4095 gene locus_tag LOCUS_29180 gene putA 2914 4095 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_29180 5305 4097 gene locus_tag LOCUS_29190 5305 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5657 5298 gene locus_tag LOCUS_29200 5657 5298 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_29200 5799 7511 gene locus_tag LOCUS_29210 gene lysS 5799 7511 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_29210 10543 7973 gene locus_tag LOCUS_29220 10543 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_29220 10827 11570 gene locus_tag LOCUS_29230 10827 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 11574 12539 gene locus_tag LOCUS_29240 11574 12539 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_29240 12607 14262 gene locus_tag LOCUS_29250 12607 14262 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_29250 14266 15123 gene locus_tag LOCUS_29260 14266 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 15420 16871 gene locus_tag LOCUS_29270 15420 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 17676 16879 gene locus_tag LOCUS_29280 gene alsD 17676 16879 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_29280 18318 17689 gene locus_tag LOCUS_29290 18318 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 18426 19337 gene locus_tag LOCUS_29300 18426 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence122 2 661 gene locus_tag LOCUS_29310 2 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1451 726 gene locus_tag LOCUS_29320 1451 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2037 1468 gene locus_tag LOCUS_29330 2037 1468 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_29330 2527 2111 gene locus_tag LOCUS_29340 2527 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3313 2984 gene locus_tag LOCUS_29350 3313 2984 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_29350 7737 3448 gene locus_tag LOCUS_29360 gene dnaE 7737 3448 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_29360 8074 9714 gene locus_tag LOCUS_29370 8074 9714 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_29370 10850 9744 gene locus_tag LOCUS_29380 10850 9744 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_29380 13851 11185 gene locus_tag LOCUS_29390 13851 11185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_29390 14182 13841 gene locus_tag LOCUS_29400 14182 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 15199 14423 gene locus_tag LOCUS_29410 15199 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 17484 15280 gene locus_tag LOCUS_29420 17484 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 17743 17561 gene locus_tag LOCUS_29430 17743 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence123 222 2501 gene locus_tag LOCUS_29440 222 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29440 2498 3853 gene locus_tag LOCUS_29450 2498 3853 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_29450 4379 3963 gene locus_tag LOCUS_29460 4379 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 4394 4588 gene locus_tag LOCUS_29470 4394 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5111 7471 gene locus_tag LOCUS_29480 5111 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 9827 8271 gene locus_tag LOCUS_29490 9827 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 10332 9982 gene locus_tag LOCUS_29500 10332 9982 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_29500 11720 10410 gene locus_tag LOCUS_29510 gene ftsA 11720 10410 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_29510 12572 11805 gene locus_tag LOCUS_29520 12572 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 13891 12569 gene locus_tag LOCUS_29530 gene murC 13891 12569 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_29530 14913 13942 gene locus_tag LOCUS_29540 gene murG 14913 13942 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_29540 16217 15057 gene locus_tag LOCUS_29550 gene ftsW 16217 15057 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_29550 16634 16260 gene locus_tag LOCUS_29560 16634 16260 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_29560 18019 16673 gene locus_tag LOCUS_29570 gene murD 18019 16673 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL9 protein_id gnl|my_center|LOCUS_29570 <19224 18066 gene locus_tag LOCUS_29580 <19224 18066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H198:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence124 <1 840 gene locus_tag LOCUS_29590 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767911.1:DNA polymerase III subunit gamma/tau note possible pseudo, frameshifted 1209 1517 gene locus_tag LOCUS_29600 1209 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3069 2095 gene locus_tag LOCUS_29610 3069 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_29610 5046 3115 gene locus_tag LOCUS_29620 5046 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 5723 5082 gene locus_tag LOCUS_29630 5723 5082 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_29630 6959 5724 gene locus_tag LOCUS_29640 6959 5724 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_29640 8089 7019 gene locus_tag LOCUS_29650 8089 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 8175 9176 gene locus_tag LOCUS_29660 8175 9176 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_29660 9160 9561 gene locus_tag LOCUS_29670 9160 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 9572 10861 gene locus_tag LOCUS_29680 gene pepP 9572 10861 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_29680 10854 11297 gene locus_tag LOCUS_29690 10854 11297 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261977.1 protein_id gnl|my_center|LOCUS_29690 11294 11563 gene locus_tag LOCUS_29700 11294 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 11571 12020 gene locus_tag LOCUS_29710 11571 12020 CDS product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_29710 12154 14517 gene locus_tag LOCUS_29720 12154 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 14694 15245 gene locus_tag LOCUS_29730 14694 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 15317 16642 gene locus_tag LOCUS_29740 gene rmuC 15317 16642 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence125 155 1189 gene locus_tag LOCUS_29750 gene spsE 155 1189 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_29750 1186 2292 gene locus_tag LOCUS_29760 1186 2292 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_29760 2279 3325 gene locus_tag LOCUS_29770 2279 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3329 4045 gene locus_tag LOCUS_29780 gene ptmB 3329 4045 CDS product posttranslational modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_29780 4042 4950 gene locus_tag LOCUS_29790 4042 4950 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_29790 4961 5695 gene locus_tag LOCUS_29800 gene ptmA 4961 5695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_29800 5699 6547 gene locus_tag LOCUS_29810 gene hisF 5699 6547 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946486.1 protein_id gnl|my_center|LOCUS_29810 6525 7211 gene locus_tag LOCUS_29820 gene hisH 6525 7211 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60599 protein_id gnl|my_center|LOCUS_29820 7232 8506 gene locus_tag LOCUS_29830 7232 8506 CDS product LPS biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946485.1 protein_id gnl|my_center|LOCUS_29830 8508 9386 gene locus_tag LOCUS_29840 8508 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 9900 10379 gene locus_tag LOCUS_29850 9900 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29850 10456 11166 gene locus_tag LOCUS_29860 10456 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 11356 13149 gene locus_tag LOCUS_29870 11356 13149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_29870 13531 14661 gene locus_tag LOCUS_29880 13531 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 14778 15896 gene locus_tag LOCUS_29890 14778 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 15908 16615 gene locus_tag LOCUS_29900 15908 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 16834 18042 gene locus_tag LOCUS_29910 16834 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 18507 19172 gene locus_tag LOCUS_29920 18507 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence126 962 423 gene locus_tag LOCUS_29930 962 423 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_29930 1552 1124 gene locus_tag LOCUS_29940 1552 1124 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_29940 1781 3283 gene locus_tag LOCUS_29950 1781 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4825 3359 gene locus_tag LOCUS_29960 4825 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5810 5034 gene locus_tag LOCUS_29970 gene uspA 5810 5034 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_29970 5950 6447 gene locus_tag LOCUS_29980 5950 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6522 7199 gene locus_tag LOCUS_29990 6522 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7705 9996 gene locus_tag LOCUS_30000 7705 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_30000 10550 10191 gene locus_tag LOCUS_30010 10550 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 11386 10547 gene locus_tag LOCUS_30020 gene fdhD 11386 10547 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_30020 13161 11482 gene locus_tag LOCUS_30030 gene fhs 13161 11482 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 protein_id gnl|my_center|LOCUS_30030 13303 13932 gene locus_tag LOCUS_30040 13303 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 14446 13913 gene locus_tag LOCUS_30050 14446 13913 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_30050 14661 15446 gene locus_tag LOCUS_30060 14661 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 15510 16043 gene locus_tag LOCUS_30070 15510 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 17199 16045 gene locus_tag LOCUS_30080 gene solA 17199 16045 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_30080 17890 17342 gene locus_tag LOCUS_30090 17890 17342 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_30090 18249 18518 gene locus_tag LOCUS_30100 18249 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence127 636 1382 gene locus_tag LOCUS_30110 636 1382 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_30110 2237 1401 gene locus_tag LOCUS_30120 2237 1401 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_30120 3070 2378 gene locus_tag LOCUS_30130 3070 2378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_30130 4502 3060 gene locus_tag LOCUS_30140 4502 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 5162 4614 gene locus_tag LOCUS_30150 5162 4614 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267269.1 protein_id gnl|my_center|LOCUS_30150 6296 5226 gene locus_tag LOCUS_30160 6296 5226 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_30160 7266 6298 gene locus_tag LOCUS_30170 gene kdsD 7266 6298 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_30170 7348 9537 gene locus_tag LOCUS_30180 7348 9537 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_30180 9570 10856 gene locus_tag LOCUS_30190 gene purD 9570 10856 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_30190 10899 12260 gene locus_tag LOCUS_30200 10899 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 12257 12724 gene locus_tag LOCUS_30210 12257 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 13255 12743 gene locus_tag LOCUS_30220 13255 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 15918 13252 gene locus_tag LOCUS_30230 15918 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 17226 16144 gene locus_tag LOCUS_30240 17226 16144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 18012 17539 gene locus_tag LOCUS_30250 18012 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence128 821 111 gene locus_tag LOCUS_30260 821 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1043 2377 gene locus_tag LOCUS_30270 1043 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2465 4042 gene locus_tag LOCUS_30280 2465 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4833 4354 gene locus_tag LOCUS_30290 4833 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 5330 4914 gene locus_tag LOCUS_30300 5330 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_30300 7139 5580 gene locus_tag LOCUS_30310 7139 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 7647 7174 gene locus_tag LOCUS_30320 7647 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 8040 10511 gene locus_tag LOCUS_30330 8040 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 11003 10518 gene locus_tag LOCUS_30340 11003 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_30340 11462 11094 gene locus_tag LOCUS_30350 11462 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 11544 11705 gene locus_tag LOCUS_30360 11544 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 12507 11842 gene locus_tag LOCUS_30370 12507 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13286 12576 gene locus_tag LOCUS_30380 13286 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_30380 14203 13373 gene locus_tag LOCUS_30390 14203 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 14508 15194 gene locus_tag LOCUS_30400 14508 15194 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_30400 15194 16681 gene locus_tag LOCUS_30410 15194 16681 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_30410 16674 17999 gene locus_tag LOCUS_30420 16674 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence129 141 392 gene locus_tag LOCUS_30430 gene rpsR 141 392 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_30430 425 868 gene locus_tag LOCUS_30440 gene rplI 425 868 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_30440 1026 2669 gene locus_tag LOCUS_30450 1026 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3010 2795 gene locus_tag LOCUS_30460 3010 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3647 3453 gene locus_tag LOCUS_30470 3647 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 4029 5972 gene locus_tag LOCUS_30480 gene glgE 4029 5972 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_30480 5987 7615 gene locus_tag LOCUS_30490 5987 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 7618 9540 gene locus_tag LOCUS_30500 gene glgB 7618 9540 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_30500 9617 11983 gene locus_tag LOCUS_30510 9617 11983 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_30510 11990 12727 gene locus_tag LOCUS_30520 11990 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 13401 12979 gene locus_tag LOCUS_30530 13401 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 14094 13705 gene locus_tag LOCUS_30540 14094 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 14794 14405 gene locus_tag LOCUS_30550 14794 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 17237 15330 gene locus_tag LOCUS_30560 17237 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 18716 17901 gene locus_tag LOCUS_30570 18716 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence130 463 1764 gene locus_tag LOCUS_30580 463 1764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_30580 1962 2453 gene locus_tag LOCUS_30590 1962 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2731 5577 gene locus_tag LOCUS_30600 2731 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 5759 5977 gene locus_tag LOCUS_30610 5759 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 7627 5978 gene locus_tag LOCUS_30620 7627 5978 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_30620 8501 7641 gene locus_tag LOCUS_30630 8501 7641 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_30630 8457 8912 gene locus_tag LOCUS_30640 8457 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_30640 8935 10020 gene locus_tag LOCUS_30650 8935 10020 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_30650 10898 10092 gene locus_tag LOCUS_30660 gene dltE 10898 10092 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_30660 12124 11009 gene locus_tag LOCUS_30670 12124 11009 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_30670 12457 14868 gene locus_tag LOCUS_30680 12457 14868 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_30680 15709 14909 gene locus_tag LOCUS_30690 15709 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 15819 16769 gene locus_tag LOCUS_30700 15819 16769 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_30700 16826 17011 gene locus_tag LOCUS_30710 16826 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 18357 17203 gene locus_tag LOCUS_30720 18357 17203 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence131 60 584 gene locus_tag LOCUS_30730 gene nuoB 60 584 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_30730 581 1066 gene locus_tag LOCUS_30740 581 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1067 2284 gene locus_tag LOCUS_30750 gene nuoD 1067 2284 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_30750 3007 2369 gene locus_tag LOCUS_30760 3007 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3179 3252 gene locus_tag LOCUS_t00210 3179 3252 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3666 6155 gene locus_tag LOCUS_30770 3666 6155 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_30770 6387 6719 gene locus_tag LOCUS_30780 6387 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 6716 9334 gene locus_tag LOCUS_30790 6716 9334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_30790 9327 11978 gene locus_tag LOCUS_30800 9327 11978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_30800 12025 12915 gene locus_tag LOCUS_30810 12025 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_30810 13036 13563 gene locus_tag LOCUS_30820 13036 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_30820 13722 16670 gene locus_tag LOCUS_30830 13722 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 17607 16717 gene locus_tag LOCUS_30840 17607 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 <18570 17699 gene locus_tag LOCUS_30850 <18570 17699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase >Feature sequence132 310 128 gene locus_tag LOCUS_30860 310 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 602 1981 gene locus_tag LOCUS_30870 602 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 2195 3517 gene locus_tag LOCUS_30880 2195 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3666 5048 gene locus_tag LOCUS_30890 3666 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 5319 6596 gene locus_tag LOCUS_30900 5319 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 6716 8149 gene locus_tag LOCUS_30910 6716 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 8971 8675 gene locus_tag LOCUS_30920 8971 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 10866 8980 gene locus_tag LOCUS_30930 10866 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 11673 10870 gene locus_tag LOCUS_30940 11673 10870 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_30940 12105 11869 gene locus_tag LOCUS_30950 12105 11869 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_30950 13223 12129 gene locus_tag LOCUS_30960 13223 12129 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_30960 13518 15452 gene locus_tag LOCUS_30970 gene dnaG 13518 15452 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_30970 15514 16641 gene locus_tag LOCUS_30980 gene ribBA 15514 16641 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_30980 16690 17358 gene locus_tag LOCUS_30990 16690 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 17509 18192 gene locus_tag LOCUS_31000 17509 18192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence133 3083 1623 gene locus_tag LOCUS_31010 3083 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 4118 3237 gene locus_tag LOCUS_31020 4118 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 5129 4197 gene locus_tag LOCUS_31030 5129 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 5564 6508 gene locus_tag LOCUS_31040 gene gapA 5564 6508 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_31040 9493 6920 gene locus_tag LOCUS_31050 9493 6920 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_31050 10078 9494 gene locus_tag LOCUS_31060 10078 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403342.1 protein_id gnl|my_center|LOCUS_31060 10854 10102 gene locus_tag LOCUS_31070 10854 10102 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_31070 11640 10906 gene locus_tag LOCUS_31080 gene porT 11640 10906 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_31080 12311 11589 gene locus_tag LOCUS_31090 gene menG 12311 11589 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A005 protein_id gnl|my_center|LOCUS_31090 13202 12495 gene locus_tag LOCUS_31100 13202 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 13427 14056 gene locus_tag LOCUS_31110 13427 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 15306 14167 gene locus_tag LOCUS_31120 15306 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 16675 15578 gene locus_tag LOCUS_31130 16675 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 16995 16675 gene locus_tag LOCUS_31140 16995 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31140 17214 17023 gene locus_tag LOCUS_31150 17214 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31150 >Feature sequence134 364 1203 gene locus_tag LOCUS_31160 364 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1591 1211 gene locus_tag LOCUS_31170 1591 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1788 3491 gene locus_tag LOCUS_31180 1788 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 4849 3563 gene locus_tag LOCUS_31190 4849 3563 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_31190 5806 4919 gene locus_tag LOCUS_31200 gene thrB 5806 4919 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_31200 6423 5917 gene locus_tag LOCUS_31210 6423 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8916 6484 gene locus_tag LOCUS_31220 gene thrA 8916 6484 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_31220 10220 8958 gene locus_tag LOCUS_31230 gene ilvA 10220 8958 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_31230 11396 10326 gene locus_tag LOCUS_31240 11396 10326 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_31240 11937 11413 gene locus_tag LOCUS_31250 gene ilvH 11937 11413 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_31250 13661 11940 gene locus_tag LOCUS_31260 gene ilvB 13661 11940 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_31260 15357 13675 gene locus_tag LOCUS_31270 gene ilvD 15357 13675 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_31270 16240 15350 gene locus_tag LOCUS_31280 gene ilvE 16240 15350 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_31280 17032 18009 gene locus_tag LOCUS_31290 17032 18009 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence135 175 573 gene locus_tag LOCUS_31300 175 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 597 854 gene locus_tag LOCUS_31310 597 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1478 879 gene locus_tag LOCUS_31320 gene coaE 1478 879 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_31320 2448 1471 gene locus_tag LOCUS_31330 2448 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2778 2470 gene locus_tag LOCUS_31340 2778 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3305 2796 gene locus_tag LOCUS_31350 3305 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3624 3319 gene locus_tag LOCUS_31360 3624 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 4779 3634 gene locus_tag LOCUS_31370 4779 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 5983 4880 gene locus_tag LOCUS_31380 gene vdh 5983 4880 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_31380 6137 7924 gene locus_tag LOCUS_31390 6137 7924 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_31390 8538 8011 gene locus_tag LOCUS_31400 8538 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 10307 8535 gene locus_tag LOCUS_31410 10307 8535 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_31410 11061 10312 gene locus_tag LOCUS_31420 gene truA 11061 10312 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_31420 12301 11102 gene locus_tag LOCUS_31430 12301 11102 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705263.1 protein_id gnl|my_center|LOCUS_31430 12517 12876 gene locus_tag LOCUS_31440 12517 12876 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_31440 12948 13469 gene locus_tag LOCUS_31450 12948 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence136 817 200 gene locus_tag LOCUS_31460 817 200 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_31460 1064 1759 gene locus_tag LOCUS_31470 1064 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1774 3591 gene locus_tag LOCUS_31480 1774 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 5162 3645 gene locus_tag LOCUS_31490 gene srfJ 5162 3645 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_31490 5359 6585 gene locus_tag LOCUS_31500 gene folC 5359 6585 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_31500 6589 7251 gene locus_tag LOCUS_31510 gene trmB 6589 7251 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_31510 7248 7892 gene locus_tag LOCUS_31520 7248 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 9494 7893 gene locus_tag LOCUS_31530 9494 7893 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_31530 9877 10815 gene locus_tag LOCUS_31540 9877 10815 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_31540 10802 11677 gene locus_tag LOCUS_31550 10802 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_31550 11719 13572 gene locus_tag LOCUS_31560 11719 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 13914 13573 gene locus_tag LOCUS_31570 13914 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 14700 14002 gene locus_tag LOCUS_31580 14700 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 15196 14702 gene locus_tag LOCUS_31590 15196 14702 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_31590 15896 15294 gene locus_tag LOCUS_31600 15896 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 16064 16522 gene locus_tag LOCUS_31610 16064 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 16530 16847 gene locus_tag LOCUS_31620 16530 16847 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_31620 16849 17091 gene locus_tag LOCUS_31630 16849 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence137 2792 2436 gene locus_tag LOCUS_31640 2792 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2922 3722 gene locus_tag LOCUS_31650 2922 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3896 5026 gene locus_tag LOCUS_31660 3896 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 6584 5055 gene locus_tag LOCUS_31670 6584 5055 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_31670 7356 6760 gene locus_tag LOCUS_31680 7356 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_31680 7876 7358 gene locus_tag LOCUS_31690 7876 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 9157 7880 gene locus_tag LOCUS_31700 9157 7880 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_31700 9407 10120 gene locus_tag LOCUS_31710 9407 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 10346 12037 gene locus_tag LOCUS_31720 10346 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_31720 12077 13021 gene locus_tag LOCUS_31730 12077 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 13219 16050 gene locus_tag LOCUS_31740 13219 16050 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence138 935 129 gene locus_tag LOCUS_31750 935 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_31750 1167 3605 gene locus_tag LOCUS_31760 1167 3605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_31760 3694 5136 gene locus_tag LOCUS_31770 3694 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 5175 6530 gene locus_tag LOCUS_31780 gene atoE 5175 6530 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_31780 7291 7602 gene locus_tag LOCUS_31790 7291 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 7630 8886 gene locus_tag LOCUS_31800 7630 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 9205 9408 gene locus_tag LOCUS_31810 9205 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 9734 9531 gene locus_tag LOCUS_31820 9734 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 9787 10530 gene locus_tag LOCUS_31830 9787 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 10720 13533 gene locus_tag LOCUS_31840 gene acnB 10720 13533 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_31840 14364 13561 gene locus_tag LOCUS_31850 14364 13561 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_31850 14559 15164 gene locus_tag LOCUS_31860 14559 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 15869 16225 gene locus_tag LOCUS_31870 15869 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 16423 17004 gene locus_tag LOCUS_31880 16423 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence139 1392 865 gene locus_tag LOCUS_31890 1392 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2904 1468 gene locus_tag LOCUS_31900 2904 1468 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_31900 3424 3011 gene locus_tag LOCUS_31910 3424 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 4930 3488 gene locus_tag LOCUS_31920 4930 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 5798 5019 gene locus_tag LOCUS_31930 5798 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 6740 5946 gene locus_tag LOCUS_31940 6740 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 7232 6822 gene locus_tag LOCUS_31950 7232 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 9293 7329 gene locus_tag LOCUS_31960 9293 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 9459 9686 gene locus_tag LOCUS_31970 9459 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 11545 9779 gene locus_tag LOCUS_31980 11545 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 11845 13524 gene locus_tag LOCUS_31990 11845 13524 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 protein_id gnl|my_center|LOCUS_31990 14269 13598 gene locus_tag LOCUS_32000 14269 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 15420 15031 gene locus_tag LOCUS_32010 15420 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 16414 15956 gene locus_tag LOCUS_32020 16414 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence140 1322 468 gene locus_tag LOCUS_32030 1322 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 1665 1324 gene locus_tag LOCUS_32040 1665 1324 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_32040 2119 1667 gene locus_tag LOCUS_32050 gene dtd 2119 1667 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_32050 2255 3454 gene locus_tag LOCUS_32060 2255 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3478 4119 gene locus_tag LOCUS_32070 3478 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4707 4183 gene locus_tag LOCUS_32080 4707 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 5290 8550 gene locus_tag LOCUS_32090 5290 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 8717 9310 gene locus_tag LOCUS_32100 8717 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9375 9593 gene locus_tag LOCUS_32110 9375 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 10314 9664 gene locus_tag LOCUS_32120 10314 9664 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_32120 10910 10272 gene locus_tag LOCUS_32130 10910 10272 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_32130 11374 10949 gene locus_tag LOCUS_32140 11374 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 11902 11381 gene locus_tag LOCUS_32150 11902 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_32150 13077 12058 gene locus_tag LOCUS_32160 13077 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 13331 13645 gene locus_tag LOCUS_32170 13331 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 13724 14248 gene locus_tag LOCUS_32180 13724 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 14267 15166 gene locus_tag LOCUS_32190 14267 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_32190 <16925 15310 gene locus_tag LOCUS_32200 <16925 15310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203426.1:helicase >Feature sequence141 <1 901 gene locus_tag LOCUS_32210 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 946 1380 gene locus_tag LOCUS_32220 946 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2459 1455 gene locus_tag LOCUS_32230 2459 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_32230 3468 4310 gene locus_tag LOCUS_32240 3468 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 6023 4368 gene locus_tag LOCUS_32250 6023 4368 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_32250 6225 7151 gene locus_tag LOCUS_32260 6225 7151 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_32260 7308 7997 gene locus_tag LOCUS_32270 7308 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 8272 8721 gene locus_tag LOCUS_32280 8272 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 9062 8886 gene locus_tag LOCUS_32290 9062 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 9957 9211 gene locus_tag LOCUS_32300 9957 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 10097 11122 gene locus_tag LOCUS_32310 10097 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 11737 11156 gene locus_tag LOCUS_32320 11737 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 13668 12658 gene locus_tag LOCUS_32330 13668 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 14583 13687 gene locus_tag LOCUS_32340 14583 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670643.1 protein_id gnl|my_center|LOCUS_32340 15276 14746 gene locus_tag LOCUS_32350 gene mogA 15276 14746 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_32350 15381 16493 gene locus_tag LOCUS_32360 15381 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence142 878 186 gene locus_tag LOCUS_32370 878 186 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_32370 2167 875 gene locus_tag LOCUS_32380 2167 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2375 2539 gene locus_tag LOCUS_32390 2375 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2542 3984 gene locus_tag LOCUS_32400 2542 3984 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_32400 5180 4494 gene locus_tag LOCUS_32410 5180 4494 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_32410 6511 5186 gene locus_tag LOCUS_32420 6511 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6663 9032 gene locus_tag LOCUS_32430 6663 9032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_32430 9025 9270 gene locus_tag LOCUS_32440 9025 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 12585 9670 gene locus_tag LOCUS_32450 12585 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 13735 13367 gene locus_tag LOCUS_32460 13735 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 14930 13713 gene locus_tag LOCUS_32470 14930 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 15713 14940 gene locus_tag LOCUS_32480 15713 14940 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142690.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence143 773 291 gene locus_tag LOCUS_32490 gene moaC 773 291 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_32490 1976 777 gene locus_tag LOCUS_32500 gene moeA 1976 777 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_32500 3040 2051 gene locus_tag LOCUS_32510 gene moaA 3040 2051 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ09 protein_id gnl|my_center|LOCUS_32510 4194 3217 gene locus_tag LOCUS_32520 4194 3217 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_32520 5335 4187 gene locus_tag LOCUS_32530 5335 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_32530 6213 5335 gene locus_tag LOCUS_32540 6213 5335 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_32540 6767 6210 gene locus_tag LOCUS_32550 6767 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 9245 6852 gene locus_tag LOCUS_32560 9245 6852 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_32560 9778 9272 gene locus_tag LOCUS_32570 9778 9272 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_32570 10665 9796 gene locus_tag LOCUS_32580 10665 9796 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_32580 11224 10877 gene locus_tag LOCUS_32590 11224 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 11413 12411 gene locus_tag LOCUS_32600 11413 12411 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_32600 12875 13642 gene locus_tag LOCUS_32610 12875 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_32610 13681 14817 gene locus_tag LOCUS_32620 13681 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 14911 15264 gene locus_tag LOCUS_32630 14911 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 <16694 15936 gene locus_tag LOCUS_32640 <16694 15936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037887.1:peptidase >Feature sequence144 220 987 gene locus_tag LOCUS_32650 220 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 2385 2173 gene locus_tag LOCUS_32660 2385 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2342 2998 gene locus_tag LOCUS_32670 2342 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3124 3996 gene locus_tag LOCUS_32680 3124 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3986 5101 gene locus_tag LOCUS_32690 3986 5101 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_32690 5089 6900 gene locus_tag LOCUS_32700 gene wbtH 5089 6900 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_32700 6876 8066 gene locus_tag LOCUS_32710 6876 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 8131 9213 gene locus_tag LOCUS_32720 8131 9213 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_32720 9254 9814 gene locus_tag LOCUS_32730 gene wcgN 9254 9814 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 protein_id gnl|my_center|LOCUS_32730 9807 10169 gene locus_tag LOCUS_32740 9807 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 10272 10949 gene locus_tag LOCUS_32750 10272 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 10921 11556 gene locus_tag LOCUS_32760 10921 11556 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_32760 11588 12682 gene locus_tag LOCUS_32770 11588 12682 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_32770 12704 14590 gene locus_tag LOCUS_32780 12704 14590 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_32780 15487 14642 gene locus_tag LOCUS_32790 15487 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 15813 15739 gene locus_tag LOCUS_t00220 15813 15739 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence145 1196 69 gene locus_tag LOCUS_32800 1196 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_32800 1217 2296 gene locus_tag LOCUS_32810 1217 2296 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_32810 2451 3704 gene locus_tag LOCUS_32820 2451 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 4490 3705 gene locus_tag LOCUS_32830 4490 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 4859 5545 gene locus_tag LOCUS_32840 4859 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 5725 6501 gene locus_tag LOCUS_32850 5725 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 6609 7334 gene locus_tag LOCUS_32860 6609 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 7662 10898 gene locus_tag LOCUS_32870 7662 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32870 11033 12457 gene locus_tag LOCUS_32880 11033 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 12634 12440 gene locus_tag LOCUS_32890 12634 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12772 13440 gene locus_tag LOCUS_32900 12772 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 13443 15458 gene locus_tag LOCUS_32910 13443 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence146 545 3820 gene locus_tag LOCUS_32920 545 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32920 5151 4060 gene locus_tag LOCUS_32930 5151 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_32930 5639 5367 gene locus_tag LOCUS_32940 5639 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 7106 5874 gene locus_tag LOCUS_32950 7106 5874 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_32950 7321 8406 gene locus_tag LOCUS_32960 7321 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 8399 9115 gene locus_tag LOCUS_32970 8399 9115 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_32970 9835 9134 gene locus_tag LOCUS_32980 9835 9134 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_32980 10863 9832 gene locus_tag LOCUS_32990 10863 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 11065 11586 gene locus_tag LOCUS_33000 11065 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 12067 11651 gene locus_tag LOCUS_33010 12067 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 13846 12080 gene locus_tag LOCUS_33020 13846 12080 CDS product L-ascorbate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 protein_id gnl|my_center|LOCUS_33020 14610 13855 gene locus_tag LOCUS_33030 14610 13855 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119768.1 protein_id gnl|my_center|LOCUS_33030 15041 14616 gene locus_tag LOCUS_33040 15041 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 15194 15529 gene locus_tag LOCUS_33050 15194 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence147 2613 1870 gene locus_tag LOCUS_33060 2613 1870 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_33060 3549 2614 gene locus_tag LOCUS_33070 3549 2614 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_33070 4318 3557 gene locus_tag LOCUS_33080 4318 3557 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_33080 5722 4319 gene locus_tag LOCUS_33090 5722 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_33090 6853 5873 gene locus_tag LOCUS_33100 gene dfrA 6853 5873 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_33100 7600 6860 gene locus_tag LOCUS_33110 7600 6860 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_33110 7757 8956 gene locus_tag LOCUS_33120 gene hflX 7757 8956 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 protein_id gnl|my_center|LOCUS_33120 9122 9194 gene locus_tag LOCUS_t00230 9122 9194 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9616 10041 gene locus_tag LOCUS_33130 9616 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_33130 10190 11062 gene locus_tag LOCUS_33140 10190 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 11184 11675 gene locus_tag LOCUS_33150 11184 11675 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_33150 11680 12336 gene locus_tag LOCUS_33160 11680 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 12737 13147 gene locus_tag LOCUS_33170 12737 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 13660 14853 gene locus_tag LOCUS_33180 13660 14853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_33180 14860 15936 gene locus_tag LOCUS_33190 14860 15936 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence148 784 1710 gene locus_tag LOCUS_33200 784 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2384 1707 gene locus_tag LOCUS_33210 2384 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3065 2412 gene locus_tag LOCUS_33220 3065 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3406 3062 gene locus_tag LOCUS_33230 3406 3062 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_33230 3565 7011 gene locus_tag LOCUS_33240 gene pyc 3565 7011 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_33240 7596 7769 gene locus_tag LOCUS_33250 7596 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 10247 8739 gene locus_tag LOCUS_33260 10247 8739 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_33260 12789 10393 gene locus_tag LOCUS_33270 12789 10393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_33270 13335 12946 gene locus_tag LOCUS_33280 13335 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 14026 13394 gene locus_tag LOCUS_33290 14026 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 14971 14039 gene locus_tag LOCUS_33300 gene oxyR 14971 14039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_33300 15061 15513 gene locus_tag LOCUS_33310 15061 15513 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786060.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence149 1604 774 gene locus_tag LOCUS_33320 1604 774 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_33320 1756 3171 gene locus_tag LOCUS_33330 1756 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33330 3279 3959 gene locus_tag LOCUS_33340 3279 3959 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_33340 4088 4300 gene locus_tag LOCUS_33350 4088 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 4403 5305 gene locus_tag LOCUS_33360 4403 5305 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_33360 5307 6638 gene locus_tag LOCUS_33370 5307 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 6698 7477 gene locus_tag LOCUS_33380 6698 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 8008 7610 gene locus_tag LOCUS_33390 8008 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710095.1 protein_id gnl|my_center|LOCUS_33390 9089 8121 gene locus_tag LOCUS_33400 9089 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 9332 9994 gene locus_tag LOCUS_33410 gene nth 9332 9994 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_33410 10461 10003 gene locus_tag LOCUS_33420 10461 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 11448 10624 gene locus_tag LOCUS_33430 11448 10624 CDS product taurine catabolism dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908663.1 protein_id gnl|my_center|LOCUS_33430 11692 12240 gene locus_tag LOCUS_33440 11692 12240 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_33440 12288 13109 gene locus_tag LOCUS_33450 12288 13109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_33450 14002 13166 gene locus_tag LOCUS_33460 14002 13166 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_33460 15021 14113 gene locus_tag LOCUS_33470 15021 14113 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202722.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence150 <1 1688 gene locus_tag LOCUS_33480 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KM32:polyphosphate kinase 2894 1659 gene locus_tag LOCUS_33490 2894 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3190 4053 gene locus_tag LOCUS_33500 3190 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 4102 7782 gene locus_tag LOCUS_33510 4102 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 10807 7784 gene locus_tag LOCUS_33520 10807 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 10908 11684 gene locus_tag LOCUS_33530 10908 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 12571 11681 gene locus_tag LOCUS_33540 12571 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_33540 13107 12691 gene locus_tag LOCUS_33550 13107 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 14415 13183 gene locus_tag LOCUS_33560 14415 13183 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_33560 15514 14522 gene locus_tag LOCUS_33570 15514 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence151 292 6789 gene locus_tag LOCUS_33580 292 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 6822 7220 gene locus_tag LOCUS_33590 6822 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 7660 7316 gene locus_tag LOCUS_33600 7660 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 7812 9398 gene locus_tag LOCUS_33610 7812 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 9450 10400 gene locus_tag LOCUS_33620 gene xerD 9450 10400 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 protein_id gnl|my_center|LOCUS_33620 10397 11293 gene locus_tag LOCUS_33630 10397 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 11304 11522 gene locus_tag LOCUS_33640 11304 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 11726 11968 gene locus_tag LOCUS_33650 11726 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 12325 12026 gene locus_tag LOCUS_33660 12325 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 13418 13197 gene locus_tag LOCUS_33670 13418 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 14618 15412 gene locus_tag LOCUS_33680 14618 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence152 1510 884 gene locus_tag LOCUS_33690 1510 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2814 1822 gene locus_tag LOCUS_33700 2814 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3724 2798 gene locus_tag LOCUS_33710 3724 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 5033 3738 gene locus_tag LOCUS_33720 5033 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 6129 5056 gene locus_tag LOCUS_33730 6129 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 8742 6136 gene locus_tag LOCUS_33740 8742 6136 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107923.1 protein_id gnl|my_center|LOCUS_33740 8935 9837 gene locus_tag LOCUS_33750 gene alkA 8935 9837 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123533.1 protein_id gnl|my_center|LOCUS_33750 9940 12399 gene locus_tag LOCUS_33760 9940 12399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_33760 13007 12420 gene locus_tag LOCUS_33770 13007 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 13411 13163 gene locus_tag LOCUS_33780 13411 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 14112 13408 gene locus_tag LOCUS_33790 14112 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 protein_id gnl|my_center|LOCUS_33790 14951 14109 gene locus_tag LOCUS_33800 gene ada 14951 14109 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_33800 15439 15020 gene locus_tag LOCUS_33810 15439 15020 CDS product BluF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073432.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence153 11019 15074 gene locus_tag LOCUS_33820 11019 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence154 311 637 gene locus_tag LOCUS_33830 311 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 646 3246 gene locus_tag LOCUS_33840 646 3246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_33840 3290 5842 gene locus_tag LOCUS_33850 3290 5842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_33850 5835 8426 gene locus_tag LOCUS_33860 5835 8426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_33860 8470 11019 gene locus_tag LOCUS_33870 8470 11019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_33870 11619 11107 gene locus_tag LOCUS_33880 11619 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 14923 11876 gene locus_tag LOCUS_33890 14923 11876 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_33890 >Feature sequence155 3955 878 gene locus_tag LOCUS_33900 3955 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 4731 3976 gene locus_tag LOCUS_33910 4731 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 5137 6339 gene locus_tag LOCUS_33920 gene mnmA 5137 6339 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_33920 6978 6367 gene locus_tag LOCUS_33930 6978 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 8613 6982 gene locus_tag LOCUS_33940 8613 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 8951 8610 gene locus_tag LOCUS_33950 8951 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 9879 9106 gene locus_tag LOCUS_33960 9879 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 12833 10104 gene locus_tag LOCUS_33970 12833 10104 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 protein_id gnl|my_center|LOCUS_33970 13275 13601 gene locus_tag LOCUS_33980 13275 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence156 81 1424 gene locus_tag LOCUS_33990 81 1424 CDS product ammonia channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_33990 3409 1487 gene locus_tag LOCUS_34000 3409 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 5336 3426 gene locus_tag LOCUS_34010 5336 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 7279 5333 gene locus_tag LOCUS_34020 7279 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 8169 7564 gene locus_tag LOCUS_34030 gene sodA 8169 7564 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_34030 8655 8209 gene locus_tag LOCUS_34040 gene tadA 8655 8209 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 protein_id gnl|my_center|LOCUS_34040 8749 10500 gene locus_tag LOCUS_34050 gene aspS 8749 10500 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_34050 10583 12646 gene locus_tag LOCUS_34060 10583 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 12673 13017 gene locus_tag LOCUS_34070 gene rsbV 12673 13017 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4J8 protein_id gnl|my_center|LOCUS_34070 13007 13426 gene locus_tag LOCUS_34080 13007 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 13432 15366 gene locus_tag LOCUS_34090 13432 15366 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence157 <1 1031 gene locus_tag LOCUS_34100 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140762.1:peptidase 1230 1535 gene locus_tag LOCUS_34110 1230 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1532 1819 gene locus_tag LOCUS_34120 1532 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3744 2410 gene locus_tag LOCUS_34130 3744 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3846 4958 gene locus_tag LOCUS_34140 3846 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 5319 5014 gene locus_tag LOCUS_34150 5319 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 5620 5324 gene locus_tag LOCUS_34160 5620 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 6181 7359 gene locus_tag LOCUS_34170 gene tnp 6181 7359 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011244852.1 protein_id gnl|my_center|LOCUS_34170 7951 7676 gene locus_tag LOCUS_34180 7951 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 8605 8162 gene locus_tag LOCUS_34190 8605 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 8960 9409 gene locus_tag LOCUS_34200 8960 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10294 9584 gene locus_tag LOCUS_34210 10294 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 10865 10287 gene locus_tag LOCUS_34220 10865 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 14227 10862 gene locus_tag LOCUS_34230 14227 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_34230 <15409 14556 gene locus_tag LOCUS_34240 <15409 14556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence158 553 1056 gene locus_tag LOCUS_34250 553 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_34250 1058 1471 gene locus_tag LOCUS_34260 1058 1471 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_34260 2093 1602 gene locus_tag LOCUS_34270 2093 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 3490 2105 gene locus_tag LOCUS_34280 3490 2105 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_34280 4096 3494 gene locus_tag LOCUS_34290 4096 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 4588 4097 gene locus_tag LOCUS_34300 4588 4097 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_34300 4842 5402 gene locus_tag LOCUS_34310 4842 5402 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_34310 5466 6230 gene locus_tag LOCUS_34320 5466 6230 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_34320 6898 6299 gene locus_tag LOCUS_34330 6898 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 7443 7198 gene locus_tag LOCUS_34340 7443 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 7591 7830 gene locus_tag LOCUS_34350 7591 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 8009 7927 gene locus_tag LOCUS_t00240 8009 7927 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9512 8130 gene locus_tag LOCUS_34360 9512 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814671.1 protein_id gnl|my_center|LOCUS_34360 10089 9496 gene locus_tag LOCUS_34370 10089 9496 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_34370 10271 12154 gene locus_tag LOCUS_34380 10271 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_34380 12376 13620 gene locus_tag LOCUS_34390 gene mntH 12376 13620 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_34390 13675 14592 gene locus_tag LOCUS_34400 13675 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 14745 14832 gene locus_tag LOCUS_t00250 14745 14832 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence159 220 1254 gene locus_tag LOCUS_34410 gene ctaC 220 1254 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_34410 1379 3148 gene locus_tag LOCUS_34420 gene ctaD 1379 3148 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_34420 3126 4184 gene locus_tag LOCUS_34430 gene ctaA 3126 4184 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_34430 4184 5086 gene locus_tag LOCUS_34440 gene ctaB 4184 5086 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_34440 5083 5673 gene locus_tag LOCUS_34450 gene ctaE 5083 5673 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_34450 5688 6455 gene locus_tag LOCUS_34460 gene coxP 5688 6455 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_34460 6469 6840 gene locus_tag LOCUS_34470 6469 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 6908 7510 gene locus_tag LOCUS_34480 6908 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 7507 8043 gene locus_tag LOCUS_34490 gene yozB 7507 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_34490 8411 8040 gene locus_tag LOCUS_34500 8411 8040 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_34500 8620 8408 gene locus_tag LOCUS_34510 8620 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 8806 9030 gene locus_tag LOCUS_34520 8806 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 8990 9385 gene locus_tag LOCUS_34530 8990 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_34530 9514 13143 gene locus_tag LOCUS_34540 9514 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence160 <1 939 gene locus_tag LOCUS_34550 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027582.1:glycosyl hydrolase 1588 4188 gene locus_tag LOCUS_34560 1588 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 4282 5634 gene locus_tag LOCUS_34570 4282 5634 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_34570 6291 5872 gene locus_tag LOCUS_34580 6291 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 7581 6478 gene locus_tag LOCUS_34590 7581 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 8442 7789 gene locus_tag LOCUS_34600 8442 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 9331 8489 gene locus_tag LOCUS_34610 9331 8489 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444280.1 protein_id gnl|my_center|LOCUS_34610 9458 10705 gene locus_tag LOCUS_34620 9458 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 10687 11142 gene locus_tag LOCUS_34630 10687 11142 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_34630 11556 11134 gene locus_tag LOCUS_34640 11556 11134 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 protein_id gnl|my_center|LOCUS_34640 12337 11549 gene locus_tag LOCUS_34650 12337 11549 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 protein_id gnl|my_center|LOCUS_34650 12436 14928 gene locus_tag LOCUS_34660 12436 14928 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence161 <1 1366 gene locus_tag LOCUS_34670 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963831.1:gamma-glutamyltransferase 1484 2827 gene locus_tag LOCUS_34680 1484 2827 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_34680 3726 2824 gene locus_tag LOCUS_34690 gene dhmA 3726 2824 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_34690 4200 3733 gene locus_tag LOCUS_34700 4200 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4271 4678 gene locus_tag LOCUS_34710 4271 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932933.1 protein_id gnl|my_center|LOCUS_34710 4653 6191 gene locus_tag LOCUS_34720 4653 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6239 6724 gene locus_tag LOCUS_34730 6239 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 6792 7142 gene locus_tag LOCUS_34740 6792 7142 CDS product bleomycin binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242578.1 protein_id gnl|my_center|LOCUS_34740 7840 7427 gene locus_tag LOCUS_34750 7840 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 9306 8068 gene locus_tag LOCUS_34760 9306 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 9430 10968 gene locus_tag LOCUS_34770 9430 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 11664 10972 gene locus_tag LOCUS_34780 11664 10972 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 protein_id gnl|my_center|LOCUS_34780 12511 11807 gene locus_tag LOCUS_34790 12511 11807 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_34790 13925 12516 gene locus_tag LOCUS_34800 13925 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 14723 14238 gene locus_tag LOCUS_34810 14723 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence162 406 2064 gene locus_tag LOCUS_34820 gene paaZ 406 2064 CDS product phenylacetic acid degradation oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549951.1 protein_id gnl|my_center|LOCUS_34820 2323 2499 gene locus_tag LOCUS_34830 2323 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3174 2860 gene locus_tag LOCUS_34840 3174 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3967 3176 gene locus_tag LOCUS_34850 3967 3176 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_34850 4476 3973 gene locus_tag LOCUS_34860 gene folA 4476 3973 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE6 protein_id gnl|my_center|LOCUS_34860 5393 4473 gene locus_tag LOCUS_34870 gene fmt 5393 4473 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_34870 6856 5705 gene locus_tag LOCUS_34880 6856 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_34880 6971 8125 gene locus_tag LOCUS_34890 6971 8125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107808.1 protein_id gnl|my_center|LOCUS_34890 9415 8639 gene locus_tag LOCUS_34900 9415 8639 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_34900 9548 10072 gene locus_tag LOCUS_34910 gene gmhB 9548 10072 CDS product D-glycero-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH26 protein_id gnl|my_center|LOCUS_34910 10207 11070 gene locus_tag LOCUS_34920 10207 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 11067 12089 gene locus_tag LOCUS_34930 11067 12089 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_34930 12086 12766 gene locus_tag LOCUS_34940 12086 12766 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_34940 <15130 12767 gene locus_tag LOCUS_34950 <15130 12767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence163 2277 1261 gene locus_tag LOCUS_34960 2277 1261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918523.1 protein_id gnl|my_center|LOCUS_34960 2624 3079 gene locus_tag LOCUS_34970 2624 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_34970 3069 3449 gene locus_tag LOCUS_34980 3069 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 3524 3976 gene locus_tag LOCUS_34990 3524 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 4789 4001 gene locus_tag LOCUS_35000 4789 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 5327 4794 gene locus_tag LOCUS_35010 5327 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_35010 6108 5344 gene locus_tag LOCUS_35020 6108 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 6330 6139 gene locus_tag LOCUS_35030 6330 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7950 6361 gene locus_tag LOCUS_35040 7950 6361 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_35040 9162 8287 gene locus_tag LOCUS_35050 9162 8287 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_35050 10465 9164 gene locus_tag LOCUS_35060 10465 9164 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_35060 10537 11616 gene locus_tag LOCUS_35070 10537 11616 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_35070 13084 11963 gene locus_tag LOCUS_35080 13084 11963 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_35080 13208 14086 gene locus_tag LOCUS_35090 13208 14086 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_35090 14083 14883 gene locus_tag LOCUS_35100 14083 14883 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence164 2878 503 gene locus_tag LOCUS_35110 2878 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4321 3218 gene locus_tag LOCUS_35120 4321 3218 CDS product tyrosinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_35120 4917 4333 gene locus_tag LOCUS_35130 4917 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 5668 5144 gene locus_tag LOCUS_35140 5668 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 6243 5950 gene locus_tag LOCUS_35150 gene parE1 6243 5950 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 protein_id gnl|my_center|LOCUS_35150 6488 6240 gene locus_tag LOCUS_35160 6488 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 8009 6675 gene locus_tag LOCUS_35170 8009 6675 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_35170 9382 8009 gene locus_tag LOCUS_35180 9382 8009 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_35180 9558 11978 gene locus_tag LOCUS_35190 9558 11978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_35190 11981 14380 gene locus_tag LOCUS_35200 11981 14380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence165 6206 9598 gene locus_tag LOCUS_35210 6206 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 9564 11786 gene locus_tag LOCUS_35220 9564 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 12397 11783 gene locus_tag LOCUS_35230 12397 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 12943 12500 gene locus_tag LOCUS_35240 12943 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 14483 13872 gene locus_tag LOCUS_35250 14483 13872 CDS product putative two-component response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703361.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence166 441 1205 gene locus_tag LOCUS_35260 gene coaX 441 1205 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM55 protein_id gnl|my_center|LOCUS_35260 1205 1930 gene locus_tag LOCUS_35270 1205 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3440 1938 gene locus_tag LOCUS_35280 3440 1938 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_35280 5121 3490 gene locus_tag LOCUS_35290 5121 3490 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_35290 6935 6444 gene locus_tag LOCUS_35300 gene aspG 6935 6444 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_35300 8066 7041 gene locus_tag LOCUS_35310 8066 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_35310 8566 12783 gene locus_tag LOCUS_35320 8566 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 12780 13667 gene locus_tag LOCUS_35330 gene cas1 12780 13667 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_35330 13667 14005 gene locus_tag LOCUS_35340 gene cas2 13667 14005 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_35340 14111 15004 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtcttcaagatcagcattcgacatcaaaccacaac >Feature sequence167 826 3024 gene locus_tag LOCUS_35350 826 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3133 4071 gene locus_tag LOCUS_35360 3133 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 5505 4072 gene locus_tag LOCUS_35370 5505 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 5598 7481 gene locus_tag LOCUS_35380 gene aceB 5598 7481 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG51 protein_id gnl|my_center|LOCUS_35380 7478 9754 gene locus_tag LOCUS_35390 gene aceA 7478 9754 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729276.1 protein_id gnl|my_center|LOCUS_35390 10568 11332 gene locus_tag LOCUS_35400 10568 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 11333 11668 gene locus_tag LOCUS_35410 11333 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 11923 13551 gene locus_tag LOCUS_35420 11923 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 13671 13835 gene locus_tag LOCUS_35430 13671 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 13894 14742 gene locus_tag LOCUS_35440 13894 14742 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719748.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence168 <1 2178 gene locus_tag LOCUS_35450 <1 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 6074 2376 gene locus_tag LOCUS_35460 6074 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 7934 6513 gene locus_tag LOCUS_35470 7934 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 9488 8070 gene locus_tag LOCUS_35480 9488 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 10585 9692 gene locus_tag LOCUS_35490 10585 9692 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460600.1 protein_id gnl|my_center|LOCUS_35490 10811 11668 gene locus_tag LOCUS_35500 10811 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 12354 11860 gene locus_tag LOCUS_35510 12354 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 13612 12662 gene locus_tag LOCUS_35520 13612 12662 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038507.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence169 1088 294 gene locus_tag LOCUS_35530 1088 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 1698 1078 gene locus_tag LOCUS_35540 1698 1078 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_35540 4194 1924 gene locus_tag LOCUS_35550 4194 1924 CDS product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 protein_id gnl|my_center|LOCUS_35550 5468 4302 gene locus_tag LOCUS_35560 5468 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 5809 6039 gene locus_tag LOCUS_35570 5809 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 7697 6036 gene locus_tag LOCUS_35580 7697 6036 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_35580 9352 7760 gene locus_tag LOCUS_35590 9352 7760 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_35590 9525 10112 gene locus_tag LOCUS_35600 9525 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 10269 10850 gene locus_tag LOCUS_35610 10269 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 11698 10847 gene locus_tag LOCUS_35620 gene cphB 11698 10847 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_35620 12333 11695 gene locus_tag LOCUS_35630 12333 11695 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_35630 <14884 12435 gene locus_tag LOCUS_35640 <14884 12435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S457:chromosome partition protein Smc >Feature sequence170 <1 1889 gene locus_tag LOCUS_35650 <1 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase 1956 2180 gene locus_tag LOCUS_35660 1956 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2147 2425 gene locus_tag LOCUS_35670 2147 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2508 2969 gene locus_tag LOCUS_35680 2508 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3690 3025 gene locus_tag LOCUS_35690 3690 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3866 4681 gene locus_tag LOCUS_35700 3866 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 5145 4771 gene locus_tag LOCUS_35710 5145 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 5334 5906 gene locus_tag LOCUS_35720 5334 5906 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_35720 5984 6859 gene locus_tag LOCUS_35730 5984 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 9888 6916 gene locus_tag LOCUS_35740 9888 6916 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_35740 10072 12489 gene locus_tag LOCUS_35750 10072 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_35750 12501 12833 gene locus_tag LOCUS_35760 12501 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 12868 13488 gene locus_tag LOCUS_35770 12868 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_35770 13614 14132 gene locus_tag LOCUS_35780 13614 14132 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_35780 14600 14199 gene locus_tag LOCUS_35790 14600 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence171 3809 414 gene locus_tag LOCUS_35800 gene icmF 3809 414 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_35800 6665 4428 gene locus_tag LOCUS_35810 6665 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 7797 6628 gene locus_tag LOCUS_35820 gene rlmL 7797 6628 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_35820 8015 8509 gene locus_tag LOCUS_35830 8015 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_35830 8496 8753 gene locus_tag LOCUS_35840 8496 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 9351 8758 gene locus_tag LOCUS_35850 9351 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 9897 9532 gene locus_tag LOCUS_35860 9897 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 10467 9907 gene locus_tag LOCUS_35870 10467 9907 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_35870 12124 10730 gene locus_tag LOCUS_35880 12124 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 13601 12219 gene locus_tag LOCUS_35890 13601 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence172 1692 808 gene locus_tag LOCUS_35900 gene metR 1692 808 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262273.1 protein_id gnl|my_center|LOCUS_35900 1853 2407 gene locus_tag LOCUS_35910 1853 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3180 3875 gene locus_tag LOCUS_35920 3180 3875 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 protein_id gnl|my_center|LOCUS_35920 4285 3905 gene locus_tag LOCUS_35930 4285 3905 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_35930 4471 5553 gene locus_tag LOCUS_35940 4471 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 5628 6695 gene locus_tag LOCUS_35950 5628 6695 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_35950 6827 7519 gene locus_tag LOCUS_35960 6827 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 7718 7909 gene locus_tag LOCUS_35970 7718 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 8047 9102 gene locus_tag LOCUS_35980 8047 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 9803 9114 gene locus_tag LOCUS_35990 9803 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 11062 10037 gene locus_tag LOCUS_36000 11062 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 11347 11790 gene locus_tag LOCUS_36010 gene cdd 11347 11790 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_36010 12184 13347 gene locus_tag LOCUS_36020 12184 13347 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_36020 13462 14505 gene locus_tag LOCUS_36030 13462 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence173 276 1121 gene locus_tag LOCUS_36040 276 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1253 4717 gene locus_tag LOCUS_36050 1253 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5735 4770 gene locus_tag LOCUS_36060 gene hldD 5735 4770 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_36060 5807 6229 gene locus_tag LOCUS_36070 5807 6229 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_36070 7497 6271 gene locus_tag LOCUS_36080 gene clpX 7497 6271 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_36080 8172 7504 gene locus_tag LOCUS_36090 gene clpP 8172 7504 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_36090 9587 8256 gene locus_tag LOCUS_36100 9587 8256 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_36100 9741 9659 gene locus_tag LOCUS_t00260 9741 9659 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9855 12083 gene locus_tag LOCUS_36110 gene relA 9855 12083 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_36110 12133 12594 gene locus_tag LOCUS_36120 gene fur 12133 12594 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_36120 12610 12957 gene locus_tag LOCUS_36130 gene spoIIAA 12610 12957 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W5 protein_id gnl|my_center|LOCUS_36130 12988 14256 gene locus_tag LOCUS_36140 gene purA 12988 14256 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_36140 >Feature sequence174 3035 1065 gene locus_tag LOCUS_36150 3035 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 4958 3042 gene locus_tag LOCUS_36160 4958 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 5285 7495 gene locus_tag LOCUS_36170 5285 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 8203 7646 gene locus_tag LOCUS_36180 8203 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_36180 9237 8287 gene locus_tag LOCUS_36190 9237 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 9341 10180 gene locus_tag LOCUS_36200 9341 10180 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_36200 10752 10204 gene locus_tag LOCUS_36210 gene guaA 10752 10204 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_36210 11653 10958 gene locus_tag LOCUS_36220 11653 10958 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_36220 11852 12346 gene locus_tag LOCUS_36230 11852 12346 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_36230 13834 12467 gene locus_tag LOCUS_36240 13834 12467 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_36240 <14493 13835 gene locus_tag LOCUS_36250 <14493 13835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860725.1:glutamate carboxypeptidase >Feature sequence175 <1 643 gene locus_tag LOCUS_36260 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388877.1:MBL fold metallo-hydrolase 1311 799 gene locus_tag LOCUS_36270 1311 799 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_36270 1482 2189 gene locus_tag LOCUS_36280 1482 2189 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122143.1 protein_id gnl|my_center|LOCUS_36280 2329 2904 gene locus_tag LOCUS_36290 2329 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3729 2923 gene locus_tag LOCUS_36300 3729 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3882 5162 gene locus_tag LOCUS_36310 gene pabB 3882 5162 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_36310 5201 6151 gene locus_tag LOCUS_36320 5201 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_36320 6304 6939 gene locus_tag LOCUS_36330 6304 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 7163 7729 gene locus_tag LOCUS_36340 7163 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 7860 8471 gene locus_tag LOCUS_36350 7860 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 8703 10187 gene locus_tag LOCUS_36360 gene miaB 8703 10187 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_36360 10168 11472 gene locus_tag LOCUS_36370 10168 11472 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_36370 11492 11989 gene locus_tag LOCUS_36380 11492 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_36380 12027 13142 gene locus_tag LOCUS_36390 12027 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 13135 13503 gene locus_tag LOCUS_36400 13135 13503 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_36400 14290 13571 gene locus_tag LOCUS_36410 14290 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence176 1109 321 gene locus_tag LOCUS_36420 1109 321 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268042.1 protein_id gnl|my_center|LOCUS_36420 1267 2988 gene locus_tag LOCUS_36430 1267 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867182.1 protein_id gnl|my_center|LOCUS_36430 3778 4473 gene locus_tag LOCUS_36440 3778 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4503 5075 gene locus_tag LOCUS_36450 4503 5075 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_36450 5065 6228 gene locus_tag LOCUS_36460 5065 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 6410 7021 gene locus_tag LOCUS_36470 6410 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 7489 7025 gene locus_tag LOCUS_36480 7489 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 7624 8718 gene locus_tag LOCUS_36490 7624 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 8873 9916 gene locus_tag LOCUS_36500 gene irpA 8873 9916 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_36500 9929 11329 gene locus_tag LOCUS_36510 9929 11329 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_36510 11313 13721 gene locus_tag LOCUS_36520 gene fecA 11313 13721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_36520 >Feature sequence177 1192 83 gene locus_tag LOCUS_36530 1192 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 2273 1194 gene locus_tag LOCUS_36540 2273 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3414 2305 gene locus_tag LOCUS_36550 3414 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 4531 3416 gene locus_tag LOCUS_36560 4531 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 5612 4542 gene locus_tag LOCUS_36570 5612 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 6781 5675 gene locus_tag LOCUS_36580 6781 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 7896 6781 gene locus_tag LOCUS_36590 7896 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 8966 7896 gene locus_tag LOCUS_36600 8966 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 10033 8966 gene locus_tag LOCUS_36610 10033 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 11085 10033 gene locus_tag LOCUS_36620 11085 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 13550 11085 gene locus_tag LOCUS_36630 13550 11085 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence178 905 69 gene locus_tag LOCUS_36640 905 69 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 protein_id gnl|my_center|LOCUS_36640 1108 908 gene locus_tag LOCUS_36650 1108 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 2146 1217 gene locus_tag LOCUS_36660 2146 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 4113 2191 gene locus_tag LOCUS_36670 gene kefB 4113 2191 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_36670 4715 4110 gene locus_tag LOCUS_36680 4715 4110 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_36680 6098 4830 gene locus_tag LOCUS_36690 gene phrB3 6098 4830 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_36690 7627 6095 gene locus_tag LOCUS_36700 7627 6095 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_36700 9543 8116 gene locus_tag LOCUS_36710 9543 8116 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_36710 11531 10062 gene locus_tag LOCUS_36720 gene cry2 11531 10062 CDS product cryptochrome-like protein cry2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS67 protein_id gnl|my_center|LOCUS_36720 11779 12951 gene locus_tag LOCUS_36730 gene hisC 11779 12951 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_36730 >Feature sequence179 739 122 gene locus_tag LOCUS_36740 739 122 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_36740 1846 740 gene locus_tag LOCUS_36750 1846 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728269.1 protein_id gnl|my_center|LOCUS_36750 2886 1840 gene locus_tag LOCUS_36760 gene hypE 2886 1840 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_36760 3989 2883 gene locus_tag LOCUS_36770 3989 2883 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_36770 4243 3986 gene locus_tag LOCUS_36780 4243 3986 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_36780 6450 4234 gene locus_tag LOCUS_36790 gene hypF 6450 4234 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_36790 7245 6538 gene locus_tag LOCUS_36800 gene hypB 7245 6538 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_36800 7778 7437 gene locus_tag LOCUS_36810 7778 7437 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462320.1 protein_id gnl|my_center|LOCUS_36810 9262 7781 gene locus_tag LOCUS_36820 9262 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 9573 9259 gene locus_tag LOCUS_36830 9573 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 10049 9570 gene locus_tag LOCUS_36840 10049 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 11782 10196 gene locus_tag LOCUS_36850 gene hybC 11782 10196 CDS product cytochrome-c3 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_36850 12748 11789 gene locus_tag LOCUS_36860 gene hybA 12748 11789 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_36860 13391 13041 gene locus_tag LOCUS_36870 13391 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence180 <1 1295 gene locus_tag LOCUS_36880 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962292.1:outer membrane protein 1702 2898 gene locus_tag LOCUS_36890 gene kdnA 1702 2898 CDS product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 protein_id gnl|my_center|LOCUS_36890 2895 3629 gene locus_tag LOCUS_36900 gene kdsB 2895 3629 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_36900 3698 4777 gene locus_tag LOCUS_36910 gene kdnB 3698 4777 CDS product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 protein_id gnl|my_center|LOCUS_36910 4783 5325 gene locus_tag LOCUS_36920 4783 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 5786 5340 gene locus_tag LOCUS_36930 5786 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 9250 6038 gene locus_tag LOCUS_36940 9250 6038 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_36940 9418 10005 gene locus_tag LOCUS_36950 9418 10005 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T1 protein_id gnl|my_center|LOCUS_36950 10155 12656 gene locus_tag LOCUS_36960 10155 12656 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069784.1 protein_id gnl|my_center|LOCUS_36960 12643 13032 gene locus_tag LOCUS_36970 12643 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886681.1 protein_id gnl|my_center|LOCUS_36970 13022 13258 gene locus_tag LOCUS_36980 13022 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 13872 13234 gene locus_tag LOCUS_36990 13872 13234 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence181 3116 1335 gene locus_tag LOCUS_37000 3116 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3621 3268 gene locus_tag LOCUS_37010 3621 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 6427 3815 gene locus_tag LOCUS_37020 6427 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 8007 6526 gene locus_tag LOCUS_37030 8007 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 8565 8293 gene locus_tag LOCUS_37040 8565 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 10040 8733 gene locus_tag LOCUS_37050 10040 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 11820 10132 gene locus_tag LOCUS_37060 11820 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 12254 11937 gene locus_tag LOCUS_37070 12254 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 <13861 12262 gene locus_tag LOCUS_37080 <13861 12262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein >Feature sequence182 113 1102 gene locus_tag LOCUS_37090 113 1102 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_37090 1107 1535 gene locus_tag LOCUS_37100 1107 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_37100 1649 1903 gene locus_tag LOCUS_37110 1649 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 1900 2490 gene locus_tag LOCUS_37120 1900 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 2534 3001 gene locus_tag LOCUS_37130 2534 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 3133 3441 gene locus_tag LOCUS_37140 3133 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3476 3907 gene locus_tag LOCUS_37150 3476 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 4054 4473 gene locus_tag LOCUS_37160 4054 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4470 5465 gene locus_tag LOCUS_37170 gene fadB5 4470 5465 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_37170 5539 6822 gene locus_tag LOCUS_37180 5539 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 6848 7396 gene locus_tag LOCUS_37190 6848 7396 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_37190 8218 7400 gene locus_tag LOCUS_37200 8218 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 8323 8853 gene locus_tag LOCUS_37210 8323 8853 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_37210 9473 8955 gene locus_tag LOCUS_37220 9473 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 9679 10002 gene locus_tag LOCUS_37230 9679 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 9984 10628 gene locus_tag LOCUS_37240 9984 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37240 10628 11140 gene locus_tag LOCUS_37250 10628 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 11164 11910 gene locus_tag LOCUS_37260 11164 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 <13840 12316 gene locus_tag LOCUS_37270 <13840 12316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399759.1:kojibiose phosphorylase >Feature sequence183 2579 1365 gene locus_tag LOCUS_37280 2579 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 2754 3053 gene locus_tag LOCUS_37290 2754 3053 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_37290 3164 5122 gene locus_tag LOCUS_37300 gene gyrB 3164 5122 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_37300 5206 7353 gene locus_tag LOCUS_37310 5206 7353 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_37310 8255 7362 gene locus_tag LOCUS_37320 gene ppx 8255 7362 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_37320 8419 8970 gene locus_tag LOCUS_37330 8419 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 8970 9725 gene locus_tag LOCUS_37340 8970 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 9727 10407 gene locus_tag LOCUS_37350 9727 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 10604 11620 gene locus_tag LOCUS_37360 10604 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 11639 12034 gene locus_tag LOCUS_37370 11639 12034 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence184 2321 5743 gene locus_tag LOCUS_37380 2321 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 5836 6612 gene locus_tag LOCUS_37390 5836 6612 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_37390 6743 7375 gene locus_tag LOCUS_37400 6743 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 8263 7475 gene locus_tag LOCUS_37410 8263 7475 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_37410 8396 9388 gene locus_tag LOCUS_37420 8396 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 9595 10935 gene locus_tag LOCUS_37430 9595 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 11456 10938 gene locus_tag LOCUS_37440 11456 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 11812 12438 gene locus_tag LOCUS_37450 11812 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 13348 12452 gene locus_tag LOCUS_37460 13348 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence185 1059 442 gene locus_tag LOCUS_37470 1059 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459261.1 protein_id gnl|my_center|LOCUS_37470 2214 1699 gene locus_tag LOCUS_37480 2214 1699 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_37480 2878 2390 gene locus_tag LOCUS_37490 2878 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 4427 3156 gene locus_tag LOCUS_37500 4427 3156 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_37500 5886 4501 gene locus_tag LOCUS_37510 5886 4501 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_37510 7551 5890 gene locus_tag LOCUS_37520 7551 5890 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_37520 7907 9808 gene locus_tag LOCUS_37530 7907 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 9805 10557 gene locus_tag LOCUS_37540 9805 10557 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_37540 <13606 11474 gene locus_tag LOCUS_37550 <13606 11474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase >Feature sequence186 126 2579 gene locus_tag LOCUS_37560 126 2579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_37560 2583 4958 gene locus_tag LOCUS_37570 2583 4958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37570 4974 7385 gene locus_tag LOCUS_37580 4974 7385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37580 7398 9767 gene locus_tag LOCUS_37590 7398 9767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37590 9856 12285 gene locus_tag LOCUS_37600 9856 12285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_37600 <13500 12394 gene locus_tag LOCUS_37610 <13500 12394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:9-O-acetylesterase >Feature sequence187 291 494 gene locus_tag LOCUS_37620 291 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 751 1863 gene locus_tag LOCUS_37630 751 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 2936 2016 gene locus_tag LOCUS_37640 2936 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_37640 4060 2933 gene locus_tag LOCUS_37650 4060 2933 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_37650 4838 4116 gene locus_tag LOCUS_37660 4838 4116 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_37660 7484 5613 gene locus_tag LOCUS_37670 7484 5613 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_37670 8565 7621 gene locus_tag LOCUS_37680 8565 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 8752 10065 gene locus_tag LOCUS_37690 8752 10065 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_37690 10123 10566 gene locus_tag LOCUS_37700 10123 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 11135 10563 gene locus_tag LOCUS_37710 11135 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 11346 11927 gene locus_tag LOCUS_37720 11346 11927 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_37720 12037 12597 gene locus_tag LOCUS_37730 12037 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence188 695 2857 gene locus_tag LOCUS_37740 gene glnA 695 2857 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_37740 2994 4952 gene locus_tag LOCUS_37750 2994 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 5041 5946 gene locus_tag LOCUS_37760 5041 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 6104 5943 gene locus_tag LOCUS_37770 6104 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 7641 6262 gene locus_tag LOCUS_37780 7641 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 8466 7867 gene locus_tag LOCUS_37790 8466 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 9451 8468 gene locus_tag LOCUS_37800 gene fabH2 9451 8468 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_37800 9736 10500 gene locus_tag LOCUS_37810 9736 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_37810 11226 10528 gene locus_tag LOCUS_37820 11226 10528 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_37820 11438 13102 gene locus_tag LOCUS_37830 gene pdhC 11438 13102 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_37830 >Feature sequence189 950 288 gene locus_tag LOCUS_37840 950 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1062 1445 gene locus_tag LOCUS_37850 1062 1445 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_37850 1504 3012 gene locus_tag LOCUS_37860 gene gltX 1504 3012 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_37860 3024 3254 gene locus_tag LOCUS_37870 3024 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3391 3251 gene locus_tag LOCUS_37880 3391 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 4888 3548 gene locus_tag LOCUS_37890 4888 3548 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_37890 5693 5112 gene locus_tag LOCUS_37900 5693 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_37900 5748 6701 gene locus_tag LOCUS_37910 5748 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 6727 7140 gene locus_tag LOCUS_37920 6727 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 7137 7304 gene locus_tag LOCUS_37930 7137 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 7420 7725 gene locus_tag LOCUS_37940 7420 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 7722 8456 gene locus_tag LOCUS_37950 7722 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_37950 8453 8986 gene locus_tag LOCUS_37960 8453 8986 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_37960 9185 10528 gene locus_tag LOCUS_37970 9185 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_37970 10528 12090 gene locus_tag LOCUS_37980 10528 12090 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence190 475 1380 gene locus_tag LOCUS_37990 gene cysD 475 1380 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_37990 1380 2642 gene locus_tag LOCUS_38000 gene cysN 1380 2642 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_38000 2656 3414 gene locus_tag LOCUS_38010 gene cysQ 2656 3414 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_38010 3424 4701 gene locus_tag LOCUS_38020 3424 4701 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_38020 4706 5761 gene locus_tag LOCUS_38030 4706 5761 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_38030 5764 6894 gene locus_tag LOCUS_38040 gene porR 5764 6894 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_38040 7042 7566 gene locus_tag LOCUS_38050 7042 7566 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_38050 7559 8065 gene locus_tag LOCUS_38060 7559 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 8112 10751 gene locus_tag LOCUS_38070 8112 10751 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_38070 10801 12135 gene locus_tag LOCUS_38080 10801 12135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975609.1 protein_id gnl|my_center|LOCUS_38080 12171 12932 gene locus_tag LOCUS_38090 12171 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence191 2421 3029 gene locus_tag LOCUS_38100 2421 3029 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_38100 3053 3718 gene locus_tag LOCUS_38110 3053 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 5156 3726 gene locus_tag LOCUS_38120 5156 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 6491 5280 gene locus_tag LOCUS_38130 6491 5280 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_38130 9194 6519 gene locus_tag LOCUS_38140 9194 6519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 protein_id gnl|my_center|LOCUS_38140 9541 9197 gene locus_tag LOCUS_38150 9541 9197 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_38150 10234 9635 gene locus_tag LOCUS_38160 10234 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 11343 10234 gene locus_tag LOCUS_38170 gene mtnA 11343 10234 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 protein_id gnl|my_center|LOCUS_38170 >Feature sequence192 252 803 gene locus_tag LOCUS_38180 252 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 876 1358 gene locus_tag LOCUS_38190 876 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1426 1929 gene locus_tag LOCUS_38200 1426 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1955 2503 gene locus_tag LOCUS_38210 1955 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3613 2522 gene locus_tag LOCUS_38220 3613 2522 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_38220 3879 3664 gene locus_tag LOCUS_38230 3879 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 4319 3891 gene locus_tag LOCUS_38240 4319 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 6926 4434 gene locus_tag LOCUS_38250 6926 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 7897 6977 gene locus_tag LOCUS_38260 7897 6977 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763536.1 protein_id gnl|my_center|LOCUS_38260 8473 7943 gene locus_tag LOCUS_38270 8473 7943 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_38270 10102 8651 gene locus_tag LOCUS_38280 10102 8651 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084170.1 protein_id gnl|my_center|LOCUS_38280 10893 10315 gene locus_tag LOCUS_38290 10893 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 12444 11020 gene locus_tag LOCUS_38300 12444 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence193 858 436 gene locus_tag LOCUS_38310 858 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 1441 941 gene locus_tag LOCUS_38320 1441 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 2071 1478 gene locus_tag LOCUS_38330 2071 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 2546 2118 gene locus_tag LOCUS_38340 2546 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 3083 2730 gene locus_tag LOCUS_38350 3083 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 3815 3192 gene locus_tag LOCUS_38360 3815 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4412 3918 gene locus_tag LOCUS_38370 4412 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_38370 5023 4463 gene locus_tag LOCUS_38380 5023 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 5888 5121 gene locus_tag LOCUS_38390 5888 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_38390 6338 5961 gene locus_tag LOCUS_38400 6338 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 6839 6501 gene locus_tag LOCUS_38410 6839 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 7763 7203 gene locus_tag LOCUS_38420 7763 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 9064 7928 gene locus_tag LOCUS_38430 9064 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 9530 11422 gene locus_tag LOCUS_38440 9530 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 12348 11419 gene locus_tag LOCUS_38450 12348 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 12893 12492 gene locus_tag LOCUS_38460 12893 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence194 <1 2279 gene locus_tag LOCUS_38470 <1 2279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:peptidase S8 4185 2281 gene locus_tag LOCUS_38480 4185 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 4463 4182 gene locus_tag LOCUS_38490 4463 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 6952 4538 gene locus_tag LOCUS_38500 6952 4538 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_38500 7043 7585 gene locus_tag LOCUS_38510 7043 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 7582 8424 gene locus_tag LOCUS_38520 gene kdsA 7582 8424 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIB8 protein_id gnl|my_center|LOCUS_38520 8436 9284 gene locus_tag LOCUS_38530 gene wza 8436 9284 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_38530 9286 11718 gene locus_tag LOCUS_38540 gene wzc 9286 11718 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_38540 >Feature sequence195 145 339 gene locus_tag LOCUS_38550 145 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 884 486 gene locus_tag LOCUS_38560 884 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 1701 1102 gene locus_tag LOCUS_38570 1701 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 2559 2050 gene locus_tag LOCUS_38580 2559 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3647 2835 gene locus_tag LOCUS_38590 gene dapD 3647 2835 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_38590 3686 4807 gene locus_tag LOCUS_38600 3686 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 4954 5607 gene locus_tag LOCUS_38610 gene sirR 4954 5607 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_38610 5595 6518 gene locus_tag LOCUS_38620 gene troA 5595 6518 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_38620 6521 7312 gene locus_tag LOCUS_38630 gene mntB 6521 7312 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_38630 7314 8600 gene locus_tag LOCUS_38640 gene mntC 7314 8600 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_38640 8785 9663 gene locus_tag LOCUS_38650 gene mntD 8785 9663 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_38650 10269 9685 gene locus_tag LOCUS_38660 10269 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 11235 10354 gene locus_tag LOCUS_38670 11235 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 11312 12691 gene locus_tag LOCUS_38680 gene mnmE 11312 12691 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_38680 >Feature sequence196 1354 587 gene locus_tag LOCUS_38690 1354 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3060 1621 gene locus_tag LOCUS_38700 3060 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 5760 3157 gene locus_tag LOCUS_38710 5760 3157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_38710 6098 5757 gene locus_tag LOCUS_38720 6098 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 6720 6469 gene locus_tag LOCUS_38730 6720 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6616 7032 gene locus_tag LOCUS_38740 6616 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 8731 7124 gene locus_tag LOCUS_38750 8731 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 8875 10368 gene locus_tag LOCUS_38760 8875 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 11698 10430 gene locus_tag LOCUS_38770 11698 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 12638 11823 gene locus_tag LOCUS_38780 12638 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence197 411 1208 gene locus_tag LOCUS_38790 411 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 1275 2009 gene locus_tag LOCUS_38800 1275 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 2019 2717 gene locus_tag LOCUS_38810 2019 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 3088 3342 gene locus_tag LOCUS_38820 3088 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4162 3566 gene locus_tag LOCUS_38830 4162 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4839 4258 gene locus_tag LOCUS_38840 4839 4258 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_38840 5460 4870 gene locus_tag LOCUS_38850 gene azoR 5460 4870 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 protein_id gnl|my_center|LOCUS_38850 5611 6831 gene locus_tag LOCUS_38860 5611 6831 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_38860 6828 7277 gene locus_tag LOCUS_38870 6828 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 7774 7325 gene locus_tag LOCUS_38880 7774 7325 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_38880 7965 7801 gene locus_tag LOCUS_38890 7965 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 9106 8132 gene locus_tag LOCUS_38900 9106 8132 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_38900 9318 10496 gene locus_tag LOCUS_38910 9318 10496 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975381.1 protein_id gnl|my_center|LOCUS_38910 10838 11365 gene locus_tag LOCUS_38920 10838 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 11375 12133 gene locus_tag LOCUS_38930 11375 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 12163 12357 gene locus_tag LOCUS_38940 12163 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence198 119 316 gene locus_tag LOCUS_38950 119 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_38950 386 1090 gene locus_tag LOCUS_38960 386 1090 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173233.1 protein_id gnl|my_center|LOCUS_38960 2825 1071 gene locus_tag LOCUS_38970 2825 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 3767 2985 gene locus_tag LOCUS_38980 3767 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4673 3777 gene locus_tag LOCUS_38990 4673 3777 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_38990 4846 5667 gene locus_tag LOCUS_39000 4846 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 6690 5671 gene locus_tag LOCUS_39010 6690 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 6829 7797 gene locus_tag LOCUS_39020 gene trpS 6829 7797 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_39020 8114 8608 gene locus_tag LOCUS_39030 8114 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 12017 8862 gene locus_tag LOCUS_39040 12017 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence199 1581 538 gene locus_tag LOCUS_39050 1581 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_39050 2835 2089 gene locus_tag LOCUS_39060 2835 2089 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_39060 3012 4406 gene locus_tag LOCUS_39070 gene lpdA2 3012 4406 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_39070 4698 7544 gene locus_tag LOCUS_39080 4698 7544 CDS product Rab family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933192.1 protein_id gnl|my_center|LOCUS_39080 9297 8308 gene locus_tag LOCUS_39090 9297 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 9706 9290 gene locus_tag LOCUS_39100 9706 9290 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_39100 9791 10675 gene locus_tag LOCUS_39110 9791 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence200 <1 2194 gene locus_tag LOCUS_39120 <1 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:permease 2347 2670 gene locus_tag LOCUS_39130 2347 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 2758 4347 gene locus_tag LOCUS_39140 2758 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4348 5304 gene locus_tag LOCUS_39150 4348 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 5639 6073 gene locus_tag LOCUS_39160 5639 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 6099 6542 gene locus_tag LOCUS_39170 6099 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 7569 6604 gene locus_tag LOCUS_39180 7569 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 9262 7586 gene locus_tag LOCUS_39190 9262 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 12420 9280 gene locus_tag LOCUS_39200 12420 9280 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403145.1 protein_id gnl|my_center|LOCUS_39200 >Feature sequence201 315 1121 gene locus_tag LOCUS_39210 315 1121 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_39210 2003 1179 gene locus_tag LOCUS_39220 2003 1179 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_39220 2346 2957 gene locus_tag LOCUS_39230 2346 2957 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_39230 2974 4839 gene locus_tag LOCUS_39240 2974 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4845 5294 gene locus_tag LOCUS_39250 4845 5294 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_39250 5314 6162 gene locus_tag LOCUS_39260 gene tktA 5314 6162 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_39260 6175 7128 gene locus_tag LOCUS_39270 gene tktC 6175 7128 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_39270 8766 7195 gene locus_tag LOCUS_39280 8766 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 9219 9602 gene locus_tag LOCUS_39290 9219 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 9717 10904 gene locus_tag LOCUS_39300 gene argD 9717 10904 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_39300 11480 10953 gene locus_tag LOCUS_39310 11480 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 12098 11559 gene locus_tag LOCUS_39320 gene hslV 12098 11559 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_39320 >Feature sequence202 472 68 gene locus_tag LOCUS_39330 472 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1343 462 gene locus_tag LOCUS_39340 1343 462 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUP9 protein_id gnl|my_center|LOCUS_39340 1559 2557 gene locus_tag LOCUS_39350 1559 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 2568 3206 gene locus_tag LOCUS_39360 2568 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 3188 3997 gene locus_tag LOCUS_39370 3188 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 3966 4619 gene locus_tag LOCUS_39380 3966 4619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 protein_id gnl|my_center|LOCUS_39380 5172 4951 gene locus_tag LOCUS_39390 5172 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 5299 5742 gene locus_tag LOCUS_39400 5299 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 6513 5854 gene locus_tag LOCUS_39410 6513 5854 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_39410 8845 6494 gene locus_tag LOCUS_39420 8845 6494 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_39420 9391 8876 gene locus_tag LOCUS_39430 9391 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 9804 10172 gene locus_tag LOCUS_39440 9804 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 10615 11085 gene locus_tag LOCUS_39450 10615 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 12251 11490 gene locus_tag LOCUS_39460 12251 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence203 617 1054 gene locus_tag LOCUS_39470 617 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_39470 2564 1110 gene locus_tag LOCUS_39480 2564 1110 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_39480 3693 2650 gene locus_tag LOCUS_39490 3693 2650 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_39490 4745 3813 gene locus_tag LOCUS_39500 4745 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 7711 4781 gene locus_tag LOCUS_39510 7711 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 10822 7871 gene locus_tag LOCUS_39520 10822 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 12012 11056 gene locus_tag LOCUS_39530 12012 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence204 54 1544 gene locus_tag LOCUS_39540 54 1544 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_39540 1551 2222 gene locus_tag LOCUS_39550 1551 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2235 3086 gene locus_tag LOCUS_39560 2235 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 3311 4207 gene locus_tag LOCUS_39570 3311 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 5184 4387 gene locus_tag LOCUS_39580 5184 4387 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_39580 5770 5195 gene locus_tag LOCUS_39590 5770 5195 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_39590 7102 5777 gene locus_tag LOCUS_39600 7102 5777 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_39600 7203 7276 gene locus_tag LOCUS_t00270 7203 7276 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8268 7444 gene locus_tag LOCUS_39610 8268 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 8936 8325 gene locus_tag LOCUS_39620 8936 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 9322 8936 gene locus_tag LOCUS_39630 9322 8936 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence205 903 508 gene locus_tag LOCUS_39640 903 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 1573 911 gene locus_tag LOCUS_39650 1573 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 2184 1573 gene locus_tag LOCUS_39660 2184 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 2392 2637 gene locus_tag LOCUS_39670 2392 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2993 4366 gene locus_tag LOCUS_39680 2993 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4446 4901 gene locus_tag LOCUS_39690 4446 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 5004 5492 gene locus_tag LOCUS_39700 5004 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 5628 6077 gene locus_tag LOCUS_39710 5628 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 8244 6169 gene locus_tag LOCUS_39720 8244 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 9398 8379 gene locus_tag LOCUS_39730 gene potA 9398 8379 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZJ0 protein_id gnl|my_center|LOCUS_39730 10573 9455 gene locus_tag LOCUS_39740 10573 9455 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_39740 >Feature sequence206 3468 2140 gene locus_tag LOCUS_39750 3468 2140 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_39750 4237 3479 gene locus_tag LOCUS_39760 4237 3479 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_39760 4814 4242 gene locus_tag LOCUS_39770 4814 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 5126 5602 gene locus_tag LOCUS_39780 5126 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 6120 5626 gene locus_tag LOCUS_39790 6120 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_39790 6395 6796 gene locus_tag LOCUS_39800 6395 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 6802 8850 gene locus_tag LOCUS_39810 6802 8850 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 protein_id gnl|my_center|LOCUS_39810 9756 8920 gene locus_tag LOCUS_39820 9756 8920 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_39820 9876 10634 gene locus_tag LOCUS_39830 9876 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 10637 11794 gene locus_tag LOCUS_39840 10637 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 >Feature sequence207 1094 756 gene locus_tag LOCUS_39850 1094 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 2334 1105 gene locus_tag LOCUS_39860 2334 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 2979 2467 gene locus_tag LOCUS_39870 2979 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 4451 3039 gene locus_tag LOCUS_39880 4451 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 5116 4667 gene locus_tag LOCUS_39890 5116 4667 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_39890 5506 5138 gene locus_tag LOCUS_39900 5506 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 5768 6433 gene locus_tag LOCUS_39910 5768 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 6702 6436 gene locus_tag LOCUS_39920 6702 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 7478 6768 gene locus_tag LOCUS_39930 7478 6768 CDS product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_39930 8356 7547 gene locus_tag LOCUS_39940 8356 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 9991 8561 gene locus_tag LOCUS_39950 9991 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_39950 10498 10154 gene locus_tag LOCUS_39960 10498 10154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704429.1 protein_id gnl|my_center|LOCUS_39960 10593 11192 gene locus_tag LOCUS_39970 10593 11192 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644741.1 protein_id gnl|my_center|LOCUS_39970 11189 11587 gene locus_tag LOCUS_39980 11189 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence208 703 3888 gene locus_tag LOCUS_39990 703 3888 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_39990 3959 6121 gene locus_tag LOCUS_40000 3959 6121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_40000 6114 7391 gene locus_tag LOCUS_40010 6114 7391 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109189.1 protein_id gnl|my_center|LOCUS_40010 8608 7397 gene locus_tag LOCUS_40020 8608 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 9192 8839 gene locus_tag LOCUS_40030 9192 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 9938 9501 gene locus_tag LOCUS_40040 9938 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 10182 10691 gene locus_tag LOCUS_40050 10182 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 >Feature sequence209 2763 4085 gene locus_tag LOCUS_40060 2763 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_40060 4127 5071 gene locus_tag LOCUS_40070 4127 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 5274 5966 gene locus_tag LOCUS_40080 gene folE2 5274 5966 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_40080 5963 7474 gene locus_tag LOCUS_40090 gene cysS 5963 7474 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_40090 7625 8143 gene locus_tag LOCUS_40100 gene dcd 7625 8143 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_40100 8461 8700 gene locus_tag LOCUS_40110 8461 8700 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 protein_id gnl|my_center|LOCUS_40110 8941 9876 gene locus_tag LOCUS_40120 8941 9876 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 protein_id gnl|my_center|LOCUS_40120 10051 10482 gene locus_tag LOCUS_40130 10051 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 10563 11207 gene locus_tag LOCUS_40140 10563 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 <12023 11209 gene locus_tag LOCUS_40150 <12023 11209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H213:5'-nucleotidase SurE >Feature sequence210 <1 1076 gene locus_tag LOCUS_40160 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108756.1:peptidase M16 1076 1717 gene locus_tag LOCUS_40170 1076 1717 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_40170 1786 3675 gene locus_tag LOCUS_40180 1786 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 3724 4695 gene locus_tag LOCUS_40190 3724 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_40190 5212 5541 gene locus_tag LOCUS_40200 5212 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 6287 5871 gene locus_tag LOCUS_40210 6287 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 7630 6515 gene locus_tag LOCUS_40220 7630 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40220 8338 7850 gene locus_tag LOCUS_40230 8338 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 8649 9014 gene locus_tag LOCUS_tm00010 8649 9014 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9759 10019 gene locus_tag LOCUS_40240 9759 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 <12015 10026 gene locus_tag LOCUS_40250 <12015 10026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962188.1:helicase >Feature sequence211 2471 1308 gene locus_tag LOCUS_40260 2471 1308 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_40260 3820 2468 gene locus_tag LOCUS_40270 3820 2468 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_40270 4433 3804 gene locus_tag LOCUS_40280 4433 3804 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_40280 4643 5443 gene locus_tag LOCUS_40290 4643 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5525 5893 gene locus_tag LOCUS_40300 5525 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 6162 7817 gene locus_tag LOCUS_40310 6162 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 7822 8559 gene locus_tag LOCUS_40320 gene algR 7822 8559 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_40320 8940 11159 gene locus_tag LOCUS_40330 8940 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108745.1 protein_id gnl|my_center|LOCUS_40330 >Feature sequence212 1026 394 gene locus_tag LOCUS_40340 1026 394 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_40340 2301 1075 gene locus_tag LOCUS_40350 gene citC 2301 1075 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT9 protein_id gnl|my_center|LOCUS_40350 3234 2416 gene locus_tag LOCUS_40360 gene panB 3234 2416 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_40360 4252 3431 gene locus_tag LOCUS_40370 gene mscS 4252 3431 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_40370 4791 4288 gene locus_tag LOCUS_40380 gene pyrR2 4791 4288 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_40380 5284 4811 gene locus_tag LOCUS_40390 5284 4811 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 protein_id gnl|my_center|LOCUS_40390 6563 5364 gene locus_tag LOCUS_40400 6563 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 6672 7316 gene locus_tag LOCUS_40410 6672 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 7512 10490 gene locus_tag LOCUS_40420 7512 10490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_40420 11279 10506 gene locus_tag LOCUS_40430 11279 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence213 <1 592 gene locus_tag LOCUS_40440 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962816.1:bacillithiol biosynthesis deacetylase BshB1 767 1360 gene locus_tag LOCUS_40450 767 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 2013 1372 gene locus_tag LOCUS_40460 gene pdxH 2013 1372 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE19 protein_id gnl|my_center|LOCUS_40460 2167 2742 gene locus_tag LOCUS_40470 2167 2742 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_40470 2800 5172 gene locus_tag LOCUS_40480 2800 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 5274 5347 gene locus_tag LOCUS_t00280 5274 5347 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5424 6377 gene locus_tag LOCUS_40490 5424 6377 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_40490 7009 6383 gene locus_tag LOCUS_40500 7009 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 8881 7025 gene locus_tag LOCUS_40510 8881 7025 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_40510 10202 9036 gene locus_tag LOCUS_40520 10202 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence214 1950 421 gene locus_tag LOCUS_40530 1950 421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_40530 2187 3806 gene locus_tag LOCUS_40540 gene pckA1 2187 3806 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_40540 4108 5187 gene locus_tag LOCUS_40550 4108 5187 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_40550 7359 5497 gene locus_tag LOCUS_40560 gene pckG 7359 5497 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y3 protein_id gnl|my_center|LOCUS_40560 8856 8245 gene locus_tag LOCUS_40570 8856 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 9135 9656 gene locus_tag LOCUS_40580 9135 9656 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_40580 9828 10286 gene locus_tag LOCUS_40590 9828 10286 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence215 400 1455 gene locus_tag LOCUS_40600 400 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403247.1 protein_id gnl|my_center|LOCUS_40600 1459 1929 gene locus_tag LOCUS_40610 1459 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 1996 3279 gene locus_tag LOCUS_40620 gene tyrS 1996 3279 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_40620 3667 4950 gene locus_tag LOCUS_40630 3667 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 6077 5217 gene locus_tag LOCUS_40640 6077 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 8428 6077 gene locus_tag LOCUS_40650 8428 6077 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_40650 9272 8643 gene locus_tag LOCUS_40660 9272 8643 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_40660 <11793 9346 gene locus_tag LOCUS_40670 <11793 9346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence216 157 774 gene locus_tag LOCUS_40680 157 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_40680 1142 777 gene locus_tag LOCUS_40690 1142 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1334 1864 gene locus_tag LOCUS_40700 gene flaR 1334 1864 CDS product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_40700 1964 2731 gene locus_tag LOCUS_40710 1964 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 2765 3283 gene locus_tag LOCUS_40720 2765 3283 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 protein_id gnl|my_center|LOCUS_40720 5788 3425 gene locus_tag LOCUS_40730 5788 3425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_40730 7082 6123 gene locus_tag LOCUS_40740 7082 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 7189 7698 gene locus_tag LOCUS_40750 7189 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_40750 7788 8414 gene locus_tag LOCUS_40760 gene narP 7788 8414 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208537.1 protein_id gnl|my_center|LOCUS_40760 8612 9091 gene locus_tag LOCUS_40770 8612 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963612.1 protein_id gnl|my_center|LOCUS_40770 9088 10023 gene locus_tag LOCUS_40780 9088 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_40780 10325 10170 gene locus_tag LOCUS_40790 10325 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 10312 10677 gene locus_tag LOCUS_40800 10312 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 10674 11360 gene locus_tag LOCUS_40810 10674 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence217 278 1300 gene locus_tag LOCUS_40820 gene ltaE 278 1300 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_40820 1297 1659 gene locus_tag LOCUS_40830 1297 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 1665 2846 gene locus_tag LOCUS_40840 1665 2846 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_40840 4529 3045 gene locus_tag LOCUS_40850 gene degP/Q 4529 3045 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_40850 4782 6278 gene locus_tag LOCUS_40860 4782 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_40860 6289 7452 gene locus_tag LOCUS_40870 gene dxr 6289 7452 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_40870 7452 8777 gene locus_tag LOCUS_40880 7452 8777 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_40880 10804 8774 gene locus_tag LOCUS_40890 10804 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence218 423 2075 gene locus_tag LOCUS_40900 423 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2243 2752 gene locus_tag LOCUS_40910 2243 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2804 3937 gene locus_tag LOCUS_40920 2804 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4245 4460 gene locus_tag LOCUS_40930 4245 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4488 7028 gene locus_tag LOCUS_40940 4488 7028 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384833.1 protein_id gnl|my_center|LOCUS_40940 7165 8904 gene locus_tag LOCUS_40950 7165 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 9725 8901 gene locus_tag LOCUS_40960 9725 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_40960 9973 11343 gene locus_tag LOCUS_40970 9973 11343 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_40970 11526 11660 gene locus_tag LOCUS_40980 11526 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence219 1335 2489 gene locus_tag LOCUS_40990 1335 2489 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFT4 protein_id gnl|my_center|LOCUS_40990 2486 3082 gene locus_tag LOCUS_41000 2486 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 3079 4215 gene locus_tag LOCUS_41010 3079 4215 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_41010 4240 4482 gene locus_tag LOCUS_41020 gene moaD 4240 4482 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_41020 4479 4895 gene locus_tag LOCUS_41030 4479 4895 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531881.1 protein_id gnl|my_center|LOCUS_41030 4923 6143 gene locus_tag LOCUS_41040 4923 6143 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_41040 6140 6577 gene locus_tag LOCUS_41050 6140 6577 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_41050 6713 7903 gene locus_tag LOCUS_41060 6713 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 8959 7916 gene locus_tag LOCUS_41070 8959 7916 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_41070 9879 8956 gene locus_tag LOCUS_41080 9879 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 10007 10474 gene locus_tag LOCUS_41090 10007 10474 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_41090 10542 11141 gene locus_tag LOCUS_41100 gene sigZ 10542 11141 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 protein_id gnl|my_center|LOCUS_41100 >Feature sequence220 702 79 gene locus_tag LOCUS_41110 702 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 1859 876 gene locus_tag LOCUS_41120 1859 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 2146 1883 gene locus_tag LOCUS_41130 2146 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 2362 2174 gene locus_tag LOCUS_41140 2362 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 3623 2364 gene locus_tag LOCUS_41150 3623 2364 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_41150 6088 3683 gene locus_tag LOCUS_41160 6088 3683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_41160 6279 6836 gene locus_tag LOCUS_41170 6279 6836 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 protein_id gnl|my_center|LOCUS_41170 6838 7659 gene locus_tag LOCUS_41180 6838 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 7737 8234 gene locus_tag LOCUS_41190 7737 8234 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_41190 9841 8360 gene locus_tag LOCUS_41200 9841 8360 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_41200 9926 10780 gene locus_tag LOCUS_41210 gene mvaB 9926 10780 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_41210 11202 10777 gene locus_tag LOCUS_41220 11202 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence221 <1 3021 gene locus_tag LOCUS_41230 <1 3021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789008.1:multidrug efflux pump protein 4234 2999 gene locus_tag LOCUS_41240 4234 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 4425 5732 gene locus_tag LOCUS_41250 4425 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence222 328 17 gene locus_tag LOCUS_41260 328 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 930 340 gene locus_tag LOCUS_41270 930 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 1867 1034 gene locus_tag LOCUS_41280 1867 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 3065 1920 gene locus_tag LOCUS_41290 3065 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 3132 4553 gene locus_tag LOCUS_41300 3132 4553 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_41300 5294 4554 gene locus_tag LOCUS_41310 5294 4554 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_41310 6399 5287 gene locus_tag LOCUS_41320 6399 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 7530 6445 gene locus_tag LOCUS_41330 7530 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 8698 7634 gene locus_tag LOCUS_41340 8698 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 10625 8688 gene locus_tag LOCUS_41350 10625 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 <11501 10629 gene locus_tag LOCUS_41360 <11501 10629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462310.1:thioether cross-link-forming SCIFF peptide maturase >Feature sequence223 587 832 gene locus_tag LOCUS_41370 587 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 protein_id gnl|my_center|LOCUS_41370 1547 891 gene locus_tag LOCUS_41380 1547 891 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_41380 2538 1699 gene locus_tag LOCUS_41390 2538 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_41390 3115 2552 gene locus_tag LOCUS_41400 3115 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 3574 3146 gene locus_tag LOCUS_41410 3574 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 4336 3590 gene locus_tag LOCUS_41420 4336 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 4993 4709 gene locus_tag LOCUS_41430 4993 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 5553 4996 gene locus_tag LOCUS_41440 5553 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 6050 5847 gene locus_tag LOCUS_41450 6050 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 7774 7430 gene locus_tag LOCUS_41460 7774 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8688 7771 gene locus_tag LOCUS_41470 8688 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 10936 8690 gene locus_tag LOCUS_41480 10936 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence224 3057 2704 gene locus_tag LOCUS_41490 3057 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 4454 3054 gene locus_tag LOCUS_41500 4454 3054 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_41500 5504 4455 gene locus_tag LOCUS_41510 5504 4455 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_41510 7165 5504 gene locus_tag LOCUS_41520 7165 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_41520 7555 7355 gene locus_tag LOCUS_41530 7555 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 9064 7658 gene locus_tag LOCUS_41540 9064 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 <11330 9621 gene locus_tag LOCUS_41550 <11330 9621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107142.1:collagen-binding protein >Feature sequence225 1410 466 gene locus_tag LOCUS_41560 1410 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1985 1470 gene locus_tag LOCUS_41570 1985 1470 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_41570 2207 3757 gene locus_tag LOCUS_41580 2207 3757 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202050.1 protein_id gnl|my_center|LOCUS_41580 3754 4632 gene locus_tag LOCUS_41590 3754 4632 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_41590 4638 4880 gene locus_tag LOCUS_41600 4638 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4834 6000 gene locus_tag LOCUS_41610 4834 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 6396 7124 gene locus_tag LOCUS_41620 6396 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 7597 7193 gene locus_tag LOCUS_41630 7597 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 8466 7669 gene locus_tag LOCUS_41640 8466 7669 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_41640 9452 8463 gene locus_tag LOCUS_41650 9452 8463 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_41650 10168 9452 gene locus_tag LOCUS_41660 10168 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 10260 10991 gene locus_tag LOCUS_41670 10260 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 >Feature sequence226 177 416 gene locus_tag LOCUS_41680 177 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 478 1647 gene locus_tag LOCUS_41690 478 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 1722 2087 gene locus_tag LOCUS_41700 1722 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 2605 2306 gene locus_tag LOCUS_41710 2605 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 2870 3988 gene locus_tag LOCUS_41720 2870 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 5335 4046 gene locus_tag LOCUS_41730 gene eno 5335 4046 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_41730 6450 5347 gene locus_tag LOCUS_41740 gene carA 6450 5347 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_41740 7587 6568 gene locus_tag LOCUS_41750 7587 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 8268 7723 gene locus_tag LOCUS_41760 8268 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 9320 8331 gene locus_tag LOCUS_41770 gene rpoA 9320 8331 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_41770 9806 9354 gene locus_tag LOCUS_41780 9806 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 10370 9978 gene locus_tag LOCUS_41790 gene rpsK 10370 9978 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 protein_id gnl|my_center|LOCUS_41790 10795 10418 gene locus_tag LOCUS_41800 gene rpsM 10795 10418 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_41800 >Feature sequence227 1850 570 gene locus_tag LOCUS_41810 1850 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 2700 2044 gene locus_tag LOCUS_41820 2700 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 3475 2918 gene locus_tag LOCUS_41830 gene gpmA 3475 2918 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_41830 4251 3460 gene locus_tag LOCUS_41840 gene cobS 4251 3460 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_41840 4883 5131 gene locus_tag LOCUS_41850 4883 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 6307 5270 gene locus_tag LOCUS_41860 gene cobT 6307 5270 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_41860 7008 6310 gene locus_tag LOCUS_41870 7008 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_41870 7513 7010 gene locus_tag LOCUS_41880 gene cobU 7513 7010 CDS product cobinamide kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 protein_id gnl|my_center|LOCUS_41880 8076 7510 gene locus_tag LOCUS_41890 8076 7510 CDS product ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_41890 10059 8188 gene locus_tag LOCUS_41900 gene btuB 10059 8188 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI41 protein_id gnl|my_center|LOCUS_41900 <10991 10064 gene locus_tag LOCUS_41910 <10991 10064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932103.1:iron(III) ABC transporter ATP-binding protein >Feature sequence228 403 1797 gene locus_tag LOCUS_41920 403 1797 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_41920 2046 3509 gene locus_tag LOCUS_41930 2046 3509 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_41930 5092 3635 gene locus_tag LOCUS_41940 5092 3635 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_41940 6625 5309 gene locus_tag LOCUS_41950 6625 5309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_41950 9689 6618 gene locus_tag LOCUS_41960 9689 6618 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_41960 10773 9694 gene locus_tag LOCUS_41970 10773 9694 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_41970 >Feature sequence229 2302 1001 gene locus_tag LOCUS_41980 2302 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 3706 2528 gene locus_tag LOCUS_41990 3706 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 4282 3773 gene locus_tag LOCUS_42000 4282 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 4332 4811 gene locus_tag LOCUS_42010 4332 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42010 4818 5465 gene locus_tag LOCUS_42020 4818 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42020 5494 6972 gene locus_tag LOCUS_42030 5494 6972 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_42030 6969 7556 gene locus_tag LOCUS_42040 6969 7556 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_42040 8015 10477 gene locus_tag LOCUS_42050 8015 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 >Feature sequence230 4104 3673 gene locus_tag LOCUS_42060 4104 3673 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_42060 4361 4101 gene locus_tag LOCUS_42070 4361 4101 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_42070 6317 4425 gene locus_tag LOCUS_42080 6317 4425 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_42080 6980 6324 gene locus_tag LOCUS_42090 6980 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 7144 6977 gene locus_tag LOCUS_42100 7144 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 7609 7151 gene locus_tag LOCUS_42110 7609 7151 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_42110 8078 7620 gene locus_tag LOCUS_42120 8078 7620 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_42120 9692 8115 gene locus_tag LOCUS_42130 9692 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 10520 9714 gene locus_tag LOCUS_42140 10520 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence231 3114 307 gene locus_tag LOCUS_42150 3114 307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_42150 3850 3503 gene locus_tag LOCUS_42160 gene gldC 3850 3503 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_42160 4984 4322 gene locus_tag LOCUS_42170 gene atoA 4984 4322 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_42170 5685 4987 gene locus_tag LOCUS_42180 gene atoD 5685 4987 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_42180 6629 5697 gene locus_tag LOCUS_42190 gene ribF 6629 5697 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_42190 7377 6643 gene locus_tag LOCUS_42200 gene truB 7377 6643 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_42200 8168 7377 gene locus_tag LOCUS_42210 gene uppP 8168 7377 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_42210 8384 8172 gene locus_tag LOCUS_42220 8384 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 9306 8386 gene locus_tag LOCUS_42230 9306 8386 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_42230 10108 9476 gene locus_tag LOCUS_42240 10108 9476 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_42240 10170 10607 gene locus_tag LOCUS_42250 10170 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_42250 >Feature sequence232 5777 2445 gene locus_tag LOCUS_42260 5777 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6074 8467 gene locus_tag LOCUS_42270 6074 8467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_42270 >Feature sequence233 <1 1219 gene locus_tag LOCUS_42280 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108276.1:TonB-dependent receptor 1286 2167 gene locus_tag LOCUS_42290 1286 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 2398 3396 gene locus_tag LOCUS_42300 2398 3396 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_42300 5382 3424 gene locus_tag LOCUS_42310 5382 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 5590 6237 gene locus_tag LOCUS_42320 5590 6237 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_42320 8075 6303 gene locus_tag LOCUS_42330 8075 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 9715 8075 gene locus_tag LOCUS_42340 9715 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 10212 9844 gene locus_tag LOCUS_42350 10212 9844 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_42350 >Feature sequence234 1526 126 gene locus_tag LOCUS_42360 gene fumC 1526 126 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_42360 1891 2613 gene locus_tag LOCUS_42370 1891 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 2749 3810 gene locus_tag LOCUS_42380 2749 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 3807 4553 gene locus_tag LOCUS_42390 3807 4553 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_42390 5422 4559 gene locus_tag LOCUS_42400 5422 4559 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_42400 6394 5489 gene locus_tag LOCUS_42410 6394 5489 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701395.1 protein_id gnl|my_center|LOCUS_42410 6897 6538 gene locus_tag LOCUS_42420 6897 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 7037 7408 gene locus_tag LOCUS_42430 7037 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 8394 8071 gene locus_tag LOCUS_42440 8394 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 9407 8574 gene locus_tag LOCUS_42450 9407 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 >Feature sequence235 871 59 gene locus_tag LOCUS_42460 871 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1938 1030 gene locus_tag LOCUS_42470 1938 1030 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_42470 2944 2027 gene locus_tag LOCUS_42480 2944 2027 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_42480 4197 3073 gene locus_tag LOCUS_42490 4197 3073 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_42490 4652 4299 gene locus_tag LOCUS_42500 4652 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026986.1 protein_id gnl|my_center|LOCUS_42500 5302 4727 gene locus_tag LOCUS_42510 5302 4727 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_42510 5964 5356 gene locus_tag LOCUS_42520 5964 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 6515 5985 gene locus_tag LOCUS_42530 6515 5985 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_42530 7265 6663 gene locus_tag LOCUS_42540 7265 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 8029 7319 gene locus_tag LOCUS_42550 8029 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639356.2 protein_id gnl|my_center|LOCUS_42550 8953 8132 gene locus_tag LOCUS_42560 8953 8132 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 protein_id gnl|my_center|LOCUS_42560 9583 9143 gene locus_tag LOCUS_42570 9583 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 10314 9685 gene locus_tag LOCUS_42580 10314 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence236 <1 1070 gene locus_tag LOCUS_42590 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD74:putative cytosol aminopeptidase 1168 2367 gene locus_tag LOCUS_42600 1168 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 3383 2667 gene locus_tag LOCUS_42610 3383 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 3421 5901 gene locus_tag LOCUS_42620 3421 5901 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_42620 6194 6676 gene locus_tag LOCUS_42630 6194 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 7207 6770 gene locus_tag LOCUS_42640 7207 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 7468 9033 gene locus_tag LOCUS_42650 7468 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 10340 9135 gene locus_tag LOCUS_42660 10340 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence237 1855 866 gene locus_tag LOCUS_42670 1855 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 4015 1931 gene locus_tag LOCUS_42680 4015 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 5235 4129 gene locus_tag LOCUS_42690 gene dnaJ 5235 4129 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_42690 5828 5238 gene locus_tag LOCUS_42700 gene grpE 5828 5238 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_42700 6116 7219 gene locus_tag LOCUS_42710 6116 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_42710 7797 7294 gene locus_tag LOCUS_42720 7797 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 8929 7901 gene locus_tag LOCUS_42730 gene obg 8929 7901 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_42730 9545 8967 gene locus_tag LOCUS_42740 gene adk 9545 8967 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_42740 10128 9589 gene locus_tag LOCUS_42750 10128 9589 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_42750 >Feature sequence238 1685 909 gene locus_tag LOCUS_42760 1685 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_42760 2792 1695 gene locus_tag LOCUS_42770 2792 1695 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_42770 2908 3891 gene locus_tag LOCUS_42780 gene lpxK 2908 3891 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_42780 3968 5833 gene locus_tag LOCUS_42790 3968 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_42790 6147 5953 gene locus_tag LOCUS_42800 6147 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 6712 6137 gene locus_tag LOCUS_42810 6712 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_42810 7299 6859 gene locus_tag LOCUS_42820 7299 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 7766 7335 gene locus_tag LOCUS_42830 7766 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 8802 8209 gene locus_tag LOCUS_42840 8802 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 9983 8874 gene locus_tag LOCUS_42850 9983 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_42850 >Feature sequence239 1129 230 gene locus_tag LOCUS_42860 1129 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1275 1952 gene locus_tag LOCUS_42870 gene cmk 1275 1952 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 protein_id gnl|my_center|LOCUS_42870 1957 2850 gene locus_tag LOCUS_42880 gene ispH 1957 2850 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_42880 2994 4361 gene locus_tag LOCUS_42890 gene nqrA 2994 4361 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_42890 4366 5550 gene locus_tag LOCUS_42900 gene nqrB 4366 5550 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_42900 5537 6292 gene locus_tag LOCUS_42910 gene nqrC 5537 6292 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_42910 6313 6978 gene locus_tag LOCUS_42920 gene nqrD 6313 6978 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_42920 6992 7603 gene locus_tag LOCUS_42930 gene nqrE 6992 7603 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_42930 8124 7684 gene locus_tag LOCUS_42940 8124 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 8327 8782 gene locus_tag LOCUS_42950 8327 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 9486 8779 gene locus_tag LOCUS_42960 9486 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence240 <1 501 gene locus_tag LOCUS_42970 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein 513 2144 gene locus_tag LOCUS_42980 513 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 >Feature sequence241 1165 566 gene locus_tag LOCUS_42990 1165 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_42990 1218 1844 gene locus_tag LOCUS_43000 1218 1844 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EY6 protein_id gnl|my_center|LOCUS_43000 4184 1872 gene locus_tag LOCUS_43010 4184 1872 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 protein_id gnl|my_center|LOCUS_43010 4409 4960 gene locus_tag LOCUS_43020 4409 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_43020 5061 5939 gene locus_tag LOCUS_43030 5061 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 6050 8755 gene locus_tag LOCUS_43040 6050 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 8780 9508 gene locus_tag LOCUS_43050 8780 9508 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_43050 10035 9697 gene locus_tag LOCUS_43060 10035 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 >Feature sequence242 3284 1311 gene locus_tag LOCUS_43070 3284 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 5191 3281 gene locus_tag LOCUS_43080 5191 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 5596 7215 gene locus_tag LOCUS_43090 5596 7215 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KR0 protein_id gnl|my_center|LOCUS_43090 8841 8389 gene locus_tag LOCUS_43100 8841 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 <10270 8864 gene locus_tag LOCUS_43110 <10270 8864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence243 1311 442 gene locus_tag LOCUS_43120 gene ykuF 1311 442 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_43120 1545 2501 gene locus_tag LOCUS_43130 1545 2501 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_43130 2520 2813 gene locus_tag LOCUS_43140 2520 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 3011 3910 gene locus_tag LOCUS_43150 3011 3910 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_43150 4073 7009 gene locus_tag LOCUS_43160 4073 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 >Feature sequence244 392 676 gene locus_tag LOCUS_43170 392 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 839 1774 gene locus_tag LOCUS_43180 839 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 2442 3299 gene locus_tag LOCUS_43190 2442 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 3325 3972 gene locus_tag LOCUS_43200 3325 3972 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_43200 4314 6851 gene locus_tag LOCUS_43210 4314 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 6848 7216 gene locus_tag LOCUS_43220 6848 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 7203 9713 gene locus_tag LOCUS_43230 7203 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence245 <1 2031 gene locus_tag LOCUS_43240 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203504.1:competence protein 2028 2801 gene locus_tag LOCUS_43250 2028 2801 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_43250 2895 3146 gene locus_tag LOCUS_43260 2895 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3143 3445 gene locus_tag LOCUS_43270 3143 3445 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964042.1 protein_id gnl|my_center|LOCUS_43270 3489 5414 gene locus_tag LOCUS_43280 3489 5414 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_43280 5465 6058 gene locus_tag LOCUS_43290 5465 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 6092 6436 gene locus_tag LOCUS_43300 6092 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 6426 6980 gene locus_tag LOCUS_43310 6426 6980 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_43310 7083 9857 gene locus_tag LOCUS_43320 7083 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence246 588 2456 gene locus_tag LOCUS_43330 588 2456 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_43330 2526 3893 gene locus_tag LOCUS_43340 2526 3893 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118040.1 protein_id gnl|my_center|LOCUS_43340 4033 5430 gene locus_tag LOCUS_43350 gene xylE 4033 5430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_43350 5922 5473 gene locus_tag LOCUS_43360 5922 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 7359 5965 gene locus_tag LOCUS_43370 7359 5965 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_43370 7595 8989 gene locus_tag LOCUS_43380 7595 8989 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_43380 8999 10099 gene locus_tag LOCUS_43390 8999 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 >Feature sequence247 <1 1270 gene locus_tag LOCUS_43400 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679762.1:membrane protein 2646 1267 gene locus_tag LOCUS_43410 2646 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 4277 2646 gene locus_tag LOCUS_43420 4277 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 5468 4464 gene locus_tag LOCUS_43430 5468 4464 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_43430 8000 5577 gene locus_tag LOCUS_43440 8000 5577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_43440 <10189 8217 gene locus_tag LOCUS_43450 <10189 8217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence248 1675 5 gene locus_tag LOCUS_43460 1675 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55492 protein_id gnl|my_center|LOCUS_43460 2669 1830 gene locus_tag LOCUS_43470 2669 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_43470 3978 2653 gene locus_tag LOCUS_43480 3978 2653 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_43480 4913 4125 gene locus_tag LOCUS_43490 4913 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 5001 6092 gene locus_tag LOCUS_43500 5001 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 7129 6098 gene locus_tag LOCUS_43510 7129 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence249 54 1100 gene locus_tag LOCUS_43520 54 1100 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_43520 1097 1792 gene locus_tag LOCUS_43530 1097 1792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_43530 1856 2563 gene locus_tag LOCUS_43540 1856 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 3017 9427 gene locus_tag LOCUS_43550 3017 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence250 177 1736 gene locus_tag LOCUS_43560 gene hutH 177 1736 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_43560 1738 3729 gene locus_tag LOCUS_43570 gene hutU 1738 3729 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_43570 3855 5084 gene locus_tag LOCUS_43580 gene hutI 3855 5084 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_43580 7544 5130 gene locus_tag LOCUS_43590 7544 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 8002 9858 gene locus_tag LOCUS_43600 8002 9858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence251 154 1536 gene locus_tag LOCUS_43610 154 1536 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 protein_id gnl|my_center|LOCUS_43610 1596 1880 gene locus_tag LOCUS_43620 1596 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 2431 1877 gene locus_tag LOCUS_43630 2431 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 2997 2467 gene locus_tag LOCUS_43640 2997 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 3295 4644 gene locus_tag LOCUS_43650 3295 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 4657 5370 gene locus_tag LOCUS_43660 4657 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 5382 6428 gene locus_tag LOCUS_43670 5382 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 7763 6435 gene locus_tag LOCUS_43680 7763 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 <10074 8841 gene locus_tag LOCUS_43690 <10074 8841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784703.1:membrane protein >Feature sequence252 1668 991 gene locus_tag LOCUS_43700 1668 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 2828 1680 gene locus_tag LOCUS_43710 2828 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 3215 2943 gene locus_tag LOCUS_43720 3215 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 4222 3485 gene locus_tag LOCUS_43730 4222 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 5247 4219 gene locus_tag LOCUS_43740 5247 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701760.1 protein_id gnl|my_center|LOCUS_43740 6041 5289 gene locus_tag LOCUS_43750 6041 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 6792 6115 gene locus_tag LOCUS_43760 6792 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 7468 6806 gene locus_tag LOCUS_43770 7468 6806 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_43770 9025 7472 gene locus_tag LOCUS_43780 9025 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 9526 9140 gene locus_tag LOCUS_43790 9526 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 <10067 9454 gene locus_tag LOCUS_43800 <10067 9454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870430.1:glycosyl transferase >Feature sequence253 915 28 gene locus_tag LOCUS_43810 915 28 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_43810 1037 2431 gene locus_tag LOCUS_43820 1037 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 2431 2670 gene locus_tag LOCUS_43830 2431 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 2855 4783 gene locus_tag LOCUS_43840 2855 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 4882 6399 gene locus_tag LOCUS_43850 4882 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 6530 6796 gene locus_tag LOCUS_43860 6530 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 7241 8887 gene locus_tag LOCUS_43870 7241 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence254 1056 205 gene locus_tag LOCUS_43880 1056 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 2038 1184 gene locus_tag LOCUS_43890 2038 1184 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_43890 1980 2144 gene locus_tag LOCUS_43900 1980 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 4809 2215 gene locus_tag LOCUS_43910 4809 2215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_43910 5276 4884 gene locus_tag LOCUS_43920 5276 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5382 6158 gene locus_tag LOCUS_43930 5382 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 6237 7709 gene locus_tag LOCUS_43940 6237 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 7702 9171 gene locus_tag LOCUS_43950 7702 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 >Feature sequence255 1262 4366 gene locus_tag LOCUS_43960 1262 4366 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_43960 4611 4390 gene locus_tag LOCUS_43970 4611 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 4634 5785 gene locus_tag LOCUS_43980 4634 5785 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_43980 5870 7129 gene locus_tag LOCUS_43990 5870 7129 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 protein_id gnl|my_center|LOCUS_43990 7132 8211 gene locus_tag LOCUS_44000 7132 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence256 1208 63 gene locus_tag LOCUS_44010 gene aspC3 1208 63 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_44010 1713 3116 gene locus_tag LOCUS_44020 gene trpE 1713 3116 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_44020 3189 3770 gene locus_tag LOCUS_44030 gene pabA 3189 3770 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_44030 3803 4789 gene locus_tag LOCUS_44040 gene trpD 3803 4789 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_44040 4842 5645 gene locus_tag LOCUS_44050 gene trpC 4842 5645 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_44050 5720 6319 gene locus_tag LOCUS_44060 gene trpF 5720 6319 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_44060 6319 6939 gene locus_tag LOCUS_44070 6319 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 6929 7363 gene locus_tag LOCUS_44080 6929 7363 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_44080 7367 8548 gene locus_tag LOCUS_44090 gene trpB 7367 8548 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_44090 8582 9385 gene locus_tag LOCUS_44100 gene trpA 8582 9385 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_44100 9401 9871 gene locus_tag LOCUS_44110 9401 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence257 723 962 gene locus_tag LOCUS_44120 723 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 966 1937 gene locus_tag LOCUS_44130 966 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 2015 3817 gene locus_tag LOCUS_44140 2015 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 4216 5781 gene locus_tag LOCUS_44150 4216 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 5940 6773 gene locus_tag LOCUS_44160 5940 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_44160 7684 6854 gene locus_tag LOCUS_44170 gene tsf 7684 6854 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_44170 8584 7793 gene locus_tag LOCUS_44180 gene rpsB 8584 7793 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_44180 8996 8610 gene locus_tag LOCUS_44190 gene rpsI 8996 8610 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_44190 9452 9009 gene locus_tag LOCUS_44200 gene rplM 9452 9009 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_44200 >Feature sequence258 <1 1401 gene locus_tag LOCUS_44210 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582818.1:pectate lyase 3946 1562 gene locus_tag LOCUS_44220 3946 1562 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_44220 6506 4113 gene locus_tag LOCUS_44230 6506 4113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_44230 8906 6510 gene locus_tag LOCUS_44240 8906 6510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_44240 <9794 8910 gene locus_tag LOCUS_44250 <9794 8910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease >Feature sequence259 913 4041 gene locus_tag LOCUS_44260 913 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 4041 7235 gene locus_tag LOCUS_44270 4041 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 7232 8566 gene locus_tag LOCUS_44280 7232 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence260 596 934 gene locus_tag LOCUS_44290 gene arsR 596 934 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 protein_id gnl|my_center|LOCUS_44290 918 1373 gene locus_tag LOCUS_44300 918 1373 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 protein_id gnl|my_center|LOCUS_44300 2812 1523 gene locus_tag LOCUS_44310 gene hemL 2812 1523 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_44310 4652 2802 gene locus_tag LOCUS_44320 4652 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 6183 4654 gene locus_tag LOCUS_44330 gene guaA 6183 4654 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_44330 6519 6926 gene locus_tag LOCUS_44340 6519 6926 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_44340 7455 8492 gene locus_tag LOCUS_44350 7455 8492 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_44350 >Feature sequence261 3080 1929 gene locus_tag LOCUS_44360 3080 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 3596 3216 gene locus_tag LOCUS_44370 3596 3216 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_44370 3781 3593 gene locus_tag LOCUS_44380 3781 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 4771 3914 gene locus_tag LOCUS_44390 4771 3914 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_44390 5043 6293 gene locus_tag LOCUS_44400 5043 6293 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_44400 6293 7180 gene locus_tag LOCUS_44410 6293 7180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_44410 7183 8007 gene locus_tag LOCUS_44420 7183 8007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_44420 8013 9113 gene locus_tag LOCUS_44430 8013 9113 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_44430 >Feature sequence262 271 1320 gene locus_tag LOCUS_44440 271 1320 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 protein_id gnl|my_center|LOCUS_44440 1322 2122 gene locus_tag LOCUS_44450 1322 2122 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_44450 4820 2235 gene locus_tag LOCUS_44460 4820 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 6061 4835 gene locus_tag LOCUS_44470 6061 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 6187 6558 gene locus_tag LOCUS_44480 6187 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 9022 6608 gene locus_tag LOCUS_44490 9022 6608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_44490 >Feature sequence263 277 1023 gene locus_tag LOCUS_44500 277 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 1080 1478 gene locus_tag LOCUS_44510 1080 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 2402 1917 gene locus_tag LOCUS_44520 2402 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 4971 2992 gene locus_tag LOCUS_44530 4971 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 5190 5474 gene locus_tag LOCUS_44540 5190 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44540 5583 5945 gene locus_tag LOCUS_44550 5583 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44550 5942 7003 gene locus_tag LOCUS_44560 5942 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 7794 7030 gene locus_tag LOCUS_44570 7794 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 8414 7863 gene locus_tag LOCUS_44580 8414 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_44580 9333 8473 gene locus_tag LOCUS_44590 9333 8473 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence264 <1 824 gene locus_tag LOCUS_44600 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107753.1:transcriptional regulator 941 2422 gene locus_tag LOCUS_44610 gene citT 941 2422 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 protein_id gnl|my_center|LOCUS_44610 2539 3309 gene locus_tag LOCUS_44620 2539 3309 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 protein_id gnl|my_center|LOCUS_44620 4496 3387 gene locus_tag LOCUS_44630 4496 3387 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_44630 5346 4684 gene locus_tag LOCUS_44640 5346 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 5647 6345 gene locus_tag LOCUS_44650 5647 6345 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_44650 6429 7100 gene locus_tag LOCUS_44660 6429 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 7200 7676 gene locus_tag LOCUS_44670 7200 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 7742 8242 gene locus_tag LOCUS_44680 7742 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 >Feature sequence265 <1 2982 gene locus_tag LOCUS_44690 <1 2982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 3193 6375 gene locus_tag LOCUS_44700 3193 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence266 3370 2921 gene locus_tag LOCUS_44710 3370 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 4243 3491 gene locus_tag LOCUS_44720 4243 3491 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_44720 6149 4245 gene locus_tag LOCUS_44730 6149 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 6785 6285 gene locus_tag LOCUS_44740 6785 6285 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_44740 7173 6850 gene locus_tag LOCUS_44750 7173 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 7256 7993 gene locus_tag LOCUS_44760 gene etfB 7256 7993 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_44760 8018 8971 gene locus_tag LOCUS_44770 gene etfA 8018 8971 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence267 1053 823 gene locus_tag LOCUS_44780 1053 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 1568 1050 gene locus_tag LOCUS_44790 1568 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2975 1659 gene locus_tag LOCUS_44800 2975 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 4277 2988 gene locus_tag LOCUS_44810 4277 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 4989 4270 gene locus_tag LOCUS_44820 gene coaX 4989 4270 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_44820 5031 6110 gene locus_tag LOCUS_44830 5031 6110 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_44830 6151 7377 gene locus_tag LOCUS_44840 6151 7377 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_44840 7505 9058 gene locus_tag LOCUS_44850 7505 9058 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_44850 >Feature sequence268 1534 5 gene locus_tag LOCUS_44860 1534 5 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746478.1 protein_id gnl|my_center|LOCUS_44860 1886 2653 gene locus_tag LOCUS_44870 1886 2653 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_44870 3609 2632 gene locus_tag LOCUS_44880 3609 2632 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_44880 4573 3614 gene locus_tag LOCUS_44890 4573 3614 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_44890 5078 4578 gene locus_tag LOCUS_44900 5078 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 5730 5200 gene locus_tag LOCUS_44910 5730 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 6988 5720 gene locus_tag LOCUS_44920 gene pyrC2 6988 5720 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_44920 8993 6990 gene locus_tag LOCUS_44930 8993 6990 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence269 1209 202 gene locus_tag LOCUS_44940 1209 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 2083 1211 gene locus_tag LOCUS_44950 2083 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 3315 2080 gene locus_tag LOCUS_44960 3315 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 4040 3312 gene locus_tag LOCUS_44970 4040 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_44970 5147 4062 gene locus_tag LOCUS_44980 gene wbtI 5147 4062 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 protein_id gnl|my_center|LOCUS_44980 6011 5319 gene locus_tag LOCUS_44990 6011 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 7349 6123 gene locus_tag LOCUS_45000 gene ald 7349 6123 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_45000 7776 7342 gene locus_tag LOCUS_45010 7776 7342 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_45010 <9312 7776 gene locus_tag LOCUS_45020 <9312 7776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:two-component system response regulator >Feature sequence270 1185 46 gene locus_tag LOCUS_45030 1185 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 2782 1178 gene locus_tag LOCUS_45040 2782 1178 CDS product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_45040 3791 2970 gene locus_tag LOCUS_45050 3791 2970 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_45050 3914 5020 gene locus_tag LOCUS_45060 3914 5020 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_45060 5679 5044 gene locus_tag LOCUS_45070 gene clpP 5679 5044 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAW6 protein_id gnl|my_center|LOCUS_45070 5961 5692 gene locus_tag LOCUS_45080 5961 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 6472 5942 gene locus_tag LOCUS_45090 6472 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 8337 6559 gene locus_tag LOCUS_45100 gene proS 8337 6559 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31755 protein_id gnl|my_center|LOCUS_45100 >Feature sequence271 1584 1967 gene locus_tag LOCUS_45110 1584 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 2671 1964 gene locus_tag LOCUS_45120 2671 1964 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_45120 2937 3668 gene locus_tag LOCUS_45130 2937 3668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_45130 3665 4420 gene locus_tag LOCUS_45140 3665 4420 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_45140 4612 5112 gene locus_tag LOCUS_45150 4612 5112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 protein_id gnl|my_center|LOCUS_45150 5160 5981 gene locus_tag LOCUS_45160 5160 5981 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_45160 7048 6059 gene locus_tag LOCUS_45170 7048 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 8134 7223 gene locus_tag LOCUS_45180 8134 7223 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 protein_id gnl|my_center|LOCUS_45180 >Feature sequence272 59 280 gene locus_tag LOCUS_45190 59 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 666 1223 gene locus_tag LOCUS_45200 666 1223 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729007.1 protein_id gnl|my_center|LOCUS_45200 1279 2277 gene locus_tag LOCUS_45210 1279 2277 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_45210 2347 2949 gene locus_tag LOCUS_45220 2347 2949 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_45220 2946 3416 gene locus_tag LOCUS_45230 gene tadA 2946 3416 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_45230 3413 3652 gene locus_tag LOCUS_45240 3413 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 4187 3708 gene locus_tag LOCUS_45250 4187 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 5838 4366 gene locus_tag LOCUS_45260 5838 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 6033 7496 gene locus_tag LOCUS_45270 6033 7496 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887609.1 protein_id gnl|my_center|LOCUS_45270 7969 8475 gene locus_tag LOCUS_45280 gene lspA 7969 8475 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67692 protein_id gnl|my_center|LOCUS_45280 8477 9070 gene locus_tag LOCUS_45290 8477 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence273 163 384 gene locus_tag LOCUS_45300 163 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 570 2099 gene locus_tag LOCUS_45310 570 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_45310 5699 2457 gene locus_tag LOCUS_45320 5699 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 6776 5976 gene locus_tag LOCUS_45330 6776 5976 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538091.1 protein_id gnl|my_center|LOCUS_45330 7649 7050 gene locus_tag LOCUS_45340 7649 7050 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_45340 8095 7634 gene locus_tag LOCUS_45350 8095 7634 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_45350 8618 8544 gene locus_tag LOCUS_t00290 8618 8544 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence274 <1 707 gene locus_tag LOCUS_45360 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000676633.1:DNA-binding protein 1637 762 gene locus_tag LOCUS_45370 1637 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 2050 1634 gene locus_tag LOCUS_45380 2050 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 3284 2220 gene locus_tag LOCUS_45390 3284 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 4215 3424 gene locus_tag LOCUS_45400 4215 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 4301 4915 gene locus_tag LOCUS_45410 4301 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 6177 4975 gene locus_tag LOCUS_45420 6177 4975 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_45420 6949 6371 gene locus_tag LOCUS_45430 6949 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 8533 7130 gene locus_tag LOCUS_45440 gene lnt 8533 7130 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403039.1 protein_id gnl|my_center|LOCUS_45440 >Feature sequence275 1715 618 gene locus_tag LOCUS_45450 1715 618 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_45450 2845 1799 gene locus_tag LOCUS_45460 2845 1799 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_45460 3675 3025 gene locus_tag LOCUS_45470 3675 3025 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_45470 3973 4833 gene locus_tag LOCUS_45480 3973 4833 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965264.1 protein_id gnl|my_center|LOCUS_45480 5665 5174 gene locus_tag LOCUS_45490 5665 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 7894 5678 gene locus_tag LOCUS_45500 7894 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 9007 8072 gene locus_tag LOCUS_45510 9007 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 >Feature sequence276 103 438 gene locus_tag LOCUS_45520 103 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 2092 824 gene locus_tag LOCUS_45530 2092 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 3036 2089 gene locus_tag LOCUS_45540 3036 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 4120 3029 gene locus_tag LOCUS_45550 4120 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 5951 4467 gene locus_tag LOCUS_45560 5951 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 6945 5995 gene locus_tag LOCUS_45570 6945 5995 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543833.1 protein_id gnl|my_center|LOCUS_45570 >Feature sequence277 403 822 gene locus_tag LOCUS_45580 403 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 867 1274 gene locus_tag LOCUS_45590 867 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 1287 2024 gene locus_tag LOCUS_45600 1287 2024 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_45600 2036 2383 gene locus_tag LOCUS_45610 2036 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 2499 2933 gene locus_tag LOCUS_45620 2499 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 3028 3552 gene locus_tag LOCUS_45630 3028 3552 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_45630 3622 4758 gene locus_tag LOCUS_45640 gene pntA 3622 4758 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_45640 4762 5076 gene locus_tag LOCUS_45650 gene pntA 4762 5076 CDS product NADP transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_45650 5086 6495 gene locus_tag LOCUS_45660 gene pntB 5086 6495 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNS8 protein_id gnl|my_center|LOCUS_45660 6557 7150 gene locus_tag LOCUS_45670 6557 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 7233 8648 gene locus_tag LOCUS_45680 7233 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 8722 8952 gene locus_tag LOCUS_45690 8722 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence278 39 2453 gene locus_tag LOCUS_45700 39 2453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_45700 2455 4863 gene locus_tag LOCUS_45710 2455 4863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_45710 4898 7279 gene locus_tag LOCUS_45720 4898 7279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_45720 >Feature sequence279 1473 949 gene locus_tag LOCUS_45730 1473 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 1643 2461 gene locus_tag LOCUS_45740 gene deoD 1643 2461 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 protein_id gnl|my_center|LOCUS_45740 3104 2499 gene locus_tag LOCUS_45750 3104 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 3622 3308 gene locus_tag LOCUS_45760 3622 3308 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_45760 3808 4509 gene locus_tag LOCUS_45770 3808 4509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_45770 4533 5450 gene locus_tag LOCUS_45780 gene gldA 4533 5450 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_45780 5434 7836 gene locus_tag LOCUS_45790 5434 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 7847 8356 gene locus_tag LOCUS_45800 7847 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 8676 8359 gene locus_tag LOCUS_45810 8676 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 >Feature sequence280 594 160 gene locus_tag LOCUS_45820 594 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 1838 816 gene locus_tag LOCUS_45830 1838 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 2169 1861 gene locus_tag LOCUS_45840 2169 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 2618 2274 gene locus_tag LOCUS_45850 2618 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 3311 2736 gene locus_tag LOCUS_45860 3311 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 4354 3518 gene locus_tag LOCUS_45870 4354 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 7022 4653 gene locus_tag LOCUS_45880 gene nrdA 7022 4653 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_45880 8074 7076 gene locus_tag LOCUS_45890 gene nrdB 8074 7076 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence281 <1 605 gene locus_tag LOCUS_45900 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 1138 602 gene locus_tag LOCUS_45910 1138 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 2266 1199 gene locus_tag LOCUS_45920 2266 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 2651 2247 gene locus_tag LOCUS_45930 2651 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 4131 2788 gene locus_tag LOCUS_45940 4131 2788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_45940 7282 4139 gene locus_tag LOCUS_45950 7282 4139 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_45950 8358 7282 gene locus_tag LOCUS_45960 8358 7282 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_45960 >Feature sequence282 714 346 gene locus_tag LOCUS_45970 714 346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_45970 1003 1170 gene locus_tag LOCUS_45980 1003 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 1388 1807 gene locus_tag LOCUS_45990 1388 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 2571 2131 gene locus_tag LOCUS_46000 2571 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 3764 2619 gene locus_tag LOCUS_46010 3764 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 4052 3849 gene locus_tag LOCUS_46020 4052 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 6309 4681 gene locus_tag LOCUS_46030 gene pafA 6309 4681 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_46030 >Feature sequence283 <1 1385 gene locus_tag LOCUS_46040 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971887.1:multidrug ABC transporter substrate-binding protein 1544 3070 gene locus_tag LOCUS_46050 1544 3070 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 protein_id gnl|my_center|LOCUS_46050 4483 3140 gene locus_tag LOCUS_46060 4483 3140 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A100 protein_id gnl|my_center|LOCUS_46060 4736 5872 gene locus_tag LOCUS_46070 gene paaE 4736 5872 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_46070 6145 7419 gene locus_tag LOCUS_46080 6145 7419 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 protein_id gnl|my_center|LOCUS_46080 7421 8386 gene locus_tag LOCUS_46090 7421 8386 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_46090 8602 8390 gene locus_tag LOCUS_46100 8602 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 >Feature sequence284 <1 2635 gene locus_tag LOCUS_46110 <1 2635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2809 5883 gene locus_tag LOCUS_46120 2809 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence285 1014 520 gene locus_tag LOCUS_46130 gene cdd 1014 520 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_46130 1189 1518 gene locus_tag LOCUS_46140 1189 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 1584 2921 gene locus_tag LOCUS_46150 1584 2921 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_46150 5658 3295 gene locus_tag LOCUS_46160 gene mrcA 5658 3295 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_46160 5782 6438 gene locus_tag LOCUS_46170 5782 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 6452 7168 gene locus_tag LOCUS_46180 6452 7168 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210367.1 protein_id gnl|my_center|LOCUS_46180 7830 7165 gene locus_tag LOCUS_46190 7830 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 8228 7857 gene locus_tag LOCUS_46200 8228 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 8622 8269 gene locus_tag LOCUS_46210 8622 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 >Feature sequence286 436 1407 gene locus_tag LOCUS_46220 436 1407 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_46220 1429 2607 gene locus_tag LOCUS_46230 1429 2607 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_46230 3490 2594 gene locus_tag LOCUS_46240 3490 2594 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_46240 4189 3551 gene locus_tag LOCUS_46250 4189 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4697 4182 gene locus_tag LOCUS_46260 4697 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 7313 4704 gene locus_tag LOCUS_46270 gene bamA 7313 4704 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_46270 8100 7363 gene locus_tag LOCUS_46280 gene uppS 8100 7363 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_46280 >Feature sequence287 <1 916 gene locus_tag LOCUS_46290 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 1012 2058 gene locus_tag LOCUS_46300 1012 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 2390 2190 gene locus_tag LOCUS_46310 2390 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 3981 2908 gene locus_tag LOCUS_46320 3981 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 5414 4242 gene locus_tag LOCUS_46330 5414 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 >Feature sequence288 98 1264 gene locus_tag LOCUS_46340 98 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 1375 1614 gene locus_tag LOCUS_46350 gene rpmB 1375 1614 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_46350 1678 3111 gene locus_tag LOCUS_46360 gene pepP 1678 3111 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 protein_id gnl|my_center|LOCUS_46360 4295 5248 gene locus_tag LOCUS_46370 4295 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 5245 5475 gene locus_tag LOCUS_46380 5245 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 6228 5851 gene locus_tag LOCUS_46390 6228 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 6472 7086 gene locus_tag LOCUS_46400 6472 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 7118 7936 gene locus_tag LOCUS_46410 7118 7936 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_46410 <8518 7957 gene locus_tag LOCUS_46420 <8518 7957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918286.1:oxidoreductase >Feature sequence289 910 233 gene locus_tag LOCUS_46430 910 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 1467 1069 gene locus_tag LOCUS_46440 1467 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 2745 1873 gene locus_tag LOCUS_46450 gene brkB 2745 1873 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_46450 3165 4364 gene locus_tag LOCUS_46460 3165 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 5216 4425 gene locus_tag LOCUS_46470 5216 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 5382 6437 gene locus_tag LOCUS_46480 5382 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 6434 7195 gene locus_tag LOCUS_46490 6434 7195 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_46490 7666 7842 gene locus_tag LOCUS_46500 7666 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 7860 8033 gene locus_tag LOCUS_46510 7860 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 8080 8250 gene locus_tag LOCUS_46520 8080 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence290 2019 1435 gene locus_tag LOCUS_46530 2019 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_46530 2119 2607 gene locus_tag LOCUS_46540 2119 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_46540 2607 3437 gene locus_tag LOCUS_46550 2607 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 3406 3957 gene locus_tag LOCUS_46560 3406 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 4493 3954 gene locus_tag LOCUS_46570 4493 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_46570 4675 6219 gene locus_tag LOCUS_46580 gene glyS 4675 6219 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_46580 6452 6243 gene locus_tag LOCUS_46590 6452 6243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_46590 >Feature sequence291 524 919 gene locus_tag LOCUS_46600 524 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 933 1649 gene locus_tag LOCUS_46610 933 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_46610 1807 2451 gene locus_tag LOCUS_46620 1807 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 2517 4667 gene locus_tag LOCUS_46630 2517 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_46630 4945 5157 gene locus_tag LOCUS_46640 4945 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence292 989 1804 gene locus_tag LOCUS_46650 989 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2415 3794 gene locus_tag LOCUS_46660 2415 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 4378 4779 gene locus_tag LOCUS_46670 4378 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 5170 4832 gene locus_tag LOCUS_46680 5170 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 6096 5236 gene locus_tag LOCUS_46690 6096 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 6891 6433 gene locus_tag LOCUS_46700 6891 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 <8332 6916 gene locus_tag LOCUS_46710 <8332 6916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence293 469 846 gene locus_tag LOCUS_46720 469 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 2011 875 gene locus_tag LOCUS_46730 2011 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 2829 2188 gene locus_tag LOCUS_46740 2829 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 3313 3074 gene locus_tag LOCUS_46750 3313 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 3795 3316 gene locus_tag LOCUS_46760 3795 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 5070 3856 gene locus_tag LOCUS_46770 gene gcdH 5070 3856 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_46770 5136 6101 gene locus_tag LOCUS_46780 5136 6101 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_46780 6234 7802 gene locus_tag LOCUS_46790 6234 7802 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_46790 8158 7862 gene locus_tag LOCUS_46800 8158 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence294 5 80 gene locus_tag LOCUS_t00300 5 80 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2445 1552 gene locus_tag LOCUS_46810 2445 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 2927 4570 gene locus_tag LOCUS_46820 2927 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_46820 4675 4750 gene locus_tag LOCUS_t00310 4675 4750 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5501 5160 gene locus_tag LOCUS_46830 5501 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 5559 5867 gene locus_tag LOCUS_46840 5559 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 5920 6528 gene locus_tag LOCUS_46850 5920 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 6532 7566 gene locus_tag LOCUS_46860 6532 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_46860 <8174 7658 gene locus_tag LOCUS_46870 <8174 7658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence295 396 854 gene locus_tag LOCUS_46880 396 854 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272657.1 protein_id gnl|my_center|LOCUS_46880 1137 2480 gene locus_tag LOCUS_46890 gene xylE 1137 2480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_46890 2485 4077 gene locus_tag LOCUS_46900 2485 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 4162 6120 gene locus_tag LOCUS_46910 4162 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_46910 6235 7359 gene locus_tag LOCUS_46920 6235 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 protein_id gnl|my_center|LOCUS_46920 7765 7692 gene locus_tag LOCUS_t00320 7765 7692 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence296 363 866 gene locus_tag LOCUS_46930 363 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_46930 868 1752 gene locus_tag LOCUS_46940 868 1752 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_46940 3494 1755 gene locus_tag LOCUS_46950 3494 1755 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086547.1 protein_id gnl|my_center|LOCUS_46950 5340 3613 gene locus_tag LOCUS_46960 5340 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 7017 5413 gene locus_tag LOCUS_46970 7017 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence297 <1 1006 gene locus_tag LOCUS_46980 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YW1:beta-N-acetylhexosaminidase 2375 1269 gene locus_tag LOCUS_46990 gene smf 2375 1269 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_46990 2710 2372 gene locus_tag LOCUS_47000 2710 2372 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_47000 3791 2757 gene locus_tag LOCUS_47010 3791 2757 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 protein_id gnl|my_center|LOCUS_47010 5046 4054 gene locus_tag LOCUS_47020 5046 4054 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_47020 5161 7794 gene locus_tag LOCUS_47030 gene alaS 5161 7794 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_47030 >Feature sequence298 <1 763 gene locus_tag LOCUS_47040 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66766:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B 766 1881 gene locus_tag LOCUS_47050 766 1881 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_47050 2485 1895 gene locus_tag LOCUS_47060 2485 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 3461 2868 gene locus_tag LOCUS_47070 3461 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 4013 3540 gene locus_tag LOCUS_47080 4013 3540 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_47080 4824 4171 gene locus_tag LOCUS_47090 gene pcm 4824 4171 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_47090 4946 5533 gene locus_tag LOCUS_47100 gene ribE 4946 5533 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_47100 5530 6606 gene locus_tag LOCUS_47110 5530 6606 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 protein_id gnl|my_center|LOCUS_47110 7406 6618 gene locus_tag LOCUS_47120 7406 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 7769 7587 gene locus_tag LOCUS_47130 7769 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 >Feature sequence299 928 1584 gene locus_tag LOCUS_47140 gene lolD 928 1584 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_47140 2428 1577 gene locus_tag LOCUS_47150 2428 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 2947 2489 gene locus_tag LOCUS_47160 2947 2489 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_47160 3064 3870 gene locus_tag LOCUS_47170 3064 3870 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 protein_id gnl|my_center|LOCUS_47170 3867 4658 gene locus_tag LOCUS_47180 3867 4658 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_47180 7773 4711 gene locus_tag LOCUS_47190 7773 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 >Feature sequence300 32 766 gene locus_tag LOCUS_47200 32 766 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_47200 889 2190 gene locus_tag LOCUS_47210 889 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 2193 3188 gene locus_tag LOCUS_47220 2193 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_47220 3250 4425 gene locus_tag LOCUS_47230 3250 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 4764 5366 gene locus_tag LOCUS_47240 4764 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_47240 5818 7491 gene locus_tag LOCUS_47250 5818 7491 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A849 protein_id gnl|my_center|LOCUS_47250 >Feature sequence301 140 520 gene locus_tag LOCUS_47260 140 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 1274 525 gene locus_tag LOCUS_47270 1274 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 2702 1287 gene locus_tag LOCUS_47280 2702 1287 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_47280 4515 2713 gene locus_tag LOCUS_47290 4515 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_47290 4675 5952 gene locus_tag LOCUS_47300 4675 5952 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 protein_id gnl|my_center|LOCUS_47300 6021 6341 gene locus_tag LOCUS_47310 6021 6341 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_47310 6350 6835 gene locus_tag LOCUS_47320 6350 6835 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898141.1 protein_id gnl|my_center|LOCUS_47320 6838 7230 gene locus_tag LOCUS_47330 6838 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 >Feature sequence302 218 4705 gene locus_tag LOCUS_47340 218 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 4866 5558 gene locus_tag LOCUS_47350 4866 5558 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_47350 5568 6260 gene locus_tag LOCUS_47360 5568 6260 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_47360 6363 6773 gene locus_tag LOCUS_47370 6363 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 6901 7350 gene locus_tag LOCUS_47380 6901 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 >Feature sequence303 436 2505 gene locus_tag LOCUS_47390 436 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_47390 2508 3647 gene locus_tag LOCUS_47400 2508 3647 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966347.1 protein_id gnl|my_center|LOCUS_47400 4216 3719 gene locus_tag LOCUS_47410 gene tpx 4216 3719 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_47410 4308 4532 gene locus_tag LOCUS_47420 4308 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 4687 6078 gene locus_tag LOCUS_47430 4687 6078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 protein_id gnl|my_center|LOCUS_47430 7293 6235 gene locus_tag LOCUS_47440 7293 6235 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence304 3888 1495 gene locus_tag LOCUS_47450 3888 1495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_47450 6292 3893 gene locus_tag LOCUS_47460 6292 3893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_47460 <7756 6312 gene locus_tag LOCUS_47470 <7756 6312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence305 580 2034 gene locus_tag LOCUS_47480 580 2034 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_47480 2841 2035 gene locus_tag LOCUS_47490 2841 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 3589 2831 gene locus_tag LOCUS_47500 gene lpxH 3589 2831 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_47500 5747 3678 gene locus_tag LOCUS_47510 gene ftsH 5747 3678 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_47510 6174 5818 gene locus_tag LOCUS_47520 gene rsfS 6174 5818 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_47520 6282 6989 gene locus_tag LOCUS_47530 6282 6989 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_47530 >Feature sequence306 648 400 gene locus_tag LOCUS_47540 648 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 1086 652 gene locus_tag LOCUS_47550 1086 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 2420 1092 gene locus_tag LOCUS_47560 2420 1092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_47560 5592 2425 gene locus_tag LOCUS_47570 5592 2425 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_47570 6712 5600 gene locus_tag LOCUS_47580 6712 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 7430 6813 gene locus_tag LOCUS_47590 7430 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence307 <1 1182 gene locus_tag LOCUS_47600 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 2506 1244 gene locus_tag LOCUS_47610 2506 1244 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067008.1 protein_id gnl|my_center|LOCUS_47610 3726 2599 gene locus_tag LOCUS_47620 3726 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 5487 4270 gene locus_tag LOCUS_47630 5487 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086615.1 protein_id gnl|my_center|LOCUS_47630 5994 5554 gene locus_tag LOCUS_47640 5994 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence308 208 1539 gene locus_tag LOCUS_47650 208 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_47650 2853 1849 gene locus_tag LOCUS_47660 2853 1849 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_47660 3255 3917 gene locus_tag LOCUS_47670 3255 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 4790 4416 gene locus_tag LOCUS_47680 4790 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 6758 5019 gene locus_tag LOCUS_47690 6758 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 >Feature sequence309 <1 703 gene locus_tag LOCUS_47700 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799138.1:serine protease 718 1371 gene locus_tag LOCUS_47710 gene rpe 718 1371 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_47710 1677 1372 gene locus_tag LOCUS_47720 1677 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 1878 2345 gene locus_tag LOCUS_47730 1878 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 2458 3621 gene locus_tag LOCUS_47740 2458 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 3710 6247 gene locus_tag LOCUS_47750 gene gyrA 3710 6247 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_47750 6269 7465 gene locus_tag LOCUS_47760 6269 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_47760 >Feature sequence310 673 191 gene locus_tag LOCUS_47770 673 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 995 675 gene locus_tag LOCUS_47780 995 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 1467 1084 gene locus_tag LOCUS_47790 1467 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 <7535 1460 gene locus_tag LOCUS_47800 <7535 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108535.1:cell wall-associated protein >Feature sequence311 <1 1356 gene locus_tag LOCUS_47810 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein 6943 1442 gene locus_tag LOCUS_47820 6943 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 >Feature sequence312 1082 759 gene locus_tag LOCUS_47830 1082 759 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_47830 1097 1735 gene locus_tag LOCUS_47840 1097 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 2383 1829 gene locus_tag LOCUS_47850 2383 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 2684 3727 gene locus_tag LOCUS_47860 2684 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 6020 4830 gene locus_tag LOCUS_47870 6020 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 6867 6058 gene locus_tag LOCUS_47880 6867 6058 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_47880 >Feature sequence313 1741 4245 gene locus_tag LOCUS_47890 1741 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 5567 4332 gene locus_tag LOCUS_47900 5567 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 6299 5787 gene locus_tag LOCUS_47910 6299 5787 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606654.1 protein_id gnl|my_center|LOCUS_47910 >Feature sequence314 179 30 gene locus_tag LOCUS_47920 179 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 363 3461 gene locus_tag LOCUS_47930 363 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_47930 4837 4160 gene locus_tag LOCUS_47940 4837 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5093 5422 gene locus_tag LOCUS_47950 5093 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 >Feature sequence315 44 547 gene locus_tag LOCUS_47960 44 547 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_47960 950 597 gene locus_tag LOCUS_47970 950 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 1108 2472 gene locus_tag LOCUS_47980 gene hisS 1108 2472 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_47980 2677 4347 gene locus_tag LOCUS_47990 2677 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 4370 4702 gene locus_tag LOCUS_48000 4370 4702 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_48000 4702 5709 gene locus_tag LOCUS_48010 4702 5709 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_48010 5924 5706 gene locus_tag LOCUS_48020 5924 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_48020 >Feature sequence316 551 1999 gene locus_tag LOCUS_48030 551 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_48030 2142 3062 gene locus_tag LOCUS_48040 2142 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 3159 4013 gene locus_tag LOCUS_48050 3159 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 4851 4018 gene locus_tag LOCUS_48060 4851 4018 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_48060 5801 5370 gene locus_tag LOCUS_48070 5801 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 6042 6623 gene locus_tag LOCUS_48080 6042 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 6613 6900 gene locus_tag LOCUS_48090 6613 6900 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_48090 >Feature sequence317 2295 2035 gene locus_tag LOCUS_48100 2295 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 3071 2553 gene locus_tag LOCUS_48110 3071 2553 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023850.1 protein_id gnl|my_center|LOCUS_48110 4006 3152 gene locus_tag LOCUS_48120 4006 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 4956 4006 gene locus_tag LOCUS_48130 gene ftsY 4956 4006 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_48130 5201 5046 gene locus_tag LOCUS_48140 5201 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 5386 5204 gene locus_tag LOCUS_48150 gene rpmG 5386 5204 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 protein_id gnl|my_center|LOCUS_48150 6735 5971 gene locus_tag LOCUS_48160 6735 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 >Feature sequence318 288 1592 gene locus_tag LOCUS_48170 288 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 2044 1586 gene locus_tag LOCUS_48180 2044 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 2427 2822 gene locus_tag LOCUS_48190 2427 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 2929 4392 gene locus_tag LOCUS_48200 2929 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 4424 4927 gene locus_tag LOCUS_48210 4424 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 4947 5492 gene locus_tag LOCUS_48220 4947 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 5665 6189 gene locus_tag LOCUS_48230 5665 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 >Feature sequence319 <1 676 gene locus_tag LOCUS_48240 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KE72:peptide chain release factor 3 2602 695 gene locus_tag LOCUS_48250 2602 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 2683 3405 gene locus_tag LOCUS_48260 2683 3405 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_48260 3548 4876 gene locus_tag LOCUS_48270 3548 4876 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_48270 4915 5613 gene locus_tag LOCUS_48280 4915 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 6198 5614 gene locus_tag LOCUS_48290 6198 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 6558 6310 gene locus_tag LOCUS_48300 6558 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 <7073 6570 gene locus_tag LOCUS_48310 <7073 6570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta >Feature sequence320 1473 268 gene locus_tag LOCUS_48320 1473 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 4079 1686 gene locus_tag LOCUS_48330 4079 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 4244 5167 gene locus_tag LOCUS_48340 4244 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 >Feature sequence321 1260 571 gene locus_tag LOCUS_48350 1260 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 1943 1257 gene locus_tag LOCUS_48360 1943 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 2278 1940 gene locus_tag LOCUS_48370 gene ywzG 2278 1940 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_48370 2461 3018 gene locus_tag LOCUS_48380 2461 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 3100 3810 gene locus_tag LOCUS_48390 3100 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 3894 4331 gene locus_tag LOCUS_48400 3894 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 5051 4491 gene locus_tag LOCUS_48410 gene pth 5051 4491 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_48410 5843 5250 gene locus_tag LOCUS_48420 gene rplY 5843 5250 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_48420 6786 5854 gene locus_tag LOCUS_48430 gene prsA 6786 5854 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_48430 >Feature sequence322 823 1386 gene locus_tag LOCUS_48440 823 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 1390 2382 gene locus_tag LOCUS_48450 1390 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 2409 3008 gene locus_tag LOCUS_48460 2409 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 2992 3912 gene locus_tag LOCUS_48470 2992 3912 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_48470 3915 4757 gene locus_tag LOCUS_48480 3915 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 5771 4809 gene locus_tag LOCUS_48490 5771 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 6356 5976 gene locus_tag LOCUS_48500 6356 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 >Feature sequence323 1168 395 gene locus_tag LOCUS_48510 gene sdhB 1168 395 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_48510 3204 1195 gene locus_tag LOCUS_48520 gene sdhA 3204 1195 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_48520 3829 3206 gene locus_tag LOCUS_48530 gene sdhC 3829 3206 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_48530 >Feature sequence324 <1 1796 gene locus_tag LOCUS_48540 <1 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein 1797 3116 gene locus_tag LOCUS_48550 1797 3116 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 protein_id gnl|my_center|LOCUS_48550 3274 3630 gene locus_tag LOCUS_48560 3274 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 3576 3830 gene locus_tag LOCUS_48570 3576 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 3827 4516 gene locus_tag LOCUS_48580 3827 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4567 6846 gene locus_tag LOCUS_48590 4567 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence325 >Feature sequence326 515 826 gene locus_tag LOCUS_48600 515 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 1113 1736 gene locus_tag LOCUS_48610 1113 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 2721 1834 gene locus_tag LOCUS_48620 2721 1834 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_48620 2781 3902 gene locus_tag LOCUS_48630 gene gfo 2781 3902 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_48630 4275 3916 gene locus_tag LOCUS_48640 4275 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 4372 4217 gene locus_tag LOCUS_48650 4372 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 4416 5081 gene locus_tag LOCUS_48660 4416 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 5087 5485 gene locus_tag LOCUS_48670 5087 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 <6844 5916 gene locus_tag LOCUS_48680 <6844 5916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KBZ2:phosphoenolpyruvate carboxylase >Feature sequence327 420 608 gene locus_tag LOCUS_48690 420 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 986 1177 gene locus_tag LOCUS_48700 986 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 1262 1453 gene locus_tag LOCUS_48710 1262 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 1735 1926 gene locus_tag LOCUS_48720 1735 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 2471 1947 gene locus_tag LOCUS_48730 2471 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 4636 2474 gene locus_tag LOCUS_48740 4636 2474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_48740 6314 4689 gene locus_tag LOCUS_48750 6314 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 >Feature sequence328 2284 998 gene locus_tag LOCUS_48760 2284 998 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_48760 2794 4134 gene locus_tag LOCUS_48770 gene amt-2 2794 4134 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_48770 4272 5303 gene locus_tag LOCUS_48780 4272 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 5347 6375 gene locus_tag LOCUS_48790 gene glnII 5347 6375 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_48790 >Feature sequence329 <1 1878 gene locus_tag LOCUS_48800 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 2595 3779 gene locus_tag LOCUS_48810 2595 3779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_48810 3873 5597 gene locus_tag LOCUS_48820 3873 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 6249 5692 gene locus_tag LOCUS_48830 gene ppiA 6249 5692 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH4 protein_id gnl|my_center|LOCUS_48830 >Feature sequence330 <1 2090 gene locus_tag LOCUS_48840 <1 2090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase 3188 2139 gene locus_tag LOCUS_48850 3188 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 4146 3472 gene locus_tag LOCUS_48860 4146 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 5103 4495 gene locus_tag LOCUS_48870 5103 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 5591 5163 gene locus_tag LOCUS_48880 5591 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 6384 5773 gene locus_tag LOCUS_48890 6384 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 >Feature sequence331 <1 1197 gene locus_tag LOCUS_48900 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease 2282 1266 gene locus_tag LOCUS_48910 gene recA 2282 1266 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_48910 2392 3426 gene locus_tag LOCUS_48920 2392 3426 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_48920 3498 4277 gene locus_tag LOCUS_48930 3498 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_48930 4362 5054 gene locus_tag LOCUS_48940 gene phoP 4362 5054 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_48940 5058 6134 gene locus_tag LOCUS_48950 5058 6134 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403627.1 protein_id gnl|my_center|LOCUS_48950 >Feature sequence332 1403 2194 gene locus_tag LOCUS_48960 1403 2194 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109883.1 protein_id gnl|my_center|LOCUS_48960 2204 3310 gene locus_tag LOCUS_48970 2204 3310 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_48970 3311 4540 gene locus_tag LOCUS_48980 3311 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 5326 4856 gene locus_tag LOCUS_48990 5326 4856 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_48990 >Feature sequence333 1860 1180 gene locus_tag LOCUS_49000 1860 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 2020 3339 gene locus_tag LOCUS_49010 2020 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 3433 4581 gene locus_tag LOCUS_49020 3433 4581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_49020 4671 5351 gene locus_tag LOCUS_49030 4671 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108665.1 protein_id gnl|my_center|LOCUS_49030 5489 6385 gene locus_tag LOCUS_49040 5489 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_49040 >Feature sequence334 <1 1427 gene locus_tag LOCUS_49050 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 1553 4396 gene locus_tag LOCUS_49060 1553 4396 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_49060 5197 4460 gene locus_tag LOCUS_49070 5197 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 5980 5330 gene locus_tag LOCUS_49080 5980 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 >Feature sequence335 924 2135 gene locus_tag LOCUS_49090 924 2135 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141933.1 protein_id gnl|my_center|LOCUS_49090 2864 2136 gene locus_tag LOCUS_49100 2864 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 4983 2881 gene locus_tag LOCUS_49110 4983 2881 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_49110 6280 4985 gene locus_tag LOCUS_49120 6280 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_49120 >Feature sequence336 1906 2253 gene locus_tag LOCUS_49130 1906 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 2647 2922 gene locus_tag LOCUS_49140 2647 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 2913 3287 gene locus_tag LOCUS_49150 2913 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 3688 3374 gene locus_tag LOCUS_49160 3688 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 3785 4552 gene locus_tag LOCUS_49170 3785 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 4559 5353 gene locus_tag LOCUS_49180 4559 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 <6477 5350 gene locus_tag LOCUS_49190 <6477 5350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:coproporphyrinogen III oxidase >Feature sequence337 1 741 gene locus_tag LOCUS_49200 1 741 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_49200 1416 751 gene locus_tag LOCUS_49210 1416 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_49210 2033 1455 gene locus_tag LOCUS_49220 2033 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_49220 3967 2141 gene locus_tag LOCUS_49230 3967 2141 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_49230 5324 4101 gene locus_tag LOCUS_49240 gene aroA 5324 4101 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_49240 6361 5321 gene locus_tag LOCUS_49250 gene aroB 6361 5321 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_49250 >Feature sequence338 264 437 gene locus_tag LOCUS_49260 264 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 646 867 gene locus_tag LOCUS_49270 646 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 915 1085 gene locus_tag LOCUS_49280 915 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 1279 2496 gene locus_tag LOCUS_49290 1279 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 2509 4326 gene locus_tag LOCUS_49300 2509 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 4334 6151 gene locus_tag LOCUS_49310 4334 6151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_49310 >Feature sequence339 518 57 gene locus_tag LOCUS_49320 518 57 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_49320 1134 520 gene locus_tag LOCUS_49330 1134 520 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_49330 1548 1186 gene locus_tag LOCUS_49340 1548 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 2364 1570 gene locus_tag LOCUS_49350 2364 1570 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_49350 2640 2552 gene locus_tag LOCUS_t00330 2640 2552 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3792 2731 gene locus_tag LOCUS_49360 gene ansA 3792 2731 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_49360 4552 3770 gene locus_tag LOCUS_49370 gene tatD 4552 3770 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_49370 5664 4558 gene locus_tag LOCUS_49380 5664 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 6281 5661 gene locus_tag LOCUS_49390 6281 5661 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_49390 >Feature sequence340 1304 1960 gene locus_tag LOCUS_49400 1304 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 2382 1969 gene locus_tag LOCUS_49410 2382 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 3461 3093 gene locus_tag LOCUS_49420 3461 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 3624 3454 gene locus_tag LOCUS_49430 3624 3454 CDS product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_49430 3773 3627 gene locus_tag LOCUS_49440 3773 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 4625 3777 gene locus_tag LOCUS_49450 4625 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_49450 4774 5883 gene locus_tag LOCUS_49460 4774 5883 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 protein_id gnl|my_center|LOCUS_49460 >Feature sequence341 2279 951 gene locus_tag LOCUS_49470 gene xylA 2279 951 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_49470 3780 2290 gene locus_tag LOCUS_49480 3780 2290 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_49480 <6400 3836 gene locus_tag LOCUS_49490 <6400 3836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933192.1:Rab family protein >Feature sequence342 142 729 gene locus_tag LOCUS_49500 gene gmhA 142 729 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP02 protein_id gnl|my_center|LOCUS_49500 719 2260 gene locus_tag LOCUS_49510 719 2260 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_49510 2709 2347 gene locus_tag LOCUS_49520 2709 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 2825 3430 gene locus_tag LOCUS_49530 2825 3430 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_49530 3427 3810 gene locus_tag LOCUS_49540 3427 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 3897 4616 gene locus_tag LOCUS_49550 3897 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 5249 4605 gene locus_tag LOCUS_49560 5249 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 5332 6051 gene locus_tag LOCUS_49570 5332 6051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_49570 >Feature sequence343 1113 2099 gene locus_tag LOCUS_49580 1113 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 2122 3456 gene locus_tag LOCUS_49590 2122 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 3468 4640 gene locus_tag LOCUS_49600 3468 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 5142 5975 gene locus_tag LOCUS_49610 5142 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 >Feature sequence344 1958 705 gene locus_tag LOCUS_49620 1958 705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_49620 3464 2214 gene locus_tag LOCUS_49630 3464 2214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_49630 4049 5425 gene locus_tag LOCUS_49640 4049 5425 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_49640 >Feature sequence345 <1 1356 gene locus_tag LOCUS_49650 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865056.1:KamA family radical SAM protein 1622 4237 gene locus_tag LOCUS_49660 1622 4237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_49660 >Feature sequence346 836 1735 gene locus_tag LOCUS_49670 836 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 2645 1770 gene locus_tag LOCUS_49680 gene modC 2645 1770 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_49680 3313 2642 gene locus_tag LOCUS_49690 3313 2642 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_49690 3711 3313 gene locus_tag LOCUS_49700 3711 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 4475 3708 gene locus_tag LOCUS_49710 gene modA 4475 3708 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_49710 4721 5077 gene locus_tag LOCUS_49720 4721 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 >Feature sequence347 785 132 gene locus_tag LOCUS_49730 785 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 1032 3044 gene locus_tag LOCUS_49740 1032 3044 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_49740 3632 3084 gene locus_tag LOCUS_49750 3632 3084 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_49750 3936 3715 gene locus_tag LOCUS_49760 3936 3715 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_49760 4057 4299 gene locus_tag LOCUS_49770 4057 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 >Feature sequence348 843 2981 gene locus_tag LOCUS_49780 843 2981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_49780 2984 4303 gene locus_tag LOCUS_49790 2984 4303 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 protein_id gnl|my_center|LOCUS_49790 5985 4306 gene locus_tag LOCUS_49800 5985 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 >Feature sequence349 448 1218 gene locus_tag LOCUS_49810 448 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 1553 1888 gene locus_tag LOCUS_49820 1553 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423827.1 protein_id gnl|my_center|LOCUS_49820 1924 2952 gene locus_tag LOCUS_49830 1924 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 2972 3568 gene locus_tag LOCUS_49840 2972 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 3624 3854 gene locus_tag LOCUS_49850 3624 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 3874 4143 gene locus_tag LOCUS_49860 3874 4143 CDS product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 protein_id gnl|my_center|LOCUS_49860 4201 4467 gene locus_tag LOCUS_49870 4201 4467 CDS product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 protein_id gnl|my_center|LOCUS_49870 4881 5150 gene locus_tag LOCUS_49880 4881 5150 CDS product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423837.1 protein_id gnl|my_center|LOCUS_49880 5256 5525 gene locus_tag LOCUS_49890 5256 5525 CDS product RebB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 protein_id gnl|my_center|LOCUS_49890 5579 5845 gene locus_tag LOCUS_49900 5579 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 >Feature sequence350 5961 6134 gene locus_tag LOCUS_49910 5961 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 >Feature sequence351 2356 1295 gene locus_tag LOCUS_49920 2356 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 >Feature sequence352 2249 3592 gene locus_tag LOCUS_49930 2249 3592 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFT0 protein_id gnl|my_center|LOCUS_49930 3838 5085 gene locus_tag LOCUS_49940 3838 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 >Feature sequence353 1151 1603 gene locus_tag LOCUS_49950 1151 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 3128 1830 gene locus_tag LOCUS_49960 3128 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 3486 3142 gene locus_tag LOCUS_49970 3486 3142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_49970 4282 3620 gene locus_tag LOCUS_49980 4282 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence354 1108 500 gene locus_tag LOCUS_49990 1108 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 1641 1189 gene locus_tag LOCUS_50000 1641 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 2814 1759 gene locus_tag LOCUS_50010 2814 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 4087 3101 gene locus_tag LOCUS_50020 4087 3101 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083422.1 protein_id gnl|my_center|LOCUS_50020 4698 4180 gene locus_tag LOCUS_50030 4698 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 5868 4711 gene locus_tag LOCUS_50040 5868 4711 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_50040 >Feature sequence355 1230 700 gene locus_tag LOCUS_50050 1230 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 2376 1312 gene locus_tag LOCUS_50060 2376 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918754.1 protein_id gnl|my_center|LOCUS_50060 3845 2853 gene locus_tag LOCUS_50070 3845 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 5488 4133 gene locus_tag LOCUS_50080 5488 4133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_50080 <6050 5551 gene locus_tag LOCUS_50090 <6050 5551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107494.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence356 <1 561 gene locus_tag LOCUS_50100 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase 773 1555 gene locus_tag LOCUS_50110 773 1555 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035626.1 protein_id gnl|my_center|LOCUS_50110 1558 2619 gene locus_tag LOCUS_50120 1558 2619 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_50120 3572 2607 gene locus_tag LOCUS_50130 gene hemB 3572 2607 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_50130 3796 3599 gene locus_tag LOCUS_50140 3796 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 4040 3831 gene locus_tag LOCUS_50150 4040 3831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_50150 4671 4042 gene locus_tag LOCUS_50160 4671 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 >Feature sequence357 1272 184 gene locus_tag LOCUS_50170 1272 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 2447 1407 gene locus_tag LOCUS_50180 gene cya2 2447 1407 CDS product adenylate cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52915 protein_id gnl|my_center|LOCUS_50180 3136 2444 gene locus_tag LOCUS_50190 3136 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962246.1 protein_id gnl|my_center|LOCUS_50190 <6047 3129 gene locus_tag LOCUS_50200 <6047 3129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:multidrug transporter AcrB >Feature sequence358 1789 359 gene locus_tag LOCUS_50210 1789 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141302.1 protein_id gnl|my_center|LOCUS_50210 3202 1796 gene locus_tag LOCUS_50220 3202 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_50220 3911 3213 gene locus_tag LOCUS_50230 3911 3213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_50230 4501 4073 gene locus_tag LOCUS_50240 4501 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 5754 4555 gene locus_tag LOCUS_50250 5754 4555 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258650.1 protein_id gnl|my_center|LOCUS_50250 >Feature sequence359 776 141 gene locus_tag LOCUS_50260 776 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 1277 798 gene locus_tag LOCUS_50270 1277 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 2368 1274 gene locus_tag LOCUS_50280 2368 1274 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_50280 3969 2416 gene locus_tag LOCUS_50290 gene gltB2 3969 2416 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_50290 5678 4101 gene locus_tag LOCUS_50300 5678 4101 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_50300 >Feature sequence360 3108 2284 gene locus_tag LOCUS_50310 3108 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 3995 3105 gene locus_tag LOCUS_50320 3995 3105 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_50320 4195 5253 gene locus_tag LOCUS_50330 4195 5253 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_50330 >Feature sequence361 3 242 gene locus_tag LOCUS_50340 3 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 431 1099 gene locus_tag LOCUS_50350 431 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 1342 1112 gene locus_tag LOCUS_50360 1342 1112 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_50360 1685 2260 gene locus_tag LOCUS_50370 1685 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 2335 3228 gene locus_tag LOCUS_50380 2335 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 3221 4060 gene locus_tag LOCUS_50390 3221 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_50390 >Feature sequence362 462 1613 gene locus_tag LOCUS_50400 462 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_50400 3707 1638 gene locus_tag LOCUS_50410 3707 1638 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_50410 5598 3760 gene locus_tag LOCUS_50420 5598 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 >Feature sequence363 891 3182 gene locus_tag LOCUS_50430 891 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 3583 3191 gene locus_tag LOCUS_50440 3583 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 4680 3709 gene locus_tag LOCUS_50450 4680 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 >Feature sequence364 1188 562 gene locus_tag LOCUS_50460 1188 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 1246 1671 gene locus_tag LOCUS_50470 1246 1671 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_50470 1668 2897 gene locus_tag LOCUS_50480 1668 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_50480 2894 4585 gene locus_tag LOCUS_50490 gene menD 2894 4585 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_50490 >Feature sequence365 2553 40 gene locus_tag LOCUS_50500 gene priA 2553 40 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A451 protein_id gnl|my_center|LOCUS_50500 4711 2684 gene locus_tag LOCUS_50510 gene yyaL 4711 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 protein_id gnl|my_center|LOCUS_50510 5690 4713 gene locus_tag LOCUS_50520 5690 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_50520 >Feature sequence366 <1 947 gene locus_tag LOCUS_50530 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868529.1:MATE family efflux transporter 1004 1732 gene locus_tag LOCUS_50540 1004 1732 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109262.1 protein_id gnl|my_center|LOCUS_50540 1744 2160 gene locus_tag LOCUS_50550 1744 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 2157 2933 gene locus_tag LOCUS_50560 gene truA2 2157 2933 CDS product tRNA pseudouridine synthase A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813Z9 protein_id gnl|my_center|LOCUS_50560 3016 3498 gene locus_tag LOCUS_50570 3016 3498 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_50570 3485 3952 gene locus_tag LOCUS_50580 3485 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3952 4518 gene locus_tag LOCUS_50590 3952 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 <5714 4513 gene locus_tag LOCUS_50600 <5714 4513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001253926.1:C4-dicarboxylate transporter >Feature sequence367 422 658 gene locus_tag LOCUS_50610 422 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 2243 819 gene locus_tag LOCUS_50620 2243 819 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_50620 3557 2319 gene locus_tag LOCUS_50630 3557 2319 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_50630 3710 5005 gene locus_tag LOCUS_50640 3710 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 5497 5012 gene locus_tag LOCUS_50650 5497 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 >Feature sequence368 132 1181 gene locus_tag LOCUS_50660 gene hisC 132 1181 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_50660 1178 2278 gene locus_tag LOCUS_50670 gene hisB 1178 2278 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_50670 2812 2426 gene locus_tag LOCUS_50680 2812 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 3022 3939 gene locus_tag LOCUS_50690 3022 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 4073 4396 gene locus_tag LOCUS_50700 gene ywzG 4073 4396 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_50700 >Feature sequence369 <1 528 gene locus_tag LOCUS_50710 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087972.1:enoyl-CoA hydratase 550 1017 gene locus_tag LOCUS_50720 550 1017 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_50720 1095 1538 gene locus_tag LOCUS_50730 1095 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 4272 1591 gene locus_tag LOCUS_50740 4272 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 4637 4278 gene locus_tag LOCUS_50750 4637 4278 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_50750 5129 5503 gene locus_tag LOCUS_50760 5129 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 >Feature sequence370 1653 2540 gene locus_tag LOCUS_50770 1653 2540 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence371 430 1011 gene locus_tag LOCUS_50780 430 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 1464 1135 gene locus_tag LOCUS_50790 1464 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 1690 2628 gene locus_tag LOCUS_50800 1690 2628 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889034.1 protein_id gnl|my_center|LOCUS_50800 2713 3276 gene locus_tag LOCUS_50810 2713 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 3432 3950 gene locus_tag LOCUS_50820 3432 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 3984 4223 gene locus_tag LOCUS_50830 3984 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 4298 5416 gene locus_tag LOCUS_50840 4298 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 >Feature sequence372 242 1525 gene locus_tag LOCUS_50850 242 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 1662 2615 gene locus_tag LOCUS_50860 1662 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 2867 3199 gene locus_tag LOCUS_50870 2867 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 3304 5361 gene locus_tag LOCUS_50880 3304 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 >Feature sequence373 4999 2291 gene locus_tag LOCUS_50890 4999 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 >Feature sequence374 752 588 gene locus_tag LOCUS_50900 752 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 1193 1756 gene locus_tag LOCUS_50910 1193 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 1811 2407 gene locus_tag LOCUS_50920 1811 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 2445 3122 gene locus_tag LOCUS_50930 2445 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 3275 3634 gene locus_tag LOCUS_50940 3275 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 4727 3837 gene locus_tag LOCUS_50950 4727 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 5009 5278 gene locus_tag LOCUS_50960 5009 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 >Feature sequence375 1213 2322 gene locus_tag LOCUS_50970 1213 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 2561 2379 gene locus_tag LOCUS_50980 2561 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 2878 2597 gene locus_tag LOCUS_50990 2878 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 2968 3192 gene locus_tag LOCUS_51000 2968 3192 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_51000 3300 3524 gene locus_tag LOCUS_51010 3300 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 4618 3659 gene locus_tag LOCUS_51020 4618 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 4884 5248 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgatgtcgaatgctgatcttgaagact >Feature sequence376 1407 1111 gene locus_tag LOCUS_51030 1407 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 2725 1409 gene locus_tag LOCUS_51040 2725 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_51040 4183 2915 gene locus_tag LOCUS_51050 4183 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 <5247 4265 gene locus_tag LOCUS_51060 <5247 4265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase >Feature sequence377 1003 731 gene locus_tag LOCUS_51070 1003 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 1629 1021 gene locus_tag LOCUS_51080 1629 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 2912 1785 gene locus_tag LOCUS_51090 gene hppD 2912 1785 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_51090 3483 3004 gene locus_tag LOCUS_51100 3483 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 4455 3565 gene locus_tag LOCUS_51110 4455 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence378 848 2086 gene locus_tag LOCUS_51120 848 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 2083 2514 gene locus_tag LOCUS_51130 2083 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 3001 2516 gene locus_tag LOCUS_51140 3001 2516 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_51140 4056 3028 gene locus_tag LOCUS_51150 gene ribD 4056 3028 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEE2 protein_id gnl|my_center|LOCUS_51150 4107 4958 gene locus_tag LOCUS_51160 gene prmC 4107 4958 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_51160 >Feature sequence379 <1 1255 gene locus_tag LOCUS_51170 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889715.1:peptidase M23 1577 1332 gene locus_tag LOCUS_51180 gene rpmE2 1577 1332 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_51180 1740 3401 gene locus_tag LOCUS_51190 1740 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 >Feature sequence380 496 2580 gene locus_tag LOCUS_51200 496 2580 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_51200 2643 2915 gene locus_tag LOCUS_51210 2643 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 2918 3610 gene locus_tag LOCUS_51220 2918 3610 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143374.1 protein_id gnl|my_center|LOCUS_51220 3614 3844 gene locus_tag LOCUS_51230 3614 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 3844 4515 gene locus_tag LOCUS_51240 gene rsmI 3844 4515 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_51240 <5200 4516 gene locus_tag LOCUS_51250 <5200 4516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A1G3:cysteine desulfurase >Feature sequence381 1396 641 gene locus_tag LOCUS_51260 1396 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 3232 1499 gene locus_tag LOCUS_51270 3232 1499 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_51270 3560 4369 gene locus_tag LOCUS_51280 3560 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 <5199 4455 gene locus_tag LOCUS_51290 <5199 4455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:isoquinoline 1-oxidoreductase subunit beta >Feature sequence382 2224 953 gene locus_tag LOCUS_51300 2224 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 2589 3557 gene locus_tag LOCUS_51310 2589 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 4609 3614 gene locus_tag LOCUS_51320 4609 3614 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_51320 4927 4643 gene locus_tag LOCUS_51330 4927 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 >Feature sequence383 484 1659 gene locus_tag LOCUS_51340 484 1659 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_51340 1781 2932 gene locus_tag LOCUS_51350 1781 2932 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_51350 2974 4233 gene locus_tag LOCUS_51360 2974 4233 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_51360 4230 5042 gene locus_tag LOCUS_51370 4230 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 >Feature sequence384 855 1346 gene locus_tag LOCUS_51380 855 1346 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_51380 1336 2217 gene locus_tag LOCUS_51390 1336 2217 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_51390 2278 4710 gene locus_tag LOCUS_51400 2278 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 >Feature sequence385 161 469 gene locus_tag LOCUS_51410 161 469 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_51410 648 1904 gene locus_tag LOCUS_51420 648 1904 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_51420 1930 3150 gene locus_tag LOCUS_51430 gene porY 1930 3150 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_51430 3618 3965 gene locus_tag LOCUS_51440 3618 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 >Feature sequence386 1401 1913 gene locus_tag LOCUS_51450 1401 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 1917 3146 gene locus_tag LOCUS_51460 gene amaB 1917 3146 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930602.1 protein_id gnl|my_center|LOCUS_51460 3152 4042 gene locus_tag LOCUS_51470 3152 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 >Feature sequence387 483 67 gene locus_tag LOCUS_51480 gene yqiW 483 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_51480 854 528 gene locus_tag LOCUS_51490 854 528 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_51490 1288 851 gene locus_tag LOCUS_51500 gene sufE 1288 851 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_51500 2532 1291 gene locus_tag LOCUS_51510 gene sufS 2532 1291 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_51510 3859 2534 gene locus_tag LOCUS_51520 gene sufD 3859 2534 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_51520 4622 3864 gene locus_tag LOCUS_51530 gene sufC 4622 3864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_51530 >Feature sequence388 1460 198 gene locus_tag LOCUS_51540 1460 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 2141 1587 gene locus_tag LOCUS_51550 2141 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 2702 3265 gene locus_tag LOCUS_51560 2702 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 3290 4507 gene locus_tag LOCUS_51570 gene dinB 3290 4507 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_51570 4614 4976 gene locus_tag LOCUS_51580 4614 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 >Feature sequence389 491 1744 gene locus_tag LOCUS_51590 491 1744 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728377.1 protein_id gnl|my_center|LOCUS_51590 1899 3284 gene locus_tag LOCUS_51600 1899 3284 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_51600 <5018 3624 gene locus_tag LOCUS_51610 <5018 3624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257647.1:two-component sensor histidine kinase >Feature sequence390 <1 1138 gene locus_tag LOCUS_51620 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MP7:methionine--tRNA ligase 1454 2050 gene locus_tag LOCUS_51630 1454 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_51630 2051 3052 gene locus_tag LOCUS_51640 2051 3052 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_51640 3056 4285 gene locus_tag LOCUS_51650 3056 4285 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_51650 4979 4293 gene locus_tag LOCUS_51660 4979 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 >Feature sequence391 2516 327 gene locus_tag LOCUS_51670 2516 327 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_51670 3927 2650 gene locus_tag LOCUS_51680 gene rocD 3927 2650 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_51680 4332 4694 gene locus_tag LOCUS_51690 4332 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 >Feature sequence392 1076 492 gene locus_tag LOCUS_51700 1076 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 1952 1149 gene locus_tag LOCUS_51710 1952 1149 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_51710 2896 1973 gene locus_tag LOCUS_51720 gene rsgA2 2896 1973 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_51720 4205 2877 gene locus_tag LOCUS_51730 4205 2877 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_51730 >Feature sequence393 1073 342 gene locus_tag LOCUS_51740 1073 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 2227 1463 gene locus_tag LOCUS_51750 2227 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 3482 2340 gene locus_tag LOCUS_51760 3482 2340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529200.1 protein_id gnl|my_center|LOCUS_51760 3898 3479 gene locus_tag LOCUS_51770 3898 3479 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481479.1 protein_id gnl|my_center|LOCUS_51770 4045 4878 gene locus_tag LOCUS_51780 4045 4878 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269240.1 protein_id gnl|my_center|LOCUS_51780 >Feature sequence394 181 1227 gene locus_tag LOCUS_51790 gene queA 181 1227 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_51790 1301 1972 gene locus_tag LOCUS_51800 gene ispD 1301 1972 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_51800 2020 2802 gene locus_tag LOCUS_51810 2020 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_51810 2890 4122 gene locus_tag LOCUS_51820 gene yegT 2890 4122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_51820 >Feature sequence395 88 993 gene locus_tag LOCUS_51830 88 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 1011 1820 gene locus_tag LOCUS_51840 1011 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 1817 2389 gene locus_tag LOCUS_51850 1817 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 2386 3177 gene locus_tag LOCUS_51860 2386 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 3195 3719 gene locus_tag LOCUS_51870 3195 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 >Feature sequence396 2952 4298 gene locus_tag LOCUS_51880 2952 4298 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_51880 >Feature sequence397 <1 1058 gene locus_tag LOCUS_51890 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943764.1:3-deoxy-7-phosphoheptulonate synthase 1831 1115 gene locus_tag LOCUS_51900 1831 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 2542 2123 gene locus_tag LOCUS_51910 2542 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 3434 2616 gene locus_tag LOCUS_51920 3434 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 4018 4596 gene locus_tag LOCUS_51930 4018 4596 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109260.1 protein_id gnl|my_center|LOCUS_51930 >Feature sequence398 829 3198 gene locus_tag LOCUS_51940 829 3198 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_51940 3198 3683 gene locus_tag LOCUS_51950 3198 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 >Feature sequence399 953 603 gene locus_tag LOCUS_51960 953 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 1361 1050 gene locus_tag LOCUS_51970 1361 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 1972 1718 gene locus_tag LOCUS_51980 1972 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 2036 2971 gene locus_tag LOCUS_51990 2036 2971 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_51990 >Feature sequence400 290 1027 gene locus_tag LOCUS_52000 290 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 1092 1610 gene locus_tag LOCUS_52010 1092 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 1620 2495 gene locus_tag LOCUS_52020 1620 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 2535 3008 gene locus_tag LOCUS_52030 2535 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 3110 3970 gene locus_tag LOCUS_52040 3110 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 >Feature sequence401 728 1894 gene locus_tag LOCUS_52050 728 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 1991 3187 gene locus_tag LOCUS_52060 1991 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 3567 3193 gene locus_tag LOCUS_52070 gene groES-2 3567 3193 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_52070 >Feature sequence402 1543 176 gene locus_tag LOCUS_52080 1543 176 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_52080 2486 1674 gene locus_tag LOCUS_52090 2486 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 2741 3556 gene locus_tag LOCUS_52100 gene kce 2741 3556 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 protein_id gnl|my_center|LOCUS_52100 3553 4236 gene locus_tag LOCUS_52110 3553 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 >Feature sequence403 182 1084 gene locus_tag LOCUS_52120 182 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 3919 1292 gene locus_tag LOCUS_52130 3919 1292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_52130 4248 3916 gene locus_tag LOCUS_52140 4248 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence404 449 907 gene locus_tag LOCUS_52150 449 907 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_52150 1029 2489 gene locus_tag LOCUS_52160 1029 2489 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 protein_id gnl|my_center|LOCUS_52160 2496 2999 gene locus_tag LOCUS_52170 2496 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 2999 3502 gene locus_tag LOCUS_52180 2999 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 3549 4067 gene locus_tag LOCUS_52190 3549 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 4124 4783 gene locus_tag LOCUS_52200 4124 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 >Feature sequence405 2320 1745 gene locus_tag LOCUS_52210 2320 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 3469 2426 gene locus_tag LOCUS_52220 3469 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 4419 3982 gene locus_tag LOCUS_52230 4419 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 >Feature sequence406 481 804 gene locus_tag LOCUS_52240 gene tfoX 481 804 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_52240 1784 2533 gene locus_tag LOCUS_52250 1784 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 2817 2545 gene locus_tag LOCUS_52260 2817 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 3154 4593 gene locus_tag LOCUS_52270 3154 4593 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_52270 >Feature sequence407 1572 985 gene locus_tag LOCUS_52280 1572 985 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_52280 2968 1574 gene locus_tag LOCUS_52290 gene leuC 2968 1574 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_52290 4133 2970 gene locus_tag LOCUS_52300 gene leuA 4133 2970 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_52300 >Feature sequence408 310 77 gene locus_tag LOCUS_52310 310 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 503 1372 gene locus_tag LOCUS_52320 503 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 1477 3894 gene locus_tag LOCUS_52330 1477 3894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_52330 >Feature sequence409 1910 579 gene locus_tag LOCUS_52340 gene argH 1910 579 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_52340 3020 1962 gene locus_tag LOCUS_52350 3020 1962 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_52350 3808 3017 gene locus_tag LOCUS_52360 gene argB 3808 3017 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_52360 <4609 3808 gene locus_tag LOCUS_52370 <4609 3808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1E9:N-acetylornithine carbamoyltransferase >Feature sequence410 274 1029 gene locus_tag LOCUS_52380 274 1029 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_52380 2119 2760 gene locus_tag LOCUS_52390 2119 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 2797 3450 gene locus_tag LOCUS_52400 2797 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 3523 4167 gene locus_tag LOCUS_52410 3523 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 >Feature sequence411 1431 283 gene locus_tag LOCUS_52420 1431 283 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_52420 2132 1767 gene locus_tag LOCUS_52430 2132 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 2788 2129 gene locus_tag LOCUS_52440 2788 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 3465 2881 gene locus_tag LOCUS_52450 3465 2881 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_52450 <4573 3688 gene locus_tag LOCUS_52460 <4573 3688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122637.1:sulfate permease >Feature sequence412 693 2078 gene locus_tag LOCUS_52470 gene speA 693 2078 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_52470 2125 3129 gene locus_tag LOCUS_52480 2125 3129 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108892.1 protein_id gnl|my_center|LOCUS_52480 3589 3134 gene locus_tag LOCUS_52490 3589 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 4034 3690 gene locus_tag LOCUS_52500 gene arsC 4034 3690 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_52500 >Feature sequence413 1200 295 gene locus_tag LOCUS_52510 1200 295 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_52510 2075 1203 gene locus_tag LOCUS_52520 2075 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691887.1 protein_id gnl|my_center|LOCUS_52520 2504 2112 gene locus_tag LOCUS_52530 2504 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 >Feature sequence414 991 1152 gene locus_tag LOCUS_52540 991 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 1293 2438 gene locus_tag LOCUS_52550 1293 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 2475 3875 gene locus_tag LOCUS_52560 2475 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 >Feature sequence415 119 910 gene locus_tag LOCUS_52570 119 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 918 1742 gene locus_tag LOCUS_52580 918 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_52580 1851 3137 gene locus_tag LOCUS_52590 gene gltA 1851 3137 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_52590 >Feature sequence416 317 2998 gene locus_tag LOCUS_52600 317 2998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_52600 >Feature sequence417 1069 215 gene locus_tag LOCUS_52610 1069 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 1383 2648 gene locus_tag LOCUS_52620 gene hemA 1383 2648 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_52620 >Feature sequence418 1054 92 gene locus_tag LOCUS_52630 1054 92 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_52630 1886 1062 gene locus_tag LOCUS_52640 gene yyaK 1886 1062 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_52640 3154 1889 gene locus_tag LOCUS_52650 3154 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 <4470 3416 gene locus_tag LOCUS_52660 <4470 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin >Feature sequence419 333 752 gene locus_tag LOCUS_52670 333 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 923 1828 gene locus_tag LOCUS_52680 923 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 1839 2738 gene locus_tag LOCUS_52690 1839 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 3029 3805 gene locus_tag LOCUS_52700 3029 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence420 <1 912 gene locus_tag LOCUS_52710 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein 983 1570 gene locus_tag LOCUS_52720 983 1570 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_52720 1685 2365 gene locus_tag LOCUS_52730 1685 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 2564 3178 gene locus_tag LOCUS_52740 2564 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 3482 4024 gene locus_tag LOCUS_52750 3482 4024 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_52750 >Feature sequence421 1049 684 gene locus_tag LOCUS_52760 1049 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 1228 1671 gene locus_tag LOCUS_52770 1228 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 1668 2693 gene locus_tag LOCUS_52780 gene apbE 1668 2693 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_52780 2690 2917 gene locus_tag LOCUS_52790 2690 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 2902 4134 gene locus_tag LOCUS_52800 2902 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_52800 >Feature sequence422 1245 550 gene locus_tag LOCUS_52810 1245 550 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_52810 2311 1238 gene locus_tag LOCUS_52820 2311 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 2910 2323 gene locus_tag LOCUS_52830 2910 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 3172 4089 gene locus_tag LOCUS_52840 gene mrsF 3172 4089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 protein_id gnl|my_center|LOCUS_52840 >Feature sequence423 <1 3140 gene locus_tag LOCUS_52850 <1 3140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6Z2:phosphoribosylformylglycinamidine synthase >Feature sequence424 <1 702 gene locus_tag LOCUS_52860 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 801 1409 gene locus_tag LOCUS_52870 801 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 4256 1833 gene locus_tag LOCUS_52880 4256 1833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_52880 >Feature sequence425 1 144 gene locus_tag LOCUS_52890 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 250 1101 gene locus_tag LOCUS_52900 250 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_52900 1456 1271 gene locus_tag LOCUS_52910 1456 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 1554 3392 gene locus_tag LOCUS_52920 1554 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 3398 4147 gene locus_tag LOCUS_52930 3398 4147 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_52930 >Feature sequence426 641 1183 gene locus_tag LOCUS_52940 641 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 1502 1849 gene locus_tag LOCUS_52950 1502 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence427 691 966 gene locus_tag LOCUS_52960 691 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 1024 2823 gene locus_tag LOCUS_52970 1024 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 >Feature sequence428 2855 336 gene locus_tag LOCUS_52980 2855 336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_52980 >Feature sequence429 231 2582 gene locus_tag LOCUS_52990 231 2582 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_52990 2589 3674 gene locus_tag LOCUS_53000 2589 3674 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 protein_id gnl|my_center|LOCUS_53000 >Feature sequence430 66 710 gene locus_tag LOCUS_53010 66 710 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_53010 1185 829 gene locus_tag LOCUS_53020 1185 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 1340 1900 gene locus_tag LOCUS_53030 1340 1900 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_53030 1897 2307 gene locus_tag LOCUS_53040 1897 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 3377 2304 gene locus_tag LOCUS_53050 3377 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_53050 3688 3539 gene locus_tag LOCUS_53060 3688 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 >Feature sequence431 <1 574 gene locus_tag LOCUS_53070 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107493.1:sensor histidine kinase 1644 2027 gene locus_tag LOCUS_53080 1644 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44075 protein_id gnl|my_center|LOCUS_53080 2125 3015 gene locus_tag LOCUS_53090 gene ybgG 2125 3015 CDS product homocysteine S-methyltransferase YbgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31463 protein_id gnl|my_center|LOCUS_53090 3008 3625 gene locus_tag LOCUS_53100 3008 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 >Feature sequence432 236 658 gene locus_tag LOCUS_53110 236 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 <4068 724 gene locus_tag LOCUS_53120 <4068 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:alkaline phosphatase >Feature sequence433 1836 1624 gene locus_tag LOCUS_53130 1836 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 2817 2038 gene locus_tag LOCUS_53140 2817 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 >Feature sequence434 >Feature sequence435 850 8 gene locus_tag LOCUS_53150 850 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 2879 1197 gene locus_tag LOCUS_53160 2879 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 3246 2872 gene locus_tag LOCUS_53170 3246 2872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_53170 3549 3881 gene locus_tag LOCUS_53180 3549 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 >Feature sequence436 1701 2618 gene locus_tag LOCUS_53190 1701 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 >Feature sequence437 <1 629 gene locus_tag LOCUS_53200 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797789.1:isochorismatase 689 1546 gene locus_tag LOCUS_53210 689 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 2070 2142 gene locus_tag LOCUS_t00340 2070 2142 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3427 2420 gene locus_tag LOCUS_53220 3427 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 >Feature sequence438 1641 691 gene locus_tag LOCUS_53230 gene mocA 1641 691 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083082.1 protein_id gnl|my_center|LOCUS_53230 >Feature sequence439 721 1053 gene locus_tag LOCUS_53240 721 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 1054 3651 gene locus_tag LOCUS_53250 1054 3651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence440 1175 180 gene locus_tag LOCUS_53260 1175 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309936.1 protein_id gnl|my_center|LOCUS_53260 2080 1178 gene locus_tag LOCUS_53270 2080 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 3001 2162 gene locus_tag LOCUS_53280 3001 2162 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_53280 <3853 3135 gene locus_tag LOCUS_53290 <3853 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464393.1:alpha/beta hydrolase >Feature sequence441 1090 56 gene locus_tag LOCUS_53300 1090 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 1950 1261 gene locus_tag LOCUS_53310 1950 1261 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 protein_id gnl|my_center|LOCUS_53310 3478 1943 gene locus_tag LOCUS_53320 3478 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 >Feature sequence442 1 906 gene locus_tag LOCUS_53330 1 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 911 2371 gene locus_tag LOCUS_53340 gene ycgA 911 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55908 protein_id gnl|my_center|LOCUS_53340 3699 2368 gene locus_tag LOCUS_53350 3699 2368 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 protein_id gnl|my_center|LOCUS_53350 >Feature sequence443 1171 53 gene locus_tag LOCUS_53360 1171 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 1654 1202 gene locus_tag LOCUS_53370 1654 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 >Feature sequence444 652 1629 gene locus_tag LOCUS_53380 gene pdhB 652 1629 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_53380 1691 2188 gene locus_tag LOCUS_53390 1691 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 2248 2958 gene locus_tag LOCUS_53400 2248 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 <3725 2955 gene locus_tag LOCUS_53410 <3725 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RB9:signal recognition particle protein >Feature sequence445 1276 2898 gene locus_tag LOCUS_53420 gene dnaB 1276 2898 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_53420 >Feature sequence446 267 893 gene locus_tag LOCUS_53430 267 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 1031 2134 gene locus_tag LOCUS_53440 1031 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 2765 3529 gene locus_tag LOCUS_53450 2765 3529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_53450 >Feature sequence447 2636 207 gene locus_tag LOCUS_53460 2636 207 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_53460 >Feature sequence448 1425 109 gene locus_tag LOCUS_53470 gene natB 1425 109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_53470 2342 1422 gene locus_tag LOCUS_53480 gene natA 2342 1422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_53480 3370 2483 gene locus_tag LOCUS_53490 3370 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 >Feature sequence449 1230 337 gene locus_tag LOCUS_53500 gene menA 1230 337 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_53500 1744 1232 gene locus_tag LOCUS_53510 1744 1232 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_53510 <3621 1746 gene locus_tag LOCUS_53520 <3621 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A3X5:arginine--tRNA ligase >Feature sequence450 <1 1565 gene locus_tag LOCUS_53530 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490383.1:peptidase M23 2229 1675 gene locus_tag LOCUS_53540 2229 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 2646 2419 gene locus_tag LOCUS_53550 2646 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 >Feature sequence451 1136 1705 gene locus_tag LOCUS_53560 1136 1705 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_53560 1770 3221 gene locus_tag LOCUS_53570 1770 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 >Feature sequence452 617 1291 gene locus_tag LOCUS_53580 617 1291 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_53580 1546 1803 gene locus_tag LOCUS_53590 1546 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 2494 1865 gene locus_tag LOCUS_53600 gene fkpA 2494 1865 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 protein_id gnl|my_center|LOCUS_53600 3350 2646 gene locus_tag LOCUS_53610 gene crtO 3350 2646 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_53610 >Feature sequence453 2656 1634 gene locus_tag LOCUS_53620 2656 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 >Feature sequence454 <1 668 gene locus_tag LOCUS_53630 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957837.1:radical SAM protein 1282 1106 gene locus_tag LOCUS_53640 1282 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 2131 1343 gene locus_tag LOCUS_53650 2131 1343 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_53650 2223 2996 gene locus_tag LOCUS_53660 2223 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 >Feature sequence455 1 306 gene locus_tag LOCUS_53670 1 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 303 890 gene locus_tag LOCUS_53680 303 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 1786 887 gene locus_tag LOCUS_53690 1786 887 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 protein_id gnl|my_center|LOCUS_53690 1966 2292 gene locus_tag LOCUS_53700 1966 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_53700 2978 2298 gene locus_tag LOCUS_53710 2978 2298 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_53710 >Feature sequence456 <1 1836 gene locus_tag LOCUS_53720 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108758.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence457 <1 573 gene locus_tag LOCUS_53730 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q45585:ECF RNA polymerase sigma factor SigW 1370 1996 gene locus_tag LOCUS_53740 gene rsmG 1370 1996 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_53740 2385 1990 gene locus_tag LOCUS_53750 2385 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 <3538 2463 gene locus_tag LOCUS_53760 <3538 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964122.1:ABC transporter permease >Feature sequence458 1221 853 gene locus_tag LOCUS_53770 1221 853 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_53770 1371 2525 gene locus_tag LOCUS_53780 1371 2525 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_53780 >Feature sequence459 735 1883 gene locus_tag LOCUS_53790 735 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 1987 2808 gene locus_tag LOCUS_53800 1987 2808 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 protein_id gnl|my_center|LOCUS_53800 >Feature sequence460 433 801 gene locus_tag LOCUS_53810 433 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 1330 1548 gene locus_tag LOCUS_53820 1330 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 1627 2034 gene locus_tag LOCUS_53830 1627 2034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_53830 2170 2622 gene locus_tag LOCUS_53840 2170 2622 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_53840 >Feature sequence461 >Feature sequence462 1360 296 gene locus_tag LOCUS_53850 1360 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 1973 1578 gene locus_tag LOCUS_53860 1973 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 2742 2005 gene locus_tag LOCUS_53870 2742 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 >Feature sequence463 3127 521 gene locus_tag LOCUS_53880 3127 521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_53880 >Feature sequence464 1 405 gene locus_tag LOCUS_53890 1 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 >Feature sequence465 1032 1439 gene locus_tag LOCUS_53900 1032 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 2620 1451 gene locus_tag LOCUS_53910 2620 1451 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_53910 <3375 2641 gene locus_tag LOCUS_53920 <3375 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765880.1:glycosyl transferase >Feature sequence466 636 2897 gene locus_tag LOCUS_53930 gene acnA 636 2897 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_53930 >Feature sequence467 308 1942 gene locus_tag LOCUS_53940 308 1942 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_53940 1942 2664 gene locus_tag LOCUS_53950 1942 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence468 <1 821 gene locus_tag LOCUS_53960 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000755373.1:PAS domain-containing sensor histidine kinase >Feature sequence469 <1 787 gene locus_tag LOCUS_53970 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864662.1:prephenate dehydrogenase 880 1725 gene locus_tag LOCUS_53980 880 1725 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_53980 1807 2151 gene locus_tag LOCUS_53990 1807 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 <3282 2207 gene locus_tag LOCUS_54000 <3282 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence470 214 1272 gene locus_tag LOCUS_54010 214 1272 CDS product secretion protein HylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919655.1 protein_id gnl|my_center|LOCUS_54010 >Feature sequence471 1445 2782 gene locus_tag LOCUS_54020 1445 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 3108 2788 gene locus_tag LOCUS_54030 3108 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 >Feature sequence472 142 804 gene locus_tag LOCUS_54040 142 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54040 820 1371 gene locus_tag LOCUS_54050 820 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 1390 2412 gene locus_tag LOCUS_54060 gene lpxD 1390 2412 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_54060 >Feature sequence473 <1 1306 gene locus_tag LOCUS_54070 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963916.1:multidrug transporter AcrB 1454 1642 gene locus_tag LOCUS_54080 1454 1642 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_54080 2333 1746 gene locus_tag LOCUS_54090 2333 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 >Feature sequence474 280 1173 gene locus_tag LOCUS_54100 280 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 1998 1252 gene locus_tag LOCUS_54110 1998 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 <3182 2098 gene locus_tag LOCUS_54120 <3182 2098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:multidrug transporter AcrB >Feature sequence475 386 1570 gene locus_tag LOCUS_54130 386 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 1646 1783 gene locus_tag LOCUS_54140 1646 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 >Feature sequence476 1 501 gene locus_tag LOCUS_54150 1 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 618 1148 gene locus_tag LOCUS_54160 618 1148 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_54160 1183 1623 gene locus_tag LOCUS_54170 1183 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 1648 2445 gene locus_tag LOCUS_54180 1648 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence477 1810 1301 gene locus_tag LOCUS_54190 1810 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 2442 1807 gene locus_tag LOCUS_54200 gene pnuC 2442 1807 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_54200 2553 3023 gene locus_tag LOCUS_54210 2553 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 >Feature sequence478 1025 2563 gene locus_tag LOCUS_54220 1025 2563 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_54220 >Feature sequence479 2137 989 gene locus_tag LOCUS_54230 2137 989 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_54230 >Feature sequence480 723 2006 gene locus_tag LOCUS_54240 723 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_54240 2003 2701 gene locus_tag LOCUS_54250 2003 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 >Feature sequence481 1627 374 gene locus_tag LOCUS_54260 1627 374 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_54260 2178 2927 gene locus_tag LOCUS_54270 gene rhmA 2178 2927 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NN63 protein_id gnl|my_center|LOCUS_54270 >Feature sequence482 1509 733 gene locus_tag LOCUS_54280 1509 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 >Feature sequence483 591 151 gene locus_tag LOCUS_54290 591 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 826 2652 gene locus_tag LOCUS_54300 826 2652 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602099.1 protein_id gnl|my_center|LOCUS_54300 >Feature sequence484 469 990 gene locus_tag LOCUS_54310 469 990 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_54310 1073 1627 gene locus_tag LOCUS_54320 1073 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 1741 2826 gene locus_tag LOCUS_54330 1741 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 >Feature sequence485 919 29 gene locus_tag LOCUS_54340 919 29 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035514.1 protein_id gnl|my_center|LOCUS_54340 1040 1423 gene locus_tag LOCUS_54350 1040 1423 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_54350 1423 2361 gene locus_tag LOCUS_54360 1423 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 >Feature sequence486 274 1473 gene locus_tag LOCUS_54370 274 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 2432 2031 gene locus_tag LOCUS_54380 2432 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence487 181 2130 gene locus_tag LOCUS_54390 181 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 >Feature sequence488 <2787 538 gene locus_tag LOCUS_54400 <2787 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence489 1118 297 gene locus_tag LOCUS_54410 1118 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 1754 1245 gene locus_tag LOCUS_54420 1754 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 >Feature sequence490 20 694 gene locus_tag LOCUS_54430 20 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 <2634 761 gene locus_tag LOCUS_54440 <2634 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence491 1165 305 gene locus_tag LOCUS_54450 1165 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 >Feature sequence492 >Feature sequence493 158 1477 gene locus_tag LOCUS_54460 158 1477 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_54460 2193 1507 gene locus_tag LOCUS_54470 2193 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 >Feature sequence494 710 2152 gene locus_tag LOCUS_54480 710 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 >Feature sequence495 1475 939 gene locus_tag LOCUS_54490 1475 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 2524 1877 gene locus_tag LOCUS_54500 2524 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 >Feature sequence496 86 1171 gene locus_tag LOCUS_54510 86 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 2539 1673 gene locus_tag LOCUS_54520 2539 1673 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_54520 >Feature sequence497 4 1503 gene locus_tag LOCUS_54530 4 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 1505 2527 gene locus_tag LOCUS_54540 1505 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 >Feature sequence498 1168 281 gene locus_tag LOCUS_54550 1168 281 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_54550 >Feature sequence499 <1 673 gene locus_tag LOCUS_54560 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876079.1:sensory transduction regulatory protein >Feature sequence500 >Feature sequence501 283 1653 gene locus_tag LOCUS_54570 283 1653 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_54570 >Feature sequence502 >Feature sequence503 <1 1431 gene locus_tag LOCUS_54580 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease 2446 1508 gene locus_tag LOCUS_54590 2446 1508 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_54590 >Feature sequence504 321 893 gene locus_tag LOCUS_54600 321 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 1990 965 gene locus_tag LOCUS_54610 1990 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 >Feature sequence505 353 171 gene locus_tag LOCUS_54620 353 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 2228 495 gene locus_tag LOCUS_54630 2228 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 >Feature sequence506 >Feature sequence507 263 1975 gene locus_tag LOCUS_54640 263 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 >Feature sequence508 101 475 gene locus_tag LOCUS_54650 101 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_54650 665 1438 gene locus_tag LOCUS_54660 665 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 1595 2044 gene locus_tag LOCUS_54670 1595 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 >Feature sequence509 204 656 gene locus_tag LOCUS_54680 204 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 653 1300 gene locus_tag LOCUS_54690 653 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 1827 1312 gene locus_tag LOCUS_54700 1827 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 >Feature sequence510 >Feature sequence511 880 263 gene locus_tag LOCUS_54710 880 263 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_54710 1664 882 gene locus_tag LOCUS_54720 gene lpxA 1664 882 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_54720 <2254 1661 gene locus_tag LOCUS_54730 <2254 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A015:bifunctional enzyme LpxC/FabZ >Feature sequence512 1124 744 gene locus_tag LOCUS_54740 1124 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 1864 1148 gene locus_tag LOCUS_54750 1864 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 >Feature sequence513 <2218 449 gene locus_tag LOCUS_54760 <2218 449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence514 >Feature sequence515 920 408 gene locus_tag LOCUS_54770 920 408 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_54770 1039 1833 gene locus_tag LOCUS_54780 1039 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_54780 2132 1830 gene locus_tag LOCUS_54790 2132 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 >Feature sequence516 <2150 664 gene locus_tag LOCUS_54800 <2150 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence517 1852 992 gene locus_tag LOCUS_54810 gene hisG 1852 992 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE6 protein_id gnl|my_center|LOCUS_54810 >Feature sequence518 248 1657 gene locus_tag LOCUS_54820 248 1657 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_54820 >Feature sequence519 146 1108 gene locus_tag LOCUS_54830 146 1108 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_54830 1580 1164 gene locus_tag LOCUS_54840 1580 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 >Feature sequence520 <1 1700 gene locus_tag LOCUS_54850 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038548.1:tail-specific protease >Feature sequence521 <1 1337 gene locus_tag LOCUS_54860 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein 2049 1453 gene locus_tag LOCUS_54870 2049 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 >Feature sequence522 1507 545 gene locus_tag LOCUS_54880 1507 545 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_54880 >Feature sequence523 653 108 gene locus_tag LOCUS_54890 653 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 771 1232 gene locus_tag LOCUS_54900 771 1232 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_54900 >Feature sequence524 384 79 gene locus_tag LOCUS_54910 384 79 CDS product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727587.1 protein_id gnl|my_center|LOCUS_54910 >Feature sequence525 1894 482 gene locus_tag LOCUS_54920 1894 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 >Feature sequence526 >Feature sequence527 36 695 gene locus_tag LOCUS_54930 gene mrsA 36 695 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_54930 1573 1055 gene locus_tag LOCUS_54940 1573 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 >Feature sequence528 324 689 gene locus_tag LOCUS_54950 gene folB 324 689 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_54950 686 1546 gene locus_tag LOCUS_54960 686 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881733.1 protein_id gnl|my_center|LOCUS_54960 >Feature sequence529 76 1314 gene locus_tag LOCUS_54970 76 1314 CDS product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_54970 >Feature sequence530 763 837 gene locus_tag LOCUS_t00350 763 837 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1202 1011 gene locus_tag LOCUS_54980 1202 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 1590 1162 gene locus_tag LOCUS_54990 1590 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 >Feature sequence531 >Feature sequence532 1622 720 gene locus_tag LOCUS_55000 1622 720 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_55000 >Feature sequence533 760 1539 gene locus_tag LOCUS_55010 760 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_55010 >Feature sequence534 <1 1000 gene locus_tag LOCUS_55020 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDJ0:phosphoribosylglycinamide formyltransferase 2 >Feature sequence535 <1 823 gene locus_tag LOCUS_55030 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920196.1:short-chain dehydrogenase >Feature sequence536 329 904 gene locus_tag LOCUS_55040 329 904 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_55040