>Feature sequence001 2 1474 gene locus_tag LOCUS_00010 2 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2227 1547 gene locus_tag LOCUS_00020 2227 1547 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_00020 3287 2247 gene locus_tag LOCUS_00030 3287 2247 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_00030 4626 3331 gene locus_tag LOCUS_00040 4626 3331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_00040 5093 4623 gene locus_tag LOCUS_00050 5093 4623 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602519.1 protein_id gnl|my_center|LOCUS_00050 6091 5102 gene locus_tag LOCUS_00060 6091 5102 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_00060 7507 6107 gene locus_tag LOCUS_00070 gene uxaC 7507 6107 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_00070 7844 8989 gene locus_tag LOCUS_00080 7844 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9911 9153 gene locus_tag LOCUS_00090 9911 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10081 11139 gene locus_tag LOCUS_00100 gene rhaT 10081 11139 CDS product L-rhamnose-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIZ8 protein_id gnl|my_center|LOCUS_00100 11176 12339 gene locus_tag LOCUS_00110 11176 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061900.1 protein_id gnl|my_center|LOCUS_00110 12336 13478 gene locus_tag LOCUS_00120 12336 13478 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061901.1 protein_id gnl|my_center|LOCUS_00120 13614 14756 gene locus_tag LOCUS_00130 13614 14756 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061901.1 protein_id gnl|my_center|LOCUS_00130 14761 16002 gene locus_tag LOCUS_00140 14761 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16003 17058 gene locus_tag LOCUS_00150 16003 17058 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533030.1 protein_id gnl|my_center|LOCUS_00150 17106 17546 gene locus_tag LOCUS_00160 17106 17546 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533031.1 protein_id gnl|my_center|LOCUS_00160 18871 17600 gene locus_tag LOCUS_00170 18871 17600 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_00170 19619 18861 gene locus_tag LOCUS_00180 19619 18861 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_00180 21197 20007 gene locus_tag LOCUS_00190 gene fdh 21197 20007 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_00190 22727 21258 gene locus_tag LOCUS_00200 22727 21258 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_00200 24204 22768 gene locus_tag LOCUS_00210 gene GALNS 24204 22768 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_00210 27476 24201 gene locus_tag LOCUS_00220 27476 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_00220 30953 27594 gene locus_tag LOCUS_00230 30953 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_00230 32443 31031 gene locus_tag LOCUS_00240 32443 31031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957021.1 protein_id gnl|my_center|LOCUS_00240 33489 34040 gene locus_tag LOCUS_00250 33489 34040 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_00250 34231 35481 gene locus_tag LOCUS_00260 34231 35481 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_00260 35657 39061 gene locus_tag LOCUS_00270 35657 39061 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_00270 39081 40754 gene locus_tag LOCUS_00280 39081 40754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_00280 41207 44344 gene locus_tag LOCUS_00290 41207 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 44370 45788 gene locus_tag LOCUS_00300 44370 45788 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 protein_id gnl|my_center|LOCUS_00300 45807 46289 gene locus_tag LOCUS_00310 45807 46289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 46383 47204 gene locus_tag LOCUS_00320 46383 47204 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_00320 47318 48901 gene locus_tag LOCUS_00330 47318 48901 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766132.1 protein_id gnl|my_center|LOCUS_00330 48935 49846 gene locus_tag LOCUS_00340 gene iolS 48935 49846 CDS product protein IolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46336 protein_id gnl|my_center|LOCUS_00340 49872 51011 gene locus_tag LOCUS_00350 49872 51011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 51145 51699 gene locus_tag LOCUS_00360 51145 51699 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_00360 52632 51862 gene locus_tag LOCUS_00370 52632 51862 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_00370 53476 52637 gene locus_tag LOCUS_00380 53476 52637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 54525 53488 gene locus_tag LOCUS_00390 54525 53488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 55595 54522 gene locus_tag LOCUS_00400 55595 54522 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887660.1 protein_id gnl|my_center|LOCUS_00400 55911 57275 gene locus_tag LOCUS_00410 gene araE 55911 57275 CDS product arabinose-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96710 protein_id gnl|my_center|LOCUS_00410 57706 58365 gene locus_tag LOCUS_00420 57706 58365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 58519 61821 gene locus_tag LOCUS_00430 58519 61821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_00430 61845 63323 gene locus_tag LOCUS_00440 61845 63323 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_00440 63382 64446 gene locus_tag LOCUS_00450 gene pam 63382 64446 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_00450 64772 66094 gene locus_tag LOCUS_00460 64772 66094 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_00460 66145 67515 gene locus_tag LOCUS_00470 66145 67515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 69855 67672 gene locus_tag LOCUS_00480 69855 67672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 70752 69883 gene locus_tag LOCUS_00490 70752 69883 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_00490 72041 70842 gene locus_tag LOCUS_00500 72041 70842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 74308 72032 gene locus_tag LOCUS_00510 74308 72032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 76208 74541 gene locus_tag LOCUS_00520 76208 74541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 76927 78531 gene locus_tag LOCUS_00530 gene uxaA 76927 78531 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210408.1 protein_id gnl|my_center|LOCUS_00530 78528 79304 gene locus_tag LOCUS_00540 78528 79304 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708130.1 protein_id gnl|my_center|LOCUS_00540 79317 80165 gene locus_tag LOCUS_00550 79317 80165 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_00550 80162 80992 gene locus_tag LOCUS_00560 80162 80992 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_00560 80989 81555 gene locus_tag LOCUS_00570 80989 81555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 81552 81770 gene locus_tag LOCUS_00580 81552 81770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 81879 83111 gene locus_tag LOCUS_00590 gene fucP 81879 83111 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_00590 83125 83454 gene locus_tag LOCUS_00600 83125 83454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_00600 83451 84602 gene locus_tag LOCUS_00610 gene lldD 83451 84602 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_00610 85713 84682 gene locus_tag LOCUS_00620 gene yxjG_1 85713 84682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_00620 86698 85715 gene locus_tag LOCUS_00630 86698 85715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 87636 88667 gene locus_tag LOCUS_00640 87636 88667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 88871 89572 gene locus_tag LOCUS_00650 88871 89572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 89611 90792 gene locus_tag LOCUS_00660 gene uxuA 89611 90792 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24215 protein_id gnl|my_center|LOCUS_00660 91020 91280 gene locus_tag LOCUS_00670 91020 91280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00670 91277 91507 gene locus_tag LOCUS_00680 91277 91507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00680 91535 91942 gene locus_tag LOCUS_00690 91535 91942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00690 94155 92038 gene locus_tag LOCUS_00700 gene fadJ 94155 92038 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NP24 protein_id gnl|my_center|LOCUS_00700 95474 94185 gene locus_tag LOCUS_00710 gene hadHB 95474 94185 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_00710 97364 95523 gene locus_tag LOCUS_00720 97364 95523 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_00720 97742 98326 gene locus_tag LOCUS_00730 97742 98326 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_00730 98313 98942 gene locus_tag LOCUS_00740 98313 98942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 98935 100161 gene locus_tag LOCUS_00750 98935 100161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 101472 100234 gene locus_tag LOCUS_00760 101472 100234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 103004 101469 gene locus_tag LOCUS_00770 103004 101469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767094.1 protein_id gnl|my_center|LOCUS_00770 103253 104728 gene locus_tag LOCUS_00780 gene crtI 103253 104728 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_00780 104725 105564 gene locus_tag LOCUS_00790 gene crtB 104725 105564 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_00790 105561 106061 gene locus_tag LOCUS_00800 105561 106061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 106091 106543 gene locus_tag LOCUS_00810 gene crtZ 106091 106543 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_00810 106540 107244 gene locus_tag LOCUS_00820 106540 107244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 108530 107241 gene locus_tag LOCUS_00830 gene phrB1 108530 107241 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_00830 109946 108531 gene locus_tag LOCUS_00840 109946 108531 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_00840 110484 109957 gene locus_tag LOCUS_00850 gene btuE 110484 109957 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYB7 protein_id gnl|my_center|LOCUS_00850 111810 110488 gene locus_tag LOCUS_00860 111810 110488 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_00860 112467 111811 gene locus_tag LOCUS_00870 112467 111811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_00870 112948 112478 gene locus_tag LOCUS_00880 112948 112478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_00880 113180 114079 gene locus_tag LOCUS_00890 113180 114079 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_00890 114890 114123 gene locus_tag LOCUS_00900 114890 114123 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_00900 116754 115273 gene locus_tag LOCUS_00910 gene srfJ 116754 115273 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_00910 118336 116852 gene locus_tag LOCUS_00920 118336 116852 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_00920 119094 118438 gene locus_tag LOCUS_00930 119094 118438 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_00930 120560 119097 gene locus_tag LOCUS_00940 gene phrB2 120560 119097 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_00940 121645 120557 gene locus_tag LOCUS_00950 121645 120557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 122399 122566 gene locus_tag LOCUS_00960 122399 122566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 124262 122598 gene locus_tag LOCUS_00970 124262 122598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 126554 124350 gene locus_tag LOCUS_00980 126554 124350 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_00980 127038 126547 gene locus_tag LOCUS_00990 127038 126547 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 protein_id gnl|my_center|LOCUS_00990 129422 127269 gene locus_tag LOCUS_01000 129422 127269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 130870 129425 gene locus_tag LOCUS_01010 130870 129425 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_01010 133211 130875 gene locus_tag LOCUS_01020 133211 130875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 134159 133224 gene locus_tag LOCUS_01030 gene pam 134159 133224 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_01030 135078 134851 gene locus_tag LOCUS_01040 135078 134851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 136022 137254 gene locus_tag LOCUS_01050 136022 137254 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_01050 137247 137921 gene locus_tag LOCUS_01060 137247 137921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 138000 138278 gene locus_tag LOCUS_01070 138000 138278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 138268 138915 gene locus_tag LOCUS_01080 138268 138915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 139173 139679 gene locus_tag LOCUS_01090 139173 139679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 139688 140764 gene locus_tag LOCUS_01100 139688 140764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 141742 141344 gene locus_tag LOCUS_tm00010 141742 141344 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 141874 142758 gene locus_tag LOCUS_01110 141874 142758 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_01110 145063 143663 gene locus_tag LOCUS_01120 145063 143663 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_01120 145686 145060 gene locus_tag LOCUS_01130 gene rsmG 145686 145060 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_01130 145970 147250 gene locus_tag LOCUS_01140 gene tgt 145970 147250 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_01140 147258 148334 gene locus_tag LOCUS_01150 147258 148334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_01150 148331 149242 gene locus_tag LOCUS_01160 148331 149242 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_01160 150055 149234 gene locus_tag LOCUS_01170 gene ispE 150055 149234 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_01170 150991 150179 gene locus_tag LOCUS_01180 150991 150179 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_01180 152691 151033 gene locus_tag LOCUS_01190 152691 151033 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S05 protein_id gnl|my_center|LOCUS_01190 152906 152697 gene locus_tag LOCUS_01200 152906 152697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 153802 152906 gene locus_tag LOCUS_01210 153802 152906 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_01210 154988 153795 gene locus_tag LOCUS_01220 gene coaBC 154988 153795 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_01220 155328 155002 gene locus_tag LOCUS_01230 155328 155002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_01230 156029 155343 gene locus_tag LOCUS_01240 156029 155343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 157773 156199 gene locus_tag LOCUS_01250 157773 156199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_01250 157885 159231 gene locus_tag LOCUS_01260 gene tilS 157885 159231 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_01260 159376 160314 gene locus_tag LOCUS_01270 gene mdh 159376 160314 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0W0 protein_id gnl|my_center|LOCUS_01270 161311 160403 gene locus_tag LOCUS_01280 161311 160403 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_01280 161465 162304 gene locus_tag LOCUS_01290 161465 162304 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_01290 162485 164482 gene locus_tag LOCUS_01300 162485 164482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_01300 164479 165609 gene locus_tag LOCUS_01310 164479 165609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 protein_id gnl|my_center|LOCUS_01310 165677 166939 gene locus_tag LOCUS_01320 165677 166939 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_01320 167121 168569 gene locus_tag LOCUS_01330 167121 168569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 168572 170041 gene locus_tag LOCUS_01340 168572 170041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 173096 170034 gene locus_tag LOCUS_01350 173096 170034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_01350 173360 174781 gene locus_tag LOCUS_01360 gene putA 173360 174781 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_01360 174836 175792 gene locus_tag LOCUS_01370 gene socC 174836 175792 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_01370 176643 175834 gene locus_tag LOCUS_01380 176643 175834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 176849 179029 gene locus_tag LOCUS_01390 176849 179029 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_01390 179270 180127 gene locus_tag LOCUS_01400 gene tesB 179270 180127 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_01400 180280 181350 gene locus_tag LOCUS_01410 gene gstcD 180280 181350 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_01410 181620 182861 gene locus_tag LOCUS_01420 181620 182861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 183280 182903 gene locus_tag LOCUS_01430 183280 182903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 184676 183282 gene locus_tag LOCUS_01440 184676 183282 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_01440 184817 187327 gene locus_tag LOCUS_01450 184817 187327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 188027 187320 gene locus_tag LOCUS_01460 188027 187320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 188124 188197 gene locus_tag LOCUS_t00010 188124 188197 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 4829 1479 gene locus_tag LOCUS_01470 gene mfd 4829 1479 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_01470 5013 6506 gene locus_tag LOCUS_01480 5013 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_01480 6716 8356 gene locus_tag LOCUS_01490 gene pvdE 6716 8356 CDS product cyclic peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103875.1 protein_id gnl|my_center|LOCUS_01490 8421 9200 gene locus_tag LOCUS_01500 8421 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9298 10011 gene locus_tag LOCUS_01510 9298 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10767 10039 gene locus_tag LOCUS_01520 10767 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11000 12616 gene locus_tag LOCUS_01530 11000 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 15387 12907 gene locus_tag LOCUS_01540 15387 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_01540 15458 16006 gene locus_tag LOCUS_01550 15458 16006 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_01550 16472 15990 gene locus_tag LOCUS_01560 16472 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 16503 17102 gene locus_tag LOCUS_01570 16503 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_01570 17111 19321 gene locus_tag LOCUS_01580 17111 19321 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_01580 19349 20128 gene locus_tag LOCUS_01590 19349 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20125 20847 gene locus_tag LOCUS_01600 20125 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 20910 21755 gene locus_tag LOCUS_01610 20910 21755 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_01610 23043 21763 gene locus_tag LOCUS_01620 23043 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 24024 25067 gene locus_tag LOCUS_01630 24024 25067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25070 26743 gene locus_tag LOCUS_01640 gene malL 25070 26743 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_01640 27254 26769 gene locus_tag LOCUS_01650 gene recX 27254 26769 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D6 protein_id gnl|my_center|LOCUS_01650 27727 27254 gene locus_tag LOCUS_01660 27727 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28589 27732 gene locus_tag LOCUS_01670 28589 27732 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_01670 29007 28612 gene locus_tag LOCUS_01680 29007 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 29100 30620 gene locus_tag LOCUS_01690 gene gpmI 29100 30620 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_01690 30622 31170 gene locus_tag LOCUS_01700 30622 31170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 31399 31163 gene locus_tag LOCUS_01710 31399 31163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 32020 31496 gene locus_tag LOCUS_01720 gene purE 32020 31496 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_01720 33234 32017 gene locus_tag LOCUS_01730 gene purK 33234 32017 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_01730 33431 34300 gene locus_tag LOCUS_01740 33431 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 34461 34727 gene locus_tag LOCUS_01750 34461 34727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35738 35463 gene locus_tag LOCUS_01760 35738 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 36321 35884 gene locus_tag LOCUS_01770 36321 35884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 37852 37409 gene locus_tag LOCUS_01780 37852 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 39041 37989 gene locus_tag LOCUS_01790 39041 37989 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_01790 39517 40230 gene locus_tag LOCUS_01800 39517 40230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 42076 40709 gene locus_tag LOCUS_01810 42076 40709 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_01810 43723 42101 gene locus_tag LOCUS_01820 gene ggt 43723 42101 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403657.1 protein_id gnl|my_center|LOCUS_01820 46337 43923 gene locus_tag LOCUS_01830 gene mur/alr 46337 43923 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_01830 47059 46334 gene locus_tag LOCUS_01840 47059 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47470 47545 gene locus_tag LOCUS_t00020 47470 47545 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47646 49283 gene locus_tag LOCUS_01850 47646 49283 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_01850 49255 49959 gene locus_tag LOCUS_01860 gene rprY 49255 49959 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_01860 50023 50751 gene locus_tag LOCUS_01870 gene hisA 50023 50751 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT1 protein_id gnl|my_center|LOCUS_01870 51038 50748 gene locus_tag LOCUS_01880 51038 50748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 51667 51593 gene locus_tag LOCUS_t00030 51667 51593 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 53057 51717 gene locus_tag LOCUS_01890 gene pyrC1 53057 51717 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_01890 53353 56217 gene locus_tag LOCUS_01900 gene gcvP 53353 56217 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_01900 56697 56245 gene locus_tag LOCUS_01910 56697 56245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 57449 56694 gene locus_tag LOCUS_01920 57449 56694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_01920 57867 58403 gene locus_tag LOCUS_01930 57867 58403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 58425 59783 gene locus_tag LOCUS_01940 gene rmuC 58425 59783 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_01940 59812 60189 gene locus_tag LOCUS_01950 gene groES-2 59812 60189 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_01950 60245 60529 gene locus_tag LOCUS_01960 60245 60529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_01960 61661 60606 gene locus_tag LOCUS_01970 61661 60606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 62034 62564 gene locus_tag LOCUS_01980 62034 62564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01980 62561 62749 gene locus_tag LOCUS_01990 62561 62749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01990 63206 62883 gene locus_tag LOCUS_02000 63206 62883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123017.1 protein_id gnl|my_center|LOCUS_02000 63491 64066 gene locus_tag LOCUS_02010 63491 64066 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_02010 64277 65179 gene locus_tag LOCUS_02020 gene hchA 64277 65179 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_02020 65338 66177 gene locus_tag LOCUS_02030 65338 66177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 67660 66689 gene locus_tag LOCUS_02040 gene hemB 67660 66689 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_02040 68457 67699 gene locus_tag LOCUS_02050 68457 67699 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_02050 69773 68532 gene locus_tag LOCUS_02060 gene rocD 69773 68532 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_02060 70090 70329 gene locus_tag LOCUS_02070 gene rpmB 70090 70329 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_02070 70341 70523 gene locus_tag LOCUS_02080 gene rpmG 70341 70523 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_02080 70526 70675 gene locus_tag LOCUS_02090 70526 70675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 70766 71719 gene locus_tag LOCUS_02100 gene ftsY 70766 71719 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_02100 72407 71811 gene locus_tag LOCUS_02110 72407 71811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 73497 72511 gene locus_tag LOCUS_02120 73497 72511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 73694 74176 gene locus_tag LOCUS_02130 73694 74176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 75723 74173 gene locus_tag LOCUS_02140 gene cafA 75723 74173 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_02140 76630 75854 gene locus_tag LOCUS_02150 76630 75854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 76939 76649 gene locus_tag LOCUS_02160 76939 76649 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_02160 77079 78083 gene locus_tag LOCUS_02170 gene mutY 77079 78083 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_02170 78097 78546 gene locus_tag LOCUS_02180 78097 78546 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W20 protein_id gnl|my_center|LOCUS_02180 78607 79881 gene locus_tag LOCUS_02190 78607 79881 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_02190 79878 80447 gene locus_tag LOCUS_02200 79878 80447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 80492 82585 gene locus_tag LOCUS_02210 gene recG 80492 82585 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_02210 84499 83195 gene locus_tag LOCUS_02220 gene gntP 84499 83195 CDS product idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966868.1 protein_id gnl|my_center|LOCUS_02220 85808 84591 gene locus_tag LOCUS_02230 85808 84591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_02230 86708 86073 gene locus_tag LOCUS_02240 86708 86073 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02240 87391 86705 gene locus_tag LOCUS_02250 gene rsmI 87391 86705 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_02250 87623 87381 gene locus_tag LOCUS_02260 87623 87381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 87886 87626 gene locus_tag LOCUS_02270 87886 87626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 90067 87944 gene locus_tag LOCUS_02280 90067 87944 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_02280 91360 90143 gene locus_tag LOCUS_02290 91360 90143 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_02290 92214 91660 gene locus_tag LOCUS_02300 92214 91660 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_02300 93532 92228 gene locus_tag LOCUS_02310 93532 92228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 94819 93551 gene locus_tag LOCUS_02320 94819 93551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_02320 95531 94806 gene locus_tag LOCUS_02330 gene coaX 95531 94806 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_02330 95559 96614 gene locus_tag LOCUS_02340 95559 96614 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_02340 97955 96633 gene locus_tag LOCUS_02350 97955 96633 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_02350 98439 97960 gene locus_tag LOCUS_02360 gene ribH 98439 97960 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_02360 99202 98501 gene locus_tag LOCUS_02370 99202 98501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 100279 99263 gene locus_tag LOCUS_02380 gene pdhA 100279 99263 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_02380 100371 101483 gene locus_tag LOCUS_02390 gene recF 100371 101483 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_02390 101473 101763 gene locus_tag LOCUS_02400 101473 101763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 102421 101771 gene locus_tag LOCUS_02410 102421 101771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 102827 102456 gene locus_tag LOCUS_02420 102827 102456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 102990 104306 gene locus_tag LOCUS_02430 gene rimO 102990 104306 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_02430 104314 105870 gene locus_tag LOCUS_02440 gene bshC 104314 105870 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_02440 105858 106439 gene locus_tag LOCUS_02450 gene ygfA 105858 106439 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_02450 106436 107395 gene locus_tag LOCUS_02460 106436 107395 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_02460 108466 107777 gene locus_tag LOCUS_02470 108466 107777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 109169 109327 gene locus_tag LOCUS_02480 109169 109327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 109694 112024 gene locus_tag LOCUS_02490 109694 112024 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02490 112028 112975 gene locus_tag LOCUS_02500 112028 112975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 113698 112982 gene locus_tag LOCUS_02510 113698 112982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_02510 114191 113706 gene locus_tag LOCUS_02520 gene ispF 114191 113706 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_02520 115425 114196 gene locus_tag LOCUS_02530 115425 114196 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_02530 115511 117478 gene locus_tag LOCUS_02540 gene bfmBA 115511 117478 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_02540 117547 118164 gene locus_tag LOCUS_02550 117547 118164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 118164 118508 gene locus_tag LOCUS_02560 gene ytxJ 118164 118508 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_02560 118960 119670 gene locus_tag LOCUS_02570 118960 119670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 119695 120585 gene locus_tag LOCUS_02580 gene lipA 119695 120585 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_02580 121420 120638 gene locus_tag LOCUS_02590 121420 120638 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_02590 122893 121787 gene locus_tag LOCUS_02600 122893 121787 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_02600 123966 122890 gene locus_tag LOCUS_02610 123966 122890 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861701.1 protein_id gnl|my_center|LOCUS_02610 125312 123963 gene locus_tag LOCUS_02620 125312 123963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 127016 125478 gene locus_tag LOCUS_02630 127016 125478 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_02630 127933 127343 gene locus_tag LOCUS_02640 gene gmhA 127933 127343 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45093 protein_id gnl|my_center|LOCUS_02640 128285 127920 gene locus_tag LOCUS_02650 128285 127920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 130188 128338 gene locus_tag LOCUS_02660 gene msbA 130188 128338 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_02660 130473 130715 gene locus_tag LOCUS_02670 gene rpmE2 130473 130715 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_02670 130781 131980 gene locus_tag LOCUS_02680 130781 131980 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_02680 131996 133120 gene locus_tag LOCUS_02690 gene holB 131996 133120 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_02690 133113 134027 gene locus_tag LOCUS_02700 gene hemC 133113 134027 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ26 protein_id gnl|my_center|LOCUS_02700 134064 134885 gene locus_tag LOCUS_02710 134064 134885 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_02710 134882 135787 gene locus_tag LOCUS_02720 134882 135787 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_02720 136336 135806 gene locus_tag LOCUS_02730 136336 135806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 136722 136339 gene locus_tag LOCUS_02740 136722 136339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 138158 136914 gene locus_tag LOCUS_02750 138158 136914 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_02750 140133 138169 gene locus_tag LOCUS_02760 gene dsbD 140133 138169 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_02760 141532 140159 gene locus_tag LOCUS_02770 141532 140159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_02770 146468 141600 gene locus_tag LOCUS_02780 146468 141600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 147330 146500 gene locus_tag LOCUS_02790 gene prmA 147330 146500 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_02790 147647 147327 gene locus_tag LOCUS_02800 147647 147327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 148410 147649 gene locus_tag LOCUS_02810 gene tpiA 148410 147649 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_02810 151212 148414 gene locus_tag LOCUS_02820 gene uvrA1 151212 148414 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_02820 151387 151986 gene locus_tag LOCUS_02830 151387 151986 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_02830 151961 152194 gene locus_tag LOCUS_02840 151961 152194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 152242 152886 gene locus_tag LOCUS_02850 gene nth 152242 152886 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_02850 153026 155203 gene locus_tag LOCUS_02860 153026 155203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 156697 156065 gene locus_tag LOCUS_02870 gene lspA 156697 156065 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_02870 160055 156687 gene locus_tag LOCUS_02880 gene ileS 160055 156687 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_02880 162462 160096 gene locus_tag LOCUS_02890 162462 160096 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_02890 163955 162618 gene locus_tag LOCUS_02900 gene dgt 163955 162618 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_02900 165756 164209 gene locus_tag LOCUS_02910 gene glyQS 165756 164209 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_02910 167834 165897 gene locus_tag LOCUS_02920 167834 165897 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_02920 168001 168660 gene locus_tag LOCUS_02930 168001 168660 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_02930 169977 168667 gene locus_tag LOCUS_02940 gene ugd 169977 168667 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_02940 170241 170435 gene locus_tag LOCUS_02950 gene rpsU 170241 170435 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_02950 170512 171387 gene locus_tag LOCUS_02960 gene xerC 170512 171387 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_02960 171411 171710 gene locus_tag LOCUS_02970 171411 171710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_02970 173210 171729 gene locus_tag LOCUS_02980 gene cysS 173210 171729 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_02980 173364 173813 gene locus_tag LOCUS_02990 gene rimP 173364 173813 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_02990 >Feature sequence003 1620 268 gene locus_tag LOCUS_03000 1620 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2777 1617 gene locus_tag LOCUS_03010 2777 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6103 2777 gene locus_tag LOCUS_03020 6103 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7605 6100 gene locus_tag LOCUS_03030 7605 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 10921 7631 gene locus_tag LOCUS_03040 10921 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 11802 11056 gene locus_tag LOCUS_03050 11802 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 12142 13764 gene locus_tag LOCUS_03060 12142 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13761 17093 gene locus_tag LOCUS_03070 13761 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 17341 35694 gene locus_tag LOCUS_03080 17341 35694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35712 36635 gene locus_tag LOCUS_03090 35712 36635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03090 36977 36639 gene locus_tag LOCUS_03100 36977 36639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267308.1 protein_id gnl|my_center|LOCUS_03100 37504 36974 gene locus_tag LOCUS_03110 37504 36974 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_03110 37549 38166 gene locus_tag LOCUS_03120 37549 38166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 38248 39708 gene locus_tag LOCUS_03130 gene miaB 38248 39708 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_03130 39719 40999 gene locus_tag LOCUS_03140 39719 40999 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_03140 40980 41504 gene locus_tag LOCUS_03150 40980 41504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_03150 41538 42845 gene locus_tag LOCUS_03160 41538 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 42846 43214 gene locus_tag LOCUS_03170 42846 43214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 43405 43683 gene locus_tag LOCUS_03180 gene groS 43405 43683 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_03180 43723 45372 gene locus_tag LOCUS_03190 gene groL 43723 45372 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_03190 46144 45443 gene locus_tag LOCUS_03200 gene truC 46144 45443 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_03200 46308 47087 gene locus_tag LOCUS_03210 46308 47087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 47172 48419 gene locus_tag LOCUS_03220 47172 48419 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_03220 48465 49754 gene locus_tag LOCUS_03230 gene bfmBB 48465 49754 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_03230 50001 50924 gene locus_tag LOCUS_03240 50001 50924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_03240 50924 53821 gene locus_tag LOCUS_03250 50924 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_03250 54129 53884 gene locus_tag LOCUS_03260 54129 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 56784 55117 gene locus_tag LOCUS_03270 56784 55117 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_03270 56937 57443 gene locus_tag LOCUS_03280 56937 57443 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_03280 57430 58179 gene locus_tag LOCUS_03290 57430 58179 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_03290 58325 59809 gene locus_tag LOCUS_03300 58325 59809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 59806 62250 gene locus_tag LOCUS_03310 59806 62250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_03310 62255 63154 gene locus_tag LOCUS_03320 62255 63154 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_03320 63151 64062 gene locus_tag LOCUS_03330 63151 64062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 64052 64603 gene locus_tag LOCUS_03340 64052 64603 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088749.1 protein_id gnl|my_center|LOCUS_03340 64600 65289 gene locus_tag LOCUS_03350 gene spsF 64600 65289 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_03350 65282 66316 gene locus_tag LOCUS_03360 gene legI 65282 66316 CDS product N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8T1 protein_id gnl|my_center|LOCUS_03360 66313 67425 gene locus_tag LOCUS_03370 66313 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 67427 68815 gene locus_tag LOCUS_03380 67427 68815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 69303 69641 gene locus_tag LOCUS_03390 69303 69641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 69796 70005 gene locus_tag LOCUS_03400 69796 70005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03400 70161 70562 gene locus_tag LOCUS_03410 70161 70562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03410 70572 71555 gene locus_tag LOCUS_03420 70572 71555 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_03420 71957 72928 gene locus_tag LOCUS_03430 gene pfkA 71957 72928 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_03430 73831 72917 gene locus_tag LOCUS_03440 gene miaA1 73831 72917 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_03440 74658 74933 gene locus_tag LOCUS_03450 74658 74933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 74930 75691 gene locus_tag LOCUS_03460 gene phnP 74930 75691 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_03460 75691 77214 gene locus_tag LOCUS_03470 gene fbpA 75691 77214 CDS product fibronectin-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_03470 78665 77211 gene locus_tag LOCUS_03480 78665 77211 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_03480 79077 78652 gene locus_tag LOCUS_03490 79077 78652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 79265 79501 gene locus_tag LOCUS_03500 gene acpP 79265 79501 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_03500 79518 80771 gene locus_tag LOCUS_03510 gene fabF 79518 80771 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_03510 80771 81517 gene locus_tag LOCUS_03520 gene rnc 80771 81517 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV9 protein_id gnl|my_center|LOCUS_03520 81510 83345 gene locus_tag LOCUS_03530 gene nadE 81510 83345 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_03530 83747 85084 gene locus_tag LOCUS_03540 83747 85084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 85698 85081 gene locus_tag LOCUS_03550 85698 85081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 87524 87598 gene locus_tag LOCUS_t00040 87524 87598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87988 88377 gene locus_tag LOCUS_03560 87988 88377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 88451 92242 gene locus_tag LOCUS_03570 88451 92242 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_03570 92239 93468 gene locus_tag LOCUS_03580 92239 93468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 93465 95177 gene locus_tag LOCUS_03590 93465 95177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 95187 95720 gene locus_tag LOCUS_03600 95187 95720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 95817 96215 gene locus_tag LOCUS_03610 95817 96215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 96457 97665 gene locus_tag LOCUS_03620 96457 97665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_03620 98101 99327 gene locus_tag LOCUS_03630 gene rhlE 98101 99327 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_03630 100641 99331 gene locus_tag LOCUS_03640 gene dbpA 100641 99331 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_03640 101241 100723 gene locus_tag LOCUS_03650 gene paiA 101241 100723 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_03650 102930 101356 gene locus_tag LOCUS_03660 102930 101356 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_03660 104492 103182 gene locus_tag LOCUS_03670 104492 103182 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_03670 105105 104497 gene locus_tag LOCUS_03680 105105 104497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_03680 106061 105105 gene locus_tag LOCUS_03690 gene etfA 106061 105105 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_03690 106798 106061 gene locus_tag LOCUS_03700 gene etfB 106798 106061 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_03700 106862 107200 gene locus_tag LOCUS_03710 106862 107200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 108764 107217 gene locus_tag LOCUS_03720 gene dnaB 108764 107217 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_03720 108928 109539 gene locus_tag LOCUS_03730 108928 109539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 109546 110349 gene locus_tag LOCUS_03740 109546 110349 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_03740 110397 112574 gene locus_tag LOCUS_03750 110397 112574 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_03750 114360 112561 gene locus_tag LOCUS_03760 114360 112561 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_03760 114606 115682 gene locus_tag LOCUS_03770 114606 115682 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 protein_id gnl|my_center|LOCUS_03770 115699 116124 gene locus_tag LOCUS_03780 115699 116124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 116753 116172 gene locus_tag LOCUS_03790 116753 116172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 118074 116914 gene locus_tag LOCUS_03800 gene nhaP 118074 116914 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_03800 118013 118222 gene locus_tag LOCUS_03810 118013 118222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 118393 119607 gene locus_tag LOCUS_03820 gene dacB 118393 119607 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_03820 119742 122873 gene locus_tag LOCUS_03830 119742 122873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03830 122918 124129 gene locus_tag LOCUS_03840 122918 124129 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_03840 124182 124505 gene locus_tag LOCUS_03850 124182 124505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 124518 125024 gene locus_tag LOCUS_03860 124518 125024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 125988 125014 gene locus_tag LOCUS_03870 125988 125014 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_03870 126562 126050 gene locus_tag LOCUS_03880 126562 126050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 127011 126619 gene locus_tag LOCUS_03890 127011 126619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03890 127415 126903 gene locus_tag LOCUS_03900 127415 126903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03900 129245 127860 gene locus_tag LOCUS_03910 gene pntB 129245 127860 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNS8 protein_id gnl|my_center|LOCUS_03910 129573 129268 gene locus_tag LOCUS_03920 129573 129268 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_03920 130678 129596 gene locus_tag LOCUS_03930 gene pntA 130678 129596 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_03930 133327 131081 gene locus_tag LOCUS_03940 133327 131081 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_03940 133446 134123 gene locus_tag LOCUS_03950 gene sirR 133446 134123 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_03950 134767 134306 gene locus_tag LOCUS_03960 134767 134306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 134949 135326 gene locus_tag LOCUS_03970 134949 135326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 136218 137831 gene locus_tag LOCUS_03980 gene yidK 136218 137831 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_03980 137835 138332 gene locus_tag LOCUS_03990 137835 138332 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_03990 139652 138327 gene locus_tag LOCUS_04000 139652 138327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_04000 140784 139756 gene locus_tag LOCUS_04010 140784 139756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_04010 141562 140879 gene locus_tag LOCUS_04020 141562 140879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_04020 142784 141567 gene locus_tag LOCUS_04030 142784 141567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_04030 143890 142781 gene locus_tag LOCUS_04040 143890 142781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 144738 143995 gene locus_tag LOCUS_04050 144738 143995 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_04050 145313 144735 gene locus_tag LOCUS_04060 145313 144735 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence004 1247 177 gene locus_tag LOCUS_04070 1247 177 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_04070 1990 1262 gene locus_tag LOCUS_04080 gene fabG 1990 1262 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971549.1 protein_id gnl|my_center|LOCUS_04080 2362 4485 gene locus_tag LOCUS_04090 gene susB 2362 4485 CDS product glucan 1,4-alpha-glucosidase SusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G8JZS4 protein_id gnl|my_center|LOCUS_04090 4729 5469 gene locus_tag LOCUS_04100 4729 5469 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_04100 5574 7010 gene locus_tag LOCUS_04110 5574 7010 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_04110 7300 7521 gene locus_tag LOCUS_04120 7300 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8330 7743 gene locus_tag LOCUS_04130 8330 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 8533 9498 gene locus_tag LOCUS_04140 8533 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 9491 10564 gene locus_tag LOCUS_04150 9491 10564 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_04150 11040 10561 gene locus_tag LOCUS_04160 11040 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 11362 11093 gene locus_tag LOCUS_04170 11362 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 12864 11584 gene locus_tag LOCUS_04180 gene eno 12864 11584 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KNX9 protein_id gnl|my_center|LOCUS_04180 13970 12861 gene locus_tag LOCUS_04190 gene carA 13970 12861 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_04190 14639 14085 gene locus_tag LOCUS_04200 14639 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15625 14636 gene locus_tag LOCUS_04210 gene rpoA 15625 14636 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_04210 16260 15655 gene locus_tag LOCUS_04220 gene rpsD 16260 15655 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_04220 16677 16285 gene locus_tag LOCUS_04230 gene rpsK 16677 16285 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_04230 17064 16687 gene locus_tag LOCUS_04240 gene rpsM 17064 16687 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_04240 17406 17188 gene locus_tag LOCUS_04250 gene infA 17406 17188 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN0 protein_id gnl|my_center|LOCUS_04250 18719 17406 gene locus_tag LOCUS_04260 gene secY 18719 17406 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_04260 19168 18719 gene locus_tag LOCUS_04270 gene rplO 19168 18719 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_04270 19352 19170 gene locus_tag LOCUS_04280 gene rpmD 19352 19170 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q927M5 protein_id gnl|my_center|LOCUS_04280 19871 19353 gene locus_tag LOCUS_04290 gene rpsE 19871 19353 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_04290 20224 19877 gene locus_tag LOCUS_04300 gene rplR 20224 19877 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRH6 protein_id gnl|my_center|LOCUS_04300 20784 20233 gene locus_tag LOCUS_04310 gene rplF 20784 20233 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_04310 21192 20794 gene locus_tag LOCUS_04320 gene rpsH 21192 20794 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_04320 21544 21275 gene locus_tag LOCUS_04330 gene rpsN 21544 21275 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_04330 22106 21552 gene locus_tag LOCUS_04340 gene rplE 22106 21552 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_04340 22434 22108 gene locus_tag LOCUS_04350 gene rplX 22434 22108 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_04350 22805 22437 gene locus_tag LOCUS_04360 gene rplN 22805 22437 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_04360 23061 22807 gene locus_tag LOCUS_04370 gene rpsQ 23061 22807 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_04370 23263 23069 gene locus_tag LOCUS_04380 gene rpmC 23263 23069 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_04380 23679 23260 gene locus_tag LOCUS_04390 gene rplP 23679 23260 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_04390 24423 23698 gene locus_tag LOCUS_04400 gene rpsC 24423 23698 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_04400 24906 24427 gene locus_tag LOCUS_04410 gene rplV 24906 24427 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_04410 25181 24906 gene locus_tag LOCUS_04420 gene rpsS 25181 24906 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_04420 26002 25181 gene locus_tag LOCUS_04430 gene rplB 26002 25181 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_04430 26300 26013 gene locus_tag LOCUS_04440 gene rplW 26300 26013 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_04440 26926 26300 gene locus_tag LOCUS_04450 gene rplD 26926 26300 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_04450 27562 26930 gene locus_tag LOCUS_04460 gene rplC 27562 26930 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_04460 28033 27728 gene locus_tag LOCUS_04470 gene rpsJ 28033 27728 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_04470 30152 28053 gene locus_tag LOCUS_04480 gene fusA 30152 28053 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_04480 30631 30164 gene locus_tag LOCUS_04490 gene rpsG 30631 30164 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_04490 31021 30641 gene locus_tag LOCUS_04500 gene rpsL 31021 30641 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_04500 31430 31113 gene locus_tag LOCUS_04510 31430 31113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_04510 35741 31431 gene locus_tag LOCUS_04520 gene rpoC 35741 31431 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_04520 39651 35779 gene locus_tag LOCUS_04530 gene rpoB 39651 35779 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_04530 40136 39762 gene locus_tag LOCUS_04540 gene rplL 40136 39762 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_04540 40693 40166 gene locus_tag LOCUS_04550 gene rplJ 40693 40166 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q3 protein_id gnl|my_center|LOCUS_04550 41393 40695 gene locus_tag LOCUS_04560 gene rplA 41393 40695 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_04560 41855 41403 gene locus_tag LOCUS_04570 gene rplK 41855 41403 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_04570 42414 41857 gene locus_tag LOCUS_04580 gene nusG 42414 41857 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_04580 42608 42417 gene locus_tag LOCUS_04590 gene secE 42608 42417 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ1 protein_id gnl|my_center|LOCUS_04590 42693 42620 gene locus_tag LOCUS_t00050 42693 42620 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 43980 42793 gene locus_tag LOCUS_04600 gene tuf 43980 42793 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_04600 44237 44165 gene locus_tag LOCUS_t00060 44237 44165 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 44388 44315 gene locus_tag LOCUS_t00070 44388 44315 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44491 44408 gene locus_tag LOCUS_t00080 44491 44408 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 44778 45107 gene locus_tag LOCUS_04610 44778 45107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 45356 46060 gene locus_tag LOCUS_04620 gene pyrH 45356 46060 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_04620 46065 46625 gene locus_tag LOCUS_04630 gene frr 46065 46625 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ0 protein_id gnl|my_center|LOCUS_04630 47194 46622 gene locus_tag LOCUS_04640 gene nadD 47194 46622 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_04640 47766 47191 gene locus_tag LOCUS_04650 gene gmk 47766 47191 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_04650 48667 48047 gene locus_tag LOCUS_04660 48667 48047 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_04660 49187 50317 gene locus_tag LOCUS_04670 49187 50317 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_04670 50444 51283 gene locus_tag LOCUS_04680 50444 51283 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122210.1 protein_id gnl|my_center|LOCUS_04680 52569 51271 gene locus_tag LOCUS_04690 gene ahcY 52569 51271 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_04690 53379 52621 gene locus_tag LOCUS_04700 53379 52621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 53425 53826 gene locus_tag LOCUS_04710 gene rsfS 53425 53826 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L3 protein_id gnl|my_center|LOCUS_04710 53887 55944 gene locus_tag LOCUS_04720 gene ftsH 53887 55944 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_04720 55993 56772 gene locus_tag LOCUS_04730 gene lpxH 55993 56772 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04730 56839 57912 gene locus_tag LOCUS_04740 56839 57912 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_04740 57913 58956 gene locus_tag LOCUS_04750 57913 58956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 61491 58960 gene locus_tag LOCUS_04760 gene chb 61491 58960 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_04760 62055 61540 gene locus_tag LOCUS_04770 gene pyrR2 62055 61540 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_04770 62536 62045 gene locus_tag LOCUS_04780 62536 62045 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_04780 63809 62652 gene locus_tag LOCUS_04790 63809 62652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 64705 67659 gene locus_tag LOCUS_04800 64705 67659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_04800 68121 67783 gene locus_tag LOCUS_04810 68121 67783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 68355 70382 gene locus_tag LOCUS_04820 68355 70382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 70564 72267 gene locus_tag LOCUS_04830 70564 72267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 72380 74602 gene locus_tag LOCUS_04840 72380 74602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 75860 74649 gene locus_tag LOCUS_04850 gene nuoD 75860 74649 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_04850 76352 75870 gene locus_tag LOCUS_04860 76352 75870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 76882 76349 gene locus_tag LOCUS_04870 gene nuoB 76882 76349 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_04870 77346 76879 gene locus_tag LOCUS_04880 gene nuoA 77346 76879 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 protein_id gnl|my_center|LOCUS_04880 77516 77953 gene locus_tag LOCUS_04890 77516 77953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 77961 78755 gene locus_tag LOCUS_04900 77961 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 80489 78816 gene locus_tag LOCUS_04910 80489 78816 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_04910 81817 80588 gene locus_tag LOCUS_04920 gene hutI 81817 80588 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42084 protein_id gnl|my_center|LOCUS_04920 82943 81927 gene locus_tag LOCUS_04930 82943 81927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 84484 82940 gene locus_tag LOCUS_04940 84484 82940 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_04940 85803 84814 gene locus_tag LOCUS_04950 gene idiA 85803 84814 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_04950 87340 86072 gene locus_tag LOCUS_04960 87340 86072 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_04960 87501 87586 gene locus_tag LOCUS_t00090 87501 87586 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 88777 87866 gene locus_tag LOCUS_04970 88777 87866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 89664 89359 gene locus_tag LOCUS_04980 89664 89359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 90189 89839 gene locus_tag LOCUS_04990 90189 89839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 90536 90192 gene locus_tag LOCUS_05000 90536 90192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 91120 90755 gene locus_tag LOCUS_05010 91120 90755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 91415 91579 gene locus_tag LOCUS_05020 91415 91579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 91585 91905 gene locus_tag LOCUS_05030 91585 91905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 92063 92248 gene locus_tag LOCUS_05040 92063 92248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 92492 94054 gene locus_tag LOCUS_05050 92492 94054 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_05050 94235 95191 gene locus_tag LOCUS_05060 gene ilvA 94235 95191 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225180.1 protein_id gnl|my_center|LOCUS_05060 95439 96227 gene locus_tag LOCUS_05070 95439 96227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_05070 98483 96279 gene locus_tag LOCUS_05080 98483 96279 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_05080 98675 99697 gene locus_tag LOCUS_05090 gene adhP 98675 99697 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_05090 99796 100788 gene locus_tag LOCUS_05100 gene mtnK 99796 100788 CDS product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819F1 protein_id gnl|my_center|LOCUS_05100 102042 100771 gene locus_tag LOCUS_05110 102042 100771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_05110 102323 103666 gene locus_tag LOCUS_05120 102323 103666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 103670 105298 gene locus_tag LOCUS_05130 103670 105298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 105444 106193 gene locus_tag LOCUS_05140 105444 106193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_05140 108104 106197 gene locus_tag LOCUS_05150 108104 106197 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_05150 108740 108156 gene locus_tag LOCUS_05160 108740 108156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 108898 110256 gene locus_tag LOCUS_05170 gene rhlE 108898 110256 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_05170 110377 111195 gene locus_tag LOCUS_05180 gene yqkF 110377 111195 CDS product putative oxidoreductase YqkF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54569 protein_id gnl|my_center|LOCUS_05180 112299 111202 gene locus_tag LOCUS_05190 112299 111202 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_05190 112356 113660 gene locus_tag LOCUS_05200 112356 113660 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_05200 113657 114538 gene locus_tag LOCUS_05210 113657 114538 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_05210 117658 114572 gene locus_tag LOCUS_05220 117658 114572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 117880 119280 gene locus_tag LOCUS_05230 gene dnaA 117880 119280 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_05230 119518 121017 gene locus_tag LOCUS_05240 119518 121017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_05240 121025 122173 gene locus_tag LOCUS_05250 gene dxr 121025 122173 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A684 protein_id gnl|my_center|LOCUS_05250 122173 123486 gene locus_tag LOCUS_05260 122173 123486 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_05260 125481 123532 gene locus_tag LOCUS_05270 125481 123532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 125655 128126 gene locus_tag LOCUS_05280 gene lon 125655 128126 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_05280 128270 129109 gene locus_tag LOCUS_05290 128270 129109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 129112 130479 gene locus_tag LOCUS_05300 gene hslU 129112 130479 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_05300 130660 131652 gene locus_tag LOCUS_05310 gene argK 130660 131652 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_05310 132754 131657 gene locus_tag LOCUS_05320 132754 131657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_05320 134574 132751 gene locus_tag LOCUS_05330 134574 132751 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_05330 134947 135981 gene locus_tag LOCUS_05340 134947 135981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 135978 137042 gene locus_tag LOCUS_05350 135978 137042 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_05350 137039 138019 gene locus_tag LOCUS_05360 137039 138019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence005 227 745 gene locus_tag LOCUS_05370 gene sixA 227 745 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_05370 2207 756 gene locus_tag LOCUS_05380 2207 756 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_05380 3198 2524 gene locus_tag LOCUS_05390 3198 2524 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_05390 3369 4316 gene locus_tag LOCUS_05400 3369 4316 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_05400 4590 4901 gene locus_tag LOCUS_05410 4590 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05410 5093 6412 gene locus_tag LOCUS_05420 5093 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6622 8094 gene locus_tag LOCUS_05430 6622 8094 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_05430 8465 8268 gene locus_tag LOCUS_05440 8465 8268 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_05440 8736 8467 gene locus_tag LOCUS_05450 8736 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 9317 8904 gene locus_tag LOCUS_05460 9317 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10292 9639 gene locus_tag LOCUS_05470 10292 9639 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_05470 10485 10649 gene locus_tag LOCUS_05480 10485 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10924 11298 gene locus_tag LOCUS_05490 10924 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05490 11522 11917 gene locus_tag LOCUS_05500 11522 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13107 12199 gene locus_tag LOCUS_05510 13107 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13357 14394 gene locus_tag LOCUS_05520 13357 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_05520 14454 15338 gene locus_tag LOCUS_05530 gene aguB 14454 15338 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_05530 16143 15364 gene locus_tag LOCUS_05540 16143 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 16574 16104 gene locus_tag LOCUS_05550 16574 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05550 18143 16938 gene locus_tag LOCUS_05560 18143 16938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 19369 18179 gene locus_tag LOCUS_05570 19369 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 21309 19405 gene locus_tag LOCUS_05580 21309 19405 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_05580 24662 21375 gene locus_tag LOCUS_05590 24662 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 25960 24629 gene locus_tag LOCUS_05600 25960 24629 CDS product cephalosporin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108337.1 protein_id gnl|my_center|LOCUS_05600 28862 26049 gene locus_tag LOCUS_05610 28862 26049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 30202 28850 gene locus_tag LOCUS_05620 gene araE 30202 28850 CDS product arabinose-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96710 protein_id gnl|my_center|LOCUS_05620 31714 30206 gene locus_tag LOCUS_05630 31714 30206 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_05630 33363 31963 gene locus_tag LOCUS_05640 33363 31963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_05640 36111 33364 gene locus_tag LOCUS_05650 36111 33364 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05650 37625 36144 gene locus_tag LOCUS_05660 37625 36144 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_05660 40756 37625 gene locus_tag LOCUS_05670 40756 37625 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_05670 41637 40756 gene locus_tag LOCUS_05680 41637 40756 CDS product DUF4961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760969.1 protein_id gnl|my_center|LOCUS_05680 42122 41727 gene locus_tag LOCUS_05690 42122 41727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 42285 43040 gene locus_tag LOCUS_05700 42285 43040 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_05700 45216 43033 gene locus_tag LOCUS_05710 45216 43033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 46294 45200 gene locus_tag LOCUS_05720 46294 45200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 47219 46284 gene locus_tag LOCUS_05730 gene glcK 47219 46284 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254107.1 protein_id gnl|my_center|LOCUS_05730 47645 48010 gene locus_tag LOCUS_05740 47645 48010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 48130 49083 gene locus_tag LOCUS_05750 48130 49083 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978637.1 protein_id gnl|my_center|LOCUS_05750 49191 50402 gene locus_tag LOCUS_05760 49191 50402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 50606 50815 gene locus_tag LOCUS_05770 50606 50815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 51679 50870 gene locus_tag LOCUS_05780 51679 50870 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420070.1 protein_id gnl|my_center|LOCUS_05780 51999 52877 gene locus_tag LOCUS_05790 51999 52877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 53858 52953 gene locus_tag LOCUS_05800 53858 52953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_05800 54632 53907 gene locus_tag LOCUS_05810 54632 53907 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_05810 55629 55018 gene locus_tag LOCUS_05820 gene recR 55629 55018 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_05820 55917 55630 gene locus_tag LOCUS_05830 55917 55630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 55984 57426 gene locus_tag LOCUS_05840 55984 57426 CDS product sodium/iodide co-transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_05840 57750 57418 gene locus_tag LOCUS_05850 gene ogt2 57750 57418 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_05850 57790 58449 gene locus_tag LOCUS_05860 57790 58449 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930507.1 protein_id gnl|my_center|LOCUS_05860 58553 59263 gene locus_tag LOCUS_05870 58553 59263 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_05870 59273 59836 gene locus_tag LOCUS_05880 59273 59836 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_05880 59844 60911 gene locus_tag LOCUS_05890 gene ilvE 59844 60911 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_05890 60921 62321 gene locus_tag LOCUS_05900 60921 62321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 62664 63596 gene locus_tag LOCUS_05910 gene prfB 62664 63596 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_05910 63589 64773 gene locus_tag LOCUS_05920 63589 64773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014408.1 protein_id gnl|my_center|LOCUS_05920 64770 65420 gene locus_tag LOCUS_05930 64770 65420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_05930 66577 65453 gene locus_tag LOCUS_05940 gene dnaJ 66577 65453 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_05940 67139 66579 gene locus_tag LOCUS_05950 gene grpE 67139 66579 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_05950 68204 67221 gene locus_tag LOCUS_05960 gene obg 68204 67221 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_05960 68786 68211 gene locus_tag LOCUS_05970 gene adk 68786 68211 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_05970 69621 68824 gene locus_tag LOCUS_05980 69621 68824 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_05980 69818 70279 gene locus_tag LOCUS_05990 69818 70279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 70393 71415 gene locus_tag LOCUS_06000 gene hemE 70393 71415 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_06000 72415 71405 gene locus_tag LOCUS_06010 72415 71405 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_06010 73603 72419 gene locus_tag LOCUS_06020 73603 72419 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_06020 74651 73779 gene locus_tag LOCUS_06030 74651 73779 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_06030 76282 75077 gene locus_tag LOCUS_06040 76282 75077 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_06040 77676 76369 gene locus_tag LOCUS_06050 gene norM 77676 76369 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_06050 78892 82752 gene locus_tag LOCUS_06060 78892 82752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 82769 83350 gene locus_tag LOCUS_06070 gene rnhB 82769 83350 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_06070 83378 84154 gene locus_tag LOCUS_06080 gene exoA 83378 84154 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37454 protein_id gnl|my_center|LOCUS_06080 84164 85246 gene locus_tag LOCUS_06090 gene gcvT 84164 85246 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_06090 85251 85961 gene locus_tag LOCUS_06100 gene comB 85251 85961 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM81 protein_id gnl|my_center|LOCUS_06100 86361 85951 gene locus_tag LOCUS_06110 86361 85951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_06110 86688 86362 gene locus_tag LOCUS_06120 86688 86362 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_06120 87591 86710 gene locus_tag LOCUS_06130 87591 86710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_06130 90894 87601 gene locus_tag LOCUS_06140 90894 87601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 91935 90898 gene locus_tag LOCUS_06150 gene fjo30 91935 90898 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_06150 91982 92620 gene locus_tag LOCUS_06160 91982 92620 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_06160 92617 93306 gene locus_tag LOCUS_06170 92617 93306 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_06170 93342 96692 gene locus_tag LOCUS_06180 gene porU 93342 96692 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_06180 96712 97917 gene locus_tag LOCUS_06190 gene porV 96712 97917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_06190 97914 99173 gene locus_tag LOCUS_06200 97914 99173 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_06200 101339 99153 gene locus_tag LOCUS_06210 101339 99153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 102605 101343 gene locus_tag LOCUS_06220 gene hemA 102605 101343 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_06220 103246 103521 gene locus_tag LOCUS_06230 103246 103521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 103528 107526 gene locus_tag LOCUS_06240 103528 107526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 107974 107513 gene locus_tag LOCUS_06250 107974 107513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 109361 108084 gene locus_tag LOCUS_06260 gene purD 109361 108084 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_06260 111587 109404 gene locus_tag LOCUS_06270 111587 109404 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_06270 111768 112841 gene locus_tag LOCUS_06280 111768 112841 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_06280 113620 112838 gene locus_tag LOCUS_06290 113620 112838 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_06290 114684 113581 gene locus_tag LOCUS_06300 114684 113581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 114847 115617 gene locus_tag LOCUS_06310 114847 115617 CDS product putative S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUV5 protein_id gnl|my_center|LOCUS_06310 115632 116111 gene locus_tag LOCUS_06320 gene nlpC 115632 116111 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 protein_id gnl|my_center|LOCUS_06320 116145 116219 gene locus_tag LOCUS_t00100 116145 116219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 116711 116854 gene locus_tag LOCUS_06330 116711 116854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 117290 118249 gene locus_tag LOCUS_06340 117290 118249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 118394 119380 gene locus_tag LOCUS_06350 118394 119380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence006 338 1045 gene locus_tag LOCUS_06360 338 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_06360 1218 1757 gene locus_tag LOCUS_06370 1218 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1782 2510 gene locus_tag LOCUS_06380 1782 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2536 3399 gene locus_tag LOCUS_06390 2536 3399 CDS product UPF0719 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67364 protein_id gnl|my_center|LOCUS_06390 3387 4940 gene locus_tag LOCUS_06400 gene speE2 3387 4940 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 protein_id gnl|my_center|LOCUS_06400 6439 4937 gene locus_tag LOCUS_06410 6439 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7420 6440 gene locus_tag LOCUS_06420 7420 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 8397 7630 gene locus_tag LOCUS_06430 8397 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8647 8384 gene locus_tag LOCUS_06440 8647 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8795 10009 gene locus_tag LOCUS_06450 8795 10009 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_06450 10006 10389 gene locus_tag LOCUS_06460 10006 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 12740 10503 gene locus_tag LOCUS_06470 gene katG 12740 10503 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_06470 13004 13942 gene locus_tag LOCUS_06480 gene oxyR 13004 13942 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_06480 15272 14292 gene locus_tag LOCUS_06490 15272 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 15796 15269 gene locus_tag LOCUS_06500 15796 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 16551 16132 gene locus_tag LOCUS_06510 16551 16132 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403506.1 protein_id gnl|my_center|LOCUS_06510 16717 17193 gene locus_tag LOCUS_06520 16717 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889516.1 protein_id gnl|my_center|LOCUS_06520 17445 18545 gene locus_tag LOCUS_06530 17445 18545 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_06530 18546 19457 gene locus_tag LOCUS_06540 gene rsgA2 18546 19457 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_06540 20373 19582 gene locus_tag LOCUS_06550 20373 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06550 20772 20467 gene locus_tag LOCUS_06560 20772 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06560 21215 22342 gene locus_tag LOCUS_06570 21215 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 23242 22901 gene locus_tag LOCUS_06580 23242 22901 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_06580 23832 23248 gene locus_tag LOCUS_06590 23832 23248 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_06590 25274 23847 gene locus_tag LOCUS_06600 25274 23847 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_06600 27112 25454 gene locus_tag LOCUS_06610 27112 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 29503 27236 gene locus_tag LOCUS_06620 gene uvrD 29503 27236 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_06620 29673 30494 gene locus_tag LOCUS_06630 29673 30494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 31540 30491 gene locus_tag LOCUS_06640 31540 30491 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_06640 31731 32138 gene locus_tag LOCUS_06650 31731 32138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212298.1 protein_id gnl|my_center|LOCUS_06650 33288 32146 gene locus_tag LOCUS_06660 33288 32146 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_06660 33885 33340 gene locus_tag LOCUS_06670 33885 33340 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749H7 protein_id gnl|my_center|LOCUS_06670 35167 33878 gene locus_tag LOCUS_06680 35167 33878 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_06680 36545 35193 gene locus_tag LOCUS_06690 36545 35193 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_06690 36965 38338 gene locus_tag LOCUS_06700 36965 38338 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_06700 38344 42297 gene locus_tag LOCUS_06710 38344 42297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 42435 43274 gene locus_tag LOCUS_06720 gene murI 42435 43274 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E4 protein_id gnl|my_center|LOCUS_06720 43447 44460 gene locus_tag LOCUS_06730 gene nuoH 43447 44460 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_06730 44430 45104 gene locus_tag LOCUS_06740 gene ndhI 44430 45104 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_06740 45097 45591 gene locus_tag LOCUS_06750 45097 45591 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012812.1 protein_id gnl|my_center|LOCUS_06750 45584 45889 gene locus_tag LOCUS_06760 gene nuoK 45584 45889 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJU0 protein_id gnl|my_center|LOCUS_06760 45892 47817 gene locus_tag LOCUS_06770 45892 47817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 47819 49441 gene locus_tag LOCUS_06780 gene ndhD 47819 49441 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_06780 49450 50853 gene locus_tag LOCUS_06790 gene nuoN2 49450 50853 CDS product NADH-quinone oxidoreductase subunit N 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL23 protein_id gnl|my_center|LOCUS_06790 50850 52736 gene locus_tag LOCUS_06800 gene purF 50850 52736 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_06800 53094 52768 gene locus_tag LOCUS_06810 gene sufA 53094 52768 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_06810 53020 53595 gene locus_tag LOCUS_06820 53020 53595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 53695 55059 gene locus_tag LOCUS_06830 53695 55059 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_06830 55140 56324 gene locus_tag LOCUS_06840 gene irpA 55140 56324 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_06840 56324 57673 gene locus_tag LOCUS_06850 56324 57673 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_06850 57666 60140 gene locus_tag LOCUS_06860 gene fecA 57666 60140 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_06860 60362 61432 gene locus_tag LOCUS_06870 gene thiL 60362 61432 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_06870 62319 61750 gene locus_tag LOCUS_06880 gene yceI 62319 61750 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_06880 62628 63212 gene locus_tag LOCUS_06890 62628 63212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_06890 63505 63705 gene locus_tag LOCUS_06900 63505 63705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 64744 63803 gene locus_tag LOCUS_06910 gene thrB 64744 63803 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_06910 66210 64759 gene locus_tag LOCUS_06920 gene thrC2 66210 64759 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967249.1 protein_id gnl|my_center|LOCUS_06920 67165 66197 gene locus_tag LOCUS_06930 67165 66197 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_06930 68727 67282 gene locus_tag LOCUS_06940 68727 67282 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_06940 69833 68814 gene locus_tag LOCUS_06950 69833 68814 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_06950 70763 71377 gene locus_tag LOCUS_06960 70763 71377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 71704 71790 gene locus_tag LOCUS_t00110 71704 71790 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 71845 72897 gene locus_tag LOCUS_06970 71845 72897 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_06970 73558 72932 gene locus_tag LOCUS_06980 73558 72932 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXI9 protein_id gnl|my_center|LOCUS_06980 73785 73867 gene locus_tag LOCUS_t00120 73785 73867 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 75095 74319 gene locus_tag LOCUS_06990 gene fjo14 75095 74319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_06990 75179 76123 gene locus_tag LOCUS_07000 75179 76123 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_07000 76113 76550 gene locus_tag LOCUS_07010 76113 76550 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_07010 76835 77062 gene locus_tag LOCUS_07020 76835 77062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 77053 77409 gene locus_tag LOCUS_07030 77053 77409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07030 78313 80205 gene locus_tag LOCUS_07040 78313 80205 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_07040 81426 80233 gene locus_tag LOCUS_07050 gene pgk 81426 80233 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_07050 82431 81484 gene locus_tag LOCUS_07060 82431 81484 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_07060 82485 82652 gene locus_tag LOCUS_07070 82485 82652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 87254 83043 gene locus_tag LOCUS_07080 87254 83043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 87953 88417 gene locus_tag LOCUS_07090 87953 88417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 89223 89546 gene locus_tag LOCUS_07100 89223 89546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 90094 90573 gene locus_tag LOCUS_07110 90094 90573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 90602 91000 gene locus_tag LOCUS_07120 90602 91000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 91287 91970 gene locus_tag LOCUS_07130 91287 91970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 92102 92401 gene locus_tag LOCUS_07140 92102 92401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 92773 92630 gene locus_tag LOCUS_07150 92773 92630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 93233 93003 gene locus_tag LOCUS_07160 93233 93003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07160 93295 93660 gene locus_tag LOCUS_07170 93295 93660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 94340 93738 gene locus_tag LOCUS_07180 94340 93738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 94724 94545 gene locus_tag LOCUS_07190 94724 94545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 95294 95488 gene locus_tag LOCUS_07200 95294 95488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 95952 96881 gene locus_tag LOCUS_07210 95952 96881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 96941 98179 gene locus_tag LOCUS_07220 96941 98179 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_07220 99239 98184 gene locus_tag LOCUS_07230 gene gpsA 99239 98184 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_07230 100881 99217 gene locus_tag LOCUS_07240 100881 99217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 101814 100921 gene locus_tag LOCUS_07250 101814 100921 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_07250 101855 102871 gene locus_tag LOCUS_07260 101855 102871 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_07260 102905 105781 gene locus_tag LOCUS_07270 102905 105781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_07270 106118 105789 gene locus_tag LOCUS_07280 106118 105789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920128.1 protein_id gnl|my_center|LOCUS_07280 106838 106176 gene locus_tag LOCUS_07290 106838 106176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 108152 106953 gene locus_tag LOCUS_07300 108152 106953 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_07300 108406 108951 gene locus_tag LOCUS_07310 108406 108951 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_07310 109368 109045 gene locus_tag LOCUS_07320 109368 109045 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5L0 protein_id gnl|my_center|LOCUS_07320 113691 109474 gene locus_tag LOCUS_07330 gene dnaE 113691 109474 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence007 505 35 gene locus_tag LOCUS_07340 505 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1613 540 gene locus_tag LOCUS_07350 1613 540 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 protein_id gnl|my_center|LOCUS_07350 2688 1645 gene locus_tag LOCUS_07360 2688 1645 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_07360 2980 4521 gene locus_tag LOCUS_07370 2980 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4555 5100 gene locus_tag LOCUS_07380 gene pyrR1 4555 5100 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_07380 5097 6023 gene locus_tag LOCUS_07390 gene pyrB 5097 6023 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_07390 7370 6024 gene locus_tag LOCUS_07400 7370 6024 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_07400 7469 8548 gene locus_tag LOCUS_07410 gene paaE 7469 8548 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_07410 8603 9091 gene locus_tag LOCUS_07420 8603 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9987 9088 gene locus_tag LOCUS_07430 9987 9088 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253092.1 protein_id gnl|my_center|LOCUS_07430 10873 10148 gene locus_tag LOCUS_07440 gene terC 10873 10148 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_07440 11613 10918 gene locus_tag LOCUS_07450 11613 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12685 11672 gene locus_tag LOCUS_07460 12685 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_07460 12921 13703 gene locus_tag LOCUS_07470 12921 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13819 14808 gene locus_tag LOCUS_07480 13819 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14825 16027 gene locus_tag LOCUS_07490 14825 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 16210 17316 gene locus_tag LOCUS_07500 16210 17316 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_07500 18063 17341 gene locus_tag LOCUS_07510 18063 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 18941 18606 gene locus_tag LOCUS_07520 18941 18606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123234.1 protein_id gnl|my_center|LOCUS_07520 19428 19012 gene locus_tag LOCUS_07530 19428 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 19733 19542 gene locus_tag LOCUS_07540 19733 19542 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_07540 19681 19836 gene locus_tag LOCUS_07550 19681 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20275 21846 gene locus_tag LOCUS_07560 20275 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 21972 23033 gene locus_tag LOCUS_07570 21972 23033 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_07570 23092 26196 gene locus_tag LOCUS_07580 23092 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 26277 28523 gene locus_tag LOCUS_07590 26277 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 28641 30821 gene locus_tag LOCUS_07600 28641 30821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 32052 30970 gene locus_tag LOCUS_07610 gene fabH1 32052 30970 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_07610 33121 32204 gene locus_tag LOCUS_07620 33121 32204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 33851 33258 gene locus_tag LOCUS_07630 33851 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 34043 34915 gene locus_tag LOCUS_07640 34043 34915 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_07640 35679 36851 gene locus_tag LOCUS_07650 35679 36851 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_07650 37170 37796 gene locus_tag LOCUS_07660 37170 37796 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_07660 38256 37897 gene locus_tag LOCUS_07670 38256 37897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_07670 39821 38322 gene locus_tag LOCUS_07680 gene aldA 39821 38322 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_07680 40584 41171 gene locus_tag LOCUS_07690 40584 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 41158 41376 gene locus_tag LOCUS_07700 41158 41376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 41339 41677 gene locus_tag LOCUS_07710 41339 41677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 41688 42083 gene locus_tag LOCUS_07720 41688 42083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 42225 42467 gene locus_tag LOCUS_07730 42225 42467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 44253 42625 gene locus_tag LOCUS_07740 44253 42625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 44741 44256 gene locus_tag LOCUS_07750 44741 44256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 45346 45969 gene locus_tag LOCUS_07760 45346 45969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 45969 46376 gene locus_tag LOCUS_07770 45969 46376 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_07770 46369 47238 gene locus_tag LOCUS_07780 46369 47238 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_07780 47900 47256 gene locus_tag LOCUS_07790 gene yeeZ 47900 47256 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_07790 48548 48054 gene locus_tag LOCUS_07800 gene aspG 48548 48054 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_07800 49637 48558 gene locus_tag LOCUS_07810 49637 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 49755 50867 gene locus_tag LOCUS_07820 49755 50867 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_07820 50879 51580 gene locus_tag LOCUS_07830 50879 51580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 53259 51577 gene locus_tag LOCUS_07840 53259 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 53942 53304 gene locus_tag LOCUS_07850 53942 53304 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_07850 55196 53964 gene locus_tag LOCUS_07860 55196 53964 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_07860 55300 56286 gene locus_tag LOCUS_07870 55300 56286 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_07870 56333 57622 gene locus_tag LOCUS_07880 gene pepP 56333 57622 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_07880 57654 58313 gene locus_tag LOCUS_07890 57654 58313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_07890 58318 59625 gene locus_tag LOCUS_07900 gene murA 58318 59625 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_07900 59891 60172 gene locus_tag LOCUS_07910 59891 60172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 61251 60169 gene locus_tag LOCUS_07920 61251 60169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_07920 62040 61402 gene locus_tag LOCUS_07930 62040 61402 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_07930 63042 62215 gene locus_tag LOCUS_07940 gene pyrF 63042 62215 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_07940 63691 63059 gene locus_tag LOCUS_07950 63691 63059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 66216 63724 gene locus_tag LOCUS_07960 gene ftsK 66216 63724 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_07960 67283 66246 gene locus_tag LOCUS_07970 gene pyrD 67283 66246 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_07970 68182 67283 gene locus_tag LOCUS_07980 gene xerC 68182 67283 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_07980 68206 68625 gene locus_tag LOCUS_07990 gene aroQ 68206 68625 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_07990 68622 69674 gene locus_tag LOCUS_08000 68622 69674 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804964.1 protein_id gnl|my_center|LOCUS_08000 69725 70201 gene locus_tag LOCUS_08010 gene rnhA 69725 70201 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_08010 70191 70904 gene locus_tag LOCUS_08020 70191 70904 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_08020 72263 70938 gene locus_tag LOCUS_08030 72263 70938 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_08030 73039 72284 gene locus_tag LOCUS_08040 73039 72284 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_08040 73862 73092 gene locus_tag LOCUS_08050 73862 73092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 74533 73811 gene locus_tag LOCUS_08060 gene menG 74533 73811 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_08060 74518 75186 gene locus_tag LOCUS_08070 gene engB 74518 75186 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_08070 75243 75782 gene locus_tag LOCUS_08080 75243 75782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_08080 76175 75771 gene locus_tag LOCUS_08090 76175 75771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 76304 77341 gene locus_tag LOCUS_08100 76304 77341 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_08100 77400 79313 gene locus_tag LOCUS_08110 gene sglT 77400 79313 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_08110 79428 79754 gene locus_tag LOCUS_08120 79428 79754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 79878 80786 gene locus_tag LOCUS_08130 79878 80786 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_08130 80779 81822 gene locus_tag LOCUS_08140 80779 81822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_08140 81996 81826 gene locus_tag LOCUS_08150 81996 81826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 82061 82720 gene locus_tag LOCUS_08160 82061 82720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 82935 83669 gene locus_tag LOCUS_08170 82935 83669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 86580 83737 gene locus_tag LOCUS_08180 86580 83737 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_08180 88253 86718 gene locus_tag LOCUS_08190 88253 86718 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_08190 90868 88325 gene locus_tag LOCUS_08200 90868 88325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 91006 92214 gene locus_tag LOCUS_08210 91006 92214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 93433 92291 gene locus_tag LOCUS_08220 93433 92291 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_08220 94171 93566 gene locus_tag LOCUS_08230 94171 93566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 95716 94187 gene locus_tag LOCUS_08240 95716 94187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 95869 97923 gene locus_tag LOCUS_08250 gene dcp1 95869 97923 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence008 204 815 gene locus_tag LOCUS_08260 204 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 911 1372 gene locus_tag LOCUS_08270 911 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1488 1991 gene locus_tag LOCUS_08280 1488 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3595 2654 gene locus_tag LOCUS_08290 gene menE 3595 2654 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_08290 3876 4661 gene locus_tag LOCUS_08300 3876 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5492 4665 gene locus_tag LOCUS_08310 gene menB 5492 4665 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WQ8 protein_id gnl|my_center|LOCUS_08310 7146 5473 gene locus_tag LOCUS_08320 gene menD 7146 5473 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WR0 protein_id gnl|my_center|LOCUS_08320 8327 7143 gene locus_tag LOCUS_08330 8327 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_08330 8745 8308 gene locus_tag LOCUS_08340 8745 8308 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706462.1 protein_id gnl|my_center|LOCUS_08340 8938 9561 gene locus_tag LOCUS_08350 gene gpm 8938 9561 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_08350 9957 11090 gene locus_tag LOCUS_08360 9957 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 11308 11102 gene locus_tag LOCUS_08370 11308 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11758 11468 gene locus_tag LOCUS_08380 11758 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13563 11761 gene locus_tag LOCUS_08390 13563 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 14422 13649 gene locus_tag LOCUS_08400 14422 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15587 14517 gene locus_tag LOCUS_08410 gene ddlA 15587 14517 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNY7 protein_id gnl|my_center|LOCUS_08410 18608 15645 gene locus_tag LOCUS_08420 18608 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 18892 18644 gene locus_tag LOCUS_08430 18892 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 19993 18899 gene locus_tag LOCUS_08440 19993 18899 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_08440 20087 22015 gene locus_tag LOCUS_08450 gene dnaG 20087 22015 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_08450 22044 23258 gene locus_tag LOCUS_08460 gene ribBA 22044 23258 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_08460 23260 23856 gene locus_tag LOCUS_08470 23260 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 23859 24629 gene locus_tag LOCUS_08480 gene surE 23859 24629 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_08480 25270 24626 gene locus_tag LOCUS_08490 25270 24626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 26000 25272 gene locus_tag LOCUS_08500 26000 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 28459 25997 gene locus_tag LOCUS_08510 gene priA 28459 25997 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_08510 30544 28469 gene locus_tag LOCUS_08520 gene yyaL 30544 28469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 protein_id gnl|my_center|LOCUS_08520 31524 30559 gene locus_tag LOCUS_08530 31524 30559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_08530 32044 31601 gene locus_tag LOCUS_08540 gene rplI 32044 31601 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_08540 32303 32052 gene locus_tag LOCUS_08550 gene rpsR 32303 32052 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_08550 32668 32300 gene locus_tag LOCUS_08560 gene rpsF 32668 32300 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_08560 33674 32739 gene locus_tag LOCUS_08570 33674 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 34071 33820 gene locus_tag LOCUS_08580 34071 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 34820 34434 gene locus_tag LOCUS_08590 gene apaG 34820 34434 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_08590 35039 35701 gene locus_tag LOCUS_08600 gene ung 35039 35701 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V6 protein_id gnl|my_center|LOCUS_08600 37160 35727 gene locus_tag LOCUS_08610 gene lepB 37160 35727 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_08610 37883 37170 gene locus_tag LOCUS_08620 gene dapB 37883 37170 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_08620 38374 37892 gene locus_tag LOCUS_08630 38374 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 39356 38463 gene locus_tag LOCUS_08640 gene parB 39356 38463 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_08640 40134 39358 gene locus_tag LOCUS_08650 40134 39358 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_08650 42139 40319 gene locus_tag LOCUS_08660 gene yidC 42139 40319 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_08660 43798 42167 gene locus_tag LOCUS_08670 gene pyrG 43798 42167 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_08670 45049 43964 gene locus_tag LOCUS_08680 gene serC 45049 43964 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44336 protein_id gnl|my_center|LOCUS_08680 47073 45181 gene locus_tag LOCUS_08690 47073 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 48034 49308 gene locus_tag LOCUS_08700 gene actA 48034 49308 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_08700 49333 52422 gene locus_tag LOCUS_08710 gene actB 49333 52422 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_08710 52433 53797 gene locus_tag LOCUS_08720 gene actC 52433 53797 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_08720 53797 54327 gene locus_tag LOCUS_08730 gene actD 53797 54327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_08730 54329 54937 gene locus_tag LOCUS_08740 gene actE 54329 54937 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_08740 54944 56230 gene locus_tag LOCUS_08750 gene actF 54944 56230 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_08750 56246 57331 gene locus_tag LOCUS_08760 gene ctaC 56246 57331 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_08760 57339 59189 gene locus_tag LOCUS_08770 gene ctaD 57339 59189 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_08770 59210 60100 gene locus_tag LOCUS_08780 gene ctaB 59210 60100 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_08780 60100 60684 gene locus_tag LOCUS_08790 gene ctaE 60100 60684 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_08790 60694 61440 gene locus_tag LOCUS_08800 60694 61440 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 protein_id gnl|my_center|LOCUS_08800 61469 61795 gene locus_tag LOCUS_08810 61469 61795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 61931 62203 gene locus_tag LOCUS_08820 61931 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 62200 62769 gene locus_tag LOCUS_08830 gene yozB 62200 62769 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_08830 64701 66971 gene locus_tag LOCUS_08840 64701 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 67735 66986 gene locus_tag LOCUS_08850 67735 66986 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_08850 68463 67732 gene locus_tag LOCUS_08860 68463 67732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08860 68567 69262 gene locus_tag LOCUS_08870 68567 69262 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_08870 69304 71244 gene locus_tag LOCUS_08880 gene ispG 69304 71244 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1H5 protein_id gnl|my_center|LOCUS_08880 71653 72333 gene locus_tag LOCUS_08890 71653 72333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 75187 72416 gene locus_tag LOCUS_08900 gene leuS 75187 72416 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_08900 75391 76185 gene locus_tag LOCUS_08910 gene thyA 75391 76185 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_08910 76420 77850 gene locus_tag LOCUS_08920 76420 77850 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786410.1 protein_id gnl|my_center|LOCUS_08920 77852 79264 gene locus_tag LOCUS_08930 77852 79264 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_08930 79838 79254 gene locus_tag LOCUS_08940 79838 79254 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_08940 80223 79906 gene locus_tag LOCUS_08950 80223 79906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 81376 80204 gene locus_tag LOCUS_08960 81376 80204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 81460 82755 gene locus_tag LOCUS_08970 81460 82755 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_08970 82840 83013 gene locus_tag LOCUS_08980 82840 83013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 83324 83626 gene locus_tag LOCUS_08990 83324 83626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 83696 83992 gene locus_tag LOCUS_09000 83696 83992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 84891 84001 gene locus_tag LOCUS_09010 gene dapA 84891 84001 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_09010 85390 84893 gene locus_tag LOCUS_09020 85390 84893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 87426 85390 gene locus_tag LOCUS_09030 gene ligA 87426 85390 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_09030 87642 89066 gene locus_tag LOCUS_09040 87642 89066 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_09040 89100 89798 gene locus_tag LOCUS_09050 89100 89798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 89867 90664 gene locus_tag LOCUS_09060 89867 90664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 91888 90650 gene locus_tag LOCUS_09070 91888 90650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence009 23 736 gene locus_tag LOCUS_09080 23 736 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_09080 1133 876 gene locus_tag LOCUS_09090 1133 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6106 1754 gene locus_tag LOCUS_09100 6106 1754 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_09100 7046 6669 gene locus_tag LOCUS_09110 7046 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 7279 7079 gene locus_tag LOCUS_09120 7279 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 7744 10296 gene locus_tag LOCUS_09130 7744 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10402 12816 gene locus_tag LOCUS_09140 10402 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 12918 13988 gene locus_tag LOCUS_09150 12918 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14012 16966 gene locus_tag LOCUS_09160 14012 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 17095 19293 gene locus_tag LOCUS_09170 17095 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 19522 19932 gene locus_tag LOCUS_09180 19522 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225806.1 protein_id gnl|my_center|LOCUS_09180 20462 23488 gene locus_tag LOCUS_09190 20462 23488 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_09190 23508 25010 gene locus_tag LOCUS_09200 23508 25010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_09200 25097 26584 gene locus_tag LOCUS_09210 25097 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 26683 28755 gene locus_tag LOCUS_09220 26683 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 28821 31268 gene locus_tag LOCUS_09230 28821 31268 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_09230 31297 34110 gene locus_tag LOCUS_09240 31297 34110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 34161 34583 gene locus_tag LOCUS_09250 gene rbsD 34161 34583 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUH3 protein_id gnl|my_center|LOCUS_09250 34708 36471 gene locus_tag LOCUS_09260 34708 36471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 36674 38011 gene locus_tag LOCUS_09270 36674 38011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 38668 40293 gene locus_tag LOCUS_09280 38668 40293 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_09280 40354 41361 gene locus_tag LOCUS_09290 gene yjmD 40354 41361 CDS product putative zinc-type alcohol dehydrogenase-like protein YjmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35045 protein_id gnl|my_center|LOCUS_09290 41380 42237 gene locus_tag LOCUS_09300 41380 42237 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_09300 42215 43435 gene locus_tag LOCUS_09310 42215 43435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 43504 45132 gene locus_tag LOCUS_09320 gene araB 43504 45132 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIM8 protein_id gnl|my_center|LOCUS_09320 45129 45833 gene locus_tag LOCUS_09330 gene sgaE 45129 45833 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ETH6 protein_id gnl|my_center|LOCUS_09330 45864 47732 gene locus_tag LOCUS_09340 45864 47732 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_09340 47749 49224 gene locus_tag LOCUS_09350 gene araA 47749 49224 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_09350 51270 49546 gene locus_tag LOCUS_09360 51270 49546 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_09360 52341 51328 gene locus_tag LOCUS_09370 gene trpS 52341 51328 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_09370 52390 53457 gene locus_tag LOCUS_09380 52390 53457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 55286 53463 gene locus_tag LOCUS_09390 55286 53463 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_09390 57283 55325 gene locus_tag LOCUS_09400 gene gyrB 57283 55325 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_09400 57804 57427 gene locus_tag LOCUS_09410 57804 57427 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09410 59558 57801 gene locus_tag LOCUS_09420 59558 57801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 59645 60886 gene locus_tag LOCUS_09430 gene gcdH 59645 60886 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_09430 61461 62780 gene locus_tag LOCUS_09440 61461 62780 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_09440 62885 63952 gene locus_tag LOCUS_09450 62885 63952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 64135 65166 gene locus_tag LOCUS_09460 gene glnII 64135 65166 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_09460 66418 65240 gene locus_tag LOCUS_09470 gene argD 66418 65240 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_09470 67436 66486 gene locus_tag LOCUS_09480 gene tktC 67436 66486 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_09480 68280 67438 gene locus_tag LOCUS_09490 gene tktA 68280 67438 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_09490 69541 68444 gene locus_tag LOCUS_09500 69541 68444 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970073.1 protein_id gnl|my_center|LOCUS_09500 69640 69906 gene locus_tag LOCUS_09510 69640 69906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 70634 70179 gene locus_tag LOCUS_09520 70634 70179 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_09520 72361 70631 gene locus_tag LOCUS_09530 72361 70631 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_09530 73073 72465 gene locus_tag LOCUS_09540 73073 72465 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09540 74401 73079 gene locus_tag LOCUS_09550 74401 73079 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_09550 75180 74515 gene locus_tag LOCUS_09560 75180 74515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_09560 75837 75181 gene locus_tag LOCUS_09570 75837 75181 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 protein_id gnl|my_center|LOCUS_09570 77727 76492 gene locus_tag LOCUS_09580 77727 76492 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_09580 78387 77821 gene locus_tag LOCUS_09590 78387 77821 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_09590 78450 79979 gene locus_tag LOCUS_09600 gene guaA 78450 79979 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_09600 79979 81772 gene locus_tag LOCUS_09610 79979 81772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 81773 83071 gene locus_tag LOCUS_09620 gene hemL 81773 83071 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_09620 83867 83103 gene locus_tag LOCUS_09630 83867 83103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 85013 84267 gene locus_tag LOCUS_09640 gene kdsB 85013 84267 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_09640 86326 85010 gene locus_tag LOCUS_09650 86326 85010 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence010 1051 896 gene locus_tag LOCUS_09660 1051 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3044 1209 gene locus_tag LOCUS_09670 gene glmS 3044 1209 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_09670 4367 3051 gene locus_tag LOCUS_09680 4367 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5163 4351 gene locus_tag LOCUS_09690 5163 4351 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_09690 5280 6128 gene locus_tag LOCUS_09700 gene panC 5280 6128 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67891 protein_id gnl|my_center|LOCUS_09700 6404 7243 gene locus_tag LOCUS_09710 6404 7243 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_09710 7230 7703 gene locus_tag LOCUS_09720 7230 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7707 8402 gene locus_tag LOCUS_09730 7707 8402 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_09730 8471 9613 gene locus_tag LOCUS_09740 8471 9613 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09740 10001 10297 gene locus_tag LOCUS_09750 10001 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10685 10347 gene locus_tag LOCUS_09760 10685 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 12284 11094 gene locus_tag LOCUS_09770 12284 11094 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_09770 12771 12277 gene locus_tag LOCUS_09780 12771 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 16100 12753 gene locus_tag LOCUS_09790 gene secA 16100 12753 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_09790 16988 16164 gene locus_tag LOCUS_09800 gene dapF 16988 16164 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_09800 17357 17004 gene locus_tag LOCUS_09810 gene rplS 17357 17004 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51642 protein_id gnl|my_center|LOCUS_09810 19462 17543 gene locus_tag LOCUS_09820 gene dnaK 19462 17543 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YW6 protein_id gnl|my_center|LOCUS_09820 19713 21299 gene locus_tag LOCUS_09830 gene prfC 19713 21299 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_09830 21306 22001 gene locus_tag LOCUS_09840 21306 22001 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09840 22436 24295 gene locus_tag LOCUS_09850 22436 24295 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203287.1 protein_id gnl|my_center|LOCUS_09850 24641 24384 gene locus_tag LOCUS_09860 24641 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 26144 24645 gene locus_tag LOCUS_09870 gene atpD 26144 24645 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_09870 26455 27411 gene locus_tag LOCUS_09880 26455 27411 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_09880 28435 27425 gene locus_tag LOCUS_09890 28435 27425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_09890 29669 28446 gene locus_tag LOCUS_09900 gene porY 29669 28446 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_09900 31002 29716 gene locus_tag LOCUS_09910 gene natB 31002 29716 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_09910 32008 30995 gene locus_tag LOCUS_09920 gene natA 32008 30995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_09920 32199 32936 gene locus_tag LOCUS_09930 32199 32936 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_09930 32955 33242 gene locus_tag LOCUS_09940 gene gatC 32955 33242 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y5 protein_id gnl|my_center|LOCUS_09940 33253 36036 gene locus_tag LOCUS_09950 33253 36036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 36047 37597 gene locus_tag LOCUS_09960 gene hutH 36047 37597 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_09960 39617 37617 gene locus_tag LOCUS_09970 gene hutU 39617 37617 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_09970 40439 39765 gene locus_tag LOCUS_09980 40439 39765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 41006 40632 gene locus_tag LOCUS_09990 gene gcvH 41006 40632 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_09990 48191 41064 gene locus_tag LOCUS_10000 gene sprA 48191 41064 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_10000 48861 48271 gene locus_tag LOCUS_10010 gene ruvA 48861 48271 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_10010 51142 48854 gene locus_tag LOCUS_10020 gene maeB 51142 48854 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_10020 52154 51159 gene locus_tag LOCUS_10030 52154 51159 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_10030 53623 52271 gene locus_tag LOCUS_10040 53623 52271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 55050 53629 gene locus_tag LOCUS_10050 gene gatA 55050 53629 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_10050 55260 55057 gene locus_tag LOCUS_10060 gene tatA 55260 55057 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B9 protein_id gnl|my_center|LOCUS_10060 56455 55307 gene locus_tag LOCUS_10070 56455 55307 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_10070 57212 56478 gene locus_tag LOCUS_10080 57212 56478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 58890 57205 gene locus_tag LOCUS_10090 58890 57205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_10090 60468 58972 gene locus_tag LOCUS_10100 60468 58972 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_10100 61254 60472 gene locus_tag LOCUS_10110 gene crt 61254 60472 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_10110 62271 61336 gene locus_tag LOCUS_10120 gene ltd 62271 61336 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_10120 62599 63786 gene locus_tag LOCUS_10130 gene kbl 62599 63786 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_10130 64631 63798 gene locus_tag LOCUS_10140 64631 63798 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_10140 65476 64640 gene locus_tag LOCUS_10150 gene folP 65476 64640 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_10150 65541 66080 gene locus_tag LOCUS_10160 65541 66080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10160 66112 67197 gene locus_tag LOCUS_10170 66112 67197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_10170 67197 67715 gene locus_tag LOCUS_10180 gene aroK 67197 67715 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_10180 69239 67689 gene locus_tag LOCUS_10190 69239 67689 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_10190 70666 69308 gene locus_tag LOCUS_10200 70666 69308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 70791 72266 gene locus_tag LOCUS_10210 gene proS 70791 72266 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_10210 72250 72735 gene locus_tag LOCUS_10220 72250 72735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 72739 73749 gene locus_tag LOCUS_10230 72739 73749 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_10230 74745 73789 gene locus_tag LOCUS_10240 gene kipA 74745 73789 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WY77 protein_id gnl|my_center|LOCUS_10240 75391 74726 gene locus_tag LOCUS_10250 75391 74726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 76149 75391 gene locus_tag LOCUS_10260 76149 75391 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH05 protein_id gnl|my_center|LOCUS_10260 >Feature sequence011 719 204 gene locus_tag LOCUS_10270 719 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_10270 1360 716 gene locus_tag LOCUS_10280 1360 716 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_10280 3038 1401 gene locus_tag LOCUS_10290 3038 1401 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_10290 3042 3251 gene locus_tag LOCUS_10300 3042 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4694 3687 gene locus_tag LOCUS_10310 4694 3687 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_10310 5607 4699 gene locus_tag LOCUS_10320 gene glpQ 5607 4699 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_10320 6665 5601 gene locus_tag LOCUS_10330 6665 5601 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932560.1 protein_id gnl|my_center|LOCUS_10330 7570 6668 gene locus_tag LOCUS_10340 7570 6668 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_10340 7787 9400 gene locus_tag LOCUS_10350 7787 9400 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_10350 9415 10923 gene locus_tag LOCUS_10360 9415 10923 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_10360 10972 12297 gene locus_tag LOCUS_10370 gene xylA 10972 12297 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_10370 13620 12328 gene locus_tag LOCUS_10380 13620 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 15404 13788 gene locus_tag LOCUS_10390 15404 13788 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403138.1 protein_id gnl|my_center|LOCUS_10390 18341 15414 gene locus_tag LOCUS_10400 18341 15414 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_10400 21236 18483 gene locus_tag LOCUS_10410 21236 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 22975 21488 gene locus_tag LOCUS_10420 22975 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 24503 24428 gene locus_tag LOCUS_t00130 24503 24428 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25219 24569 gene locus_tag LOCUS_10430 25219 24569 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_10430 26496 25225 gene locus_tag LOCUS_10440 gene murF 26496 25225 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_10440 26529 26921 gene locus_tag LOCUS_10450 26529 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 27699 26908 gene locus_tag LOCUS_10460 27699 26908 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_10460 28259 27696 gene locus_tag LOCUS_10470 gene def 28259 27696 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_10470 28669 28256 gene locus_tag LOCUS_10480 28669 28256 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_10480 29398 28670 gene locus_tag LOCUS_10490 29398 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 29515 31137 gene locus_tag LOCUS_10500 29515 31137 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_10500 31752 32252 gene locus_tag LOCUS_10510 31752 32252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 33455 32274 gene locus_tag LOCUS_10520 gene chrA 33455 32274 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_10520 34166 33492 gene locus_tag LOCUS_10530 34166 33492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 36316 34163 gene locus_tag LOCUS_10540 36316 34163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_10540 36839 36309 gene locus_tag LOCUS_10550 gene tdk 36839 36309 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_10550 37131 38768 gene locus_tag LOCUS_10560 37131 38768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 40031 38769 gene locus_tag LOCUS_10570 gene rodA 40031 38769 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_10570 41814 40015 gene locus_tag LOCUS_10580 41814 40015 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_10580 43126 42323 gene locus_tag LOCUS_10590 gene mreC 43126 42323 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_10590 44155 43127 gene locus_tag LOCUS_10600 gene mreB 44155 43127 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_10600 45742 44216 gene locus_tag LOCUS_10610 gene purH 45742 44216 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_10610 46360 45788 gene locus_tag LOCUS_10620 gene purN 46360 45788 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_10620 47210 46353 gene locus_tag LOCUS_10630 47210 46353 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_10630 47961 47191 gene locus_tag LOCUS_10640 47961 47191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_10640 50493 47974 gene locus_tag LOCUS_10650 50493 47974 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_10650 50901 50497 gene locus_tag LOCUS_10660 50901 50497 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_10660 51122 50898 gene locus_tag LOCUS_10670 51122 50898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 51777 51115 gene locus_tag LOCUS_10680 51777 51115 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_10680 52480 51791 gene locus_tag LOCUS_10690 52480 51791 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_10690 52652 53707 gene locus_tag LOCUS_10700 gene rmlB 52652 53707 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_10700 53704 54570 gene locus_tag LOCUS_10710 gene rfbA 53704 54570 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_10710 54560 55099 gene locus_tag LOCUS_10720 gene rfbC 54560 55099 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_10720 55096 56040 gene locus_tag LOCUS_10730 55096 56040 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_10730 56101 56319 gene locus_tag LOCUS_10740 56101 56319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 56316 56912 gene locus_tag LOCUS_10750 gene cysC 56316 56912 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 protein_id gnl|my_center|LOCUS_10750 56909 57814 gene locus_tag LOCUS_10760 gene cysD 56909 57814 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_10760 57821 59086 gene locus_tag LOCUS_10770 gene cysN 57821 59086 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_10770 59101 59868 gene locus_tag LOCUS_10780 gene cysQ 59101 59868 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_10780 59983 62595 gene locus_tag LOCUS_10790 59983 62595 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_10790 62698 63666 gene locus_tag LOCUS_10800 62698 63666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 63674 64573 gene locus_tag LOCUS_10810 63674 64573 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_10810 64783 66063 gene locus_tag LOCUS_10820 64783 66063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 66056 67156 gene locus_tag LOCUS_10830 66056 67156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 67162 67824 gene locus_tag LOCUS_10840 67162 67824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 67858 68967 gene locus_tag LOCUS_10850 gene csp2G 67858 68967 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_10850 68957 70084 gene locus_tag LOCUS_10860 68957 70084 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_10860 71256 70060 gene locus_tag LOCUS_10870 71256 70060 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189631.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence012 56 1303 gene locus_tag LOCUS_10880 56 1303 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_10880 1348 1644 gene locus_tag LOCUS_10890 1348 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3152 1905 gene locus_tag LOCUS_10900 3152 1905 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_10900 3696 3538 gene locus_tag LOCUS_10910 3696 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4115 3945 gene locus_tag LOCUS_10920 4115 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4701 6158 gene locus_tag LOCUS_10930 4701 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6199 6942 gene locus_tag LOCUS_10940 6199 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7027 8523 gene locus_tag LOCUS_10950 7027 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8983 8762 gene locus_tag LOCUS_10960 8983 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 9618 9445 gene locus_tag LOCUS_10970 9618 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 10333 10497 gene locus_tag LOCUS_10980 10333 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 12258 11095 gene locus_tag LOCUS_10990 12258 11095 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_10990 12533 14797 gene locus_tag LOCUS_11000 gene acnA 12533 14797 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_11000 15802 15029 gene locus_tag LOCUS_11010 15802 15029 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_11010 18823 15998 gene locus_tag LOCUS_11020 18823 15998 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_11020 19218 21899 gene locus_tag LOCUS_11030 19218 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 22120 22938 gene locus_tag LOCUS_11040 22120 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 23325 23588 gene locus_tag LOCUS_11050 23325 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 24853 23597 gene locus_tag LOCUS_11060 24853 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 26361 25852 gene locus_tag LOCUS_11070 26361 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_11070 27541 26480 gene locus_tag LOCUS_11080 27541 26480 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_11080 29676 27703 gene locus_tag LOCUS_11090 29676 27703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 30876 29758 gene locus_tag LOCUS_11100 30876 29758 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_11100 31515 31351 gene locus_tag LOCUS_11110 31515 31351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33381 31924 gene locus_tag LOCUS_11120 33381 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 34029 33658 gene locus_tag LOCUS_11130 34029 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 34658 35350 gene locus_tag LOCUS_11140 34658 35350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 35355 36467 gene locus_tag LOCUS_11150 gene bchP 35355 36467 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933906.1 protein_id gnl|my_center|LOCUS_11150 37375 36473 gene locus_tag LOCUS_11160 37375 36473 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_11160 38108 37368 gene locus_tag LOCUS_11170 38108 37368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 38095 38232 gene locus_tag LOCUS_11180 38095 38232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 38347 39420 gene locus_tag LOCUS_11190 38347 39420 CDS product naringenin-chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_11190 40698 39487 gene locus_tag LOCUS_11200 40698 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 43272 40729 gene locus_tag LOCUS_11210 gene gyrA 43272 40729 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_11210 44295 43339 gene locus_tag LOCUS_11220 44295 43339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 44867 44523 gene locus_tag LOCUS_11230 44867 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 45490 45329 gene locus_tag LOCUS_11240 45490 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 47967 45622 gene locus_tag LOCUS_11250 47967 45622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_11250 48667 48014 gene locus_tag LOCUS_11260 gene rpe 48667 48014 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_11260 50238 48670 gene locus_tag LOCUS_11270 50238 48670 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_11270 51606 50470 gene locus_tag LOCUS_11280 gene mnmA 51606 50470 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_11280 51928 52530 gene locus_tag LOCUS_11290 51928 52530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 53098 52664 gene locus_tag LOCUS_11300 53098 52664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 53840 53178 gene locus_tag LOCUS_11310 gene trmB 53840 53178 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_11310 55117 53837 gene locus_tag LOCUS_11320 gene folC 55117 53837 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_11320 56052 55114 gene locus_tag LOCUS_11330 56052 55114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 56441 56049 gene locus_tag LOCUS_11340 56441 56049 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_11340 57115 56438 gene locus_tag LOCUS_11350 57115 56438 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_11350 58031 57246 gene locus_tag LOCUS_11360 58031 57246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 59792 58104 gene locus_tag LOCUS_11370 59792 58104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 62757 59785 gene locus_tag LOCUS_11380 62757 59785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 63876 62848 gene locus_tag LOCUS_11390 gene holA 63876 62848 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_11390 64018 65307 gene locus_tag LOCUS_11400 gene tyrS 64018 65307 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_11400 65355 65945 gene locus_tag LOCUS_11410 65355 65945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 66199 69348 gene locus_tag LOCUS_11420 66199 69348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_11420 70492 69350 gene locus_tag LOCUS_11430 70492 69350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence013 962 2425 gene locus_tag LOCUS_11440 962 2425 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_11440 3142 2456 gene locus_tag LOCUS_11450 3142 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3789 3148 gene locus_tag LOCUS_11460 3789 3148 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_11460 5433 3820 gene locus_tag LOCUS_11470 5433 3820 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_11470 5793 5542 gene locus_tag LOCUS_11480 5793 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6543 5851 gene locus_tag LOCUS_11490 6543 5851 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_11490 7038 8858 gene locus_tag LOCUS_11500 7038 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9008 10588 gene locus_tag LOCUS_11510 9008 10588 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_11510 10668 11630 gene locus_tag LOCUS_11520 10668 11630 CDS product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036238.1 protein_id gnl|my_center|LOCUS_11520 11768 12631 gene locus_tag LOCUS_11530 11768 12631 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_11530 12749 13774 gene locus_tag LOCUS_11540 12749 13774 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_11540 13863 14153 gene locus_tag LOCUS_11550 13863 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 14465 14641 gene locus_tag LOCUS_11560 14465 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 14704 16140 gene locus_tag LOCUS_11570 14704 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 16728 16141 gene locus_tag LOCUS_11580 16728 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 18476 17025 gene locus_tag LOCUS_11590 gene asnS 18476 17025 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_11590 18684 20114 gene locus_tag LOCUS_11600 gene rpoN 18684 20114 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_11600 20932 20243 gene locus_tag LOCUS_11610 20932 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 21102 21176 gene locus_tag LOCUS_t00140 21102 21176 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21577 22338 gene locus_tag LOCUS_11620 21577 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 23052 23243 gene locus_tag LOCUS_11630 23052 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 24460 23315 gene locus_tag LOCUS_11640 gene fjo29 24460 23315 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_11640 25833 24535 gene locus_tag LOCUS_11650 gene nqrF 25833 24535 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_11650 26778 25930 gene locus_tag LOCUS_11660 gene accD 26778 25930 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_11660 27087 26857 gene locus_tag LOCUS_11670 27087 26857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 29911 27098 gene locus_tag LOCUS_11680 gene carB 29911 27098 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_11680 31152 30082 gene locus_tag LOCUS_11690 31152 30082 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_11690 32213 31149 gene locus_tag LOCUS_11700 32213 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_11700 33704 32310 gene locus_tag LOCUS_11710 gene lpdA1 33704 32310 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_11710 35262 33751 gene locus_tag LOCUS_11720 gene sucB 35262 33751 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_11720 37981 35267 gene locus_tag LOCUS_11730 gene sucA 37981 35267 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_11730 38198 38947 gene locus_tag LOCUS_11740 gene rpsP 38198 38947 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ15 protein_id gnl|my_center|LOCUS_11740 38956 39486 gene locus_tag LOCUS_11750 gene rimM 38956 39486 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_11750 39476 40150 gene locus_tag LOCUS_11760 gene trmD 39476 40150 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_11760 40221 41396 gene locus_tag LOCUS_11770 40221 41396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_11770 41479 42780 gene locus_tag LOCUS_11780 41479 42780 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_11780 43772 42846 gene locus_tag LOCUS_11790 gene queG 43772 42846 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_11790 44871 43846 gene locus_tag LOCUS_11800 gene ruvB 44871 43846 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_11800 45048 45995 gene locus_tag LOCUS_11810 45048 45995 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_11810 45992 46705 gene locus_tag LOCUS_11820 45992 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 46979 47230 gene locus_tag LOCUS_11830 46979 47230 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_11830 47243 48931 gene locus_tag LOCUS_11840 47243 48931 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_11840 48942 50843 gene locus_tag LOCUS_11850 gene acsA 48942 50843 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_11850 53284 50906 gene locus_tag LOCUS_11860 gene nrdA 53284 50906 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_11860 54302 53310 gene locus_tag LOCUS_11870 gene nrdB 54302 53310 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_11870 54764 55072 gene locus_tag LOCUS_11880 54764 55072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11880 55082 55339 gene locus_tag LOCUS_11890 gene rpmA 55082 55339 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR3 protein_id gnl|my_center|LOCUS_11890 55750 55529 gene locus_tag LOCUS_11900 55750 55529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 55897 55763 gene locus_tag LOCUS_11910 55897 55763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 56118 56423 gene locus_tag LOCUS_11920 56118 56423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_11920 56869 56420 gene locus_tag LOCUS_11930 56869 56420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 58289 57012 gene locus_tag LOCUS_11940 gene serS 58289 57012 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_11940 58516 60135 gene locus_tag LOCUS_11950 gene rho 58516 60135 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_11950 61372 60164 gene locus_tag LOCUS_11960 61372 60164 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_11960 61639 61442 gene locus_tag LOCUS_11970 61639 61442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 63183 61636 gene locus_tag LOCUS_11980 gene gltX 63183 61636 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_11980 63585 63208 gene locus_tag LOCUS_11990 63585 63208 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 protein_id gnl|my_center|LOCUS_11990 65630 64287 gene locus_tag LOCUS_12000 65630 64287 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_12000 66312 66088 gene locus_tag LOCUS_12010 66312 66088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence014 61 1068 gene locus_tag LOCUS_12020 61 1068 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQJ8 protein_id gnl|my_center|LOCUS_12020 1784 1158 gene locus_tag LOCUS_12030 1784 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2494 1784 gene locus_tag LOCUS_12040 2494 1784 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 protein_id gnl|my_center|LOCUS_12040 3418 2540 gene locus_tag LOCUS_12050 3418 2540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211372.1 protein_id gnl|my_center|LOCUS_12050 3721 5988 gene locus_tag LOCUS_12060 3721 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6656 5985 gene locus_tag LOCUS_12070 gene lolD 6656 5985 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_12070 6760 7968 gene locus_tag LOCUS_12080 gene sucC 6760 7968 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_12080 8323 9582 gene locus_tag LOCUS_12090 gene amaA 8323 9582 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_12090 10134 13100 gene locus_tag LOCUS_12100 10134 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_12100 13502 13155 gene locus_tag LOCUS_12110 13502 13155 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYW3 protein_id gnl|my_center|LOCUS_12110 14073 13531 gene locus_tag LOCUS_12120 gene hslV 14073 13531 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072681.1 protein_id gnl|my_center|LOCUS_12120 15720 14116 gene locus_tag LOCUS_12130 gene pdhC 15720 14116 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_12130 15847 16797 gene locus_tag LOCUS_12140 15847 16797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_12140 16819 17517 gene locus_tag LOCUS_12150 16819 17517 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902474.1 protein_id gnl|my_center|LOCUS_12150 20190 17761 gene locus_tag LOCUS_12160 20190 17761 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_12160 21104 20244 gene locus_tag LOCUS_12170 21104 20244 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_12170 21619 21101 gene locus_tag LOCUS_12180 21619 21101 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_12180 22879 21692 gene locus_tag LOCUS_12190 22879 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 23256 24263 gene locus_tag LOCUS_12200 gene fabH2 23256 24263 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_12200 24447 25676 gene locus_tag LOCUS_12210 24447 25676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 27870 25708 gene locus_tag LOCUS_12220 gene glnA 27870 25708 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_12220 28279 28977 gene locus_tag LOCUS_12230 28279 28977 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_12230 29390 29010 gene locus_tag LOCUS_12240 29390 29010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 29630 30193 gene locus_tag LOCUS_12250 29630 30193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_12250 31318 30155 gene locus_tag LOCUS_12260 31318 30155 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831597.1 protein_id gnl|my_center|LOCUS_12260 31664 31446 gene locus_tag LOCUS_12270 31664 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 32044 34374 gene locus_tag LOCUS_12280 gene topA 32044 34374 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_12280 34440 34847 gene locus_tag LOCUS_12290 34440 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 36257 35133 gene locus_tag LOCUS_12300 gene dnaN 36257 35133 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_12300 37261 36335 gene locus_tag LOCUS_12310 37261 36335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 38937 37258 gene locus_tag LOCUS_12320 gene gldG 38937 37258 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_12320 39662 38937 gene locus_tag LOCUS_12330 gene gldF 39662 38937 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12330 40588 39659 gene locus_tag LOCUS_12340 gene gldA 40588 39659 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_12340 40717 41241 gene locus_tag LOCUS_12350 40717 41241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 41437 41249 gene locus_tag LOCUS_12360 41437 41249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 44704 41465 gene locus_tag LOCUS_12370 44704 41465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_12370 45768 44785 gene locus_tag LOCUS_12380 45768 44785 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974770.1 protein_id gnl|my_center|LOCUS_12380 45894 46346 gene locus_tag LOCUS_12390 45894 46346 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124734.1 protein_id gnl|my_center|LOCUS_12390 46530 46952 gene locus_tag LOCUS_12400 46530 46952 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_12400 47118 48245 gene locus_tag LOCUS_12410 gene hisC 47118 48245 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_12410 49894 48242 gene locus_tag LOCUS_12420 49894 48242 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_12420 50078 52861 gene locus_tag LOCUS_12430 50078 52861 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_12430 52867 54978 gene locus_tag LOCUS_12440 52867 54978 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203284.1 protein_id gnl|my_center|LOCUS_12440 55174 55728 gene locus_tag LOCUS_12450 55174 55728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 <66417 56028 gene locus_tag LOCUS_12460 <66417 56028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529849.1:outer membrane adhesin-like protein >Feature sequence015 164 925 gene locus_tag LOCUS_12470 164 925 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_12470 1579 929 gene locus_tag LOCUS_12480 gene pyrE 1579 929 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 protein_id gnl|my_center|LOCUS_12480 1668 2351 gene locus_tag LOCUS_12490 1668 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2798 2346 gene locus_tag LOCUS_12500 gene coaD 2798 2346 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831P9 protein_id gnl|my_center|LOCUS_12500 3685 2801 gene locus_tag LOCUS_12510 3685 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_12510 4280 3687 gene locus_tag LOCUS_12520 4280 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4822 4340 gene locus_tag LOCUS_12530 4822 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4887 5300 gene locus_tag LOCUS_12540 4887 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5679 5317 gene locus_tag LOCUS_12550 5679 5317 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_12550 6340 5672 gene locus_tag LOCUS_12560 6340 5672 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_12560 6458 7195 gene locus_tag LOCUS_12570 6458 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7382 8002 gene locus_tag LOCUS_12580 7382 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8449 8003 gene locus_tag LOCUS_12590 8449 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9544 8501 gene locus_tag LOCUS_12600 9544 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 10400 9534 gene locus_tag LOCUS_12610 10400 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 11313 10426 gene locus_tag LOCUS_12620 11313 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_12620 11395 11697 gene locus_tag LOCUS_12630 11395 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11697 14069 gene locus_tag LOCUS_12640 gene mutS2 11697 14069 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_12640 14167 14838 gene locus_tag LOCUS_12650 14167 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 15053 15880 gene locus_tag LOCUS_12660 15053 15880 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_12660 15894 16700 gene locus_tag LOCUS_12670 gene murQ 15894 16700 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_12670 16725 17294 gene locus_tag LOCUS_12680 16725 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 19664 18357 gene locus_tag LOCUS_12690 gene der 19664 18357 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_12690 20587 19694 gene locus_tag LOCUS_12700 gene era 20587 19694 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_12700 20837 20910 gene locus_tag LOCUS_t00150 20837 20910 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21214 21468 gene locus_tag LOCUS_12710 21214 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 21465 22100 gene locus_tag LOCUS_12720 21465 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 22122 23072 gene locus_tag LOCUS_12730 22122 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 23511 26972 gene locus_tag LOCUS_12740 23511 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 27051 28052 gene locus_tag LOCUS_12750 27051 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 28055 29467 gene locus_tag LOCUS_12760 28055 29467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 30237 32021 gene locus_tag LOCUS_12770 30237 32021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_12770 32216 33826 gene locus_tag LOCUS_12780 32216 33826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 33846 35243 gene locus_tag LOCUS_12790 33846 35243 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_12790 35240 35863 gene locus_tag LOCUS_12800 35240 35863 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_12800 35860 37002 gene locus_tag LOCUS_12810 35860 37002 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_12810 37587 37099 gene locus_tag LOCUS_12820 37587 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 38681 37794 gene locus_tag LOCUS_12830 38681 37794 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_12830 38900 39205 gene locus_tag LOCUS_12840 38900 39205 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_12840 40703 39210 gene locus_tag LOCUS_12850 40703 39210 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_12850 41410 40730 gene locus_tag LOCUS_12860 gene ytkL 41410 40730 CDS product UPF0173 metal-dependent hydrolase YtkL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795U4 protein_id gnl|my_center|LOCUS_12860 42283 41621 gene locus_tag LOCUS_12870 42283 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 42295 42885 gene locus_tag LOCUS_12880 42295 42885 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_12880 43006 43626 gene locus_tag LOCUS_12890 43006 43626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 43803 44483 gene locus_tag LOCUS_12900 43803 44483 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_12900 45577 46056 gene locus_tag LOCUS_12910 45577 46056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 46584 46096 gene locus_tag LOCUS_12920 46584 46096 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_12920 47278 46571 gene locus_tag LOCUS_12930 47278 46571 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_12930 48818 47283 gene locus_tag LOCUS_12940 gene zwf 48818 47283 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL52 protein_id gnl|my_center|LOCUS_12940 48927 50327 gene locus_tag LOCUS_12950 gene gntZ 48927 50327 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPK6 protein_id gnl|my_center|LOCUS_12950 51076 50333 gene locus_tag LOCUS_12960 51076 50333 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_12960 51499 51299 gene locus_tag LOCUS_12970 51499 51299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 51498 51956 gene locus_tag LOCUS_12980 51498 51956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 53010 51967 gene locus_tag LOCUS_12990 53010 51967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 53702 53094 gene locus_tag LOCUS_13000 53702 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 53997 54671 gene locus_tag LOCUS_13010 53997 54671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 54710 55678 gene locus_tag LOCUS_13020 54710 55678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 55680 56876 gene locus_tag LOCUS_13030 55680 56876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 56888 58285 gene locus_tag LOCUS_13040 gene ycgA 56888 58285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55908 protein_id gnl|my_center|LOCUS_13040 58293 59438 gene locus_tag LOCUS_13050 gene argE 58293 59438 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C5 protein_id gnl|my_center|LOCUS_13050 59565 59972 gene locus_tag LOCUS_13060 59565 59972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120045.1 protein_id gnl|my_center|LOCUS_13060 60123 60653 gene locus_tag LOCUS_13070 60123 60653 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_13070 60749 61102 gene locus_tag LOCUS_13080 60749 61102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_13080 61187 61450 gene locus_tag LOCUS_13090 61187 61450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 <62172 61523 gene locus_tag LOCUS_13100 <62172 61523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S457:chromosome partition protein Smc >Feature sequence016 2459 786 gene locus_tag LOCUS_13110 gene glnS 2459 786 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_13110 2656 3327 gene locus_tag LOCUS_13120 gene fklB 2656 3327 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_13120 4004 3381 gene locus_tag LOCUS_13130 4004 3381 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_13130 5002 4028 gene locus_tag LOCUS_13140 5002 4028 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_13140 7284 5122 gene locus_tag LOCUS_13150 gene rnr 7284 5122 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_13150 8013 7288 gene locus_tag LOCUS_13160 8013 7288 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_13160 8393 8010 gene locus_tag LOCUS_13170 8393 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9245 8517 gene locus_tag LOCUS_13180 gene lipB 9245 8517 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_13180 10219 9245 gene locus_tag LOCUS_13190 gene manA 10219 9245 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_13190 10234 10551 gene locus_tag LOCUS_13200 10234 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11763 10585 gene locus_tag LOCUS_13210 gene purM 11763 10585 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_13210 12942 11779 gene locus_tag LOCUS_13220 12942 11779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_13220 14919 12985 gene locus_tag LOCUS_13230 14919 12985 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_13230 15520 15035 gene locus_tag LOCUS_13240 15520 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_13240 16356 15565 gene locus_tag LOCUS_13250 16356 15565 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_13250 17688 16369 gene locus_tag LOCUS_13260 17688 16369 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_13260 17768 17841 gene locus_tag LOCUS_t00160 17768 17841 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 18792 18046 gene locus_tag LOCUS_13270 18792 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 19352 18795 gene locus_tag LOCUS_13280 gene scpB 19352 18795 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_13280 19729 19352 gene locus_tag LOCUS_13290 19729 19352 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_13290 21380 19854 gene locus_tag LOCUS_13300 21380 19854 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_13300 21936 22928 gene locus_tag LOCUS_13310 gene asd 21936 22928 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_13310 22930 24123 gene locus_tag LOCUS_13320 22930 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_13320 24809 24192 gene locus_tag LOCUS_13330 24809 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 25612 24803 gene locus_tag LOCUS_13340 25612 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 26538 25645 gene locus_tag LOCUS_13350 gene atpG 26538 25645 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_13350 28128 26548 gene locus_tag LOCUS_13360 gene atpA 28128 26548 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_13360 28712 28167 gene locus_tag LOCUS_13370 28712 28167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 29208 28714 gene locus_tag LOCUS_13380 gene atpF 29208 28714 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_13380 29538 29281 gene locus_tag LOCUS_13390 29538 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 30519 29569 gene locus_tag LOCUS_13400 gene atpB 30519 29569 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_13400 30990 30604 gene locus_tag LOCUS_13410 30990 30604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 31617 31150 gene locus_tag LOCUS_13420 31617 31150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 32343 31621 gene locus_tag LOCUS_13430 32343 31621 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_13430 32641 35154 gene locus_tag LOCUS_13440 gene sprE 32641 35154 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_13440 35246 37426 gene locus_tag LOCUS_13450 gene mrcA 35246 37426 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_13450 37427 39229 gene locus_tag LOCUS_13460 gene uvrC 37427 39229 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_13460 40101 39262 gene locus_tag LOCUS_13470 40101 39262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 41760 40120 gene locus_tag LOCUS_13480 41760 40120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 42617 41799 gene locus_tag LOCUS_13490 gene gldL 42617 41799 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_13490 43697 42645 gene locus_tag LOCUS_13500 43697 42645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 44816 43845 gene locus_tag LOCUS_13510 44816 43845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 45680 44910 gene locus_tag LOCUS_13520 45680 44910 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_13520 46745 45723 gene locus_tag LOCUS_13530 46745 45723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 47106 48152 gene locus_tag LOCUS_13540 47106 48152 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_13540 48895 48158 gene locus_tag LOCUS_13550 gene algR 48895 48158 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_13550 49917 48892 gene locus_tag LOCUS_13560 49917 48892 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_13560 52765 49910 gene locus_tag LOCUS_13570 52765 49910 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T17 protein_id gnl|my_center|LOCUS_13570 53890 52913 gene locus_tag LOCUS_13580 53890 52913 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_13580 53943 54503 gene locus_tag LOCUS_13590 53943 54503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 54650 55051 gene locus_tag LOCUS_13600 54650 55051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 58074 55111 gene locus_tag LOCUS_13610 58074 55111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_13610 59805 58561 gene locus_tag LOCUS_13620 59805 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 60981 59989 gene locus_tag LOCUS_13630 60981 59989 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_13630 61784 61131 gene locus_tag LOCUS_13640 gene arsC 61784 61131 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence017 <1 1703 gene locus_tag LOCUS_13650 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038421.1:gamma-glutamyltranspeptidase 1770 2462 gene locus_tag LOCUS_13660 1770 2462 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_13660 2463 3920 gene locus_tag LOCUS_13670 2463 3920 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_13670 4009 5199 gene locus_tag LOCUS_13680 4009 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_13680 5183 5677 gene locus_tag LOCUS_13690 5183 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5670 6323 gene locus_tag LOCUS_13700 5670 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_13700 6398 6934 gene locus_tag LOCUS_13710 6398 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_13710 6931 7575 gene locus_tag LOCUS_13720 6931 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7565 8023 gene locus_tag LOCUS_13730 7565 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8302 8000 gene locus_tag LOCUS_13740 8302 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8903 10057 gene locus_tag LOCUS_13750 8903 10057 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_13750 10195 11208 gene locus_tag LOCUS_13760 10195 11208 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_13760 11577 11924 gene locus_tag LOCUS_13770 11577 11924 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_13770 11921 13951 gene locus_tag LOCUS_13780 11921 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 13967 14269 gene locus_tag LOCUS_13790 13967 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 14333 14542 gene locus_tag LOCUS_13800 14333 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 16641 14962 gene locus_tag LOCUS_13810 16641 14962 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_13810 17304 17525 gene locus_tag LOCUS_13820 17304 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_13820 18202 17522 gene locus_tag LOCUS_13830 gene ispD 18202 17522 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_13830 19250 18204 gene locus_tag LOCUS_13840 gene queA 19250 18204 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_13840 19429 20619 gene locus_tag LOCUS_13850 19429 20619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_13850 21666 20671 gene locus_tag LOCUS_13860 gene recA 21666 20671 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_13860 22662 23030 gene locus_tag LOCUS_13870 22662 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 23249 23935 gene locus_tag LOCUS_13880 gene phoP 23249 23935 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_13880 23944 24990 gene locus_tag LOCUS_13890 gene phoR 23944 24990 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_13890 25014 25742 gene locus_tag LOCUS_13900 gene rluA 25014 25742 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E880 protein_id gnl|my_center|LOCUS_13900 25844 26287 gene locus_tag LOCUS_13910 gene rplM 25844 26287 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_13910 26293 26679 gene locus_tag LOCUS_13920 gene rpsI 26293 26679 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_13920 26695 27462 gene locus_tag LOCUS_13930 gene rpsB 26695 27462 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_13930 27579 28412 gene locus_tag LOCUS_13940 gene tsf 27579 28412 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_13940 28822 28592 gene locus_tag LOCUS_13950 28822 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 28986 28759 gene locus_tag LOCUS_13960 28986 28759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 29472 29059 gene locus_tag LOCUS_13970 29472 29059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 29581 29832 gene locus_tag LOCUS_13980 gene rpsT 29581 29832 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_13980 29889 30083 gene locus_tag LOCUS_13990 29889 30083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 30169 30438 gene locus_tag LOCUS_14000 30169 30438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14000 30470 31078 gene locus_tag LOCUS_14010 30470 31078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_14010 31142 33550 gene locus_tag LOCUS_14020 gene pheT 31142 33550 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_14020 33547 33843 gene locus_tag LOCUS_14030 33547 33843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 33854 34135 gene locus_tag LOCUS_14040 33854 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 35417 34194 gene locus_tag LOCUS_14050 35417 34194 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817F8 protein_id gnl|my_center|LOCUS_14050 36210 35443 gene locus_tag LOCUS_14060 gene panB 36210 35443 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_14060 36867 36310 gene locus_tag LOCUS_14070 36867 36310 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_14070 37290 38180 gene locus_tag LOCUS_14080 37290 38180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 39085 38189 gene locus_tag LOCUS_14090 39085 38189 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015900.1 protein_id gnl|my_center|LOCUS_14090 40895 39132 gene locus_tag LOCUS_14100 gene aspS 40895 39132 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_14100 41527 41009 gene locus_tag LOCUS_14110 41527 41009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 42474 41599 gene locus_tag LOCUS_14120 gene sucD 42474 41599 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_14120 43046 42555 gene locus_tag LOCUS_14130 43046 42555 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_14130 43825 43046 gene locus_tag LOCUS_14140 43825 43046 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_14140 44510 43818 gene locus_tag LOCUS_14150 44510 43818 CDS product sigma factor regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_14150 44786 45802 gene locus_tag LOCUS_14160 gene ltaE 44786 45802 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_14160 45911 46504 gene locus_tag LOCUS_14170 45911 46504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_14170 47906 46581 gene locus_tag LOCUS_14180 47906 46581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 48235 49305 gene locus_tag LOCUS_14190 48235 49305 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_14190 49980 49375 gene locus_tag LOCUS_14200 gene sodA 49980 49375 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_14200 50514 50053 gene locus_tag LOCUS_14210 gene tadA 50514 50053 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_14210 51140 50514 gene locus_tag LOCUS_14220 51140 50514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 51216 51914 gene locus_tag LOCUS_14230 51216 51914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_14230 52795 51950 gene locus_tag LOCUS_14240 52795 51950 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_14240 53928 52792 gene locus_tag LOCUS_14250 gene aspC3 53928 52792 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_14250 54550 55878 gene locus_tag LOCUS_14260 gene MET17 54550 55878 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 protein_id gnl|my_center|LOCUS_14260 55850 56836 gene locus_tag LOCUS_14270 gene metX 55850 56836 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_14270 <58611 57309 gene locus_tag LOCUS_14280 <58611 57309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase >Feature sequence018 463 3318 gene locus_tag LOCUS_14290 gene infB 463 3318 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_14290 4633 3380 gene locus_tag LOCUS_14300 gene metK 4633 3380 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_14300 5417 4707 gene locus_tag LOCUS_14310 5417 4707 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_14310 6177 5404 gene locus_tag LOCUS_14320 6177 5404 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_14320 6887 6174 gene locus_tag LOCUS_14330 gene pdxJ 6887 6174 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_14330 6930 7382 gene locus_tag LOCUS_14340 6930 7382 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_14340 7379 7900 gene locus_tag LOCUS_14350 7379 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7936 8682 gene locus_tag LOCUS_14360 gene pcbD 7936 8682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_14360 8687 9346 gene locus_tag LOCUS_14370 8687 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9350 10225 gene locus_tag LOCUS_14380 gene nadK 9350 10225 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_14380 10292 10984 gene locus_tag LOCUS_14390 10292 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11072 11812 gene locus_tag LOCUS_14400 gene uppS 11072 11812 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ5 protein_id gnl|my_center|LOCUS_14400 11809 14481 gene locus_tag LOCUS_14410 gene bamA 11809 14481 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_14410 14481 15014 gene locus_tag LOCUS_14420 14481 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 15036 15566 gene locus_tag LOCUS_14430 15036 15566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_14430 16477 15599 gene locus_tag LOCUS_14440 gene fjo11 16477 15599 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_14440 17419 16481 gene locus_tag LOCUS_14450 17419 16481 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_14450 17509 18441 gene locus_tag LOCUS_14460 17509 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 18434 18643 gene locus_tag LOCUS_14470 18434 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 18786 19454 gene locus_tag LOCUS_14480 18786 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 19522 20796 gene locus_tag LOCUS_14490 gene gdhA 19522 20796 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_14490 20797 21453 gene locus_tag LOCUS_14500 gene psd 20797 21453 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_14500 21453 21962 gene locus_tag LOCUS_14510 21453 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 22443 21973 gene locus_tag LOCUS_14520 22443 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_14520 22811 22446 gene locus_tag LOCUS_14530 22811 22446 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_14530 23826 22798 gene locus_tag LOCUS_14540 gene ribD 23826 22798 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_14540 23920 24762 gene locus_tag LOCUS_14550 gene prmC 23920 24762 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_14550 26103 25021 gene locus_tag LOCUS_14560 26103 25021 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_14560 27319 26138 gene locus_tag LOCUS_14570 gene acd 27319 26138 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_14570 27797 27312 gene locus_tag LOCUS_14580 27797 27312 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_14580 28581 27808 gene locus_tag LOCUS_14590 28581 27808 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_14590 29330 28590 gene locus_tag LOCUS_14600 29330 28590 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_14600 30146 30892 gene locus_tag LOCUS_14610 30146 30892 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14610 31127 31906 gene locus_tag LOCUS_14620 31127 31906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_14620 31899 32897 gene locus_tag LOCUS_14630 31899 32897 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_14630 32924 34105 gene locus_tag LOCUS_14640 32924 34105 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_14640 34372 35073 gene locus_tag LOCUS_14650 34372 35073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14650 35724 35104 gene locus_tag LOCUS_14660 35724 35104 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_14660 38333 35874 gene locus_tag LOCUS_14670 38333 35874 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_14670 39045 38506 gene locus_tag LOCUS_14680 39045 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 39602 38991 gene locus_tag LOCUS_14690 gene pnuC 39602 38991 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_14690 39697 41169 gene locus_tag LOCUS_14700 gene guaB 39697 41169 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_14700 41240 42070 gene locus_tag LOCUS_14710 41240 42070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 42051 43379 gene locus_tag LOCUS_14720 gene surA 42051 43379 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_14720 43386 44348 gene locus_tag LOCUS_14730 43386 44348 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_14730 45368 44349 gene locus_tag LOCUS_14740 gene pheS 45368 44349 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_14740 46795 45461 gene locus_tag LOCUS_14750 gene wcaJ 46795 45461 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_14750 47128 47724 gene locus_tag LOCUS_14760 47128 47724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 47799 49301 gene locus_tag LOCUS_14770 47799 49301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence019 387 965 gene locus_tag LOCUS_14780 387 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 981 2390 gene locus_tag LOCUS_14790 981 2390 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_14790 3665 2766 gene locus_tag LOCUS_14800 3665 2766 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_14800 5019 3691 gene locus_tag LOCUS_14810 gene arsA 5019 3691 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_14810 5356 5625 gene locus_tag LOCUS_14820 5356 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6450 6376 gene locus_tag LOCUS_t00170 6450 6376 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6855 11333 gene locus_tag LOCUS_14830 gene gltB 6855 11333 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_14830 11333 12778 gene locus_tag LOCUS_14840 gene gltD 11333 12778 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_14840 13032 12775 gene locus_tag LOCUS_14850 13032 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 13431 13162 gene locus_tag LOCUS_14860 13431 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13500 14864 gene locus_tag LOCUS_14870 gene hisS 13500 14864 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_14870 14861 16534 gene locus_tag LOCUS_14880 14861 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 16550 16882 gene locus_tag LOCUS_14890 16550 16882 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_14890 16882 17886 gene locus_tag LOCUS_14900 16882 17886 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_14900 18089 17880 gene locus_tag LOCUS_14910 18089 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 18223 20016 gene locus_tag LOCUS_14920 18223 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 protein_id gnl|my_center|LOCUS_14920 20166 21104 gene locus_tag LOCUS_14930 gene pdhB 20166 21104 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_14930 22440 21121 gene locus_tag LOCUS_14940 gene ffh 22440 21121 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_14940 23042 22572 gene locus_tag LOCUS_14950 23042 22572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_14950 24650 23160 gene locus_tag LOCUS_14960 24650 23160 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_14960 24933 25409 gene locus_tag LOCUS_14970 24933 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 25411 26523 gene locus_tag LOCUS_14980 25411 26523 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_14980 26530 29676 gene locus_tag LOCUS_14990 26530 29676 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_14990 29669 30991 gene locus_tag LOCUS_15000 29669 30991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 31207 30974 gene locus_tag LOCUS_15010 31207 30974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 31870 31250 gene locus_tag LOCUS_15020 31870 31250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15020 32307 31873 gene locus_tag LOCUS_15030 32307 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15030 32623 32399 gene locus_tag LOCUS_15040 32623 32399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15040 35129 33012 gene locus_tag LOCUS_15050 35129 33012 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458272.1 protein_id gnl|my_center|LOCUS_15050 36141 35164 gene locus_tag LOCUS_15060 36141 35164 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_15060 36423 37544 gene locus_tag LOCUS_15070 gene nagX 36423 37544 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_15070 38189 37779 gene locus_tag LOCUS_15080 gene osmC 38189 37779 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_15080 38653 40302 gene locus_tag LOCUS_15090 38653 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 41231 40371 gene locus_tag LOCUS_15100 41231 40371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 42750 41569 gene locus_tag LOCUS_15110 42750 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 44687 42858 gene locus_tag LOCUS_15120 44687 42858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 46255 44741 gene locus_tag LOCUS_15130 46255 44741 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_15130 <47844 46266 gene locus_tag LOCUS_15140 <47844 46266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence020 4682 1266 gene locus_tag LOCUS_15150 4682 1266 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_15150 5832 4684 gene locus_tag LOCUS_15160 5832 4684 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_15160 7186 5837 gene locus_tag LOCUS_15170 7186 5837 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_15170 7848 7207 gene locus_tag LOCUS_15180 7848 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7962 8774 gene locus_tag LOCUS_15190 7962 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8820 12494 gene locus_tag LOCUS_15200 gene purL 8820 12494 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R22 protein_id gnl|my_center|LOCUS_15200 12564 12637 gene locus_tag LOCUS_t00180 12564 12637 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12691 13617 gene locus_tag LOCUS_15210 gene prsA 12691 13617 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_15210 13633 14277 gene locus_tag LOCUS_15220 gene rplY 13633 14277 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_15220 14443 15000 gene locus_tag LOCUS_15230 gene pth 14443 15000 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_15230 15050 16246 gene locus_tag LOCUS_15240 15050 16246 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_15240 16259 16552 gene locus_tag LOCUS_15250 16259 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047969.1 protein_id gnl|my_center|LOCUS_15250 19704 17653 gene locus_tag LOCUS_15260 gene metG 19704 17653 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_15260 19836 21635 gene locus_tag LOCUS_15270 19836 21635 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_15270 21741 23576 gene locus_tag LOCUS_15280 21741 23576 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_15280 23633 24934 gene locus_tag LOCUS_15290 23633 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 24937 26283 gene locus_tag LOCUS_15300 24937 26283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_15300 26276 27715 gene locus_tag LOCUS_15310 26276 27715 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_15310 27789 28514 gene locus_tag LOCUS_15320 gene ste14 27789 28514 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_15320 29452 28523 gene locus_tag LOCUS_15330 gene ykuF 29452 28523 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_15330 29611 30255 gene locus_tag LOCUS_15340 29611 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 33938 30558 gene locus_tag LOCUS_15350 33938 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 34101 34595 gene locus_tag LOCUS_15360 34101 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_15360 34968 35165 gene locus_tag LOCUS_15370 34968 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 35437 35841 gene locus_tag LOCUS_15380 35437 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15380 36933 35887 gene locus_tag LOCUS_15390 36933 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 37133 37059 gene locus_tag LOCUS_t00190 37133 37059 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37236 37149 gene locus_tag LOCUS_t00200 37236 37149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37522 38358 gene locus_tag LOCUS_15400 gene batA 37522 38358 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_15400 38355 39266 gene locus_tag LOCUS_15410 38355 39266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 39434 40714 gene locus_tag LOCUS_15420 39434 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 40711 41706 gene locus_tag LOCUS_15430 gene purC 40711 41706 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_15430 41703 42074 gene locus_tag LOCUS_15440 41703 42074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 42075 42992 gene locus_tag LOCUS_15450 gene rnz 42075 42992 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_15450 42985 43779 gene locus_tag LOCUS_15460 42985 43779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_15460 45056 43812 gene locus_tag LOCUS_15470 45056 43812 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_15470 45775 45056 gene locus_tag LOCUS_15480 45775 45056 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_15480 46984 45941 gene locus_tag LOCUS_15490 46984 45941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence021 1125 337 gene locus_tag LOCUS_15500 1125 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1636 1346 gene locus_tag LOCUS_15510 1636 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3825 2128 gene locus_tag LOCUS_15520 3825 2128 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 protein_id gnl|my_center|LOCUS_15520 4104 5504 gene locus_tag LOCUS_15530 gene nagA 4104 5504 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_15530 6390 5536 gene locus_tag LOCUS_15540 6390 5536 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_15540 9509 6426 gene locus_tag LOCUS_15550 9509 6426 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122060.1 protein_id gnl|my_center|LOCUS_15550 9795 10265 gene locus_tag LOCUS_15560 9795 10265 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_15560 10278 12467 gene locus_tag LOCUS_15570 10278 12467 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_15570 12612 13055 gene locus_tag LOCUS_15580 12612 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 14023 13058 gene locus_tag LOCUS_15590 gene aspG 14023 13058 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_15590 15007 14372 gene locus_tag LOCUS_15600 15007 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 16171 15140 gene locus_tag LOCUS_15610 16171 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16544 16470 gene locus_tag LOCUS_t00210 16544 16470 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18752 16620 gene locus_tag LOCUS_15620 18752 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_15620 19378 18800 gene locus_tag LOCUS_15630 19378 18800 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_15630 19967 19383 gene locus_tag LOCUS_15640 19967 19383 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_15640 20039 20677 gene locus_tag LOCUS_15650 gene pdxH 20039 20677 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFI8 protein_id gnl|my_center|LOCUS_15650 20650 21894 gene locus_tag LOCUS_15660 20650 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 22737 22012 gene locus_tag LOCUS_15670 22737 22012 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_15670 23708 22740 gene locus_tag LOCUS_15680 gene trxB1 23708 22740 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_15680 25609 23882 gene locus_tag LOCUS_15690 25609 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_15690 28337 26220 gene locus_tag LOCUS_15700 gene pnp 28337 26220 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4N6 protein_id gnl|my_center|LOCUS_15700 28671 28402 gene locus_tag LOCUS_15710 gene rpsO 28671 28402 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_15710 30318 28756 gene locus_tag LOCUS_15720 30318 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 30845 30462 gene locus_tag LOCUS_15730 30845 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 30949 31023 gene locus_tag LOCUS_t00220 30949 31023 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33043 31157 gene locus_tag LOCUS_15740 33043 31157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_15740 33379 34563 gene locus_tag LOCUS_15750 33379 34563 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_15750 36366 34864 gene locus_tag LOCUS_15760 36366 34864 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_15760 36797 37819 gene locus_tag LOCUS_15770 36797 37819 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_15770 38089 39564 gene locus_tag LOCUS_15780 gene nhaB 38089 39564 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_15780 39756 40730 gene locus_tag LOCUS_15790 39756 40730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_15790 40757 41533 gene locus_tag LOCUS_15800 40757 41533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 41645 43270 gene locus_tag LOCUS_15810 41645 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 43357 44754 gene locus_tag LOCUS_15820 43357 44754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence022 37 1584 gene locus_tag LOCUS_15830 gene porX 37 1584 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_15830 1581 2003 gene locus_tag LOCUS_15840 1581 2003 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_15840 1987 3213 gene locus_tag LOCUS_15850 gene ald 1987 3213 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_15850 5885 3210 gene locus_tag LOCUS_15860 gene valS 5885 3210 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_15860 6912 5992 gene locus_tag LOCUS_15870 6912 5992 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_15870 7568 6909 gene locus_tag LOCUS_15880 7568 6909 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKH4 protein_id gnl|my_center|LOCUS_15880 7713 8126 gene locus_tag LOCUS_15890 gene ygcM 7713 8126 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_15890 8086 8769 gene locus_tag LOCUS_15900 gene folE1 8086 8769 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_15900 8932 11271 gene locus_tag LOCUS_15910 8932 11271 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_15910 11758 12297 gene locus_tag LOCUS_15920 11758 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 12298 13215 gene locus_tag LOCUS_15930 12298 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 13348 14151 gene locus_tag LOCUS_15940 13348 14151 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U5 protein_id gnl|my_center|LOCUS_15940 14162 14380 gene locus_tag LOCUS_15950 14162 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 14389 15186 gene locus_tag LOCUS_15960 gene uppP 14389 15186 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_15960 15183 15863 gene locus_tag LOCUS_15970 gene truB 15183 15863 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_15970 15850 16785 gene locus_tag LOCUS_15980 gene ribF 15850 16785 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_15980 16791 17123 gene locus_tag LOCUS_15990 gene gldC 16791 17123 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_15990 17293 20436 gene locus_tag LOCUS_16000 17293 20436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_16000 20481 21356 gene locus_tag LOCUS_16010 20481 21356 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_16010 24224 21732 gene locus_tag LOCUS_16020 24224 21732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 25194 26111 gene locus_tag LOCUS_16030 gene ilvE 25194 26111 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_16030 26116 27789 gene locus_tag LOCUS_16040 gene ilvD 26116 27789 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_16040 27791 29524 gene locus_tag LOCUS_16050 gene ilvB 27791 29524 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_16050 29526 30110 gene locus_tag LOCUS_16060 gene ilvH 29526 30110 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_16060 30132 31178 gene locus_tag LOCUS_16070 30132 31178 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_16070 31203 32735 gene locus_tag LOCUS_16080 gene leuA 31203 32735 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP0 protein_id gnl|my_center|LOCUS_16080 32746 34152 gene locus_tag LOCUS_16090 gene leuC 32746 34152 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_16090 34165 34755 gene locus_tag LOCUS_16100 34165 34755 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_16100 34757 36325 gene locus_tag LOCUS_16110 34757 36325 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108024.1 protein_id gnl|my_center|LOCUS_16110 36332 37402 gene locus_tag LOCUS_16120 gene leuB 36332 37402 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_16120 37404 39851 gene locus_tag LOCUS_16130 gene thrA 37404 39851 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_16130 39855 40784 gene locus_tag LOCUS_16140 gene thrB 39855 40784 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_16140 40786 42069 gene locus_tag LOCUS_16150 40786 42069 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_16150 42414 42091 gene locus_tag LOCUS_16160 42414 42091 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108942.1 protein_id gnl|my_center|LOCUS_16160 42951 44390 gene locus_tag LOCUS_16170 42951 44390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <45251 44380 gene locus_tag LOCUS_16180 <45251 44380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DGN2:choline dehydrogenase >Feature sequence023 835 611 gene locus_tag LOCUS_16190 835 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1140 946 gene locus_tag LOCUS_16200 1140 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1794 1549 gene locus_tag LOCUS_16210 1794 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1810 2223 gene locus_tag LOCUS_16220 1810 2223 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_16220 2413 3468 gene locus_tag LOCUS_16230 gene metZ 2413 3468 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_16230 3603 4061 gene locus_tag LOCUS_16240 3603 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4140 4472 gene locus_tag LOCUS_16250 4140 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6273 4537 gene locus_tag LOCUS_16260 6273 4537 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243544.1 protein_id gnl|my_center|LOCUS_16260 6384 7325 gene locus_tag LOCUS_16270 gene tolB2 6384 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708227.1 protein_id gnl|my_center|LOCUS_16270 7713 8696 gene locus_tag LOCUS_16280 7713 8696 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_16280 10036 8693 gene locus_tag LOCUS_16290 gene accC 10036 8693 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_16290 10605 10048 gene locus_tag LOCUS_16300 gene accB 10605 10048 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_16300 11140 10577 gene locus_tag LOCUS_16310 gene efp 11140 10577 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_16310 12149 11148 gene locus_tag LOCUS_16320 gene fabH1 12149 11148 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABI8 protein_id gnl|my_center|LOCUS_16320 12402 12211 gene locus_tag LOCUS_16330 gene rpmF 12402 12211 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_16330 12948 12421 gene locus_tag LOCUS_16340 12948 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770281.1 protein_id gnl|my_center|LOCUS_16340 14046 13027 gene locus_tag LOCUS_16350 gene pdxA 14046 13027 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_16350 14093 14857 gene locus_tag LOCUS_16360 gene rsmA 14093 14857 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_16360 14857 16209 gene locus_tag LOCUS_16370 gene mgtE 14857 16209 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_16370 16209 17156 gene locus_tag LOCUS_16380 16209 17156 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_16380 17267 17740 gene locus_tag LOCUS_16390 gene greA 17267 17740 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_16390 17742 18134 gene locus_tag LOCUS_16400 17742 18134 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_16400 18697 18131 gene locus_tag LOCUS_16410 gene ruvC 18697 18131 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_16410 18877 19155 gene locus_tag LOCUS_16420 18877 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 19612 20379 gene locus_tag LOCUS_16430 19612 20379 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567380.1 protein_id gnl|my_center|LOCUS_16430 20376 21440 gene locus_tag LOCUS_16440 gene ansA 20376 21440 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_16440 21539 21626 gene locus_tag LOCUS_t00230 21539 21626 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21665 22519 gene locus_tag LOCUS_16450 21665 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 22539 22844 gene locus_tag LOCUS_16460 22539 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 22846 23481 gene locus_tag LOCUS_16470 22846 23481 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_16470 23495 23959 gene locus_tag LOCUS_16480 23495 23959 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_16480 24990 24520 gene locus_tag LOCUS_16490 gene smpB 24990 24520 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_16490 25996 24992 gene locus_tag LOCUS_16500 gene tsaD 25996 24992 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_16500 26131 30399 gene locus_tag LOCUS_16510 26131 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 30849 32024 gene locus_tag LOCUS_16520 gene dctD 30849 32024 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_16520 33218 32250 gene locus_tag LOCUS_16530 33218 32250 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_16530 33311 34072 gene locus_tag LOCUS_16540 33311 34072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 36488 34074 gene locus_tag LOCUS_16550 36488 34074 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_16550 36761 37873 gene locus_tag LOCUS_16560 36761 37873 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_16560 38328 37870 gene locus_tag LOCUS_16570 38328 37870 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_16570 39604 38306 gene locus_tag LOCUS_16580 39604 38306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_16580 40594 39752 gene locus_tag LOCUS_16590 40594 39752 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_16590 41110 40676 gene locus_tag LOCUS_16600 41110 40676 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_16600 41211 42152 gene locus_tag LOCUS_16610 gene sltB1 41211 42152 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_16610 42319 43167 gene locus_tag LOCUS_16620 42319 43167 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence024 3177 2431 gene locus_tag LOCUS_16630 gene sdhB 3177 2431 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_16630 5209 3200 gene locus_tag LOCUS_16640 gene sdhA 5209 3200 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_16640 5933 5277 gene locus_tag LOCUS_16650 gene sdhC 5933 5277 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_16650 6230 9085 gene locus_tag LOCUS_16660 6230 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9064 9486 gene locus_tag LOCUS_16670 gene yuxK 9064 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_16670 9533 10405 gene locus_tag LOCUS_16680 gene fabD 9533 10405 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_16680 10566 11249 gene locus_tag LOCUS_16690 gene cmk 10566 11249 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_16690 11239 12111 gene locus_tag LOCUS_16700 gene ispH 11239 12111 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_16700 12233 13594 gene locus_tag LOCUS_16710 gene nqrA 12233 13594 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_16710 13598 14794 gene locus_tag LOCUS_16720 gene nqrB 13598 14794 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_16720 14823 15542 gene locus_tag LOCUS_16730 gene nqrC 14823 15542 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_16730 15564 16244 gene locus_tag LOCUS_16740 gene nqrD 15564 16244 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_16740 16259 16870 gene locus_tag LOCUS_16750 gene nqrE 16259 16870 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_16750 17679 18311 gene locus_tag LOCUS_16760 17679 18311 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_16760 18308 19495 gene locus_tag LOCUS_16770 18308 19495 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_16770 19488 20459 gene locus_tag LOCUS_16780 gene argC 19488 20459 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_16780 20462 21265 gene locus_tag LOCUS_16790 gene proC 20462 21265 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_16790 21262 22389 gene locus_tag LOCUS_16800 21262 22389 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_16800 22382 23329 gene locus_tag LOCUS_16810 22382 23329 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_16810 23326 24114 gene locus_tag LOCUS_16820 gene argB 23326 24114 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_16820 24092 25192 gene locus_tag LOCUS_16830 24092 25192 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_16830 25189 26481 gene locus_tag LOCUS_16840 gene argH 25189 26481 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_16840 26529 29651 gene locus_tag LOCUS_16850 26529 29651 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UE7 protein_id gnl|my_center|LOCUS_16850 29718 30146 gene locus_tag LOCUS_16860 29718 30146 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_16860 30601 31044 gene locus_tag LOCUS_16870 gene mraZ 30601 31044 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S536 protein_id gnl|my_center|LOCUS_16870 31053 31964 gene locus_tag LOCUS_16880 gene rsmH 31053 31964 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_16880 31966 32325 gene locus_tag LOCUS_16890 31966 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 32322 34424 gene locus_tag LOCUS_16900 gene ftsI 32322 34424 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_16900 34417 35877 gene locus_tag LOCUS_16910 gene murE 34417 35877 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_16910 35877 37064 gene locus_tag LOCUS_16920 gene mraY 35877 37064 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_16920 37071 38438 gene locus_tag LOCUS_16930 gene murD 37071 38438 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_16930 38435 39598 gene locus_tag LOCUS_16940 gene ftsW 38435 39598 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_16940 39628 40710 gene locus_tag LOCUS_16950 gene murG 39628 40710 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_16950 40707 42071 gene locus_tag LOCUS_16960 gene murC 40707 42071 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_16960 >Feature sequence025 1007 3499 gene locus_tag LOCUS_16970 1007 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6505 4016 gene locus_tag LOCUS_16980 6505 4016 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964024.1 protein_id gnl|my_center|LOCUS_16980 7479 7811 gene locus_tag LOCUS_16990 7479 7811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072992.1 protein_id gnl|my_center|LOCUS_16990 7905 10898 gene locus_tag LOCUS_17000 7905 10898 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_17000 12582 10930 gene locus_tag LOCUS_17010 12582 10930 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_17010 14712 12781 gene locus_tag LOCUS_17020 14712 12781 CDS product spermidine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 protein_id gnl|my_center|LOCUS_17020 15267 14740 gene locus_tag LOCUS_17030 15267 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 15412 16308 gene locus_tag LOCUS_17040 15412 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16968 16381 gene locus_tag LOCUS_17050 16968 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 17588 18019 gene locus_tag LOCUS_17060 17588 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 18648 19751 gene locus_tag LOCUS_17070 18648 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 20955 19948 gene locus_tag LOCUS_17080 20955 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 21170 21352 gene locus_tag LOCUS_17090 21170 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 22648 21899 gene locus_tag LOCUS_17100 22648 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_17100 23487 22798 gene locus_tag LOCUS_17110 23487 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 24167 23607 gene locus_tag LOCUS_17120 24167 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 25100 24348 gene locus_tag LOCUS_17130 25100 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28227 25126 gene locus_tag LOCUS_17140 28227 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 28877 28347 gene locus_tag LOCUS_17150 28877 28347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 29568 30008 gene locus_tag LOCUS_17160 29568 30008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 30774 30025 gene locus_tag LOCUS_17170 30774 30025 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_17170 31969 31091 gene locus_tag LOCUS_17180 31969 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 32982 32323 gene locus_tag LOCUS_17190 32982 32323 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_17190 33471 32983 gene locus_tag LOCUS_17200 33471 32983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 33808 34725 gene locus_tag LOCUS_17210 33808 34725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_17210 34737 36068 gene locus_tag LOCUS_17220 34737 36068 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_17220 36081 37001 gene locus_tag LOCUS_17230 36081 37001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 37044 38075 gene locus_tag LOCUS_17240 37044 38075 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_17240 38065 39090 gene locus_tag LOCUS_17250 gene selD 38065 39090 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F7 protein_id gnl|my_center|LOCUS_17250 39774 39454 gene locus_tag LOCUS_17260 39774 39454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17260 40743 40105 gene locus_tag LOCUS_17270 gene plsC 40743 40105 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence026 <1 2556 gene locus_tag LOCUS_17280 <1 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106540.1:alpha-amylase 2553 3959 gene locus_tag LOCUS_17290 gene arsA 2553 3959 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_17290 5038 4043 gene locus_tag LOCUS_17300 5038 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5303 6322 gene locus_tag LOCUS_17310 5303 6322 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_17310 6330 9776 gene locus_tag LOCUS_17320 6330 9776 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_17320 9779 11137 gene locus_tag LOCUS_17330 9779 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 11137 11595 gene locus_tag LOCUS_17340 11137 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 11601 12635 gene locus_tag LOCUS_17350 11601 12635 CDS product DUF4961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760969.1 protein_id gnl|my_center|LOCUS_17350 12662 14362 gene locus_tag LOCUS_17360 12662 14362 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_17360 14518 15951 gene locus_tag LOCUS_17370 14518 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 15951 17036 gene locus_tag LOCUS_17380 gene aroC 15951 17036 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_17380 17039 18448 gene locus_tag LOCUS_17390 gene gltP 17039 18448 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_17390 18531 19115 gene locus_tag LOCUS_17400 18531 19115 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_17400 19218 20786 gene locus_tag LOCUS_17410 19218 20786 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_17410 24362 21429 gene locus_tag LOCUS_17420 24362 21429 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_17420 25220 24366 gene locus_tag LOCUS_17430 25220 24366 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_17430 25495 26547 gene locus_tag LOCUS_17440 25495 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 27329 26544 gene locus_tag LOCUS_17450 27329 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 29405 27516 gene locus_tag LOCUS_17460 gene htpG 29405 27516 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_17460 30033 29545 gene locus_tag LOCUS_17470 30033 29545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_17470 30105 30857 gene locus_tag LOCUS_17480 gene truA 30105 30857 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_17480 30854 32620 gene locus_tag LOCUS_17490 30854 32620 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_17490 32617 33165 gene locus_tag LOCUS_17500 32617 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 34952 33162 gene locus_tag LOCUS_17510 34952 33162 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_17510 35072 36175 gene locus_tag LOCUS_17520 gene vdh 35072 36175 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_17520 36192 37355 gene locus_tag LOCUS_17530 36192 37355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 37363 37665 gene locus_tag LOCUS_17540 37363 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 37732 38250 gene locus_tag LOCUS_17550 37732 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_17550 38257 38565 gene locus_tag LOCUS_17560 38257 38565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 38581 39522 gene locus_tag LOCUS_17570 38581 39522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 39512 40117 gene locus_tag LOCUS_17580 gene coaE 39512 40117 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_17580 >Feature sequence027 <1 1520 gene locus_tag LOCUS_17590 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867156.1:sodium:proline symporter 2148 1654 gene locus_tag LOCUS_17600 2148 1654 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_17600 4072 2210 gene locus_tag LOCUS_17610 4072 2210 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_17610 5086 6780 gene locus_tag LOCUS_17620 5086 6780 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 protein_id gnl|my_center|LOCUS_17620 7629 6859 gene locus_tag LOCUS_17630 7629 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 8937 7717 gene locus_tag LOCUS_17640 gene queA 8937 7717 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_17640 8945 10018 gene locus_tag LOCUS_17650 gene menC 8945 10018 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_17650 10028 10789 gene locus_tag LOCUS_17660 10028 10789 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_17660 11795 10896 gene locus_tag LOCUS_17670 11795 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_17670 12590 11811 gene locus_tag LOCUS_17680 12590 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 14440 12590 gene locus_tag LOCUS_17690 14440 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 protein_id gnl|my_center|LOCUS_17690 15507 17996 gene locus_tag LOCUS_17700 15507 17996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 18092 19795 gene locus_tag LOCUS_17710 18092 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 20732 19872 gene locus_tag LOCUS_17720 20732 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_17720 20974 21897 gene locus_tag LOCUS_17730 20974 21897 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_17730 21975 23441 gene locus_tag LOCUS_17740 21975 23441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 25138 23438 gene locus_tag LOCUS_17750 25138 23438 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_17750 26308 25145 gene locus_tag LOCUS_17760 26308 25145 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_17760 26906 26310 gene locus_tag LOCUS_17770 26906 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 28450 27074 gene locus_tag LOCUS_17780 28450 27074 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_17780 28822 29958 gene locus_tag LOCUS_17790 28822 29958 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_17790 29970 31136 gene locus_tag LOCUS_17800 29970 31136 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709443.1 protein_id gnl|my_center|LOCUS_17800 31168 32226 gene locus_tag LOCUS_17810 31168 32226 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_17810 32419 35922 gene locus_tag LOCUS_17820 32419 35922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 36746 36180 gene locus_tag LOCUS_17830 36746 36180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 37837 36785 gene locus_tag LOCUS_17840 37837 36785 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989793.1 protein_id gnl|my_center|LOCUS_17840 38066 39607 gene locus_tag LOCUS_17850 38066 39607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence028 <1 12984 gene locus_tag LOCUS_17860 <1 12984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein 13085 14152 gene locus_tag LOCUS_17870 gene prfA 13085 14152 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_17870 14155 15549 gene locus_tag LOCUS_17880 14155 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 15769 16911 gene locus_tag LOCUS_17890 15769 16911 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_17890 17269 17093 gene locus_tag LOCUS_17900 17269 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 18142 17534 gene locus_tag LOCUS_17910 18142 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 19217 18219 gene locus_tag LOCUS_17920 19217 18219 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_17920 20191 19307 gene locus_tag LOCUS_17930 20191 19307 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_17930 20243 20728 gene locus_tag LOCUS_17940 20243 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 20731 21519 gene locus_tag LOCUS_17950 gene lgt 20731 21519 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66627 protein_id gnl|my_center|LOCUS_17950 22384 21500 gene locus_tag LOCUS_17960 22384 21500 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_17960 23480 22524 gene locus_tag LOCUS_17970 23480 22524 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_17970 26267 23496 gene locus_tag LOCUS_17980 gene polA 26267 23496 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_17980 26445 27026 gene locus_tag LOCUS_17990 26445 27026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 30012 27091 gene locus_tag LOCUS_18000 30012 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 31213 30077 gene locus_tag LOCUS_18010 31213 30077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_18010 31656 31294 gene locus_tag LOCUS_18020 gene rbfA 31656 31294 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV5 protein_id gnl|my_center|LOCUS_18020 32144 33136 gene locus_tag LOCUS_18030 32144 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 33554 33126 gene locus_tag LOCUS_18040 gene rpiB 33554 33126 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_18040 34397 33564 gene locus_tag LOCUS_18050 gene tatC 34397 33564 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_18050 <35363 34405 gene locus_tag LOCUS_18060 <35363 34405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase >Feature sequence029 325 783 gene locus_tag LOCUS_18070 325 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 952 2439 gene locus_tag LOCUS_18080 952 2439 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_18080 2546 4084 gene locus_tag LOCUS_18090 gene pcd 2546 4084 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_18090 4090 4548 gene locus_tag LOCUS_18100 4090 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4623 5018 gene locus_tag LOCUS_18110 4623 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5258 5923 gene locus_tag LOCUS_18120 5258 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 6258 6935 gene locus_tag LOCUS_18130 6258 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 8116 7076 gene locus_tag LOCUS_18140 8116 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8581 9324 gene locus_tag LOCUS_18150 8581 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9575 9859 gene locus_tag LOCUS_18160 9575 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 10370 10582 gene locus_tag LOCUS_18170 10370 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13303 10811 gene locus_tag LOCUS_18180 13303 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 15649 14018 gene locus_tag LOCUS_18190 gene pruA 15649 14018 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_18190 16383 15700 gene locus_tag LOCUS_18200 16383 15700 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_18200 16763 16380 gene locus_tag LOCUS_18210 16763 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 16927 17466 gene locus_tag LOCUS_18220 16927 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 18716 17463 gene locus_tag LOCUS_18230 18716 17463 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_18230 18926 19666 gene locus_tag LOCUS_18240 18926 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 19680 20954 gene locus_tag LOCUS_18250 gene kynU 19680 20954 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_18250 22881 20974 gene locus_tag LOCUS_18260 gene dxs 22881 20974 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_18260 22993 23772 gene locus_tag LOCUS_18270 gene scpA 22993 23772 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_18270 24212 23814 gene locus_tag LOCUS_18280 gene ndk 24212 23814 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_18280 24378 25400 gene locus_tag LOCUS_18290 gene fjo19 24378 25400 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_18290 25550 26170 gene locus_tag LOCUS_18300 25550 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 26170 26742 gene locus_tag LOCUS_18310 26170 26742 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_18310 26739 27371 gene locus_tag LOCUS_18320 gene udk 26739 27371 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_18320 27470 27748 gene locus_tag LOCUS_18330 27470 27748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 27817 30822 gene locus_tag LOCUS_18340 27817 30822 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_18340 30920 31666 gene locus_tag LOCUS_18350 30920 31666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 31862 32542 gene locus_tag LOCUS_18360 31862 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_18360 33045 32659 gene locus_tag LOCUS_18370 33045 32659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence030 297 809 gene locus_tag LOCUS_18380 297 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1241 1858 gene locus_tag LOCUS_18390 1241 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1945 2232 gene locus_tag LOCUS_18400 1945 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5597 2469 gene locus_tag LOCUS_18410 5597 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 7192 5792 gene locus_tag LOCUS_18420 7192 5792 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252784.1 protein_id gnl|my_center|LOCUS_18420 8797 7256 gene locus_tag LOCUS_18430 gene sglT 8797 7256 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_18430 9965 8802 gene locus_tag LOCUS_18440 9965 8802 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_18440 10612 10241 gene locus_tag LOCUS_18450 10612 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 10799 11416 gene locus_tag LOCUS_18460 10799 11416 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_18460 11494 11715 gene locus_tag LOCUS_18470 11494 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 11833 13293 gene locus_tag LOCUS_18480 11833 13293 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_18480 13451 16078 gene locus_tag LOCUS_18490 13451 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 16393 16656 gene locus_tag LOCUS_18500 16393 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18500 19202 16755 gene locus_tag LOCUS_18510 19202 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_18510 19732 19199 gene locus_tag LOCUS_18520 gene msrA 19732 19199 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTB6 protein_id gnl|my_center|LOCUS_18520 20180 19734 gene locus_tag LOCUS_18530 20180 19734 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_18530 20836 20420 gene locus_tag LOCUS_18540 20836 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 22725 20911 gene locus_tag LOCUS_18550 22725 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_18550 23504 22722 gene locus_tag LOCUS_18560 23504 22722 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_18560 24405 23506 gene locus_tag LOCUS_18570 24405 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701784.1 protein_id gnl|my_center|LOCUS_18570 27635 24468 gene locus_tag LOCUS_18580 27635 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 27784 28749 gene locus_tag LOCUS_18590 27784 28749 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_18590 28913 29875 gene locus_tag LOCUS_18600 28913 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 30005 30499 gene locus_tag LOCUS_18610 30005 30499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 30560 31456 gene locus_tag LOCUS_18620 30560 31456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_18620 31464 32021 gene locus_tag LOCUS_18630 31464 32021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_18630 32045 32485 gene locus_tag LOCUS_18640 32045 32485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence031 18 1280 gene locus_tag LOCUS_18650 18 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1273 2433 gene locus_tag LOCUS_18660 1273 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_18660 2436 3779 gene locus_tag LOCUS_18670 2436 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3829 5562 gene locus_tag LOCUS_18680 3829 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5567 5803 gene locus_tag LOCUS_18690 5567 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5805 6578 gene locus_tag LOCUS_18700 5805 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6590 7639 gene locus_tag LOCUS_18710 6590 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7753 9225 gene locus_tag LOCUS_18720 7753 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9280 9729 gene locus_tag LOCUS_18730 9280 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 9808 10284 gene locus_tag LOCUS_18740 9808 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 10350 10811 gene locus_tag LOCUS_18750 10350 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 10862 11050 gene locus_tag LOCUS_18760 10862 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 11056 11706 gene locus_tag LOCUS_18770 11056 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 11708 13489 gene locus_tag LOCUS_18780 11708 13489 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_18780 13834 14256 gene locus_tag LOCUS_18790 13834 14256 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_18790 14258 18058 gene locus_tag LOCUS_18800 14258 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 18075 18821 gene locus_tag LOCUS_18810 18075 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18841 22278 gene locus_tag LOCUS_18820 18841 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 22265 25501 gene locus_tag LOCUS_18830 22265 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 25504 28173 gene locus_tag LOCUS_18840 25504 28173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 28193 30133 gene locus_tag LOCUS_18850 28193 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence032 520 903 gene locus_tag LOCUS_18860 520 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1158 2117 gene locus_tag LOCUS_18870 gene nadA 1158 2117 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_18870 2121 3716 gene locus_tag LOCUS_18880 2121 3716 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q3 protein_id gnl|my_center|LOCUS_18880 3899 4432 gene locus_tag LOCUS_18890 gene idi 3899 4432 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_18890 4509 5264 gene locus_tag LOCUS_18900 4509 5264 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6S5 protein_id gnl|my_center|LOCUS_18900 6237 5269 gene locus_tag LOCUS_18910 6237 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 7378 6230 gene locus_tag LOCUS_18920 7378 6230 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_18920 8253 7381 gene locus_tag LOCUS_18930 8253 7381 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_18930 8785 8264 gene locus_tag LOCUS_18940 8785 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 11199 8860 gene locus_tag LOCUS_18950 11199 8860 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_18950 11777 11271 gene locus_tag LOCUS_18960 11777 11271 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_18960 12658 11786 gene locus_tag LOCUS_18970 12658 11786 CDS product carbon monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_18970 13902 12826 gene locus_tag LOCUS_18980 13902 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 14174 13902 gene locus_tag LOCUS_18990 14174 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 14670 15683 gene locus_tag LOCUS_19000 14670 15683 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_19000 16832 15684 gene locus_tag LOCUS_19010 16832 15684 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_19010 16914 17393 gene locus_tag LOCUS_19020 gene moaC 16914 17393 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_19020 17374 18492 gene locus_tag LOCUS_19030 17374 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 19754 18546 gene locus_tag LOCUS_19040 gene moeA 19754 18546 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_19040 20659 19757 gene locus_tag LOCUS_19050 gene moaA 20659 19757 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59038 protein_id gnl|my_center|LOCUS_19050 20761 22038 gene locus_tag LOCUS_19060 gene csdB 20761 22038 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BY0 protein_id gnl|my_center|LOCUS_19060 22035 22469 gene locus_tag LOCUS_19070 22035 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 22466 22708 gene locus_tag LOCUS_19080 gene moaD 22466 22708 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_19080 22709 23125 gene locus_tag LOCUS_19090 gene moaE 22709 23125 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_19090 24185 23664 gene locus_tag LOCUS_19100 24185 23664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 26549 25146 gene locus_tag LOCUS_19110 26549 25146 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_19110 28618 27002 gene locus_tag LOCUS_19120 gene ykpA 28618 27002 CDS product putative ABC transporter ATP-binding protein YkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31716 protein_id gnl|my_center|LOCUS_19120 28844 30265 gene locus_tag LOCUS_19130 28844 30265 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence033 <1 583 gene locus_tag LOCUS_19140 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760322.1:glycosyl transferase 576 1550 gene locus_tag LOCUS_19150 576 1550 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_19150 2068 1565 gene locus_tag LOCUS_19160 2068 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2453 2815 gene locus_tag LOCUS_19170 2453 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3997 2816 gene locus_tag LOCUS_19180 3997 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4388 4017 gene locus_tag LOCUS_19190 4388 4017 CDS product chromosome condensation protein CcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944500.1 protein_id gnl|my_center|LOCUS_19190 4972 4385 gene locus_tag LOCUS_19200 4972 4385 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_19200 5291 5668 gene locus_tag LOCUS_19210 5291 5668 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_19210 5665 6414 gene locus_tag LOCUS_19220 5665 6414 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389085.1 protein_id gnl|my_center|LOCUS_19220 6617 8512 gene locus_tag LOCUS_19230 6617 8512 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_19230 9894 8524 gene locus_tag LOCUS_19240 9894 8524 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_19240 10605 9955 gene locus_tag LOCUS_19250 10605 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 11150 11608 gene locus_tag LOCUS_19260 11150 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 13358 12252 gene locus_tag LOCUS_19270 13358 12252 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_19270 13600 13391 gene locus_tag LOCUS_19280 13600 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 15900 13663 gene locus_tag LOCUS_19290 15900 13663 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_19290 16985 16020 gene locus_tag LOCUS_19300 16985 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 18064 17003 gene locus_tag LOCUS_19310 18064 17003 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_19310 18512 18084 gene locus_tag LOCUS_19320 18512 18084 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_19320 19337 18885 gene locus_tag LOCUS_19330 19337 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 19997 19365 gene locus_tag LOCUS_19340 19997 19365 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_19340 20148 21698 gene locus_tag LOCUS_19350 20148 21698 CDS product serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122093.1 protein_id gnl|my_center|LOCUS_19350 21853 23781 gene locus_tag LOCUS_19360 21853 23781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_19360 24096 23884 gene locus_tag LOCUS_19370 24096 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 24800 24093 gene locus_tag LOCUS_19380 24800 24093 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19380 25919 24999 gene locus_tag LOCUS_19390 25919 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence034 1369 2 gene locus_tag LOCUS_19400 gene mnmE 1369 2 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_19400 1578 1366 gene locus_tag LOCUS_19410 1578 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2906 1491 gene locus_tag LOCUS_19420 2906 1491 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_19420 3672 2908 gene locus_tag LOCUS_19430 gene feoB 3672 2908 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948517.1 protein_id gnl|my_center|LOCUS_19430 4732 3650 gene locus_tag LOCUS_19440 4732 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5400 4729 gene locus_tag LOCUS_19450 gene sirR 5400 4729 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_19450 5924 6691 gene locus_tag LOCUS_19460 gene dapD 5924 6691 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_19460 6782 7543 gene locus_tag LOCUS_19470 6782 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 7575 8159 gene locus_tag LOCUS_19480 7575 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 8159 9316 gene locus_tag LOCUS_19490 gene lysA 8159 9316 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A800 protein_id gnl|my_center|LOCUS_19490 10724 9309 gene locus_tag LOCUS_19500 10724 9309 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_19500 11326 10721 gene locus_tag LOCUS_19510 11326 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 12369 11350 gene locus_tag LOCUS_19520 12369 11350 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_19520 12717 14525 gene locus_tag LOCUS_19530 12717 14525 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_19530 14700 16814 gene locus_tag LOCUS_19540 14700 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16942 17310 gene locus_tag LOCUS_19550 16942 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 19797 17311 gene locus_tag LOCUS_19560 19797 17311 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_19560 19894 20496 gene locus_tag LOCUS_19570 19894 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946025.1 protein_id gnl|my_center|LOCUS_19570 23279 20529 gene locus_tag LOCUS_19580 23279 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 24308 23358 gene locus_tag LOCUS_19590 24308 23358 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_19590 25369 24314 gene locus_tag LOCUS_19600 25369 24314 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_19600 25417 25839 gene locus_tag LOCUS_19610 25417 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence035 1016 234 gene locus_tag LOCUS_19620 1016 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2256 1243 gene locus_tag LOCUS_19630 2256 1243 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_19630 2606 3652 gene locus_tag LOCUS_19640 2606 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_19640 3793 4140 gene locus_tag LOCUS_19650 gene fdx1 3793 4140 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_19650 5065 4157 gene locus_tag LOCUS_19660 5065 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_19660 5209 5523 gene locus_tag LOCUS_19670 5209 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5675 6772 gene locus_tag LOCUS_19680 gene ychF 5675 6772 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_19680 8078 6831 gene locus_tag LOCUS_19690 8078 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 8171 8716 gene locus_tag LOCUS_19700 8171 8716 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19700 8763 10004 gene locus_tag LOCUS_19710 8763 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 10357 11592 gene locus_tag LOCUS_19720 10357 11592 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_19720 12058 15255 gene locus_tag LOCUS_19730 12058 15255 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_19730 15268 17067 gene locus_tag LOCUS_19740 15268 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 17735 20830 gene locus_tag LOCUS_19750 17735 20830 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_19750 20944 22140 gene locus_tag LOCUS_19760 20944 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 22169 23011 gene locus_tag LOCUS_19770 22169 23011 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123406.1 protein_id gnl|my_center|LOCUS_19770 23026 23826 gene locus_tag LOCUS_19780 gene mhpC 23026 23826 CDS product lipolytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_19780 23854 24981 gene locus_tag LOCUS_19790 23854 24981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_19790 25307 27103 gene locus_tag LOCUS_19800 25307 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence036 <1 696 gene locus_tag LOCUS_19810 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UKE5:DNA polymerase IV 785 1252 gene locus_tag LOCUS_19820 785 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2350 1256 gene locus_tag LOCUS_19830 gene hisB 2350 1256 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_19830 3399 2347 gene locus_tag LOCUS_19840 gene hisC 3399 2347 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_19840 4679 3396 gene locus_tag LOCUS_19850 gene hisD 4679 3396 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE7 protein_id gnl|my_center|LOCUS_19850 5542 4679 gene locus_tag LOCUS_19860 gene hisG 5542 4679 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_19860 6507 5662 gene locus_tag LOCUS_19870 gene uspA 6507 5662 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_19870 7486 6590 gene locus_tag LOCUS_19880 gene menA 7486 6590 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_19880 9267 7486 gene locus_tag LOCUS_19890 gene argS 9267 7486 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_19890 10205 9264 gene locus_tag LOCUS_19900 10205 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_19900 11118 10198 gene locus_tag LOCUS_19910 11118 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_19910 11262 12653 gene locus_tag LOCUS_19920 gene speA 11262 12653 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_19920 13153 12650 gene locus_tag LOCUS_19930 13153 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 13221 14054 gene locus_tag LOCUS_19940 13221 14054 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_19940 15179 13962 gene locus_tag LOCUS_19950 15179 13962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_19950 16228 16404 gene locus_tag LOCUS_19960 16228 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 16417 16701 gene locus_tag LOCUS_19970 16417 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 16902 18047 gene locus_tag LOCUS_19980 16902 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 18830 19039 gene locus_tag LOCUS_19990 18830 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 19655 20155 gene locus_tag LOCUS_20000 19655 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 21057 20839 gene locus_tag LOCUS_20010 21057 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 21311 21054 gene locus_tag LOCUS_20020 21311 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 21535 22893 gene locus_tag LOCUS_20030 21535 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 23646 24077 gene locus_tag LOCUS_20040 23646 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 24109 25023 gene locus_tag LOCUS_20050 gene fmt 24109 25023 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_20050 25072 25548 gene locus_tag LOCUS_20060 gene dfrA 25072 25548 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_20060 >Feature sequence037 807 2471 gene locus_tag LOCUS_20070 gene pgi 807 2471 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83IN9 protein_id gnl|my_center|LOCUS_20070 3188 2454 gene locus_tag LOCUS_20080 3188 2454 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_20080 3258 5639 gene locus_tag LOCUS_20090 3258 5639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_20090 5876 6166 gene locus_tag LOCUS_20100 5876 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6221 6469 gene locus_tag LOCUS_20110 6221 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 7035 6508 gene locus_tag LOCUS_20120 7035 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 7843 8739 gene locus_tag LOCUS_20130 gene hemF 7843 8739 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_20130 8732 9304 gene locus_tag LOCUS_20140 gene lpxF 8732 9304 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_20140 9874 9284 gene locus_tag LOCUS_20150 gene ribE 9874 9284 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_20150 9915 10568 gene locus_tag LOCUS_20160 gene pcm 9915 10568 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_20160 10562 11083 gene locus_tag LOCUS_20170 10562 11083 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_20170 11531 11977 gene locus_tag LOCUS_20180 11531 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 13077 11974 gene locus_tag LOCUS_20190 13077 11974 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_20190 14513 13074 gene locus_tag LOCUS_20200 gene gatB 14513 13074 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE11 protein_id gnl|my_center|LOCUS_20200 17149 14525 gene locus_tag LOCUS_20210 gene alaS 17149 14525 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_20210 17369 18274 gene locus_tag LOCUS_20220 17369 18274 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_20220 19042 19386 gene locus_tag LOCUS_20230 19042 19386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_20230 22106 19455 gene locus_tag LOCUS_20240 22106 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 22569 22132 gene locus_tag LOCUS_20250 gene queF 22569 22132 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKP6 protein_id gnl|my_center|LOCUS_20250 23557 22559 gene locus_tag LOCUS_20260 23557 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 24124 23735 gene locus_tag LOCUS_20270 24124 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 24983 24144 gene locus_tag LOCUS_20280 24983 24144 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence038 2985 37 gene locus_tag LOCUS_20290 2985 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_20290 5551 3941 gene locus_tag LOCUS_20300 5551 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7158 5863 gene locus_tag LOCUS_20310 7158 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 7969 8394 gene locus_tag LOCUS_20320 7969 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 8901 9368 gene locus_tag LOCUS_20330 8901 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_20330 9714 9890 gene locus_tag LOCUS_20340 9714 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 11113 11631 gene locus_tag LOCUS_20350 11113 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 11767 12783 gene locus_tag LOCUS_20360 11767 12783 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582901.1 protein_id gnl|my_center|LOCUS_20360 14136 12964 gene locus_tag LOCUS_20370 14136 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14401 14574 gene locus_tag LOCUS_20380 14401 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 14956 15159 gene locus_tag LOCUS_20390 14956 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 15195 15812 gene locus_tag LOCUS_20400 15195 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 15904 16686 gene locus_tag LOCUS_20410 15904 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 16918 17511 gene locus_tag LOCUS_20420 16918 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 18218 17733 gene locus_tag LOCUS_20430 18218 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 18709 19170 gene locus_tag LOCUS_20440 18709 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 20028 20312 gene locus_tag LOCUS_20450 20028 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 21003 21959 gene locus_tag LOCUS_20460 21003 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 22364 23749 gene locus_tag LOCUS_20470 22364 23749 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence039 2361 694 gene locus_tag LOCUS_20480 gene egl2 2361 694 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_20480 6035 2451 gene locus_tag LOCUS_20490 6035 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_20490 6939 6055 gene locus_tag LOCUS_20500 6939 6055 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_20500 7459 7387 gene locus_tag LOCUS_t00240 7459 7387 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8642 7500 gene locus_tag LOCUS_20510 gene hflX 8642 7500 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_20510 8987 10390 gene locus_tag LOCUS_20520 8987 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_20520 10443 11204 gene locus_tag LOCUS_20530 10443 11204 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_20530 11210 12100 gene locus_tag LOCUS_20540 11210 12100 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_20540 12168 12911 gene locus_tag LOCUS_20550 12168 12911 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_20550 12911 14935 gene locus_tag LOCUS_20560 gene uvrB 12911 14935 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_20560 15346 14936 gene locus_tag LOCUS_20570 15346 14936 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_20570 16380 15346 gene locus_tag LOCUS_20580 16380 15346 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_20580 16451 17080 gene locus_tag LOCUS_20590 16451 17080 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_20590 17083 17712 gene locus_tag LOCUS_20600 17083 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_20600 17821 20367 gene locus_tag LOCUS_20610 gene clpC 17821 20367 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_20610 22429 20390 gene locus_tag LOCUS_20620 22429 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 23230 22484 gene locus_tag LOCUS_20630 23230 22484 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence040 2445 622 gene locus_tag LOCUS_20640 gene mutL 2445 622 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_20640 2786 2445 gene locus_tag LOCUS_20650 2786 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3242 4318 gene locus_tag LOCUS_20660 3242 4318 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_20660 4363 5487 gene locus_tag LOCUS_20670 4363 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_20670 5493 7001 gene locus_tag LOCUS_20680 5493 7001 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_20680 7016 7663 gene locus_tag LOCUS_20690 7016 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8130 8687 gene locus_tag LOCUS_20700 8130 8687 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_20700 8915 9313 gene locus_tag LOCUS_20710 8915 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9340 11889 gene locus_tag LOCUS_20720 9340 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 12048 12944 gene locus_tag LOCUS_20730 12048 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 13136 14188 gene locus_tag LOCUS_20740 13136 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 14189 14446 gene locus_tag LOCUS_20750 14189 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 14521 16905 gene locus_tag LOCUS_20760 14521 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 17040 19652 gene locus_tag LOCUS_20770 17040 19652 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107972.1 protein_id gnl|my_center|LOCUS_20770 19694 21253 gene locus_tag LOCUS_20780 19694 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 21267 22193 gene locus_tag LOCUS_20790 21267 22193 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence041 2127 427 gene locus_tag LOCUS_20800 2127 427 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_20800 2200 2889 gene locus_tag LOCUS_20810 2200 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2951 3532 gene locus_tag LOCUS_20820 2951 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3533 4540 gene locus_tag LOCUS_20830 gene hemH 3533 4540 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_20830 4571 6115 gene locus_tag LOCUS_20840 4571 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067585.1 protein_id gnl|my_center|LOCUS_20840 7271 6132 gene locus_tag LOCUS_20850 7271 6132 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_20850 8668 7286 gene locus_tag LOCUS_20860 8668 7286 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_20860 8943 8713 gene locus_tag LOCUS_20870 8943 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 9021 9839 gene locus_tag LOCUS_20880 9021 9839 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_20880 12278 10494 gene locus_tag LOCUS_20890 12278 10494 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_20890 13103 12312 gene locus_tag LOCUS_20900 gene map 13103 12312 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_20900 13801 13181 gene locus_tag LOCUS_20910 13801 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 15277 13874 gene locus_tag LOCUS_20920 gene fumC 15277 13874 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_20920 15432 16070 gene locus_tag LOCUS_20930 gene nreC 15432 16070 CDS product oxygen regulatory protein NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN75 protein_id gnl|my_center|LOCUS_20930 16148 16366 gene locus_tag LOCUS_20940 16148 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 16363 18312 gene locus_tag LOCUS_20950 gene feoB 16363 18312 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_20950 18811 19050 gene locus_tag LOCUS_20960 18811 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 19143 19673 gene locus_tag LOCUS_20970 gene ftnA 19143 19673 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_20970 20300 19761 gene locus_tag LOCUS_20980 20300 19761 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence042 1441 182 gene locus_tag LOCUS_20990 gene purA 1441 182 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QR7 protein_id gnl|my_center|LOCUS_20990 1981 1511 gene locus_tag LOCUS_21000 1981 1511 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_21000 4219 2009 gene locus_tag LOCUS_21010 gene relA 4219 2009 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_21010 4288 4370 gene locus_tag LOCUS_t00250 4288 4370 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4436 5755 gene locus_tag LOCUS_21020 4436 5755 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_21020 5842 6510 gene locus_tag LOCUS_21030 gene clpP 5842 6510 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_21030 6512 7744 gene locus_tag LOCUS_21040 gene clpX 6512 7744 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_21040 8840 7731 gene locus_tag LOCUS_21050 gene lpxB 8840 7731 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_21050 8924 9889 gene locus_tag LOCUS_21060 gene hldD 8924 9889 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_21060 10887 9892 gene locus_tag LOCUS_21070 10887 9892 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_21070 12046 10889 gene locus_tag LOCUS_21080 12046 10889 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_21080 12063 12254 gene locus_tag LOCUS_21090 12063 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 13570 12287 gene locus_tag LOCUS_21100 13570 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21100 14103 13549 gene locus_tag LOCUS_21110 14103 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21110 15418 14123 gene locus_tag LOCUS_21120 15418 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 16406 15456 gene locus_tag LOCUS_21130 16406 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 18256 16418 gene locus_tag LOCUS_21140 18256 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 21595 18275 gene locus_tag LOCUS_21150 21595 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence043 784 278 gene locus_tag LOCUS_21160 784 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1803 919 gene locus_tag LOCUS_21170 1803 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3343 1829 gene locus_tag LOCUS_21180 gene gldG 3343 1829 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_21180 4079 3354 gene locus_tag LOCUS_21190 4079 3354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_21190 5007 4084 gene locus_tag LOCUS_21200 5007 4084 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_21200 5159 5662 gene locus_tag LOCUS_21210 5159 5662 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_21210 7467 5725 gene locus_tag LOCUS_21220 7467 5725 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202773.1 protein_id gnl|my_center|LOCUS_21220 7961 7752 gene locus_tag LOCUS_21230 7961 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 8234 8007 gene locus_tag LOCUS_21240 8234 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21240 8932 8543 gene locus_tag LOCUS_21250 8932 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9617 9186 gene locus_tag LOCUS_21260 9617 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21260 13020 9727 gene locus_tag LOCUS_21270 13020 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 14841 13153 gene locus_tag LOCUS_21280 14841 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 18248 14898 gene locus_tag LOCUS_21290 18248 14898 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_21290 19528 18476 gene locus_tag LOCUS_21300 19528 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence044 2783 726 gene locus_tag LOCUS_21310 2783 726 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_21310 5145 2923 gene locus_tag LOCUS_21320 5145 2923 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_21320 6986 5709 gene locus_tag LOCUS_21330 6986 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 7314 8381 gene locus_tag LOCUS_21340 7314 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_21340 9335 8487 gene locus_tag LOCUS_21350 9335 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 9950 10810 gene locus_tag LOCUS_21360 9950 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11100 11861 gene locus_tag LOCUS_21370 11100 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 13166 12021 gene locus_tag LOCUS_21380 gene lldA 13166 12021 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972226.1 protein_id gnl|my_center|LOCUS_21380 14077 13388 gene locus_tag LOCUS_21390 14077 13388 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_21390 15358 14279 gene locus_tag LOCUS_21400 15358 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 16586 15348 gene locus_tag LOCUS_21410 16586 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 16979 18055 gene locus_tag LOCUS_21420 16979 18055 CDS product sulfatase-modifying factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892596.1 protein_id gnl|my_center|LOCUS_21420 18572 19096 gene locus_tag LOCUS_21430 18572 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence045 <1 666 gene locus_tag LOCUS_21440 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964480.1:Fe-S cluster assembly protein SufD 663 1901 gene locus_tag LOCUS_21450 gene sufS 663 1901 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_21450 1902 2330 gene locus_tag LOCUS_21460 1902 2330 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_21460 2327 2671 gene locus_tag LOCUS_21470 2327 2671 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_21470 2694 3110 gene locus_tag LOCUS_21480 gene yqiW 2694 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_21480 3230 3715 gene locus_tag LOCUS_21490 3230 3715 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_21490 6126 3712 gene locus_tag LOCUS_21500 6126 3712 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_21500 7544 6291 gene locus_tag LOCUS_21510 7544 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8266 7541 gene locus_tag LOCUS_21520 8266 7541 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_21520 8453 10909 gene locus_tag LOCUS_21530 8453 10909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_21530 11929 10916 gene locus_tag LOCUS_21540 gene murB 11929 10916 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_21540 13674 11965 gene locus_tag LOCUS_21550 13674 11965 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_21550 13895 16147 gene locus_tag LOCUS_21560 13895 16147 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_21560 16221 16292 gene locus_tag LOCUS_t00260 16221 16292 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16854 16675 gene locus_tag LOCUS_21570 16854 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 17240 17037 gene locus_tag LOCUS_21580 17240 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 17744 18541 gene locus_tag LOCUS_21590 17744 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence046 3045 1672 gene locus_tag LOCUS_21600 3045 1672 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_21600 4258 3029 gene locus_tag LOCUS_21610 4258 3029 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_21610 5468 4248 gene locus_tag LOCUS_21620 gene aroB 5468 4248 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_21620 6509 5622 gene locus_tag LOCUS_21630 6509 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_21630 7422 6523 gene locus_tag LOCUS_21640 7422 6523 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_21640 8304 7435 gene locus_tag LOCUS_21650 8304 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 9090 8473 gene locus_tag LOCUS_21660 9090 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 9964 9095 gene locus_tag LOCUS_21670 9964 9095 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_21670 10094 10897 gene locus_tag LOCUS_21680 10094 10897 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_21680 11191 10928 gene locus_tag LOCUS_21690 11191 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 11684 11610 gene locus_tag LOCUS_t00270 11684 11610 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11826 12770 gene locus_tag LOCUS_21700 gene accA 11826 12770 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_21700 12825 13028 gene locus_tag LOCUS_21710 12825 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 13134 13310 gene locus_tag LOCUS_21720 13134 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21720 13567 14121 gene locus_tag LOCUS_21730 13567 14121 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_21730 14956 14156 gene locus_tag LOCUS_21740 14956 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_21740 16057 14963 gene locus_tag LOCUS_21750 16057 14963 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_21750 16070 17101 gene locus_tag LOCUS_21760 gene lpxK 16070 17101 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_21760 17101 18993 gene locus_tag LOCUS_21770 17101 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence047 1786 1013 gene locus_tag LOCUS_21780 1786 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2277 1879 gene locus_tag LOCUS_21790 2277 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3160 2393 gene locus_tag LOCUS_21800 3160 2393 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_21800 3492 4625 gene locus_tag LOCUS_21810 gene ncx 3492 4625 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 protein_id gnl|my_center|LOCUS_21810 4727 5143 gene locus_tag LOCUS_21820 4727 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_21820 5783 5238 gene locus_tag LOCUS_21830 5783 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 5818 6390 gene locus_tag LOCUS_21840 5818 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 8168 6387 gene locus_tag LOCUS_21850 8168 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 10257 8566 gene locus_tag LOCUS_21860 10257 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 11129 10254 gene locus_tag LOCUS_21870 11129 10254 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_21870 12994 11129 gene locus_tag LOCUS_21880 gene mnmG 12994 11129 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_21880 13480 13034 gene locus_tag LOCUS_21890 gene ybeY 13480 13034 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_21890 16865 13581 gene locus_tag LOCUS_21900 16865 13581 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_21900 17417 17617 gene locus_tag LOCUS_21910 17417 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 17660 17815 gene locus_tag LOCUS_21920 17660 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 18495 18019 gene locus_tag LOCUS_21930 18495 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence048 220 510 gene locus_tag LOCUS_21940 220 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 704 2755 gene locus_tag LOCUS_21950 704 2755 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_21950 2974 6327 gene locus_tag LOCUS_21960 gene gdhP 2974 6327 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_21960 6734 7855 gene locus_tag LOCUS_21970 6734 7855 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_21970 8495 9559 gene locus_tag LOCUS_21980 gene ykfB 8495 9559 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_21980 9704 10675 gene locus_tag LOCUS_21990 gene ctaA 9704 10675 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_21990 11136 10861 gene locus_tag LOCUS_22000 11136 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 12617 11775 gene locus_tag LOCUS_22010 12617 11775 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_22010 12674 13837 gene locus_tag LOCUS_22020 12674 13837 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_22020 13841 15511 gene locus_tag LOCUS_22030 13841 15511 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_22030 15516 15710 gene locus_tag LOCUS_22040 15516 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_22040 15854 16150 gene locus_tag LOCUS_22050 15854 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 16629 16273 gene locus_tag LOCUS_22060 16629 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 17585 17118 gene locus_tag LOCUS_22070 17585 17118 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence049 1177 260 gene locus_tag LOCUS_22080 gene rbsK 1177 260 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_22080 2091 1180 gene locus_tag LOCUS_22090 2091 1180 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_22090 5781 2233 gene locus_tag LOCUS_22100 5781 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 7233 5815 gene locus_tag LOCUS_22110 7233 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 8818 7238 gene locus_tag LOCUS_22120 8818 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 10430 8943 gene locus_tag LOCUS_22130 10430 8943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_22130 13535 10509 gene locus_tag LOCUS_22140 13535 10509 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_22140 14549 13572 gene locus_tag LOCUS_22150 14549 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 15709 14669 gene locus_tag LOCUS_22160 15709 14669 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_22160 16337 16104 gene locus_tag LOCUS_22170 16337 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence050 864 1643 gene locus_tag LOCUS_22180 864 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1689 2459 gene locus_tag LOCUS_22190 1689 2459 CDS product cobalamin biosynthesis protein CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021962.1 protein_id gnl|my_center|LOCUS_22190 2998 2486 gene locus_tag LOCUS_22200 2998 2486 CDS product peptidase M52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_22200 3452 3093 gene locus_tag LOCUS_22210 3452 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3852 3454 gene locus_tag LOCUS_22220 3852 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 4316 3849 gene locus_tag LOCUS_22230 4316 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6273 4399 gene locus_tag LOCUS_22240 6273 4399 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225646.1 protein_id gnl|my_center|LOCUS_22240 6603 6313 gene locus_tag LOCUS_22250 6603 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 6894 6613 gene locus_tag LOCUS_22260 6894 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 7187 6897 gene locus_tag LOCUS_22270 7187 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 7508 7197 gene locus_tag LOCUS_22280 7508 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 7808 7518 gene locus_tag LOCUS_22290 7808 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 8977 7811 gene locus_tag LOCUS_22300 8977 7811 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_22300 10161 9100 gene locus_tag LOCUS_22310 gene hypE 10161 9100 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_22310 10996 10169 gene locus_tag LOCUS_22320 10996 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 12257 11316 gene locus_tag LOCUS_22330 12257 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 13655 14284 gene locus_tag LOCUS_22340 13655 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 14316 14603 gene locus_tag LOCUS_22350 14316 14603 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_22350 15227 14751 gene locus_tag LOCUS_22360 15227 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence051 329 1255 gene locus_tag LOCUS_22370 329 1255 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_22370 2289 1258 gene locus_tag LOCUS_22380 gene rlmN 2289 1258 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_22380 4514 2316 gene locus_tag LOCUS_22390 4514 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5713 4511 gene locus_tag LOCUS_22400 5713 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 8481 5710 gene locus_tag LOCUS_22410 8481 5710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_22410 9221 8481 gene locus_tag LOCUS_22420 9221 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 9534 10028 gene locus_tag LOCUS_22430 9534 10028 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_22430 10028 11329 gene locus_tag LOCUS_22440 10028 11329 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_22440 11647 11572 gene locus_tag LOCUS_t00280 11647 11572 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12840 11734 gene locus_tag LOCUS_22450 12840 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 13094 12894 gene locus_tag LOCUS_22460 13094 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence052 <1 1018 gene locus_tag LOCUS_22470 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403616.1:peptidase M14 1099 4203 gene locus_tag LOCUS_22480 1099 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4266 4553 gene locus_tag LOCUS_22490 4266 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 5257 4616 gene locus_tag LOCUS_22500 5257 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5828 9133 gene locus_tag LOCUS_22510 5828 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_22510 9186 10013 gene locus_tag LOCUS_22520 9186 10013 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_22520 10753 10067 gene locus_tag LOCUS_22530 10753 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 11128 10847 gene locus_tag LOCUS_22540 11128 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 11491 11670 gene locus_tag LOCUS_22550 11491 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 12557 13441 gene locus_tag LOCUS_22560 gene lpsA 12557 13441 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963742.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence053 109 891 gene locus_tag LOCUS_22570 109 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 895 1839 gene locus_tag LOCUS_22580 895 1839 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_22580 1864 2700 gene locus_tag LOCUS_22590 1864 2700 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_22590 3308 2706 gene locus_tag LOCUS_22600 3308 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3356 4273 gene locus_tag LOCUS_22610 3356 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4275 5063 gene locus_tag LOCUS_22620 4275 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5069 5419 gene locus_tag LOCUS_22630 gene folB 5069 5419 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28823 protein_id gnl|my_center|LOCUS_22630 5706 5389 gene locus_tag LOCUS_22640 5706 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5693 6271 gene locus_tag LOCUS_22650 5693 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_22650 6273 6668 gene locus_tag LOCUS_22660 6273 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 6680 7363 gene locus_tag LOCUS_22670 6680 7363 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_22670 7363 7815 gene locus_tag LOCUS_22680 gene dtd 7363 7815 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_22680 7839 9692 gene locus_tag LOCUS_22690 gene lepA 7839 9692 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_22690 9695 10567 gene locus_tag LOCUS_22700 gene folD 9695 10567 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_22700 10548 11174 gene locus_tag LOCUS_22710 gene queE 10548 11174 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_22710 11177 13078 gene locus_tag LOCUS_22720 11177 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence054 <1 729 gene locus_tag LOCUS_22730 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NG17:tRNA 2-thiocytidine biosynthesis protein TtcA 1 737 1501 gene locus_tag LOCUS_22740 737 1501 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887409.1 protein_id gnl|my_center|LOCUS_22740 2172 1594 gene locus_tag LOCUS_22750 2172 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3408 2185 gene locus_tag LOCUS_22760 gene aroA 3408 2185 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_22760 4513 3461 gene locus_tag LOCUS_22770 gene aroB 4513 3461 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_22770 4615 5787 gene locus_tag LOCUS_22780 gene putA 4615 5787 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_22780 5787 7544 gene locus_tag LOCUS_22790 gene lysS 5787 7544 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_22790 9231 7561 gene locus_tag LOCUS_22800 gene fhs 9231 7561 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 protein_id gnl|my_center|LOCUS_22800 9367 10623 gene locus_tag LOCUS_22810 gene erg3 9367 10623 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_22810 13465 10700 gene locus_tag LOCUS_22820 13465 10700 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence055 <1 1049 gene locus_tag LOCUS_22830 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein 2482 2192 gene locus_tag LOCUS_22840 2482 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22840 3612 2893 gene locus_tag LOCUS_22850 3612 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4427 3993 gene locus_tag LOCUS_22860 4427 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5484 5182 gene locus_tag LOCUS_22870 5484 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6660 7016 gene locus_tag LOCUS_22880 6660 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22880 8556 7459 gene locus_tag LOCUS_22890 8556 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 9222 9737 gene locus_tag LOCUS_22900 9222 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 9843 10319 gene locus_tag LOCUS_22910 9843 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11766 10762 gene locus_tag LOCUS_22920 11766 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 13088 12411 gene locus_tag LOCUS_22930 13088 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence056 <1 651 gene locus_tag LOCUS_22940 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UX42:glutamine--tRNA ligase 728 2917 gene locus_tag LOCUS_22950 728 2917 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_22950 2917 3744 gene locus_tag LOCUS_22960 2917 3744 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_22960 6259 3755 gene locus_tag LOCUS_22970 6259 3755 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_22970 7000 6332 gene locus_tag LOCUS_22980 7000 6332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_22980 7130 7840 gene locus_tag LOCUS_22990 7130 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7840 9201 gene locus_tag LOCUS_23000 gene dagA 7840 9201 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836461.1 protein_id gnl|my_center|LOCUS_23000 9320 10660 gene locus_tag LOCUS_23010 9320 10660 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_23010 10667 12121 gene locus_tag LOCUS_23020 10667 12121 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_23020 12124 13290 gene locus_tag LOCUS_23030 12124 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence057 312 1721 gene locus_tag LOCUS_23040 312 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1837 2709 gene locus_tag LOCUS_23050 1837 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3319 6291 gene locus_tag LOCUS_23060 3319 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 7217 6288 gene locus_tag LOCUS_23070 7217 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 9364 7214 gene locus_tag LOCUS_23080 9364 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 10881 9364 gene locus_tag LOCUS_23090 10881 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 12175 10883 gene locus_tag LOCUS_23100 12175 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13023 12214 gene locus_tag LOCUS_23110 13023 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 13039 13236 gene locus_tag LOCUS_23120 13039 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence058 110 184 gene locus_tag LOCUS_t00290 110 184 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 853 1989 gene locus_tag LOCUS_23130 853 1989 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_23130 2211 4307 gene locus_tag LOCUS_23140 2211 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 5033 4341 gene locus_tag LOCUS_23150 gene glpF 5033 4341 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_23150 5123 6613 gene locus_tag LOCUS_23160 gene glpK 5123 6613 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTP4 protein_id gnl|my_center|LOCUS_23160 6625 8184 gene locus_tag LOCUS_23170 gene glpA 6625 8184 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_23170 8258 8815 gene locus_tag LOCUS_23180 8258 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 9195 10403 gene locus_tag LOCUS_23190 9195 10403 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_23190 10800 11918 gene locus_tag LOCUS_23200 10800 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_23200 11920 12699 gene locus_tag LOCUS_23210 11920 12699 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence059 5564 2421 gene locus_tag LOCUS_23220 5564 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 7981 6044 gene locus_tag LOCUS_23230 gene gpi2 7981 6044 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_23230 8974 8018 gene locus_tag LOCUS_23240 8974 8018 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_23240 9214 9861 gene locus_tag LOCUS_23250 9214 9861 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_23250 10312 9968 gene locus_tag LOCUS_23260 gene rplT 10312 9968 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_23260 10581 10387 gene locus_tag LOCUS_23270 gene rpmI 10581 10387 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_23270 11060 10593 gene locus_tag LOCUS_23280 gene infC 11060 10593 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_23280 <12870 11313 gene locus_tag LOCUS_23290 <12870 11313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY22:threonine--tRNA ligase >Feature sequence060 442 1818 gene locus_tag LOCUS_23300 442 1818 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_23300 1870 2307 gene locus_tag LOCUS_23310 1870 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3661 2327 gene locus_tag LOCUS_23320 3661 2327 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_23320 3945 5009 gene locus_tag LOCUS_23330 gene fbaA 3945 5009 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_23330 5270 6124 gene locus_tag LOCUS_23340 5270 6124 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_23340 6204 6707 gene locus_tag LOCUS_23350 6204 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 6823 8913 gene locus_tag LOCUS_23360 gene ptrB 6823 8913 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_23360 8994 9341 gene locus_tag LOCUS_23370 8994 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 10629 9394 gene locus_tag LOCUS_23380 10629 9394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_23380 10801 11991 gene locus_tag LOCUS_23390 10801 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_23390 12645 12052 gene locus_tag LOCUS_23400 gene miaE 12645 12052 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence061 1937 231 gene locus_tag LOCUS_23410 1937 231 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_23410 2217 3860 gene locus_tag LOCUS_23420 2217 3860 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_23420 6625 3869 gene locus_tag LOCUS_23430 gene ppc 6625 3869 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBZ2 protein_id gnl|my_center|LOCUS_23430 6787 7614 gene locus_tag LOCUS_23440 6787 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_23440 7642 8928 gene locus_tag LOCUS_23450 gene gltA 7642 8928 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_23450 9425 8946 gene locus_tag LOCUS_23460 9425 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence062 1766 519 gene locus_tag LOCUS_23470 gene dadA 1766 519 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_23470 2767 1763 gene locus_tag LOCUS_23480 2767 1763 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_23480 4305 2770 gene locus_tag LOCUS_23490 gene aldH 4305 2770 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206391.1 protein_id gnl|my_center|LOCUS_23490 5233 4319 gene locus_tag LOCUS_23500 5233 4319 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_23500 6245 5277 gene locus_tag LOCUS_23510 6245 5277 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_23510 8052 6322 gene locus_tag LOCUS_23520 8052 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 11944 8975 gene locus_tag LOCUS_23530 11944 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence063 415 206 gene locus_tag LOCUS_23540 415 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1941 670 gene locus_tag LOCUS_23550 1941 670 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_23550 2166 2672 gene locus_tag LOCUS_23560 2166 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2759 3967 gene locus_tag LOCUS_23570 2759 3967 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_23570 3971 4477 gene locus_tag LOCUS_23580 3971 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_23580 4656 5594 gene locus_tag LOCUS_23590 4656 5594 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_23590 6157 5573 gene locus_tag LOCUS_23600 6157 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 6319 6633 gene locus_tag LOCUS_23610 6319 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 7141 6650 gene locus_tag LOCUS_23620 7141 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 7683 7195 gene locus_tag LOCUS_23630 7683 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 8757 8125 gene locus_tag LOCUS_23640 8757 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 9530 8754 gene locus_tag LOCUS_23650 gene lpxA 9530 8754 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_23650 10921 9530 gene locus_tag LOCUS_23660 gene fabZ 10921 9530 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_23660 <11662 10933 gene locus_tag LOCUS_23670 <11662 10933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY99:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence064 240 431 gene locus_tag LOCUS_23680 240 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 692 2020 gene locus_tag LOCUS_23690 692 2020 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482895.1 protein_id gnl|my_center|LOCUS_23690 2061 2552 gene locus_tag LOCUS_23700 2061 2552 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_23700 3897 2743 gene locus_tag LOCUS_23710 3897 2743 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_23710 4619 5476 gene locus_tag LOCUS_23720 4619 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6080 6271 gene locus_tag LOCUS_23730 6080 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 6575 6886 gene locus_tag LOCUS_23740 6575 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 7396 8994 gene locus_tag LOCUS_23750 7396 8994 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_23750 9056 10390 gene locus_tag LOCUS_23760 gene araT 9056 10390 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CJE0 protein_id gnl|my_center|LOCUS_23760 >Feature sequence065 910 446 gene locus_tag LOCUS_23770 910 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 4473 916 gene locus_tag LOCUS_23780 4473 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_23780 7970 4473 gene locus_tag LOCUS_23790 7970 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939307.1 protein_id gnl|my_center|LOCUS_23790 8548 7967 gene locus_tag LOCUS_23800 8548 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939308.1 protein_id gnl|my_center|LOCUS_23800 9156 8536 gene locus_tag LOCUS_23810 9156 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038866.1 protein_id gnl|my_center|LOCUS_23810 9335 9153 gene locus_tag LOCUS_23820 9335 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 9683 10273 gene locus_tag LOCUS_23830 9683 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11109 10300 gene locus_tag LOCUS_23840 11109 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence066 427 909 gene locus_tag LOCUS_23850 427 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1031 2704 gene locus_tag LOCUS_23860 gene prnC 1031 2704 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198349.1 protein_id gnl|my_center|LOCUS_23860 3655 2975 gene locus_tag LOCUS_23870 3655 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4201 3725 gene locus_tag LOCUS_23880 4201 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 4857 4513 gene locus_tag LOCUS_23890 4857 4513 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072992.1 protein_id gnl|my_center|LOCUS_23890 5071 7401 gene locus_tag LOCUS_23900 5071 7401 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_23900 7436 8218 gene locus_tag LOCUS_23910 7436 8218 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_23910 8271 9473 gene locus_tag LOCUS_23920 8271 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_23920 <10939 10348 gene locus_tag LOCUS_23930 <10939 10348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918510.1:transposase >Feature sequence067 4238 306 gene locus_tag LOCUS_23940 4238 306 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109062.1 protein_id gnl|my_center|LOCUS_23940 5251 4235 gene locus_tag LOCUS_23950 5251 4235 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_23950 5591 5346 gene locus_tag LOCUS_23960 5591 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5818 5612 gene locus_tag LOCUS_23970 5818 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6353 5856 gene locus_tag LOCUS_23980 6353 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 6541 6377 gene locus_tag LOCUS_23990 6541 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 6718 6584 gene locus_tag LOCUS_24000 6718 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 8749 6740 gene locus_tag LOCUS_24010 8749 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence068 1776 382 gene locus_tag LOCUS_24020 1776 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_24020 3671 1872 gene locus_tag LOCUS_24030 3671 1872 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_24030 4700 3852 gene locus_tag LOCUS_24040 4700 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4826 5458 gene locus_tag LOCUS_24050 4826 5458 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_24050 6950 5469 gene locus_tag LOCUS_24060 6950 5469 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_24060 10103 7797 gene locus_tag LOCUS_24070 10103 7797 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_24070 >Feature sequence069 <1 769 gene locus_tag LOCUS_24080 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963369.1:ABC transporter ATP-binding protein 804 2309 gene locus_tag LOCUS_24090 804 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_24090 3321 2290 gene locus_tag LOCUS_24100 3321 2290 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_24100 3348 4271 gene locus_tag LOCUS_24110 gene acdS 3348 4271 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_24110 4316 5488 gene locus_tag LOCUS_24120 4316 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 5485 7206 gene locus_tag LOCUS_24130 5485 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 8491 7211 gene locus_tag LOCUS_24140 gene radA 8491 7211 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_24140 9721 8654 gene locus_tag LOCUS_24150 gene pheA 9721 8654 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence070 133 59 gene locus_tag LOCUS_t00300 133 59 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 199 1245 gene locus_tag LOCUS_24160 199 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1648 1391 gene locus_tag LOCUS_24170 1648 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4711 1682 gene locus_tag LOCUS_24180 4711 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 5920 4754 gene locus_tag LOCUS_24190 5920 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 7836 6118 gene locus_tag LOCUS_24200 7836 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 8833 8018 gene locus_tag LOCUS_24210 8833 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 9366 8833 gene locus_tag LOCUS_24220 9366 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 9867 9793 gene locus_tag LOCUS_t00310 9867 9793 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 325 717 gene locus_tag LOCUS_24230 325 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 723 959 gene locus_tag LOCUS_24240 723 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3789 1495 gene locus_tag LOCUS_24250 3789 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4040 4417 gene locus_tag LOCUS_24260 4040 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4560 5945 gene locus_tag LOCUS_24270 4560 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5960 6508 gene locus_tag LOCUS_24280 5960 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6676 7629 gene locus_tag LOCUS_24290 6676 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 7638 8594 gene locus_tag LOCUS_24300 7638 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence072 1762 1076 gene locus_tag LOCUS_24310 1762 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2092 2745 gene locus_tag LOCUS_24320 gene tal 2092 2745 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_24320 2769 2972 gene locus_tag LOCUS_24330 2769 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2973 3683 gene locus_tag LOCUS_24340 gene ftsE 2973 3683 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_24340 3882 4502 gene locus_tag LOCUS_24350 3882 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4489 5568 gene locus_tag LOCUS_24360 4489 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 6223 6014 gene locus_tag LOCUS_24370 6223 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24370 8789 7356 gene locus_tag LOCUS_24380 8789 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence073 1120 302 gene locus_tag LOCUS_24390 gene iolE 1120 302 CDS product inosose dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK1 protein_id gnl|my_center|LOCUS_24390 2177 1140 gene locus_tag LOCUS_24400 2177 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_24400 3980 2424 gene locus_tag LOCUS_24410 3980 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5279 4176 gene locus_tag LOCUS_24420 5279 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5827 5354 gene locus_tag LOCUS_24430 5827 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24430 6502 5945 gene locus_tag LOCUS_24440 6502 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8668 6647 gene locus_tag LOCUS_24450 8668 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8988 8743 gene locus_tag LOCUS_24460 8988 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence074 477 2714 gene locus_tag LOCUS_24470 gene dpp4 477 2714 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_24470 2704 4107 gene locus_tag LOCUS_24480 2704 4107 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_24480 4128 5738 gene locus_tag LOCUS_24490 4128 5738 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_24490 5990 6535 gene locus_tag LOCUS_24500 5990 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 6547 7704 gene locus_tag LOCUS_24510 gene solA 6547 7704 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_24510 8541 7753 gene locus_tag LOCUS_24520 8541 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 8690 9085 gene locus_tag LOCUS_24530 8690 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence075 1181 108 gene locus_tag LOCUS_24540 1181 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_24540 1315 1178 gene locus_tag LOCUS_24550 1315 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2372 5263 gene locus_tag LOCUS_24560 2372 5263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_24560 5265 6047 gene locus_tag LOCUS_24570 5265 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 6259 6591 gene locus_tag LOCUS_24580 6259 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6643 7662 gene locus_tag LOCUS_24590 6643 7662 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_24590 7674 8447 gene locus_tag LOCUS_24600 7674 8447 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence076 1230 739 gene locus_tag LOCUS_24610 1230 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1750 1223 gene locus_tag LOCUS_24620 1750 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3950 1716 gene locus_tag LOCUS_24630 3950 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4958 4143 gene locus_tag LOCUS_24640 4958 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 6486 4972 gene locus_tag LOCUS_24650 6486 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 6762 7340 gene locus_tag LOCUS_24660 6762 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence077 1571 639 gene locus_tag LOCUS_24670 1571 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4064 3057 gene locus_tag LOCUS_24680 4064 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 4594 4310 gene locus_tag LOCUS_24690 4594 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5239 4808 gene locus_tag LOCUS_24700 5239 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5880 5389 gene locus_tag LOCUS_24710 5880 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 6808 6122 gene locus_tag LOCUS_24720 6808 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7096 7968 gene locus_tag LOCUS_24730 7096 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence078 1411 989 gene locus_tag LOCUS_24740 1411 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1925 1644 gene locus_tag LOCUS_24750 1925 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2356 2796 gene locus_tag LOCUS_24760 2356 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3090 3281 gene locus_tag LOCUS_24770 3090 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3324 3692 gene locus_tag LOCUS_24780 3324 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4291 4100 gene locus_tag LOCUS_24790 4291 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4508 5137 gene locus_tag LOCUS_24800 4508 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 5572 5985 gene locus_tag LOCUS_24810 5572 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence079 76 285 gene locus_tag LOCUS_24820 76 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 388 882 gene locus_tag LOCUS_24830 388 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1414 1554 gene locus_tag LOCUS_24840 1414 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1934 2269 gene locus_tag LOCUS_24850 1934 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3146 3385 gene locus_tag LOCUS_24860 3146 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3970 3803 gene locus_tag LOCUS_24870 3970 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 4461 4970 gene locus_tag LOCUS_24880 4461 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 5449 5234 gene locus_tag LOCUS_24890 5449 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5854 5600 gene locus_tag LOCUS_24900 5854 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6429 6842 gene locus_tag LOCUS_24910 6429 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence080 1445 711 gene locus_tag LOCUS_24920 1445 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1590 2027 gene locus_tag LOCUS_24930 1590 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2287 3126 gene locus_tag LOCUS_24940 2287 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3735 3226 gene locus_tag LOCUS_24950 3735 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4546 3851 gene locus_tag LOCUS_24960 4546 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5021 5632 gene locus_tag LOCUS_24970 gene pmtA 5021 5632 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_24970 5796 6485 gene locus_tag LOCUS_24980 5796 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 7111 6872 gene locus_tag LOCUS_24990 7111 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence081 331 1695 gene locus_tag LOCUS_25000 331 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1857 2504 gene locus_tag LOCUS_25010 1857 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2581 2979 gene locus_tag LOCUS_25020 2581 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 4218 3628 gene locus_tag LOCUS_25030 4218 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 4314 5390 gene locus_tag LOCUS_25040 4314 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 5390 5770 gene locus_tag LOCUS_25050 5390 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 5782 6552 gene locus_tag LOCUS_25060 5782 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence082 81 683 gene locus_tag LOCUS_25070 gene hisI 81 683 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_25070 712 2190 gene locus_tag LOCUS_25080 712 2190 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ75 protein_id gnl|my_center|LOCUS_25080 2918 2238 gene locus_tag LOCUS_25090 2918 2238 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_25090 4520 2931 gene locus_tag LOCUS_25100 4520 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 5661 4846 gene locus_tag LOCUS_25110 5661 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence083 1894 491 gene locus_tag LOCUS_25120 1894 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2075 2578 gene locus_tag LOCUS_25130 2075 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2939 3802 gene locus_tag LOCUS_25140 2939 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 3822 4406 gene locus_tag LOCUS_25150 3822 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence084 521 1885 gene locus_tag LOCUS_25160 521 1885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_25160 1887 2846 gene locus_tag LOCUS_25170 gene ykcC 1887 2846 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_25170 2821 3813 gene locus_tag LOCUS_25180 2821 3813 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_25180 4322 5404 gene locus_tag LOCUS_25190 4322 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25190 5404 6078 gene locus_tag LOCUS_25200 5404 6078 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_25200 6684 6406 gene locus_tag LOCUS_25210 6684 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence085 158 949 gene locus_tag LOCUS_25220 158 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2696 987 gene locus_tag LOCUS_25230 2696 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence086 1323 1532 gene locus_tag LOCUS_25240 1323 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1622 1828 gene locus_tag LOCUS_25250 1622 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2584 3567 gene locus_tag LOCUS_25260 2584 3567 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_25260 3572 4849 gene locus_tag LOCUS_25270 gene wbpO 3572 4849 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_25270 5461 5099 gene locus_tag LOCUS_25280 5461 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 5760 5578 gene locus_tag LOCUS_25290 5760 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6023 5706 gene locus_tag LOCUS_25300 6023 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence087 84 1205 gene locus_tag LOCUS_25310 84 1205 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080632.1 protein_id gnl|my_center|LOCUS_25310 1218 2486 gene locus_tag LOCUS_25320 1218 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56727 protein_id gnl|my_center|LOCUS_25320 3388 2606 gene locus_tag LOCUS_25330 3388 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4146 3400 gene locus_tag LOCUS_25340 4146 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4283 6064 gene locus_tag LOCUS_25350 4283 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6130 6504 gene locus_tag LOCUS_25360 6130 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence088 1695 1231 gene locus_tag LOCUS_25370 1695 1231 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_25370 4190 2718 gene locus_tag LOCUS_25380 gene crtN 4190 2718 CDS product dehydrosqualene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_25380 4379 4678 gene locus_tag LOCUS_25390 4379 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 4711 5496 gene locus_tag LOCUS_25400 4711 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence089 6 590 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actccaaaacttagatggactaattaattgtgt 788 1027 gene locus_tag LOCUS_25410 788 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1387 1133 gene locus_tag LOCUS_25420 1387 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 4420 1589 gene locus_tag LOCUS_25430 4420 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5718 4564 gene locus_tag LOCUS_25440 5718 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence090 <1 3467 gene locus_tag LOCUS_25450 <1 3467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119627.1:cytochrome c >Feature sequence091 1436 315 gene locus_tag LOCUS_25460 1436 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2677 1766 gene locus_tag LOCUS_25470 2677 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2896 3873 gene locus_tag LOCUS_25480 2896 3873 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_25480 3929 4783 gene locus_tag LOCUS_25490 3929 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence092 1546 1746 gene locus_tag LOCUS_25500 1546 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1950 1762 gene locus_tag LOCUS_25510 1950 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2057 3253 gene locus_tag LOCUS_25520 2057 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3400 3756 gene locus_tag LOCUS_25530 3400 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3761 3964 gene locus_tag LOCUS_25540 3761 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4080 4334 gene locus_tag LOCUS_25550 4080 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 4351 4821 gene locus_tag LOCUS_25560 4351 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence093 299 799 gene locus_tag LOCUS_25570 299 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1264 869 gene locus_tag LOCUS_25580 1264 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1536 1724 gene locus_tag LOCUS_25590 1536 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2507 1806 gene locus_tag LOCUS_25600 2507 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3006 3269 gene locus_tag LOCUS_25610 3006 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4433 3333 gene locus_tag LOCUS_25620 4433 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence094 >Feature sequence095 <1 4987 gene locus_tag LOCUS_25630 <1 4987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence096 128 3805 gene locus_tag LOCUS_25640 128 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence097 58 333 gene locus_tag LOCUS_25650 58 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1062 376 gene locus_tag LOCUS_25660 1062 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1694 1227 gene locus_tag LOCUS_25670 1694 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2201 1725 gene locus_tag LOCUS_25680 2201 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2443 3036 gene locus_tag LOCUS_25690 gene miaE 2443 3036 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence098 3633 1183 gene locus_tag LOCUS_25700 3633 1183 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_25700 4593 4024 gene locus_tag LOCUS_25710 4593 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4896 4600 gene locus_tag LOCUS_25720 4896 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence099 1060 539 gene locus_tag LOCUS_25730 1060 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1577 1074 gene locus_tag LOCUS_25740 1577 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2825 1581 gene locus_tag LOCUS_25750 gene pyrC2 2825 1581 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_25750 4677 2827 gene locus_tag LOCUS_25760 4677 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence100 966 568 gene locus_tag LOCUS_25770 966 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1614 1468 gene locus_tag LOCUS_25780 1614 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2802 2083 gene locus_tag LOCUS_25790 2802 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4208 3327 gene locus_tag LOCUS_25800 4208 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4504 4349 gene locus_tag LOCUS_25810 4504 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence101 813 58 gene locus_tag LOCUS_25820 gene hisF 813 58 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_25820 1526 807 gene locus_tag LOCUS_25830 gene hisA 1526 807 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_25830 2109 1528 gene locus_tag LOCUS_25840 gene hisH 2109 1528 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_25840 2901 2176 gene locus_tag LOCUS_25850 2901 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3685 2912 gene locus_tag LOCUS_25860 gene trpA 3685 2912 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_25860 <4907 3698 gene locus_tag LOCUS_25870 <4907 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWZ1:tryptophan synthase beta chain >Feature sequence102 3303 1927 gene locus_tag LOCUS_25880 3303 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3609 3947 gene locus_tag LOCUS_25890 3609 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 4105 4677 gene locus_tag LOCUS_25900 4105 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence103 <1 925 gene locus_tag LOCUS_25910 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) 912 2156 gene locus_tag LOCUS_25920 912 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2191 4767 gene locus_tag LOCUS_25930 gene parC 2191 4767 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence104 1546 371 gene locus_tag LOCUS_25940 1546 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1738 1550 gene locus_tag LOCUS_25950 1738 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2637 1780 gene locus_tag LOCUS_25960 2637 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2907 2641 gene locus_tag LOCUS_25970 2907 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3251 2904 gene locus_tag LOCUS_25980 3251 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4324 3290 gene locus_tag LOCUS_25990 4324 3290 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101781.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence105 2177 1224 gene locus_tag LOCUS_26000 2177 1224 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_26000 <4537 2294 gene locus_tag LOCUS_26010 <4537 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor >Feature sequence106 935 1339 gene locus_tag LOCUS_26020 935 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1343 3721 gene locus_tag LOCUS_26030 1343 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3726 4088 gene locus_tag LOCUS_26040 3726 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4090 4434 gene locus_tag LOCUS_26050 4090 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence107 1368 2267 gene locus_tag LOCUS_26060 1368 2267 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence108 430 182 gene locus_tag LOCUS_26070 430 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 600 1142 gene locus_tag LOCUS_26080 600 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2037 1849 gene locus_tag LOCUS_26090 2037 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2138 2446 gene locus_tag LOCUS_26100 2138 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2485 2742 gene locus_tag LOCUS_26110 2485 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2939 2754 gene locus_tag LOCUS_26120 2939 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3633 3130 gene locus_tag LOCUS_26130 3633 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4180 3704 gene locus_tag LOCUS_26140 4180 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence109 115 591 gene locus_tag LOCUS_26150 115 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3068 837 gene locus_tag LOCUS_26160 3068 837 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence110 192 419 gene locus_tag LOCUS_26170 192 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 472 1311 gene locus_tag LOCUS_26180 472 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1371 1784 gene locus_tag LOCUS_26190 1371 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2389 3210 gene locus_tag LOCUS_26200 2389 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3311 3697 gene locus_tag LOCUS_26210 3311 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 <4307 3716 gene locus_tag LOCUS_26220 <4307 3716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918510.1:transposase >Feature sequence111 <1 699 gene locus_tag LOCUS_26230 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918510.1:transposase 1162 2277 gene locus_tag LOCUS_26240 1162 2277 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_26240 <4162 2867 gene locus_tag LOCUS_26250 <4162 2867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964345.1:all-trans-retinol 13,14-reductase >Feature sequence112 3013 2525 gene locus_tag LOCUS_26260 3013 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence113 2379 199 gene locus_tag LOCUS_26270 2379 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 <3933 2496 gene locus_tag LOCUS_26280 <3933 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase >Feature sequence114 1190 366 gene locus_tag LOCUS_26290 1190 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2937 1201 gene locus_tag LOCUS_26300 2937 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence115 <1 2307 gene locus_tag LOCUS_26310 <1 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q180P3:DNA-directed DNA polymerase 2309 3535 gene locus_tag LOCUS_26320 gene dinP 2309 3535 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_26320 >Feature sequence116 <1 2428 gene locus_tag LOCUS_26330 <1 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZR9:CRISPR-associated endonuclease Cas9 2435 3328 gene locus_tag LOCUS_26340 gene cas1 2435 3328 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_26340 3325 3663 gene locus_tag LOCUS_26350 gene cas2 3325 3663 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence117 <1 1992 gene locus_tag LOCUS_26360 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207616.1:ligand-gated channel protein 2053 2523 gene locus_tag LOCUS_26370 2053 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_26370 <3778 2560 gene locus_tag LOCUS_26380 <3778 2560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence118 1222 155 gene locus_tag LOCUS_26390 gene prfA 1222 155 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_26390 <3741 1324 gene locus_tag LOCUS_26400 <3741 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence119 1226 528 gene locus_tag LOCUS_26410 1226 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2645 1302 gene locus_tag LOCUS_26420 2645 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence120 933 130 gene locus_tag LOCUS_26430 gene trpC 933 130 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_26430 1930 938 gene locus_tag LOCUS_26440 gene trpD 1930 938 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_26440 2505 1927 gene locus_tag LOCUS_26450 2505 1927 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803788.1 protein_id gnl|my_center|LOCUS_26450 <3692 2502 gene locus_tag LOCUS_26460 <3692 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962677.1:anthranilate synthase component I >Feature sequence121 <1 760 gene locus_tag LOCUS_26470 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964154.1:cell division protein FtsQ 776 2071 gene locus_tag LOCUS_26480 gene ftsA 776 2071 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_26480 >Feature sequence122 84 3179 gene locus_tag LOCUS_26490 84 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence123 >Feature sequence124 243 614 gene locus_tag LOCUS_26500 243 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 623 922 gene locus_tag LOCUS_26510 623 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1183 1557 gene locus_tag LOCUS_26520 1183 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2140 2646 gene locus_tag LOCUS_26530 2140 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2844 3311 gene locus_tag LOCUS_26540 2844 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3553 3479 gene locus_tag LOCUS_t00320 3553 3479 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 258 1091 gene locus_tag LOCUS_26550 258 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence126 649 113 gene locus_tag LOCUS_26560 649 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1258 962 gene locus_tag LOCUS_26570 1258 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1438 1364 gene locus_tag LOCUS_t00330 1438 1364 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2087 1710 gene locus_tag LOCUS_26580 2087 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 <3499 2090 gene locus_tag LOCUS_26590 <3499 2090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877994.1:penicillin G acylase >Feature sequence127 593 850 gene locus_tag LOCUS_26600 593 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1800 1315 gene locus_tag LOCUS_26610 1800 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2045 2482 gene locus_tag LOCUS_26620 2045 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2927 2598 gene locus_tag LOCUS_26630 2927 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence128 1091 558 gene locus_tag LOCUS_26640 1091 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1477 1088 gene locus_tag LOCUS_26650 1477 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1770 1516 gene locus_tag LOCUS_26660 1770 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3043 1763 gene locus_tag LOCUS_26670 3043 1763 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence129 303 908 gene locus_tag LOCUS_26680 303 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 946 1548 gene locus_tag LOCUS_26690 946 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1554 2555 gene locus_tag LOCUS_26700 1554 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence130 160 828 gene locus_tag LOCUS_26710 160 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1408 866 gene locus_tag LOCUS_26720 1408 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2034 1402 gene locus_tag LOCUS_26730 2034 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2401 2039 gene locus_tag LOCUS_26740 2401 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2707 2411 gene locus_tag LOCUS_26750 2707 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence131 1610 585 gene locus_tag LOCUS_26760 1610 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1986 1762 gene locus_tag LOCUS_26770 1986 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence132 2 739 gene locus_tag LOCUS_26780 2 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 808 2805 gene locus_tag LOCUS_26790 808 2805 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence133 2837 963 gene locus_tag LOCUS_26800 2837 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence134 >Feature sequence135 >Feature sequence136 2564 1434 gene locus_tag LOCUS_26810 2564 1434 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence137 296 2185 gene locus_tag LOCUS_26820 296 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2187 2801 gene locus_tag LOCUS_26830 2187 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence138 <1 2508 gene locus_tag LOCUS_26840 <1 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783448.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence139 <2906 333 gene locus_tag LOCUS_26850 <2906 333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence140 400 1344 gene locus_tag LOCUS_26860 400 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence141 >Feature sequence142 913 2214 gene locus_tag LOCUS_26870 913 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence143 >Feature sequence144 <2794 706 gene locus_tag LOCUS_26880 <2794 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:type I secretion C-terminal target domain-containing protein >Feature sequence145 <2723 474 gene locus_tag LOCUS_26890 <2723 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963618.1:TonB-dependent receptor >Feature sequence146 1687 1346 gene locus_tag LOCUS_26900 1687 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1915 1727 gene locus_tag LOCUS_26910 1915 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2361 2215 gene locus_tag LOCUS_26920 2361 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence147 >Feature sequence148 1417 449 gene locus_tag LOCUS_26930 1417 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2007 1807 gene locus_tag LOCUS_26940 2007 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence149 1380 430 gene locus_tag LOCUS_26950 1380 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1459 1662 gene locus_tag LOCUS_26960 1459 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2292 1714 gene locus_tag LOCUS_26970 2292 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence150 117 608 gene locus_tag LOCUS_26980 117 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 942 580 gene locus_tag LOCUS_26990 942 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1198 1950 gene locus_tag LOCUS_27000 1198 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2207 2359 gene locus_tag LOCUS_27010 2207 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence151 >Feature sequence152 93 371 gene locus_tag LOCUS_27020 93 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1084 443 gene locus_tag LOCUS_27030 1084 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence153 1619 2230 gene locus_tag LOCUS_27040 1619 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence154 1642 125 gene locus_tag LOCUS_27050 1642 125 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence155 1696 1256 gene locus_tag LOCUS_27060 1696 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence156 1400 816 gene locus_tag LOCUS_27070 1400 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence157 >Feature sequence158 >Feature sequence159 >Feature sequence160 1155 364 gene locus_tag LOCUS_27080 1155 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1264 1515 gene locus_tag LOCUS_27090 gene rpsT 1264 1515 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_27090 1584 2294 gene locus_tag LOCUS_27100 gene radC 1584 2294 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence161 577 1818 gene locus_tag LOCUS_27110 577 1818 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence162 1489 725 gene locus_tag LOCUS_27120 gene sufC 1489 725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_27120 <2288 1521 gene locus_tag LOCUS_27130 <2288 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964482.1:Fe-S cluster assembly protein SufB >Feature sequence163 1958 1533 gene locus_tag LOCUS_27140 1958 1533 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence164 516 588 gene locus_tag LOCUS_t00340 516 588 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 873 1124 gene locus_tag LOCUS_27150 873 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1162 2112 gene locus_tag LOCUS_27160 1162 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence165 <1 560 gene locus_tag LOCUS_27170 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEM4:tRNA 2-thiocytidine biosynthesis protein TtcA 568 1332 gene locus_tag LOCUS_27180 568 1332 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_27180 1935 1417 gene locus_tag LOCUS_27190 1935 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence166 373 888 gene locus_tag LOCUS_27200 373 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence167 139 957 gene locus_tag LOCUS_27210 139 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence168 >Feature sequence169 >Feature sequence170 1437 1512 gene locus_tag LOCUS_t00350 1437 1512 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2099 1788 gene locus_tag LOCUS_27220 2099 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence171 960 475 gene locus_tag LOCUS_27230 960 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1683 1063 gene locus_tag LOCUS_27240 1683 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence172 2074 350 gene locus_tag LOCUS_27250 2074 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence173 369 16 gene locus_tag LOCUS_27260 369 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 665 366 gene locus_tag LOCUS_27270 665 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1387 728 gene locus_tag LOCUS_27280 1387 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1537 1836 gene locus_tag LOCUS_27290 1537 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence174 1384 836 gene locus_tag LOCUS_27300 1384 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence175 354 1337 gene locus_tag LOCUS_27310 354 1337 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence176 935 480 gene locus_tag LOCUS_27320 935 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1453 944 gene locus_tag LOCUS_27330 1453 944 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence177 55 438 gene locus_tag LOCUS_27340 55 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 559 810 gene locus_tag LOCUS_27350 559 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1401 1877 gene locus_tag LOCUS_27360 1401 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence178 <1952 215 gene locus_tag LOCUS_27370 <1952 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence179 1476 1327 gene locus_tag LOCUS_27380 1476 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1645 1514 gene locus_tag LOCUS_27390 1645 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence180 483 1319 gene locus_tag LOCUS_27400 483 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence181 1633 227 gene locus_tag LOCUS_27410 1633 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence182 >Feature sequence183 1290 778 gene locus_tag LOCUS_27420 1290 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence184 <1885 563 gene locus_tag LOCUS_27430 <1885 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767780.1:glycan metabolism protein RagB >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 81 863 gene locus_tag LOCUS_27440 81 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1002 1778 gene locus_tag LOCUS_27450 1002 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence189 >Feature sequence190 494 1075 gene locus_tag LOCUS_27460 494 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence191 >Feature sequence192 1603 317 gene locus_tag LOCUS_27470 1603 317 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence193 >Feature sequence194 814 1218 gene locus_tag LOCUS_27480 814 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1746 1207 gene locus_tag LOCUS_27490 1746 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence195 2 232 gene locus_tag LOCUS_27500 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 990 229 gene locus_tag LOCUS_27510 990 229 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_27510 1078 1566 gene locus_tag LOCUS_27520 1078 1566 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_27520 1770 1615 gene locus_tag LOCUS_27530 1770 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence196 >Feature sequence197 2 1474 gene locus_tag LOCUS_27540 2 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence198 <1753 982 gene locus_tag LOCUS_27550 <1753 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119046.1:NADH-dependent dehydrogenase >Feature sequence199 113 679 gene locus_tag LOCUS_27560 113 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1062 1526 gene locus_tag LOCUS_27570 1062 1526 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence200 47 313 gene locus_tag LOCUS_27580 47 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 359 1333 gene locus_tag LOCUS_27590 359 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence201 >Feature sequence202 >Feature sequence203 257 898 gene locus_tag LOCUS_27600 257 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1472 885 gene locus_tag LOCUS_27610 gene tag 1472 885 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence204 <1696 440 gene locus_tag LOCUS_27620 <1696 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788730.1:capsular polysaccharide biosynthesis protein >Feature sequence205 >Feature sequence206 327 1571 gene locus_tag LOCUS_27630 327 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence207 <1 1126 gene locus_tag LOCUS_27640 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence208 >Feature sequence209 >Feature sequence210 >Feature sequence211 >Feature sequence212 >Feature sequence213 2 292 gene locus_tag LOCUS_27650 2 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 295 966 gene locus_tag LOCUS_27660 295 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1504 1004 gene locus_tag LOCUS_27670 1504 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence214 956 45 gene locus_tag LOCUS_27680 956 45 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108521.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence215 >Feature sequence216 >Feature sequence217 78 416 gene locus_tag LOCUS_27690 78 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 <1603 433 gene locus_tag LOCUS_27700 <1603 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase >Feature sequence218 >Feature sequence219 1532 120 gene locus_tag LOCUS_27710 1532 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence220 <1 570 gene locus_tag LOCUS_27720 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964345.1:all-trans-retinol 13,14-reductase >Feature sequence221 1543 377 gene locus_tag LOCUS_27730 1543 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence222 768 418 gene locus_tag LOCUS_27740 768 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 944 765 gene locus_tag LOCUS_27750 944 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence223 169 411 gene locus_tag LOCUS_27760 169 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1308 499 gene locus_tag LOCUS_27770 1308 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence224 >Feature sequence225 843 595 gene locus_tag LOCUS_27780 843 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1391 1319 gene locus_tag LOCUS_t00360 1391 1319 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence226 >Feature sequence227 >Feature sequence228 >Feature sequence229 508 1251 gene locus_tag LOCUS_27790 508 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence230 <1 664 gene locus_tag LOCUS_27800 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119250.1:gluconolactonase >Feature sequence231 >Feature sequence232 <1469 426 gene locus_tag LOCUS_27810 <1469 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence233 >Feature sequence234 >Feature sequence235 >Feature sequence236 934 242 gene locus_tag LOCUS_27820 934 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence237 <1 682 gene locus_tag LOCUS_27830 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203288.1:membrane protein 693 1109 gene locus_tag LOCUS_27840 693 1109 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence238 <1 682 gene locus_tag LOCUS_27850 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203288.1:membrane protein 693 1109 gene locus_tag LOCUS_27860 693 1109 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence239 >Feature sequence240 871 221 gene locus_tag LOCUS_27870 871 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1277 906 gene locus_tag LOCUS_27880 1277 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence241 >Feature sequence242 14 469 gene locus_tag LOCUS_27890 14 469 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_27890 842 687 gene locus_tag LOCUS_27900 842 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence243 69 965 gene locus_tag LOCUS_27910 69 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030440.1 protein_id gnl|my_center|LOCUS_27910 970 1152 gene locus_tag LOCUS_27920 970 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence244 803 297 gene locus_tag LOCUS_27930 803 297 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence245 >Feature sequence246 >Feature sequence247 533 384 gene locus_tag LOCUS_27940 533 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 806 579 gene locus_tag LOCUS_27950 806 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1082 825 gene locus_tag LOCUS_27960 1082 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence248 >Feature sequence249 <1 1295 gene locus_tag LOCUS_27970 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404010.1:L-2,4-diaminobutyrate decarboxylase >Feature sequence250 >Feature sequence251 >Feature sequence252 >Feature sequence253 >Feature sequence254 698 42 gene locus_tag LOCUS_27980 698 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1173 691 gene locus_tag LOCUS_27990 1173 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence255 >Feature sequence256 3 878 gene locus_tag LOCUS_28000 3 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence257 >Feature sequence258 <1 829 gene locus_tag LOCUS_28010 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A5I9:putative ribosome biogenesis GTPase RsgA 2 >Feature sequence259 >Feature sequence260 <1 613 gene locus_tag LOCUS_28020 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896245.1:lantibiotic ABC transporter ATP-binding protein >Feature sequence261 33 644 gene locus_tag LOCUS_28030 33 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence262 58 261 gene locus_tag LOCUS_28040 58 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 266 463 gene locus_tag LOCUS_28050 266 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 737 1264 gene locus_tag LOCUS_28060 737 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence263 >Feature sequence264 >Feature sequence265 >Feature sequence266 >Feature sequence267 <1 624 gene locus_tag LOCUS_28070 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005420148.1:sodium-independent anion transporter >Feature sequence268 1005 364 gene locus_tag LOCUS_28080 1005 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence269 105 263 gene locus_tag LOCUS_28090 105 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 873 265 gene locus_tag LOCUS_28100 873 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence270 <1309 339 gene locus_tag LOCUS_28110 <1309 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256013.1:Xaa-Pro aminopeptidase >Feature sequence271 <1304 725 gene locus_tag LOCUS_28120 <1304 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964481.1:ABC transporter ATP-binding protein >Feature sequence272 715 482 gene locus_tag LOCUS_28130 715 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1271 735 gene locus_tag LOCUS_28140 1271 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence273 627 328 gene locus_tag LOCUS_28150 627 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1007 636 gene locus_tag LOCUS_28160 1007 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence274 >Feature sequence275 529 1074 gene locus_tag LOCUS_28170 529 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence276 1089 340 gene locus_tag LOCUS_28180 1089 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence277 797 937 gene locus_tag LOCUS_28190 797 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence278 >Feature sequence279 1000 143 gene locus_tag LOCUS_28200 1000 143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence280 941 330 gene locus_tag LOCUS_28210 941 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence281 >Feature sequence282 >Feature sequence283 1184 174 gene locus_tag LOCUS_28220 1184 174 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence284 >Feature sequence285 >Feature sequence286 >Feature sequence287 1205 732 gene locus_tag LOCUS_28230 1205 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence288 418 1209 gene locus_tag LOCUS_28240 418 1209 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence289 >Feature sequence290 >Feature sequence291 >Feature sequence292 >Feature sequence293 >Feature sequence294 >Feature sequence295 1008 115 gene locus_tag LOCUS_28250 1008 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence296 337 1059 gene locus_tag LOCUS_28260 337 1059 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence297 <1 1100 gene locus_tag LOCUS_28270 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence298 >Feature sequence299 >Feature sequence300 >Feature sequence301 225 67 gene locus_tag LOCUS_28280 225 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence302 >Feature sequence303 >Feature sequence304 214 1029 gene locus_tag LOCUS_28290 214 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence305 252 431 gene locus_tag LOCUS_28300 252 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 428 778 gene locus_tag LOCUS_28310 428 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence306 648 136 gene locus_tag LOCUS_28320 gene pyrR2 648 136 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_28320 1132 641 gene locus_tag LOCUS_28330 1132 641 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence307 >Feature sequence308 >Feature sequence309 >Feature sequence310 519 28 gene locus_tag LOCUS_28340 519 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence311 >Feature sequence312 <1171 440 gene locus_tag LOCUS_28350 <1171 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391756.1:sterol desaturase >Feature sequence313 >Feature sequence314 2 232 gene locus_tag LOCUS_28360 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence315 920 516 gene locus_tag LOCUS_28370 920 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence316 >Feature sequence317 >Feature sequence318 647 21 gene locus_tag LOCUS_28380 647 21 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_28380 >Feature sequence319 67 639 gene locus_tag LOCUS_28390 67 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 686 1114 gene locus_tag LOCUS_28400 686 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence320 39 290 gene locus_tag LOCUS_28410 39 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 274 498 gene locus_tag LOCUS_28420 274 498 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366741.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence321 >Feature sequence322 >Feature sequence323 190 831 gene locus_tag LOCUS_28430 190 831 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_28430 >Feature sequence324 604 963 gene locus_tag LOCUS_28440 604 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence325 778 404 gene locus_tag LOCUS_28450 778 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 968 771 gene locus_tag LOCUS_28460 968 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence326 >Feature sequence327 >Feature sequence328 148 375 gene locus_tag LOCUS_28470 148 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 670 410 gene locus_tag LOCUS_28480 670 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1062 814 gene locus_tag LOCUS_28490 1062 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence329 >Feature sequence330 >Feature sequence331 884 234 gene locus_tag LOCUS_28500 884 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28500 1097 924 gene locus_tag LOCUS_28510 1097 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence332 >Feature sequence333 <1 902 gene locus_tag LOCUS_28520 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963304.1:ATPase AAA >Feature sequence334 <1093 418 gene locus_tag LOCUS_28530 <1093 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002389912.1:5-deoxy-glucuronate isomerase >Feature sequence335 382 1059 gene locus_tag LOCUS_28540 382 1059 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence336 >Feature sequence337 <1085 525 gene locus_tag LOCUS_28550 <1085 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120365.1:amino acid dehydrogenase >Feature sequence338 <1 1044 gene locus_tag LOCUS_28560 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H141:DNA replication and repair protein RecF >Feature sequence339 >Feature sequence340 >Feature sequence341 95 667 gene locus_tag LOCUS_28570 gene purN 95 667 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_28570 >Feature sequence342 <1 586 gene locus_tag LOCUS_28580 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence343 <1 512 gene locus_tag LOCUS_28590 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YGT5:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence344 >Feature sequence345 >Feature sequence346 361 804 gene locus_tag LOCUS_28600 361 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence347 >Feature sequence348 >Feature sequence349 <1039 360 gene locus_tag LOCUS_28610 <1039 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF0:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence350 <1 574 gene locus_tag LOCUS_28620 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P29:30S ribosomal protein S2 >Feature sequence351 >Feature sequence352 <1 574 gene locus_tag LOCUS_28630 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403563.1:amidohydrolase >Feature sequence353 >Feature sequence354 >Feature sequence355 >Feature sequence356 >Feature sequence357 >Feature sequence358 >Feature sequence359 >Feature sequence360 >Feature sequence361 >Feature sequence362 >Feature sequence363 <1 577 gene locus_tag LOCUS_28640 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202321.1:tyrosine recombinase >Feature sequence364 <1 754 gene locus_tag LOCUS_28650 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X0S8:arabinogalactan endo-beta-1,4-galactanase >Feature sequence365 <1009 225 gene locus_tag LOCUS_28660 <1009 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWZ1:tryptophan synthase beta chain >Feature sequence366 <1 968 gene locus_tag LOCUS_28670 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804101.1:naringenin-chalcone synthase >Feature sequence367 >Feature sequence368 >Feature sequence369 >Feature sequence370