>Feature sequence0001 3883 896 gene locus_tag LOCUS_00010 3883 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5229 3931 gene locus_tag LOCUS_00020 5229 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5616 6365 gene locus_tag LOCUS_00030 5616 6365 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_00030 6556 7077 gene locus_tag LOCUS_00040 6556 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7127 7480 gene locus_tag LOCUS_00050 7127 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7524 9614 gene locus_tag LOCUS_00060 7524 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9768 9586 gene locus_tag LOCUS_00070 9768 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9791 11785 gene locus_tag LOCUS_00080 9791 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11800 13617 gene locus_tag LOCUS_00090 11800 13617 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_00090 13614 15212 gene locus_tag LOCUS_00100 13614 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15460 18225 gene locus_tag LOCUS_00110 15460 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 21636 18346 gene locus_tag LOCUS_00120 21636 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 24303 22210 gene locus_tag LOCUS_00130 24303 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 26189 24405 gene locus_tag LOCUS_00140 26189 24405 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_00140 27901 26186 gene locus_tag LOCUS_00150 27901 26186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 28491 31430 gene locus_tag LOCUS_00160 28491 31430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 32950 31673 gene locus_tag LOCUS_00170 32950 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence0002 1063 272 gene locus_tag LOCUS_00180 1063 272 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_00180 1270 2250 gene locus_tag LOCUS_00190 gene pstS 1270 2250 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_00190 2573 2196 gene locus_tag LOCUS_00200 2573 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 2461 5148 gene locus_tag LOCUS_00210 2461 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 5145 7118 gene locus_tag LOCUS_00220 5145 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 7167 8063 gene locus_tag LOCUS_00230 gene pstB 7167 8063 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_00230 8231 9403 gene locus_tag LOCUS_00240 8231 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 9580 10728 gene locus_tag LOCUS_00250 gene chrA 9580 10728 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_00250 11171 10794 gene locus_tag LOCUS_00260 11171 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 12514 11639 gene locus_tag LOCUS_00270 12514 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 13164 12616 gene locus_tag LOCUS_00280 13164 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 16386 13168 gene locus_tag LOCUS_00290 16386 13168 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_00290 17573 16410 gene locus_tag LOCUS_00300 17573 16410 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_00300 19025 17763 gene locus_tag LOCUS_00310 gene metB 19025 17763 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229485.1 protein_id gnl|my_center|LOCUS_00310 19153 19569 gene locus_tag LOCUS_00320 19153 19569 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 protein_id gnl|my_center|LOCUS_00320 21160 19616 gene locus_tag LOCUS_00330 gene cysS 21160 19616 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLW3 protein_id gnl|my_center|LOCUS_00330 21823 21251 gene locus_tag LOCUS_00340 21823 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22121 23644 gene locus_tag LOCUS_00350 22121 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 23641 24030 gene locus_tag LOCUS_00360 23641 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 24805 25695 gene locus_tag LOCUS_00370 24805 25695 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_00370 25733 25930 gene locus_tag LOCUS_00380 25733 25930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 26015 27271 gene locus_tag LOCUS_00390 26015 27271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_00390 27791 28360 gene locus_tag LOCUS_00400 27791 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 28438 29784 gene locus_tag LOCUS_00410 28438 29784 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_00410 29781 30326 gene locus_tag LOCUS_00420 29781 30326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 30415 31239 gene locus_tag LOCUS_00430 30415 31239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence0003 58 2268 gene locus_tag LOCUS_00440 gene pcrA 58 2268 CDS product ATP-dependent DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34580 protein_id gnl|my_center|LOCUS_00440 4674 2296 gene locus_tag LOCUS_00450 4674 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5421 4837 gene locus_tag LOCUS_00460 5421 4837 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_00460 5747 6811 gene locus_tag LOCUS_00470 5747 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8101 6884 gene locus_tag LOCUS_00480 8101 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 8410 8156 gene locus_tag LOCUS_00490 8410 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9055 8546 gene locus_tag LOCUS_00500 9055 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 10933 9194 gene locus_tag LOCUS_00510 10933 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 11497 12249 gene locus_tag LOCUS_00520 11497 12249 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074278.1 protein_id gnl|my_center|LOCUS_00520 12246 12569 gene locus_tag LOCUS_00530 12246 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 14278 12488 gene locus_tag LOCUS_00540 14278 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 15433 14324 gene locus_tag LOCUS_00550 gene celE 15433 14324 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_00550 16418 15447 gene locus_tag LOCUS_00560 16418 15447 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_00560 18177 16429 gene locus_tag LOCUS_00570 18177 16429 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_00570 18489 20654 gene locus_tag LOCUS_00580 18489 20654 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG52 protein_id gnl|my_center|LOCUS_00580 20947 25584 gene locus_tag LOCUS_00590 20947 25584 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_00590 25673 25999 gene locus_tag LOCUS_00600 25673 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 26737 26054 gene locus_tag LOCUS_00610 26737 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 27811 26765 gene locus_tag LOCUS_00620 gene manC 27811 26765 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence0004 <1 776 gene locus_tag LOCUS_00630 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938086.1:rod shape-determining protein RodA 798 2300 gene locus_tag LOCUS_00640 gene cafA 798 2300 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_00640 2305 4563 gene locus_tag LOCUS_00650 2305 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4779 6554 gene locus_tag LOCUS_00660 4779 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8147 6891 gene locus_tag LOCUS_00670 8147 6891 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_00670 8451 8377 gene locus_tag LOCUS_t00010 8451 8377 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8751 9425 gene locus_tag LOCUS_00680 8751 9425 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040230.1 protein_id gnl|my_center|LOCUS_00680 10531 9410 gene locus_tag LOCUS_00690 10531 9410 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530553.1 protein_id gnl|my_center|LOCUS_00690 11657 10635 gene locus_tag LOCUS_00700 11657 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 12573 11677 gene locus_tag LOCUS_00710 12573 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 13735 12575 gene locus_tag LOCUS_00720 13735 12575 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_00720 14563 13844 gene locus_tag LOCUS_00730 14563 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15322 14717 gene locus_tag LOCUS_00740 15322 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16526 15360 gene locus_tag LOCUS_00750 16526 15360 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_00750 17645 16557 gene locus_tag LOCUS_00760 17645 16557 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_00760 17857 20145 gene locus_tag LOCUS_00770 17857 20145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119225.1 protein_id gnl|my_center|LOCUS_00770 20263 21633 gene locus_tag LOCUS_00780 20263 21633 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_00780 21626 22117 gene locus_tag LOCUS_00790 21626 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_00790 22874 22143 gene locus_tag LOCUS_00800 gene smuG1 22874 22143 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_00800 22988 23215 gene locus_tag LOCUS_00810 22988 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 23217 24689 gene locus_tag LOCUS_00820 gene panF 23217 24689 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_00820 24794 25327 gene locus_tag LOCUS_00830 24794 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26468 25341 gene locus_tag LOCUS_00840 26468 25341 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_00840 28309 26489 gene locus_tag LOCUS_00850 28309 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 28566 28306 gene locus_tag LOCUS_00860 28566 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 29191 28580 gene locus_tag LOCUS_00870 29191 28580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_00870 <29759 29188 gene locus_tag LOCUS_00880 <29759 29188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727205.1:polyketide synthase >Feature sequence0005 774 52 gene locus_tag LOCUS_00890 774 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4888 788 gene locus_tag LOCUS_00900 4888 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6539 5199 gene locus_tag LOCUS_00910 6539 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7815 6541 gene locus_tag LOCUS_00920 gene tyrS2 7815 6541 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834C7 protein_id gnl|my_center|LOCUS_00920 8342 8124 gene locus_tag LOCUS_00930 8342 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8379 9455 gene locus_tag LOCUS_00940 8379 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9951 10799 gene locus_tag LOCUS_00950 9951 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 11556 10855 gene locus_tag LOCUS_00960 11556 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_00960 12955 11549 gene locus_tag LOCUS_00970 12955 11549 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_00970 14134 12959 gene locus_tag LOCUS_00980 14134 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 15786 14131 gene locus_tag LOCUS_00990 15786 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 17018 15783 gene locus_tag LOCUS_01000 17018 15783 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_01000 17737 17015 gene locus_tag LOCUS_01010 17737 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 19102 17891 gene locus_tag LOCUS_01020 19102 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 20706 19135 gene locus_tag LOCUS_01030 gene secD 20706 19135 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_01030 21032 20709 gene locus_tag LOCUS_01040 21032 20709 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_01040 22376 21252 gene locus_tag LOCUS_01050 gene tgt 22376 21252 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZC33 protein_id gnl|my_center|LOCUS_01050 23242 22415 gene locus_tag LOCUS_01060 23242 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 23355 23984 gene locus_tag LOCUS_01070 gene folK 23355 23984 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403715.1 protein_id gnl|my_center|LOCUS_01070 24040 24738 gene locus_tag LOCUS_01080 24040 24738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 24749 25990 gene locus_tag LOCUS_01090 24749 25990 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_01090 26141 26899 gene locus_tag LOCUS_01100 26141 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 27724 26906 gene locus_tag LOCUS_01110 27724 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence0006 <1 630 gene locus_tag LOCUS_01120 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000730383.1:bacillolysin 892 816 gene locus_tag LOCUS_t00020 892 816 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1205 2503 gene locus_tag LOCUS_01130 gene eno 1205 2503 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEL5 protein_id gnl|my_center|LOCUS_01130 2500 2823 gene locus_tag LOCUS_01140 2500 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2909 6394 gene locus_tag LOCUS_01150 gene mfd 2909 6394 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMB9 protein_id gnl|my_center|LOCUS_01150 6498 7316 gene locus_tag LOCUS_01160 6498 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 7294 8493 gene locus_tag LOCUS_01170 7294 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8748 8569 gene locus_tag LOCUS_01180 8748 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 10441 8786 gene locus_tag LOCUS_01190 10441 8786 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_01190 10632 10904 gene locus_tag LOCUS_01200 10632 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 10901 11335 gene locus_tag LOCUS_01210 10901 11335 CDS product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_01210 12528 11341 gene locus_tag LOCUS_01220 12528 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12735 13307 gene locus_tag LOCUS_01230 12735 13307 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMV6 protein_id gnl|my_center|LOCUS_01230 13304 14356 gene locus_tag LOCUS_01240 13304 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 14353 17451 gene locus_tag LOCUS_01250 14353 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18272 17469 gene locus_tag LOCUS_01260 18272 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20096 18459 gene locus_tag LOCUS_01270 gene coxA2 20096 18459 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_01270 20569 20093 gene locus_tag LOCUS_01280 gene coxB2 20569 20093 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403092.1 protein_id gnl|my_center|LOCUS_01280 20789 20616 gene locus_tag LOCUS_01290 20789 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 21572 20925 gene locus_tag LOCUS_01300 21572 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 23923 21569 gene locus_tag LOCUS_01310 23923 21569 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_01310 25566 23920 gene locus_tag LOCUS_01320 25566 23920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 26642 25599 gene locus_tag LOCUS_01330 26642 25599 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CM4 protein_id gnl|my_center|LOCUS_01330 27282 26644 gene locus_tag LOCUS_01340 27282 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence0007 871 404 gene locus_tag LOCUS_01350 871 404 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA4 protein_id gnl|my_center|LOCUS_01350 1008 1262 gene locus_tag LOCUS_01360 1008 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2008 1280 gene locus_tag LOCUS_01370 2008 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3268 2222 gene locus_tag LOCUS_01380 3268 2222 CDS product peptidase M35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706525.1 protein_id gnl|my_center|LOCUS_01380 3569 4159 gene locus_tag LOCUS_01390 3569 4159 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UH72 protein_id gnl|my_center|LOCUS_01390 4161 6680 gene locus_tag LOCUS_01400 4161 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6938 7855 gene locus_tag LOCUS_01410 6938 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7857 8720 gene locus_tag LOCUS_01420 7857 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8720 9742 gene locus_tag LOCUS_01430 8720 9742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_01430 9739 10602 gene locus_tag LOCUS_01440 9739 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 11353 10967 gene locus_tag LOCUS_01450 gene rplQ 11353 10967 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME9 protein_id gnl|my_center|LOCUS_01450 12367 11375 gene locus_tag LOCUS_01460 gene rpoA 12367 11375 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_01460 13021 12392 gene locus_tag LOCUS_01470 13021 12392 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_01470 13594 13193 gene locus_tag LOCUS_01480 gene rpsK 13594 13193 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF3 protein_id gnl|my_center|LOCUS_01480 13985 13605 gene locus_tag LOCUS_01490 gene rpsM 13985 13605 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_01490 14357 14130 gene locus_tag LOCUS_01500 gene infA1 14357 14130 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_01500 15193 14375 gene locus_tag LOCUS_01510 15193 14375 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01510 15756 15190 gene locus_tag LOCUS_01520 gene adk 15756 15190 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD4 protein_id gnl|my_center|LOCUS_01520 17122 15743 gene locus_tag LOCUS_01530 gene secY 17122 15743 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_01530 17556 17119 gene locus_tag LOCUS_01540 gene rplO 17556 17119 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN9 protein_id gnl|my_center|LOCUS_01540 17753 17562 gene locus_tag LOCUS_01550 gene rpmD 17753 17562 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS10 protein_id gnl|my_center|LOCUS_01550 18307 17789 gene locus_tag LOCUS_01560 gene rpsE 18307 17789 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_01560 18768 18382 gene locus_tag LOCUS_01570 gene rplR 18768 18382 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG8 protein_id gnl|my_center|LOCUS_01570 19343 18801 gene locus_tag LOCUS_01580 gene rplF 19343 18801 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR2 protein_id gnl|my_center|LOCUS_01580 19748 19356 gene locus_tag LOCUS_01590 gene rpsH 19748 19356 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ6 protein_id gnl|my_center|LOCUS_01590 20382 19819 gene locus_tag LOCUS_01600 gene rplE 20382 19819 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG8 protein_id gnl|my_center|LOCUS_01600 20740 20405 gene locus_tag LOCUS_01610 gene rplX 20740 20405 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ8 protein_id gnl|my_center|LOCUS_01610 21143 20775 gene locus_tag LOCUS_01620 gene rplN 21143 20775 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W5 protein_id gnl|my_center|LOCUS_01620 21428 21159 gene locus_tag LOCUS_01630 gene rpsQ 21428 21159 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG8 protein_id gnl|my_center|LOCUS_01630 21642 21451 gene locus_tag LOCUS_01640 gene rpmC 21642 21451 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W7 protein_id gnl|my_center|LOCUS_01640 22072 21653 gene locus_tag LOCUS_01650 gene rplP 22072 21653 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14577 protein_id gnl|my_center|LOCUS_01650 22735 22088 gene locus_tag LOCUS_01660 gene rpsC 22735 22088 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_01660 23103 22738 gene locus_tag LOCUS_01670 gene rplV 23103 22738 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS31 protein_id gnl|my_center|LOCUS_01670 23391 23107 gene locus_tag LOCUS_01680 gene rpsS 23391 23107 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_01680 24239 23406 gene locus_tag LOCUS_01690 gene rplB 24239 23406 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_01690 24568 24278 gene locus_tag LOCUS_01700 gene rplW 24568 24278 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_01700 25188 24565 gene locus_tag LOCUS_01710 gene rplD 25188 24565 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J41 protein_id gnl|my_center|LOCUS_01710 25832 25203 gene locus_tag LOCUS_01720 gene rplC 25832 25203 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60454 protein_id gnl|my_center|LOCUS_01720 26161 25853 gene locus_tag LOCUS_01730 gene rpsJ 26161 25853 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J83 protein_id gnl|my_center|LOCUS_01730 >Feature sequence0008 3507 886 gene locus_tag LOCUS_01740 3507 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3769 7251 gene locus_tag LOCUS_01750 3769 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 8927 8172 gene locus_tag LOCUS_01760 gene paaG 8927 8172 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_01760 9037 10296 gene locus_tag LOCUS_01770 9037 10296 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728252.1 protein_id gnl|my_center|LOCUS_01770 10513 11280 gene locus_tag LOCUS_01780 10513 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 11327 11842 gene locus_tag LOCUS_01790 11327 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11881 13092 gene locus_tag LOCUS_01800 gene mauG 11881 13092 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_01800 13921 13106 gene locus_tag LOCUS_01810 13921 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15955 14009 gene locus_tag LOCUS_01820 15955 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_01820 16234 15980 gene locus_tag LOCUS_01830 16234 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 16427 17791 gene locus_tag LOCUS_01840 16427 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 17788 18438 gene locus_tag LOCUS_01850 17788 18438 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_01850 19237 18491 gene locus_tag LOCUS_01860 19237 18491 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_01860 19374 19994 gene locus_tag LOCUS_01870 19374 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 20184 19987 gene locus_tag LOCUS_01880 20184 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 21459 20296 gene locus_tag LOCUS_01890 21459 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 21729 22343 gene locus_tag LOCUS_01900 gene udk 21729 22343 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_01900 22641 23324 gene locus_tag LOCUS_01910 22641 23324 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_01910 24192 23341 gene locus_tag LOCUS_01920 24192 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 26012 24249 gene locus_tag LOCUS_01930 26012 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0009 2517 1498 gene locus_tag LOCUS_01940 2517 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2877 3830 gene locus_tag LOCUS_01950 2877 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4972 3908 gene locus_tag LOCUS_01960 4972 3908 CDS product peptidase M35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706525.1 protein_id gnl|my_center|LOCUS_01960 5947 5132 gene locus_tag LOCUS_01970 gene rph 5947 5132 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXY3 protein_id gnl|my_center|LOCUS_01970 6808 5987 gene locus_tag LOCUS_01980 gene murI 6808 5987 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_01980 7523 6852 gene locus_tag LOCUS_01990 7523 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 9139 7520 gene locus_tag LOCUS_02000 9139 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 9609 9684 gene locus_tag LOCUS_t00030 9609 9684 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12200 9957 gene locus_tag LOCUS_02010 12200 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12513 14948 gene locus_tag LOCUS_02020 12513 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 15166 16194 gene locus_tag LOCUS_02030 15166 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 16235 17293 gene locus_tag LOCUS_02040 16235 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 17295 18212 gene locus_tag LOCUS_02050 gene pstC 17295 18212 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_02050 18286 19155 gene locus_tag LOCUS_02060 18286 19155 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SM4 protein_id gnl|my_center|LOCUS_02060 19149 19943 gene locus_tag LOCUS_02070 gene pstB 19149 19943 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A5 protein_id gnl|my_center|LOCUS_02070 19936 20724 gene locus_tag LOCUS_02080 19936 20724 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_02080 20902 21282 gene locus_tag LOCUS_02090 gene erpA 20902 21282 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45344 protein_id gnl|my_center|LOCUS_02090 21284 22192 gene locus_tag LOCUS_02100 21284 22192 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_02100 22200 23054 gene locus_tag LOCUS_02110 22200 23054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089015.1 protein_id gnl|my_center|LOCUS_02110 <25302 23063 gene locus_tag LOCUS_02120 <25302 23063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068567.1:serine/threonine protein kinase >Feature sequence0010 957 1913 gene locus_tag LOCUS_02130 957 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2017 2712 gene locus_tag LOCUS_02140 2017 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2813 4609 gene locus_tag LOCUS_02150 2813 4609 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_02150 4633 5370 gene locus_tag LOCUS_02160 4633 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5965 6942 gene locus_tag LOCUS_02170 5965 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7193 7023 gene locus_tag LOCUS_02180 7193 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 7497 7424 gene locus_tag LOCUS_t00040 7497 7424 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7685 8743 gene locus_tag LOCUS_02190 7685 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8752 9708 gene locus_tag LOCUS_02200 8752 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 10758 9970 gene locus_tag LOCUS_02210 10758 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11564 10755 gene locus_tag LOCUS_02220 11564 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 15165 11614 gene locus_tag LOCUS_02230 15165 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 16897 15245 gene locus_tag LOCUS_02240 16897 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 17316 20765 gene locus_tag LOCUS_02250 17316 20765 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 protein_id gnl|my_center|LOCUS_02250 20777 23122 gene locus_tag LOCUS_02260 20777 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23182 24555 gene locus_tag LOCUS_02270 23182 24555 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552128.1 protein_id gnl|my_center|LOCUS_02270 24787 25038 gene locus_tag LOCUS_02280 24787 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence0011 1171 2919 gene locus_tag LOCUS_02290 1171 2919 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115546.1 protein_id gnl|my_center|LOCUS_02290 2938 3201 gene locus_tag LOCUS_02300 2938 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3203 4156 gene locus_tag LOCUS_02310 3203 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4579 5355 gene locus_tag LOCUS_02320 4579 5355 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_02320 5926 5378 gene locus_tag LOCUS_02330 5926 5378 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC87 protein_id gnl|my_center|LOCUS_02330 6469 5999 gene locus_tag LOCUS_02340 gene smpB 6469 5999 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_02340 6683 7255 gene locus_tag LOCUS_02350 6683 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7283 9505 gene locus_tag LOCUS_02360 7283 9505 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_02360 11790 9532 gene locus_tag LOCUS_02370 11790 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_02370 12554 21007 gene locus_tag LOCUS_02380 12554 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 21550 21152 gene locus_tag LOCUS_02390 21550 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 21543 23357 gene locus_tag LOCUS_02400 21543 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence0012 1944 1150 gene locus_tag LOCUS_02410 1944 1150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 protein_id gnl|my_center|LOCUS_02410 2704 1952 gene locus_tag LOCUS_02420 2704 1952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_02420 3625 2750 gene locus_tag LOCUS_02430 3625 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4449 3622 gene locus_tag LOCUS_02440 4449 3622 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_02440 5262 4486 gene locus_tag LOCUS_02450 gene truA 5262 4486 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSC1 protein_id gnl|my_center|LOCUS_02450 6584 5247 gene locus_tag LOCUS_02460 6584 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6680 8167 gene locus_tag LOCUS_02470 6680 8167 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_02470 8247 10040 gene locus_tag LOCUS_02480 8247 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10206 11489 gene locus_tag LOCUS_02490 10206 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 11486 15124 gene locus_tag LOCUS_02500 11486 15124 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_02500 15121 18318 gene locus_tag LOCUS_02510 gene acrD 15121 18318 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_02510 18504 20969 gene locus_tag LOCUS_02520 18504 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 21495 20986 gene locus_tag LOCUS_02530 21495 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence0013 3451 536 gene locus_tag LOCUS_02540 gene gcvP 3451 536 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_02540 3776 4186 gene locus_tag LOCUS_02550 3776 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 5623 4331 gene locus_tag LOCUS_02560 5623 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8667 5998 gene locus_tag LOCUS_02570 8667 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 9205 8894 gene locus_tag LOCUS_02580 9205 8894 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_02580 9417 10931 gene locus_tag LOCUS_02590 9417 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11799 11026 gene locus_tag LOCUS_02600 11799 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 protein_id gnl|my_center|LOCUS_02600 12089 11889 gene locus_tag LOCUS_02610 12089 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 12292 13035 gene locus_tag LOCUS_02620 12292 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 13305 13117 gene locus_tag LOCUS_02630 gene tatA1 13305 13117 CDS product Sec-independent protein translocase protein TatA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66477 protein_id gnl|my_center|LOCUS_02630 13573 13863 gene locus_tag LOCUS_02640 13573 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 13935 14981 gene locus_tag LOCUS_02650 gene rlmN 13935 14981 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_02650 15725 15012 gene locus_tag LOCUS_02660 15725 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_02660 16830 15730 gene locus_tag LOCUS_02670 gene clpX 16830 15730 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_02670 16996 17997 gene locus_tag LOCUS_02680 16996 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 18053 19912 gene locus_tag LOCUS_02690 18053 19912 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence0014 2261 597 gene locus_tag LOCUS_02700 gene leuA 2261 597 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI93 protein_id gnl|my_center|LOCUS_02700 3019 4206 gene locus_tag LOCUS_02710 3019 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4635 4303 gene locus_tag LOCUS_02720 4635 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5010 5318 gene locus_tag LOCUS_02730 5010 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5302 5631 gene locus_tag LOCUS_02740 5302 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6873 5797 gene locus_tag LOCUS_02750 6873 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7059 7613 gene locus_tag LOCUS_02760 7059 7613 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_02760 7663 8109 gene locus_tag LOCUS_02770 7663 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9756 8119 gene locus_tag LOCUS_02780 9756 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12138 9883 gene locus_tag LOCUS_02790 12138 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 12437 12775 gene locus_tag LOCUS_02800 12437 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 12840 14525 gene locus_tag LOCUS_02810 12840 14525 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_02810 15274 14573 gene locus_tag LOCUS_02820 15274 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 15749 15258 gene locus_tag LOCUS_02830 15749 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 16733 15873 gene locus_tag LOCUS_02840 16733 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 17177 16755 gene locus_tag LOCUS_02850 17177 16755 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_02850 17722 17174 gene locus_tag LOCUS_02860 17722 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 20359 17789 gene locus_tag LOCUS_02870 20359 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence0015 <1 3268 gene locus_tag LOCUS_02880 <1 3268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein 3375 4772 gene locus_tag LOCUS_02890 3375 4772 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_02890 5073 7028 gene locus_tag LOCUS_02900 5073 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 7172 8383 gene locus_tag LOCUS_02910 7172 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261901.1 protein_id gnl|my_center|LOCUS_02910 8380 11277 gene locus_tag LOCUS_02920 8380 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 12792 11284 gene locus_tag LOCUS_02930 12792 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13517 12792 gene locus_tag LOCUS_02940 13517 12792 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_02940 14925 13495 gene locus_tag LOCUS_02950 14925 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 15475 15017 gene locus_tag LOCUS_02960 15475 15017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 15940 17064 gene locus_tag LOCUS_02970 15940 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 17064 18413 gene locus_tag LOCUS_02980 17064 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 18410 19699 gene locus_tag LOCUS_02990 18410 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence0016 420 3287 gene locus_tag LOCUS_03000 420 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3861 3298 gene locus_tag LOCUS_03010 3861 3298 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_03010 6793 3950 gene locus_tag LOCUS_03020 6793 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7854 6790 gene locus_tag LOCUS_03030 7854 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8828 7854 gene locus_tag LOCUS_03040 gene wbbL 8828 7854 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMY3 protein_id gnl|my_center|LOCUS_03040 9896 8892 gene locus_tag LOCUS_03050 9896 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 12151 9986 gene locus_tag LOCUS_03060 12151 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13509 12148 gene locus_tag LOCUS_03070 13509 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 13598 15076 gene locus_tag LOCUS_03080 gene serS 13598 15076 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FH6 protein_id gnl|my_center|LOCUS_03080 15125 15214 gene locus_tag LOCUS_t00050 15125 15214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15474 16868 gene locus_tag LOCUS_03090 15474 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921106.1 protein_id gnl|my_center|LOCUS_03090 17141 16851 gene locus_tag LOCUS_03100 17141 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18838 17138 gene locus_tag LOCUS_03110 18838 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 19180 19677 gene locus_tag LOCUS_03120 19180 19677 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence0017 2226 358 gene locus_tag LOCUS_03130 2226 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4825 2291 gene locus_tag LOCUS_03140 4825 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5352 6956 gene locus_tag LOCUS_03150 5352 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_03150 7007 8380 gene locus_tag LOCUS_03160 7007 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_03160 8671 13464 gene locus_tag LOCUS_03170 8671 13464 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_03170 13709 15670 gene locus_tag LOCUS_03180 gene htpG 13709 15670 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ7 protein_id gnl|my_center|LOCUS_03180 16001 16903 gene locus_tag LOCUS_03190 16001 16903 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 protein_id gnl|my_center|LOCUS_03190 16929 17768 gene locus_tag LOCUS_03200 16929 17768 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_03200 19219 17780 gene locus_tag LOCUS_03210 19219 17780 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 protein_id gnl|my_center|LOCUS_03210 19555 19313 gene locus_tag LOCUS_03220 19555 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence0018 1609 1121 gene locus_tag LOCUS_03230 1609 1121 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_03230 3682 1865 gene locus_tag LOCUS_03240 3682 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4825 3683 gene locus_tag LOCUS_03250 gene tqsA 4825 3683 CDS product pheromone autoinducer 2 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366785.1 protein_id gnl|my_center|LOCUS_03250 5220 4879 gene locus_tag LOCUS_03260 5220 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5603 6265 gene locus_tag LOCUS_03270 gene msrA 5603 6265 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_03270 6541 6287 gene locus_tag LOCUS_03280 6541 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6952 8163 gene locus_tag LOCUS_03290 6952 8163 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391475.1 protein_id gnl|my_center|LOCUS_03290 8325 9164 gene locus_tag LOCUS_03300 8325 9164 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 protein_id gnl|my_center|LOCUS_03300 9161 10468 gene locus_tag LOCUS_03310 gene tagH 9161 10468 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_03310 10508 10798 gene locus_tag LOCUS_03320 10508 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03320 10836 12146 gene locus_tag LOCUS_03330 10836 12146 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_03330 12186 12731 gene locus_tag LOCUS_03340 12186 12731 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_03340 16095 12694 gene locus_tag LOCUS_03350 16095 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16239 17771 gene locus_tag LOCUS_03360 16239 17771 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_03360 17771 18280 gene locus_tag LOCUS_03370 17771 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 18277 18903 gene locus_tag LOCUS_03380 18277 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0019 4221 2533 gene locus_tag LOCUS_03390 4221 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5583 4387 gene locus_tag LOCUS_03400 5583 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8052 5650 gene locus_tag LOCUS_03410 8052 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 8606 8043 gene locus_tag LOCUS_03420 8606 8043 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_03420 8818 9597 gene locus_tag LOCUS_03430 8818 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10340 9660 gene locus_tag LOCUS_03440 10340 9660 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484031.1 protein_id gnl|my_center|LOCUS_03440 10531 11781 gene locus_tag LOCUS_03450 10531 11781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_03450 11958 12449 gene locus_tag LOCUS_03460 gene purE 11958 12449 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_03460 12562 14904 gene locus_tag LOCUS_03470 12562 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 14973 16088 gene locus_tag LOCUS_03480 14973 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_03480 16610 16206 gene locus_tag LOCUS_03490 gene rpsN 16610 16206 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0020 1628 1092 gene locus_tag LOCUS_03500 1628 1092 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_03500 2881 1625 gene locus_tag LOCUS_03510 2881 1625 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_03510 3238 2975 gene locus_tag LOCUS_03520 3238 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3132 4250 gene locus_tag LOCUS_03530 3132 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4240 5178 gene locus_tag LOCUS_03540 4240 5178 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_03540 5214 5975 gene locus_tag LOCUS_03550 5214 5975 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_03550 5972 6892 gene locus_tag LOCUS_03560 gene nadK 5972 6892 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_03560 6880 10980 gene locus_tag LOCUS_03570 6880 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 10955 13855 gene locus_tag LOCUS_03580 gene yaeT 10955 13855 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_03580 15511 13889 gene locus_tag LOCUS_03590 15511 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 18715 16331 gene locus_tag LOCUS_03600 18715 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence0021 1774 224 gene locus_tag LOCUS_03610 gene glgA1 1774 224 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_03610 3039 1774 gene locus_tag LOCUS_03620 gene glgC 3039 1774 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_03620 3559 3299 gene locus_tag LOCUS_03630 3559 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4184 3552 gene locus_tag LOCUS_03640 4184 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 4534 4184 gene locus_tag LOCUS_03650 4534 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4728 5651 gene locus_tag LOCUS_03660 4728 5651 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706573.1 protein_id gnl|my_center|LOCUS_03660 5666 7555 gene locus_tag LOCUS_03670 5666 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7787 9007 gene locus_tag LOCUS_03680 7787 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9053 10306 gene locus_tag LOCUS_03690 9053 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 11391 10294 gene locus_tag LOCUS_03700 11391 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13180 11435 gene locus_tag LOCUS_03710 13180 11435 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_03710 13406 14029 gene locus_tag LOCUS_03720 13406 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 14641 14057 gene locus_tag LOCUS_03730 14641 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15046 16881 gene locus_tag LOCUS_03740 15046 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 17036 17959 gene locus_tag LOCUS_03750 17036 17959 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0022 <1 1256 gene locus_tag LOCUS_03760 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z3R3:acetoacetyl-coenzyme A synthetase 1464 2186 gene locus_tag LOCUS_03770 1464 2186 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_03770 2212 3756 gene locus_tag LOCUS_03780 gene bshC 2212 3756 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_03780 3758 4798 gene locus_tag LOCUS_03790 3758 4798 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_03790 4795 5235 gene locus_tag LOCUS_03800 4795 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5292 5975 gene locus_tag LOCUS_03810 5292 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_03810 7773 5995 gene locus_tag LOCUS_03820 7773 5995 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_03820 8833 7775 gene locus_tag LOCUS_03830 gene mtnA 8833 7775 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX9 protein_id gnl|my_center|LOCUS_03830 8995 10032 gene locus_tag LOCUS_03840 8995 10032 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016960.1 protein_id gnl|my_center|LOCUS_03840 10029 11303 gene locus_tag LOCUS_03850 gene purD 10029 11303 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_03850 11586 12422 gene locus_tag LOCUS_03860 11586 12422 CDS product stage 0 sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723490.1 protein_id gnl|my_center|LOCUS_03860 12419 12745 gene locus_tag LOCUS_03870 12419 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12925 14208 gene locus_tag LOCUS_03880 12925 14208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_03880 14321 15343 gene locus_tag LOCUS_03890 gene pdxA 14321 15343 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGL1 protein_id gnl|my_center|LOCUS_03890 15539 17161 gene locus_tag LOCUS_03900 gene pckA2 15539 17161 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_03900 17978 17244 gene locus_tag LOCUS_03910 17978 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence0023 1693 428 gene locus_tag LOCUS_03920 1693 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_03920 3696 1723 gene locus_tag LOCUS_03930 3696 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_03930 3835 4668 gene locus_tag LOCUS_03940 3835 4668 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_03940 4680 5882 gene locus_tag LOCUS_03950 4680 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_03950 8131 5897 gene locus_tag LOCUS_03960 8131 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 8072 8431 gene locus_tag LOCUS_03970 8072 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8493 8642 gene locus_tag LOCUS_03980 8493 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 9800 8685 gene locus_tag LOCUS_03990 9800 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 10029 12824 gene locus_tag LOCUS_04000 10029 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13360 12947 gene locus_tag LOCUS_04010 13360 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022913.1 protein_id gnl|my_center|LOCUS_04010 14287 13382 gene locus_tag LOCUS_04020 14287 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15183 14545 gene locus_tag LOCUS_04030 15183 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_04030 16300 15314 gene locus_tag LOCUS_04040 16300 15314 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529501.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence0024 3205 2276 gene locus_tag LOCUS_04050 3205 2276 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_04050 3822 3454 gene locus_tag LOCUS_04060 3822 3454 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2M2 protein_id gnl|my_center|LOCUS_04060 5318 3888 gene locus_tag LOCUS_04070 gene cls-2 5318 3888 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_04070 5451 5870 gene locus_tag LOCUS_04080 5451 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 7229 5910 gene locus_tag LOCUS_04090 7229 5910 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_04090 7312 8337 gene locus_tag LOCUS_04100 7312 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_04100 8405 9022 gene locus_tag LOCUS_04110 8405 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9842 9042 gene locus_tag LOCUS_04120 9842 9042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_04120 11518 9839 gene locus_tag LOCUS_04130 11518 9839 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_04130 12648 11515 gene locus_tag LOCUS_04140 12648 11515 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257083.1 protein_id gnl|my_center|LOCUS_04140 14181 12652 gene locus_tag LOCUS_04150 14181 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_04150 15401 14199 gene locus_tag LOCUS_04160 gene aspC 15401 14199 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335565.1 protein_id gnl|my_center|LOCUS_04160 <16600 15604 gene locus_tag LOCUS_04170 <16600 15604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase >Feature sequence0025 1865 774 gene locus_tag LOCUS_04180 gene dnaN 1865 774 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_04180 3254 2142 gene locus_tag LOCUS_04190 gene mutY 3254 2142 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_04190 3672 3538 gene locus_tag LOCUS_04200 3672 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3767 5053 gene locus_tag LOCUS_04210 gene dnaA 3767 5053 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05648 protein_id gnl|my_center|LOCUS_04210 6060 5068 gene locus_tag LOCUS_04220 6060 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6739 6119 gene locus_tag LOCUS_04230 6739 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8041 6746 gene locus_tag LOCUS_04240 8041 6746 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_04240 8625 8041 gene locus_tag LOCUS_04250 gene recR 8625 8041 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_04250 8928 8632 gene locus_tag LOCUS_04260 8928 8632 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814C9 protein_id gnl|my_center|LOCUS_04260 10826 8925 gene locus_tag LOCUS_04270 10826 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11344 11826 gene locus_tag LOCUS_04280 gene tadA 11344 11826 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H28 protein_id gnl|my_center|LOCUS_04280 11858 11947 gene locus_tag LOCUS_t00060 11858 11947 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12046 12135 gene locus_tag LOCUS_t00070 12046 12135 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12270 12404 gene locus_tag LOCUS_04290 12270 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13185 14915 gene locus_tag LOCUS_04300 gene yidC 13185 14915 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_04300 15044 16099 gene locus_tag LOCUS_04310 15044 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence0026 1975 5028 gene locus_tag LOCUS_04320 1975 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5031 5753 gene locus_tag LOCUS_04330 5031 5753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_04330 7498 6095 gene locus_tag LOCUS_04340 7498 6095 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_04340 8818 7520 gene locus_tag LOCUS_04350 8818 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9808 9539 gene locus_tag LOCUS_04360 9808 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12399 9958 gene locus_tag LOCUS_04370 12399 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12926 15040 gene locus_tag LOCUS_04380 12926 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 <16394 15150 gene locus_tag LOCUS_04390 <16394 15150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030712.1:metal-dependent hydrolase >Feature sequence0027 2257 251 gene locus_tag LOCUS_04400 2257 251 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_04400 2361 2603 gene locus_tag LOCUS_04410 2361 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2645 4450 gene locus_tag LOCUS_04420 2645 4450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_04420 4447 4668 gene locus_tag LOCUS_04430 4447 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5363 4620 gene locus_tag LOCUS_04440 5363 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_04440 5335 5622 gene locus_tag LOCUS_04450 5335 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8718 6439 gene locus_tag LOCUS_04460 8718 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8873 9964 gene locus_tag LOCUS_04470 8873 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10151 10405 gene locus_tag LOCUS_04480 10151 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11935 10421 gene locus_tag LOCUS_04490 11935 10421 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124107.1 protein_id gnl|my_center|LOCUS_04490 12127 12888 gene locus_tag LOCUS_04500 12127 12888 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_04500 13362 12901 gene locus_tag LOCUS_04510 13362 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 13506 13937 gene locus_tag LOCUS_04520 13506 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14675 13947 gene locus_tag LOCUS_04530 14675 13947 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_04530 15728 14688 gene locus_tag LOCUS_04540 15728 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0028 1369 422 gene locus_tag LOCUS_04550 1369 422 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_04550 1707 2039 gene locus_tag LOCUS_04560 1707 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2036 2971 gene locus_tag LOCUS_04570 2036 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2968 5106 gene locus_tag LOCUS_04580 2968 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5109 7364 gene locus_tag LOCUS_04590 5109 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8192 7548 gene locus_tag LOCUS_04600 8192 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8669 9811 gene locus_tag LOCUS_04610 8669 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11544 9907 gene locus_tag LOCUS_04620 11544 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 11833 13722 gene locus_tag LOCUS_04630 11833 13722 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_04630 15148 13778 gene locus_tag LOCUS_04640 15148 13778 CDS product arsenical pump family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253041.1 protein_id gnl|my_center|LOCUS_04640 15695 15249 gene locus_tag LOCUS_04650 15695 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0029 1806 4451 gene locus_tag LOCUS_04660 1806 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4455 5063 gene locus_tag LOCUS_04670 4455 5063 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_04670 5498 7459 gene locus_tag LOCUS_04680 5498 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9943 7466 gene locus_tag LOCUS_04690 9943 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11383 9971 gene locus_tag LOCUS_04700 11383 9971 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_04700 11593 11399 gene locus_tag LOCUS_04710 11593 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13995 11593 gene locus_tag LOCUS_04720 13995 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14548 14156 gene locus_tag LOCUS_04730 14548 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 14898 15269 gene locus_tag LOCUS_04740 14898 15269 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0030 <1 533 gene locus_tag LOCUS_04750 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHC0:acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase 554 1510 gene locus_tag LOCUS_04760 gene gnnA 554 1510 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_04760 1539 2420 gene locus_tag LOCUS_04770 gene mtnP 1539 2420 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_04770 2441 3202 gene locus_tag LOCUS_04780 gene surE 2441 3202 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_04780 3245 3901 gene locus_tag LOCUS_04790 gene pcm 3245 3901 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG96 protein_id gnl|my_center|LOCUS_04790 3898 4212 gene locus_tag LOCUS_04800 gene acyP 3898 4212 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35031 protein_id gnl|my_center|LOCUS_04800 4266 4781 gene locus_tag LOCUS_04810 4266 4781 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_04810 5035 6852 gene locus_tag LOCUS_04820 5035 6852 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_04820 6914 7333 gene locus_tag LOCUS_04830 6914 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 7411 7563 gene locus_tag LOCUS_04840 7411 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7700 8965 gene locus_tag LOCUS_04850 7700 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8962 9732 gene locus_tag LOCUS_04860 gene rfbF 8962 9732 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_04860 10343 9831 gene locus_tag LOCUS_04870 10343 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10389 11831 gene locus_tag LOCUS_04880 10389 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11828 13084 gene locus_tag LOCUS_04890 11828 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13081 13857 gene locus_tag LOCUS_04900 13081 13857 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_04900 14536 13880 gene locus_tag LOCUS_04910 14536 13880 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence0031 1799 390 gene locus_tag LOCUS_04920 1799 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3832 1799 gene locus_tag LOCUS_04930 3832 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5796 3832 gene locus_tag LOCUS_04940 5796 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7631 5883 gene locus_tag LOCUS_04950 7631 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 9475 7628 gene locus_tag LOCUS_04960 9475 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 10701 9526 gene locus_tag LOCUS_04970 10701 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12188 10698 gene locus_tag LOCUS_04980 12188 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 12986 12192 gene locus_tag LOCUS_04990 12986 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 14215 12986 gene locus_tag LOCUS_05000 14215 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 14607 15299 gene locus_tag LOCUS_05010 14607 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0032 811 1623 gene locus_tag LOCUS_05020 811 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 1706 3748 gene locus_tag LOCUS_05030 1706 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4550 3768 gene locus_tag LOCUS_05040 4550 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4715 5788 gene locus_tag LOCUS_05050 gene exoA 4715 5788 CDS product succinoglycan biosynthesis protein exoa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_05050 6437 5793 gene locus_tag LOCUS_05060 6437 5793 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_05060 6536 7507 gene locus_tag LOCUS_05070 6536 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9541 7514 gene locus_tag LOCUS_05080 9541 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9543 9761 gene locus_tag LOCUS_05090 9543 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9884 11050 gene locus_tag LOCUS_05100 9884 11050 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_05100 11126 12961 gene locus_tag LOCUS_05110 11126 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13088 15154 gene locus_tag LOCUS_05120 13088 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence0033 1273 233 gene locus_tag LOCUS_05130 gene gapA 1273 233 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP4 protein_id gnl|my_center|LOCUS_05130 1548 3377 gene locus_tag LOCUS_05140 1548 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3374 4732 gene locus_tag LOCUS_05150 3374 4732 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_05150 5005 5742 gene locus_tag LOCUS_05160 5005 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5929 6447 gene locus_tag LOCUS_05170 5929 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6541 7314 gene locus_tag LOCUS_05180 6541 7314 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_05180 7327 7617 gene locus_tag LOCUS_05190 7327 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7852 8196 gene locus_tag LOCUS_05200 7852 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9779 8217 gene locus_tag LOCUS_05210 9779 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10426 9707 gene locus_tag LOCUS_05220 10426 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10694 10527 gene locus_tag LOCUS_05230 10694 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12423 11002 gene locus_tag LOCUS_05240 12423 11002 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_05240 12676 14883 gene locus_tag LOCUS_05250 12676 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence0034 1426 272 gene locus_tag LOCUS_05260 1426 272 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_05260 1884 1519 gene locus_tag LOCUS_05270 1884 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2396 2047 gene locus_tag LOCUS_tm00010 2396 2047 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3421 2480 gene locus_tag LOCUS_05280 3421 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4569 3523 gene locus_tag LOCUS_05290 gene lpxK 4569 3523 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_05290 5889 4573 gene locus_tag LOCUS_05300 gene kdtA 5889 4573 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_05300 6241 6906 gene locus_tag LOCUS_05310 6241 6906 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_05310 6903 7451 gene locus_tag LOCUS_05320 6903 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7448 8296 gene locus_tag LOCUS_05330 7448 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 8367 9587 gene locus_tag LOCUS_05340 gene pulF 8367 9587 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_05340 9606 11237 gene locus_tag LOCUS_05350 gene pulE 9606 11237 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_05350 11245 12180 gene locus_tag LOCUS_05360 11245 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12182 13540 gene locus_tag LOCUS_05370 12182 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 13537 14256 gene locus_tag LOCUS_05380 13537 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 14253 14687 gene locus_tag LOCUS_05390 14253 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0035 144 758 gene locus_tag LOCUS_05400 gene rimM 144 758 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZK8 protein_id gnl|my_center|LOCUS_05400 740 1525 gene locus_tag LOCUS_05410 gene trmD 740 1525 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_05410 1622 1969 gene locus_tag LOCUS_05420 gene rplS 1622 1969 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_05420 2079 2828 gene locus_tag LOCUS_05430 2079 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2828 5911 gene locus_tag LOCUS_05440 2828 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 6026 7120 gene locus_tag LOCUS_05450 6026 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 7187 8197 gene locus_tag LOCUS_05460 7187 8197 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_05460 8210 9568 gene locus_tag LOCUS_05470 gene rarA 8210 9568 CDS product recombinase RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101460.1 protein_id gnl|my_center|LOCUS_05470 10136 9582 gene locus_tag LOCUS_05480 10136 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10439 13654 gene locus_tag LOCUS_05490 10439 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_05490 14345 13659 gene locus_tag LOCUS_05500 14345 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 14718 14371 gene locus_tag LOCUS_05510 gene spoIIAA 14718 14371 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_05510 >Feature sequence0036 642 1742 gene locus_tag LOCUS_05520 642 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1739 3337 gene locus_tag LOCUS_05530 1739 3337 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_05530 3334 4764 gene locus_tag LOCUS_05540 3334 4764 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05540 4851 6266 gene locus_tag LOCUS_05550 4851 6266 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_05550 6266 7123 gene locus_tag LOCUS_05560 6266 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140506.1 protein_id gnl|my_center|LOCUS_05560 7120 8142 gene locus_tag LOCUS_05570 7120 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 9381 8446 gene locus_tag LOCUS_05580 9381 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 12252 9592 gene locus_tag LOCUS_05590 12252 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12994 12260 gene locus_tag LOCUS_05600 12994 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_05600 13543 13004 gene locus_tag LOCUS_05610 13543 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 <14280 13587 gene locus_tag LOCUS_05620 <14280 13587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000536473.1:hemolysin >Feature sequence0037 67 474 gene locus_tag LOCUS_05630 67 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 503 2104 gene locus_tag LOCUS_05640 503 2104 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_05640 2574 2101 gene locus_tag LOCUS_05650 2574 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2791 2585 gene locus_tag LOCUS_05660 2791 2585 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564132.1 protein_id gnl|my_center|LOCUS_05660 5871 2869 gene locus_tag LOCUS_05670 5871 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6010 7833 gene locus_tag LOCUS_05680 6010 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8129 10291 gene locus_tag LOCUS_05690 8129 10291 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_05690 11524 10436 gene locus_tag LOCUS_05700 11524 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14202 11710 gene locus_tag LOCUS_05710 14202 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence0038 2251 1553 gene locus_tag LOCUS_05720 2251 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_05720 2382 3608 gene locus_tag LOCUS_05730 2382 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3730 4716 gene locus_tag LOCUS_05740 3730 4716 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_05740 4724 5206 gene locus_tag LOCUS_05750 4724 5206 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_05750 5626 6546 gene locus_tag LOCUS_05760 5626 6546 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_05760 8490 6751 gene locus_tag LOCUS_05770 8490 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8769 9182 gene locus_tag LOCUS_05780 8769 9182 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_05780 9280 10173 gene locus_tag LOCUS_05790 9280 10173 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_05790 10230 11786 gene locus_tag LOCUS_05800 10230 11786 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_05800 11806 12723 gene locus_tag LOCUS_05810 11806 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 13151 12828 gene locus_tag LOCUS_05820 13151 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <14160 13512 gene locus_tag LOCUS_05830 <14160 13512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEG2:protease >Feature sequence0039 1118 2299 gene locus_tag LOCUS_05840 1118 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2561 7294 gene locus_tag LOCUS_05850 2561 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7619 8317 gene locus_tag LOCUS_05860 7619 8317 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_05860 9676 8330 gene locus_tag LOCUS_05870 9676 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 11415 9673 gene locus_tag LOCUS_05880 11415 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 12398 11412 gene locus_tag LOCUS_05890 12398 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 13205 12405 gene locus_tag LOCUS_05900 13205 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 14150 13221 gene locus_tag LOCUS_05910 14150 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0040 1306 527 gene locus_tag LOCUS_05920 1306 527 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931384.1 protein_id gnl|my_center|LOCUS_05920 2129 1335 gene locus_tag LOCUS_05930 2129 1335 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085429.1 protein_id gnl|my_center|LOCUS_05930 3322 2126 gene locus_tag LOCUS_05940 3322 2126 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918398.1 protein_id gnl|my_center|LOCUS_05940 4244 3441 gene locus_tag LOCUS_05950 4244 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5324 4440 gene locus_tag LOCUS_05960 5324 4440 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_05960 6967 5321 gene locus_tag LOCUS_05970 6967 5321 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_05970 8582 6969 gene locus_tag LOCUS_05980 8582 6969 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_05980 9054 10238 gene locus_tag LOCUS_05990 9054 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 10612 13299 gene locus_tag LOCUS_06000 10612 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence0041 1804 3441 gene locus_tag LOCUS_06010 1804 3441 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_06010 3758 4309 gene locus_tag LOCUS_06020 3758 4309 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_06020 4319 6883 gene locus_tag LOCUS_06030 4319 6883 CDS product exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941123.1 protein_id gnl|my_center|LOCUS_06030 6880 7254 gene locus_tag LOCUS_06040 6880 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7882 7571 gene locus_tag LOCUS_06050 7882 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9594 7885 gene locus_tag LOCUS_06060 9594 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 11544 10144 gene locus_tag LOCUS_06070 gene fumC 11544 10144 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP7 protein_id gnl|my_center|LOCUS_06070 11968 12672 gene locus_tag LOCUS_06080 11968 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence0042 <1 1101 gene locus_tag LOCUS_06090 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228968.1:serine protease 1329 2450 gene locus_tag LOCUS_06100 1329 2450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_06100 2447 4132 gene locus_tag LOCUS_06110 2447 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4129 5250 gene locus_tag LOCUS_06120 4129 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6025 5267 gene locus_tag LOCUS_06130 6025 5267 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_06130 7188 6022 gene locus_tag LOCUS_06140 7188 6022 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_06140 7292 8131 gene locus_tag LOCUS_06150 7292 8131 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_06150 9206 8235 gene locus_tag LOCUS_06160 9206 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10667 9456 gene locus_tag LOCUS_06170 10667 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 11155 10664 gene locus_tag LOCUS_06180 11155 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 11314 12123 gene locus_tag LOCUS_06190 gene trmJ 11314 12123 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_06190 12890 12129 gene locus_tag LOCUS_06200 12890 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence0043 1069 536 gene locus_tag LOCUS_06210 1069 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1346 4135 gene locus_tag LOCUS_06220 1346 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06220 4192 5574 gene locus_tag LOCUS_06230 gene pilR 4192 5574 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_06230 8465 5592 gene locus_tag LOCUS_06240 8465 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10433 8895 gene locus_tag LOCUS_06250 gene merA 10433 8895 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_06250 11185 10430 gene locus_tag LOCUS_06260 11185 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 11633 12961 gene locus_tag LOCUS_06270 11633 12961 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0044 3258 4058 gene locus_tag LOCUS_06280 3258 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4615 4235 gene locus_tag LOCUS_06290 4615 4235 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_06290 5335 4625 gene locus_tag LOCUS_06300 5335 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6222 5332 gene locus_tag LOCUS_06310 6222 5332 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_06310 6448 6861 gene locus_tag LOCUS_06320 6448 6861 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_06320 6854 8416 gene locus_tag LOCUS_06330 6854 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9028 8498 gene locus_tag LOCUS_06340 9028 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 12246 9046 gene locus_tag LOCUS_06350 12246 9046 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706761.1 protein_id gnl|my_center|LOCUS_06350 <13487 12246 gene locus_tag LOCUS_06360 <13487 12246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:RND transporter >Feature sequence0045 2592 814 gene locus_tag LOCUS_06370 2592 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06370 2871 3734 gene locus_tag LOCUS_06380 2871 3734 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_06380 3746 4189 gene locus_tag LOCUS_06390 3746 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4186 4965 gene locus_tag LOCUS_06400 4186 4965 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_06400 5053 5979 gene locus_tag LOCUS_06410 5053 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7094 6000 gene locus_tag LOCUS_06420 7094 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_06420 7233 7562 gene locus_tag LOCUS_06430 gene clpS 7233 7562 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWS9 protein_id gnl|my_center|LOCUS_06430 7570 9906 gene locus_tag LOCUS_06440 gene clpA 7570 9906 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_06440 10851 10219 gene locus_tag LOCUS_06450 10851 10219 CDS product lipoprotein, RlpA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546239.1 protein_id gnl|my_center|LOCUS_06450 11036 12619 gene locus_tag LOCUS_06460 11036 12619 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0046 2722 3624 gene locus_tag LOCUS_06470 2722 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3621 8495 gene locus_tag LOCUS_06480 3621 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8716 11169 gene locus_tag LOCUS_06490 8716 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11166 11543 gene locus_tag LOCUS_06500 11166 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence0047 1072 275 gene locus_tag LOCUS_06510 1072 275 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 protein_id gnl|my_center|LOCUS_06510 3364 1076 gene locus_tag LOCUS_06520 3364 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4269 3364 gene locus_tag LOCUS_06530 4269 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5714 4347 gene locus_tag LOCUS_06540 5714 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 5911 7359 gene locus_tag LOCUS_06550 5911 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 9079 7394 gene locus_tag LOCUS_06560 9079 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9230 9679 gene locus_tag LOCUS_06570 9230 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 9693 10643 gene locus_tag LOCUS_06580 gene metF 9693 10643 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_06580 10670 12055 gene locus_tag LOCUS_06590 gene dacB 10670 12055 CDS product peptidase S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence0048 507 1199 gene locus_tag LOCUS_06600 507 1199 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_06600 1196 2170 gene locus_tag LOCUS_06610 1196 2170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_06610 2160 3749 gene locus_tag LOCUS_06620 2160 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3746 4867 gene locus_tag LOCUS_06630 3746 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4864 5931 gene locus_tag LOCUS_06640 4864 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_06640 5931 7307 gene locus_tag LOCUS_06650 5931 7307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268797.1 protein_id gnl|my_center|LOCUS_06650 7334 7984 gene locus_tag LOCUS_06660 7334 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 10516 8003 gene locus_tag LOCUS_06670 10516 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0049 800 1648 gene locus_tag LOCUS_06680 800 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1755 2780 gene locus_tag LOCUS_06690 gene ltaE 1755 2780 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_06690 2777 4006 gene locus_tag LOCUS_06700 2777 4006 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_06700 4003 4527 gene locus_tag LOCUS_06710 4003 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4606 5493 gene locus_tag LOCUS_06720 4606 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8897 5577 gene locus_tag LOCUS_06730 8897 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence0050 1269 667 gene locus_tag LOCUS_06740 gene atpH 1269 667 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_06740 1914 1321 gene locus_tag LOCUS_06750 gene atpF 1914 1321 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S434 protein_id gnl|my_center|LOCUS_06750 2388 2071 gene locus_tag LOCUS_06760 2388 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3411 2551 gene locus_tag LOCUS_06770 gene atpB 3411 2551 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_06770 3875 3408 gene locus_tag LOCUS_06780 3875 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4444 5046 gene locus_tag LOCUS_06790 gene sigR 4444 5046 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_06790 5059 5292 gene locus_tag LOCUS_06800 5059 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6703 5372 gene locus_tag LOCUS_06810 6703 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 8354 6777 gene locus_tag LOCUS_06820 8354 6777 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_06820 8520 9452 gene locus_tag LOCUS_06830 gene thrB 8520 9452 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_06830 11237 9531 gene locus_tag LOCUS_06840 gene rpoD 11237 9531 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0051 1162 1392 gene locus_tag LOCUS_06850 1162 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1406 2428 gene locus_tag LOCUS_06860 1406 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_06860 2439 3674 gene locus_tag LOCUS_06870 2439 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4039 4164 gene locus_tag LOCUS_06880 4039 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4171 4326 gene locus_tag LOCUS_06890 4171 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4326 4481 gene locus_tag LOCUS_06900 4326 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5300 7240 gene locus_tag LOCUS_06910 gene cmfA 5300 7240 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_06910 7412 8383 gene locus_tag LOCUS_06920 7412 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_06920 11094 8464 gene locus_tag LOCUS_06930 11094 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 11569 11372 gene locus_tag LOCUS_06940 11569 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence0052 1108 686 gene locus_tag LOCUS_06950 1108 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3981 1570 gene locus_tag LOCUS_06960 gene lon 3981 1570 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL28 protein_id gnl|my_center|LOCUS_06960 5356 4121 gene locus_tag LOCUS_06970 gene clpX 5356 4121 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL30 protein_id gnl|my_center|LOCUS_06970 6106 5507 gene locus_tag LOCUS_06980 gene clpP 6106 5507 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD9 protein_id gnl|my_center|LOCUS_06980 7573 6293 gene locus_tag LOCUS_06990 gene tig 7573 6293 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBY2 protein_id gnl|my_center|LOCUS_06990 7704 7620 gene locus_tag LOCUS_t00080 7704 7620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8051 7976 gene locus_tag LOCUS_t00090 8051 7976 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8413 8189 gene locus_tag LOCUS_07000 8413 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9135 8449 gene locus_tag LOCUS_07010 9135 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9966 9298 gene locus_tag LOCUS_07020 9966 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10757 9963 gene locus_tag LOCUS_07030 gene coaX 10757 9963 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_07030 11578 10781 gene locus_tag LOCUS_07040 11578 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11951 11661 gene locus_tag LOCUS_07050 11951 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0053 626 189 gene locus_tag LOCUS_07060 626 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1346 780 gene locus_tag LOCUS_07070 1346 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1580 4036 gene locus_tag LOCUS_07080 1580 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_07080 4131 4502 gene locus_tag LOCUS_07090 4131 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6042 4513 gene locus_tag LOCUS_07100 6042 4513 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_07100 7840 6053 gene locus_tag LOCUS_07110 7840 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9162 8155 gene locus_tag LOCUS_07120 9162 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9897 9334 gene locus_tag LOCUS_07130 9897 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030373.1 protein_id gnl|my_center|LOCUS_07130 10860 10039 gene locus_tag LOCUS_07140 10860 10039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 protein_id gnl|my_center|LOCUS_07140 11351 10857 gene locus_tag LOCUS_07150 11351 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence0054 288 2984 gene locus_tag LOCUS_07160 gene topA 288 2984 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV5 protein_id gnl|my_center|LOCUS_07160 3219 4124 gene locus_tag LOCUS_07170 3219 4124 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_07170 4126 6867 gene locus_tag LOCUS_07180 4126 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6950 7636 gene locus_tag LOCUS_07190 6950 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7646 8761 gene locus_tag LOCUS_07200 gene mexH 7646 8761 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_07200 8762 11767 gene locus_tag LOCUS_07210 8762 11767 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence0055 1627 4194 gene locus_tag LOCUS_07220 1627 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6646 4289 gene locus_tag LOCUS_07230 6646 4289 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_07230 7158 7520 gene locus_tag LOCUS_07240 7158 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 7755 7564 gene locus_tag LOCUS_07250 7755 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 7667 11167 gene locus_tag LOCUS_07260 7667 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0056 1085 729 gene locus_tag LOCUS_07270 1085 729 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_07270 1612 1166 gene locus_tag LOCUS_07280 1612 1166 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_07280 2238 1609 gene locus_tag LOCUS_07290 2238 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2567 2235 gene locus_tag LOCUS_07300 2567 2235 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_07300 2851 2558 gene locus_tag LOCUS_07310 2851 2558 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_07310 3327 2851 gene locus_tag LOCUS_07320 3327 2851 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_07320 4163 3579 gene locus_tag LOCUS_07330 4163 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5536 4538 gene locus_tag LOCUS_07340 gene gap 5536 4538 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67161 protein_id gnl|my_center|LOCUS_07340 6552 5536 gene locus_tag LOCUS_07350 gene gap 6552 5536 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_07350 7949 6549 gene locus_tag LOCUS_07360 gene pfkA 7949 6549 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXU6 protein_id gnl|my_center|LOCUS_07360 8522 7983 gene locus_tag LOCUS_07370 8522 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8991 8548 gene locus_tag LOCUS_07380 8991 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9538 9230 gene locus_tag LOCUS_07390 9538 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9798 10214 gene locus_tag LOCUS_07400 9798 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 10321 10761 gene locus_tag LOCUS_07410 10321 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence0057 <1 811 gene locus_tag LOCUS_07420 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942875.1:reactive intermediate/imine deaminase 851 2086 gene locus_tag LOCUS_07430 851 2086 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_07430 3803 2178 gene locus_tag LOCUS_07440 3803 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 8277 4381 gene locus_tag LOCUS_07450 8277 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence0058 489 1643 gene locus_tag LOCUS_07460 489 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2162 1659 gene locus_tag LOCUS_07470 2162 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4534 2159 gene locus_tag LOCUS_07480 4534 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5837 4569 gene locus_tag LOCUS_07490 gene murA 5837 4569 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q84 protein_id gnl|my_center|LOCUS_07490 6185 7264 gene locus_tag LOCUS_07500 gene ascD 6185 7264 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_07500 7775 7356 gene locus_tag LOCUS_07510 7775 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7849 8247 gene locus_tag LOCUS_07520 7849 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07520 8244 8990 gene locus_tag LOCUS_07530 8244 8990 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385607.1 protein_id gnl|my_center|LOCUS_07530 8987 9949 gene locus_tag LOCUS_07540 gene oppB 8987 9949 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880275.1 protein_id gnl|my_center|LOCUS_07540 9961 10908 gene locus_tag LOCUS_07550 9961 10908 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence0059 2417 1101 gene locus_tag LOCUS_07560 2417 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3297 2713 gene locus_tag LOCUS_07570 gene tag 3297 2713 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_07570 4445 3294 gene locus_tag LOCUS_07580 4445 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4841 5467 gene locus_tag LOCUS_07590 4841 5467 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_07590 5534 6784 gene locus_tag LOCUS_07600 5534 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9686 6900 gene locus_tag LOCUS_07610 9686 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9905 11461 gene locus_tag LOCUS_07620 9905 11461 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence0060 1925 1449 gene locus_tag LOCUS_07630 1925 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3106 1925 gene locus_tag LOCUS_07640 3106 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3336 3097 gene locus_tag LOCUS_07650 3336 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4379 3333 gene locus_tag LOCUS_07660 gene apbE 4379 3333 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_07660 5098 6951 gene locus_tag LOCUS_07670 5098 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7031 7837 gene locus_tag LOCUS_07680 7031 7837 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 protein_id gnl|my_center|LOCUS_07680 7974 10238 gene locus_tag LOCUS_07690 7974 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0061 557 273 gene locus_tag LOCUS_07700 557 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1066 569 gene locus_tag LOCUS_07710 1066 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1903 1208 gene locus_tag LOCUS_07720 gene yggS 1903 1208 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_07720 2692 1931 gene locus_tag LOCUS_07730 2692 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2814 2741 gene locus_tag LOCUS_t00100 2814 2741 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4333 2909 gene locus_tag LOCUS_07740 4333 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6548 4383 gene locus_tag LOCUS_07750 6548 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6819 7640 gene locus_tag LOCUS_07760 6819 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 7884 8093 gene locus_tag LOCUS_07770 gene rpsU 7884 8093 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKU0 protein_id gnl|my_center|LOCUS_07770 8292 10775 gene locus_tag LOCUS_07780 gene mutS2 8292 10775 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FQ9 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0062 1860 577 gene locus_tag LOCUS_07790 gene erg3 1860 577 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162077.1 protein_id gnl|my_center|LOCUS_07790 1905 2957 gene locus_tag LOCUS_07800 1905 2957 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_07800 2954 3493 gene locus_tag LOCUS_07810 2954 3493 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_07810 3493 4788 gene locus_tag LOCUS_07820 3493 4788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_07820 4791 5504 gene locus_tag LOCUS_07830 4791 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5501 6259 gene locus_tag LOCUS_07840 5501 6259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_07840 6264 7046 gene locus_tag LOCUS_07850 gene soj 6264 7046 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_07850 7063 7620 gene locus_tag LOCUS_07860 7063 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7739 8254 gene locus_tag LOCUS_07870 gene ppiB 7739 8254 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_07870 8479 9876 gene locus_tag LOCUS_07880 8479 9876 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_07880 11359 9899 gene locus_tag LOCUS_07890 11359 9899 CDS product ovoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119824.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0063 3233 897 gene locus_tag LOCUS_07900 3233 897 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NC2 protein_id gnl|my_center|LOCUS_07900 3656 3243 gene locus_tag LOCUS_07910 3656 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3743 4225 gene locus_tag LOCUS_07920 3743 4225 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_07920 4854 4216 gene locus_tag LOCUS_07930 4854 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5317 4970 gene locus_tag LOCUS_07940 5317 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5615 6763 gene locus_tag LOCUS_07950 5615 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7817 6771 gene locus_tag LOCUS_07960 7817 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8282 7848 gene locus_tag LOCUS_07970 8282 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 8893 8456 gene locus_tag LOCUS_07980 gene dut 8893 8456 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_07980 9792 8890 gene locus_tag LOCUS_07990 9792 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 10259 9786 gene locus_tag LOCUS_08000 gene oxpG 10259 9786 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_08000 10773 10288 gene locus_tag LOCUS_08010 gene pulG 10773 10288 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_08010 <11629 10907 gene locus_tag LOCUS_08020 <11629 10907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478663.1:type II secretion system protein GspD >Feature sequence0064 <1 1013 gene locus_tag LOCUS_08030 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403563.1:amidohydrolase 1027 1260 gene locus_tag LOCUS_08040 gene mbtH 1027 1260 CDS product MbtH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224966.1 protein_id gnl|my_center|LOCUS_08040 1379 2524 gene locus_tag LOCUS_08050 1379 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2565 3740 gene locus_tag LOCUS_08060 2565 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4535 3744 gene locus_tag LOCUS_08070 4535 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4726 6159 gene locus_tag LOCUS_08080 4726 6159 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_08080 7438 6101 gene locus_tag LOCUS_08090 7438 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9507 7516 gene locus_tag LOCUS_08100 9507 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9851 11431 gene locus_tag LOCUS_08110 9851 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0065 2 643 gene locus_tag LOCUS_08120 2 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 640 1317 gene locus_tag LOCUS_08130 640 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1357 3309 gene locus_tag LOCUS_08140 1357 3309 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08140 3411 3776 gene locus_tag LOCUS_08150 3411 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7414 3986 gene locus_tag LOCUS_08160 7414 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 8043 7510 gene locus_tag LOCUS_08170 8043 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8256 9596 gene locus_tag LOCUS_08180 8256 9596 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_08180 11192 9690 gene locus_tag LOCUS_08190 11192 9690 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817F4 protein_id gnl|my_center|LOCUS_08190 11474 11202 gene locus_tag LOCUS_08200 11474 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0066 1601 2122 gene locus_tag LOCUS_08210 1601 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2508 2999 gene locus_tag LOCUS_08220 2508 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3008 4705 gene locus_tag LOCUS_08230 3008 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5088 5699 gene locus_tag LOCUS_08240 5088 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5738 6655 gene locus_tag LOCUS_08250 5738 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6929 7624 gene locus_tag LOCUS_08260 6929 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 7662 9047 gene locus_tag LOCUS_08270 7662 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9044 9799 gene locus_tag LOCUS_08280 9044 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence0067 547 323 gene locus_tag LOCUS_08290 547 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1944 544 gene locus_tag LOCUS_08300 1944 544 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y1 protein_id gnl|my_center|LOCUS_08300 2537 2001 gene locus_tag LOCUS_08310 2537 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2854 5871 gene locus_tag LOCUS_08320 2854 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6570 5887 gene locus_tag LOCUS_08330 6570 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8589 6592 gene locus_tag LOCUS_08340 8589 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 10266 8827 gene locus_tag LOCUS_08350 gene mpl 10266 8827 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_08350 10503 11510 gene locus_tag LOCUS_08360 10503 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence0068 1386 82 gene locus_tag LOCUS_08370 1386 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2699 1383 gene locus_tag LOCUS_08380 2699 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2683 2910 gene locus_tag LOCUS_08390 2683 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2907 4487 gene locus_tag LOCUS_08400 2907 4487 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_08400 4511 4960 gene locus_tag LOCUS_08410 gene rpiB 4511 4960 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_08410 5022 6275 gene locus_tag LOCUS_08420 5022 6275 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_08420 6259 7572 gene locus_tag LOCUS_08430 gene folC 6259 7572 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_08430 8638 7577 gene locus_tag LOCUS_08440 8638 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9884 8619 gene locus_tag LOCUS_08450 9884 8619 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_08450 10751 9897 gene locus_tag LOCUS_08460 gene accD 10751 9897 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_08460 11089 10862 gene locus_tag LOCUS_08470 11089 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence0069 1206 2039 gene locus_tag LOCUS_08480 1206 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2032 4536 gene locus_tag LOCUS_08490 2032 4536 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_08490 4611 5096 gene locus_tag LOCUS_08500 4611 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 protein_id gnl|my_center|LOCUS_08500 6374 5142 gene locus_tag LOCUS_08510 6374 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6719 6644 gene locus_tag LOCUS_t00110 6719 6644 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8114 6837 gene locus_tag LOCUS_08520 8114 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8264 8872 gene locus_tag LOCUS_08530 8264 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9470 8955 gene locus_tag LOCUS_08540 9470 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9720 10604 gene locus_tag LOCUS_08550 9720 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence0070 2974 3474 gene locus_tag LOCUS_08560 2974 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5690 3465 gene locus_tag LOCUS_08570 5690 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6009 7325 gene locus_tag LOCUS_08580 gene pepT 6009 7325 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KND3 protein_id gnl|my_center|LOCUS_08580 8771 7371 gene locus_tag LOCUS_08590 gene dltB 8771 7371 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_08590 9039 8794 gene locus_tag LOCUS_08600 9039 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8929 10128 gene locus_tag LOCUS_08610 8929 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0071 <1 1306 gene locus_tag LOCUS_08620 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator 1353 3434 gene locus_tag LOCUS_08630 gene btuB 1353 3434 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_08630 3512 5938 gene locus_tag LOCUS_08640 3512 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5935 6906 gene locus_tag LOCUS_08650 5935 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6942 8396 gene locus_tag LOCUS_08660 6942 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9806 8418 gene locus_tag LOCUS_08670 9806 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9765 10040 gene locus_tag LOCUS_08680 9765 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence0072 500 1408 gene locus_tag LOCUS_08690 500 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1628 8185 gene locus_tag LOCUS_08700 1628 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 8459 9151 gene locus_tag LOCUS_08710 8459 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10285 9347 gene locus_tag LOCUS_08720 10285 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11067 10483 gene locus_tag LOCUS_08730 11067 10483 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0073 1681 665 gene locus_tag LOCUS_08740 1681 665 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_08740 2814 1861 gene locus_tag LOCUS_08750 2814 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3899 2811 gene locus_tag LOCUS_08760 3899 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6204 3973 gene locus_tag LOCUS_08770 6204 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 7591 6353 gene locus_tag LOCUS_08780 7591 6353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_08780 9249 7588 gene locus_tag LOCUS_08790 9249 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 <11070 9246 gene locus_tag LOCUS_08800 <11070 9246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546208.1:membrane protein >Feature sequence0074 824 2257 gene locus_tag LOCUS_08810 824 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3502 2264 gene locus_tag LOCUS_08820 3502 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5048 3579 gene locus_tag LOCUS_08830 gene dacB 5048 3579 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_08830 6705 5101 gene locus_tag LOCUS_08840 6705 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 6991 7935 gene locus_tag LOCUS_08850 6991 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 8212 8793 gene locus_tag LOCUS_08860 8212 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8951 10132 gene locus_tag LOCUS_08870 gene nhaA 8951 10132 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 protein_id gnl|my_center|LOCUS_08870 11064 10120 gene locus_tag LOCUS_08880 11064 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence0075 60 266 gene locus_tag LOCUS_08890 60 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 301 3159 gene locus_tag LOCUS_08900 301 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3176 4513 gene locus_tag LOCUS_08910 3176 4513 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_08910 7331 4527 gene locus_tag LOCUS_08920 gene uvrA2 7331 4527 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF05 protein_id gnl|my_center|LOCUS_08920 7481 9268 gene locus_tag LOCUS_08930 7481 9268 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0076 <1 1540 gene locus_tag LOCUS_08940 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHM1:aconitate hydratase 1751 2200 gene locus_tag LOCUS_08950 gene queD 1751 2200 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_08950 2237 2956 gene locus_tag LOCUS_08960 gene queE 2237 2956 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_08960 2997 4574 gene locus_tag LOCUS_08970 2997 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_08970 6909 4588 gene locus_tag LOCUS_08980 6909 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9236 6906 gene locus_tag LOCUS_08990 9236 6906 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941298.1 protein_id gnl|my_center|LOCUS_08990 9356 10225 gene locus_tag LOCUS_09000 9356 10225 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0077 129 1634 gene locus_tag LOCUS_09010 gene gatA 129 1634 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF0 protein_id gnl|my_center|LOCUS_09010 1624 3510 gene locus_tag LOCUS_09020 1624 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3642 4262 gene locus_tag LOCUS_09030 gene rpoE 3642 4262 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_09030 4262 4945 gene locus_tag LOCUS_09040 4262 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7250 4986 gene locus_tag LOCUS_09050 7250 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8752 7334 gene locus_tag LOCUS_09060 8752 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9830 8757 gene locus_tag LOCUS_09070 9830 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence0078 1398 67 gene locus_tag LOCUS_09080 1398 67 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_09080 1732 1442 gene locus_tag LOCUS_09090 1732 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2063 3109 gene locus_tag LOCUS_09100 2063 3109 CDS product rhizopine catabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_09100 5032 3146 gene locus_tag LOCUS_09110 gene phoR 5032 3146 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_09110 5733 5029 gene locus_tag LOCUS_09120 gene phoB 5733 5029 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_09120 6558 5902 gene locus_tag LOCUS_09130 gene phoU 6558 5902 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_09130 8389 6782 gene locus_tag LOCUS_09140 8389 6782 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_09140 8972 8421 gene locus_tag LOCUS_09150 8972 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9253 10752 gene locus_tag LOCUS_09160 9253 10752 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0079 1288 38 gene locus_tag LOCUS_09170 1288 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2156 1305 gene locus_tag LOCUS_09180 2156 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_09180 3222 2599 gene locus_tag LOCUS_09190 3222 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4649 3219 gene locus_tag LOCUS_09200 4649 3219 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_09200 5467 4646 gene locus_tag LOCUS_09210 5467 4646 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_09210 5786 5448 gene locus_tag LOCUS_09220 5786 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7397 5787 gene locus_tag LOCUS_09230 gene prnC 7397 5787 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_09230 8349 7390 gene locus_tag LOCUS_09240 8349 7390 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118476.1 protein_id gnl|my_center|LOCUS_09240 9678 8356 gene locus_tag LOCUS_09250 9678 8356 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_09250 10165 9815 gene locus_tag LOCUS_09260 10165 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0080 1070 3130 gene locus_tag LOCUS_09270 1070 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4212 3208 gene locus_tag LOCUS_09280 4212 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4623 4288 gene locus_tag LOCUS_09290 4623 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4856 4620 gene locus_tag LOCUS_09300 4856 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4956 5645 gene locus_tag LOCUS_09310 4956 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5638 6438 gene locus_tag LOCUS_09320 5638 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6444 7247 gene locus_tag LOCUS_09330 6444 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10259 7377 gene locus_tag LOCUS_09340 10259 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0081 1 396 gene locus_tag LOCUS_09350 1 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1611 430 gene locus_tag LOCUS_09360 1611 430 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_09360 5386 1697 gene locus_tag LOCUS_09370 5386 1697 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037971.1 protein_id gnl|my_center|LOCUS_09370 6116 5511 gene locus_tag LOCUS_09380 6116 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8092 6113 gene locus_tag LOCUS_09390 8092 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8310 9491 gene locus_tag LOCUS_09400 8310 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0082 644 261 gene locus_tag LOCUS_09410 644 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1021 2142 gene locus_tag LOCUS_09420 1021 2142 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_09420 2139 3536 gene locus_tag LOCUS_09430 2139 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 3561 5270 gene locus_tag LOCUS_09440 3561 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09440 5493 5248 gene locus_tag LOCUS_09450 5493 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5447 7486 gene locus_tag LOCUS_09460 5447 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7632 7708 gene locus_tag LOCUS_t00120 7632 7708 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7774 7850 gene locus_tag LOCUS_t00130 7774 7850 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7966 9903 gene locus_tag LOCUS_09470 gene thrS 7966 9903 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L8 protein_id gnl|my_center|LOCUS_09470 10021 10215 gene locus_tag LOCUS_09480 gene rpmI 10021 10215 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55874 protein_id gnl|my_center|LOCUS_09480 >Feature sequence0083 1006 2223 gene locus_tag LOCUS_09490 1006 2223 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_09490 2240 2881 gene locus_tag LOCUS_09500 gene tmk 2240 2881 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_09500 2878 3750 gene locus_tag LOCUS_09510 2878 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4047 4604 gene locus_tag LOCUS_09520 4047 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5211 4615 gene locus_tag LOCUS_09530 gene coaE 5211 4615 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD46 protein_id gnl|my_center|LOCUS_09530 6152 5208 gene locus_tag LOCUS_09540 gene folD 6152 5208 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8C5 protein_id gnl|my_center|LOCUS_09540 6450 6899 gene locus_tag LOCUS_09550 gene rplM 6450 6899 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y8 protein_id gnl|my_center|LOCUS_09550 6946 7338 gene locus_tag LOCUS_09560 gene rpsI 6946 7338 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW8 protein_id gnl|my_center|LOCUS_09560 7352 8149 gene locus_tag LOCUS_09570 gene rpsB 7352 8149 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_09570 8352 9005 gene locus_tag LOCUS_09580 gene tsf 8352 9005 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_09580 9014 9733 gene locus_tag LOCUS_09590 gene pyrH 9014 9733 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_09590 9764 10504 gene locus_tag LOCUS_09600 gene frr 9764 10504 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T15 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0084 1760 180 gene locus_tag LOCUS_09610 gene paaZ 1760 180 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_09610 2462 1842 gene locus_tag LOCUS_09620 gene ppiA 2462 1842 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E8 protein_id gnl|my_center|LOCUS_09620 2917 5433 gene locus_tag LOCUS_09630 2917 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5526 6992 gene locus_tag LOCUS_09640 5526 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6992 7792 gene locus_tag LOCUS_09650 gene phnC 6992 7792 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB5 protein_id gnl|my_center|LOCUS_09650 7826 8926 gene locus_tag LOCUS_09660 7826 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence0085 2396 3280 gene locus_tag LOCUS_09670 2396 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4620 3577 gene locus_tag LOCUS_09680 4620 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4762 5448 gene locus_tag LOCUS_09690 4762 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5890 6591 gene locus_tag LOCUS_09700 5890 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7309 6668 gene locus_tag LOCUS_09710 7309 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7502 8134 gene locus_tag LOCUS_09720 7502 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 <10436 8167 gene locus_tag LOCUS_09730 <10436 8167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140588.1:serine/threonine protein kinase >Feature sequence0086 3267 145 gene locus_tag LOCUS_09740 3267 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2850 2936 gene locus_tag LOCUS_t00140 2850 2936 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3550 4650 gene locus_tag LOCUS_09750 3550 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5333 4764 gene locus_tag LOCUS_09760 5333 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6855 5416 gene locus_tag LOCUS_09770 6855 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7077 7670 gene locus_tag LOCUS_09780 7077 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7657 8655 gene locus_tag LOCUS_09790 7657 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8924 8700 gene locus_tag LOCUS_09800 8924 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <10431 9298 gene locus_tag LOCUS_09810 <10431 9298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140055.1:Na+ ABC transporter permease >Feature sequence0087 752 980 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggcggcgggggcgacctcttc 1523 2086 gene locus_tag LOCUS_09820 1523 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2140 2619 gene locus_tag LOCUS_09830 2140 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3509 2709 gene locus_tag LOCUS_09840 3509 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3466 4245 gene locus_tag LOCUS_09850 3466 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5164 4250 gene locus_tag LOCUS_09860 5164 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7305 5164 gene locus_tag LOCUS_09870 7305 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7485 8228 gene locus_tag LOCUS_09880 gene ate 7485 8228 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0088 313 1107 gene locus_tag LOCUS_09890 313 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1156 1422 gene locus_tag LOCUS_09900 1156 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1419 2435 gene locus_tag LOCUS_09910 1419 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2922 3248 gene locus_tag LOCUS_09920 2922 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4754 3300 gene locus_tag LOCUS_09930 4754 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5700 4861 gene locus_tag LOCUS_09940 5700 4861 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_09940 9155 5829 gene locus_tag LOCUS_09950 9155 5829 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_09950 <10369 9152 gene locus_tag LOCUS_09960 <10369 9152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403253.1:RND transporter >Feature sequence0089 892 1410 gene locus_tag LOCUS_09970 gene nrdR 892 1410 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZG2 protein_id gnl|my_center|LOCUS_09970 1522 4116 gene locus_tag LOCUS_09980 gene lon 1522 4116 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_09980 4094 5101 gene locus_tag LOCUS_09990 gene thiL 4094 5101 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM5 protein_id gnl|my_center|LOCUS_09990 5922 5182 gene locus_tag LOCUS_10000 5922 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9816 6472 gene locus_tag LOCUS_10010 9816 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10343 9813 gene locus_tag LOCUS_10020 10343 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence0090 2103 1702 gene locus_tag LOCUS_10030 2103 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2342 3112 gene locus_tag LOCUS_10040 gene wzm 2342 3112 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_10040 3293 5026 gene locus_tag LOCUS_10050 3293 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5595 6890 gene locus_tag LOCUS_10060 5595 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 7368 10193 gene locus_tag LOCUS_10070 7368 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence0091 3538 1853 gene locus_tag LOCUS_10080 3538 1853 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_10080 3660 4046 gene locus_tag LOCUS_10090 3660 4046 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_10090 4043 5098 gene locus_tag LOCUS_10100 4043 5098 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_10100 5260 7581 gene locus_tag LOCUS_10110 5260 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7726 8613 gene locus_tag LOCUS_10120 7726 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 8634 10001 gene locus_tag LOCUS_10130 8634 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0092 <1 788 gene locus_tag LOCUS_10140 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272563.1:cobalamin synthesis protein P47K 821 1240 gene locus_tag LOCUS_10150 821 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1243 2109 gene locus_tag LOCUS_10160 1243 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2191 3918 gene locus_tag LOCUS_10170 2191 3918 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_10170 3878 4759 gene locus_tag LOCUS_10180 3878 4759 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_10180 4992 6785 gene locus_tag LOCUS_10190 gene shc 4992 6785 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_10190 6995 8725 gene locus_tag LOCUS_10200 6995 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9098 10045 gene locus_tag LOCUS_10210 9098 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0093 918 667 gene locus_tag LOCUS_10220 918 667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435988.1 protein_id gnl|my_center|LOCUS_10220 2414 1269 gene locus_tag LOCUS_10230 2414 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3466 4617 gene locus_tag LOCUS_10240 3466 4617 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_10240 4617 5027 gene locus_tag LOCUS_10250 4617 5027 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_10250 5472 5044 gene locus_tag LOCUS_10260 5472 5044 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 protein_id gnl|my_center|LOCUS_10260 5543 7642 gene locus_tag LOCUS_10270 gene glgX2 5543 7642 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U64 protein_id gnl|my_center|LOCUS_10270 7761 8726 gene locus_tag LOCUS_10280 gene glk 7761 8726 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_10280 >Feature sequence0094 <1 858 gene locus_tag LOCUS_10290 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142791.1:glycosyl transferase 959 2236 gene locus_tag LOCUS_10300 959 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3310 2321 gene locus_tag LOCUS_10310 3310 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4166 3432 gene locus_tag LOCUS_10320 4166 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4279 6573 gene locus_tag LOCUS_10330 gene maeB 4279 6573 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_10330 6771 7376 gene locus_tag LOCUS_10340 6771 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 7521 8342 gene locus_tag LOCUS_10350 7521 8342 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_10350 8352 9620 gene locus_tag LOCUS_10360 gene xapH 8352 9620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence0095 809 165 gene locus_tag LOCUS_10370 809 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1597 806 gene locus_tag LOCUS_10380 1597 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3286 1820 gene locus_tag LOCUS_10390 gene dctD 3286 1820 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_10390 3567 3908 gene locus_tag LOCUS_10400 3567 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_10400 3967 6759 gene locus_tag LOCUS_10410 3967 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 7806 6769 gene locus_tag LOCUS_10420 7806 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0096 <1 1699 gene locus_tag LOCUS_10430 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918869.1:peptidase 2210 1740 gene locus_tag LOCUS_10440 2210 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3706 2603 gene locus_tag LOCUS_10450 gene mnmA 3706 2603 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_10450 5763 3703 gene locus_tag LOCUS_10460 5763 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7661 5853 gene locus_tag LOCUS_10470 7661 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8023 8451 gene locus_tag LOCUS_10480 gene hit 8023 8451 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0097 486 671 gene locus_tag LOCUS_10490 486 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 735 1193 gene locus_tag LOCUS_10500 735 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1401 2015 gene locus_tag LOCUS_10510 1401 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2995 2003 gene locus_tag LOCUS_10520 2995 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5596 3119 gene locus_tag LOCUS_10530 5596 3119 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_10530 5737 6657 gene locus_tag LOCUS_10540 gene exo 5737 6657 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_10540 6727 8166 gene locus_tag LOCUS_10550 6727 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 8163 10040 gene locus_tag LOCUS_10560 8163 10040 CDS product N-acetyl-beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067938.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence0098 30 923 gene locus_tag LOCUS_10570 30 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2603 1005 gene locus_tag LOCUS_10580 2603 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4613 2655 gene locus_tag LOCUS_10590 gene mdlC 4613 2655 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_102164.2 protein_id gnl|my_center|LOCUS_10590 5210 6697 gene locus_tag LOCUS_10600 5210 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6985 8544 gene locus_tag LOCUS_10610 6985 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence0099 293 1498 gene locus_tag LOCUS_10620 293 1498 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_10620 2417 1596 gene locus_tag LOCUS_10630 2417 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3007 2417 gene locus_tag LOCUS_10640 3007 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3502 4791 gene locus_tag LOCUS_10650 3502 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5985 4864 gene locus_tag LOCUS_10660 5985 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6608 6258 gene locus_tag LOCUS_10670 6608 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8182 7343 gene locus_tag LOCUS_10680 8182 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8339 8629 gene locus_tag LOCUS_10690 8339 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9911 8727 gene locus_tag LOCUS_10700 9911 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0100 1328 2680 gene locus_tag LOCUS_10710 1328 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2700 3905 gene locus_tag LOCUS_10720 gene solA 2700 3905 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_10720 4062 4454 gene locus_tag LOCUS_10730 4062 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5438 4473 gene locus_tag LOCUS_10740 gene yhaM 5438 4473 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_10740 5641 8235 gene locus_tag LOCUS_10750 5641 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8237 8986 gene locus_tag LOCUS_10760 8237 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence0101 5401 2087 gene locus_tag LOCUS_10770 5401 2087 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_10770 6909 5563 gene locus_tag LOCUS_10780 gene pyrC 6909 5563 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFD0 protein_id gnl|my_center|LOCUS_10780 7579 6953 gene locus_tag LOCUS_10790 7579 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 <9987 7678 gene locus_tag LOCUS_10800 <9987 7678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18AN9:ATP-dependent helicase/nuclease subunit A >Feature sequence0102 <1 555 gene locus_tag LOCUS_10810 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140945.1:protoporphyrinogen oxidase 607 1560 gene locus_tag LOCUS_10820 gene hemF 607 1560 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_10820 1563 2492 gene locus_tag LOCUS_10830 1563 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_10830 3391 2465 gene locus_tag LOCUS_10840 3391 2465 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_10840 4098 3388 gene locus_tag LOCUS_10850 4098 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5348 4095 gene locus_tag LOCUS_10860 5348 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6120 9068 gene locus_tag LOCUS_10870 gene nrdA 6120 9068 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D561 protein_id gnl|my_center|LOCUS_10870 >Feature sequence0103 1388 585 gene locus_tag LOCUS_10880 1388 585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_10880 1800 2714 gene locus_tag LOCUS_10890 gene ctaB 1800 2714 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_10890 2743 3375 gene locus_tag LOCUS_10900 2743 3375 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 protein_id gnl|my_center|LOCUS_10900 3986 3489 gene locus_tag LOCUS_10910 3986 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5526 4120 gene locus_tag LOCUS_10920 5526 4120 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_10920 7452 5536 gene locus_tag LOCUS_10930 gene ntrC2 7452 5536 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881164.1 protein_id gnl|my_center|LOCUS_10930 7619 7831 gene locus_tag LOCUS_10940 7619 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 8036 8647 gene locus_tag LOCUS_10950 8036 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence0104 619 1881 gene locus_tag LOCUS_10960 gene kynU 619 1881 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 protein_id gnl|my_center|LOCUS_10960 2313 1900 gene locus_tag LOCUS_10970 2313 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4390 2381 gene locus_tag LOCUS_10980 4390 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5445 4387 gene locus_tag LOCUS_10990 5445 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8221 5477 gene locus_tag LOCUS_11000 8221 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9767 8385 gene locus_tag LOCUS_11010 gene gltB2 9767 8385 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0105 2646 685 gene locus_tag LOCUS_11020 2646 685 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_11020 3594 2734 gene locus_tag LOCUS_11030 3594 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4952 3780 gene locus_tag LOCUS_11040 4952 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5374 5736 gene locus_tag LOCUS_11050 5374 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_11050 6244 5831 gene locus_tag LOCUS_11060 6244 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6660 6241 gene locus_tag LOCUS_11070 6660 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_11070 8356 6755 gene locus_tag LOCUS_11080 gene betA 8356 6755 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_11080 8970 8422 gene locus_tag LOCUS_11090 8970 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <9887 9030 gene locus_tag LOCUS_11100 <9887 9030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVC2:ribosome-binding ATPase YchF >Feature sequence0106 1267 401 gene locus_tag LOCUS_11110 gene uppS 1267 401 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRP1 protein_id gnl|my_center|LOCUS_11110 1740 2843 gene locus_tag LOCUS_11120 1740 2843 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_11120 2851 3264 gene locus_tag LOCUS_11130 gene fxsA 2851 3264 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_11130 3974 3282 gene locus_tag LOCUS_11140 3974 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6372 4138 gene locus_tag LOCUS_11150 6372 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 6555 7979 gene locus_tag LOCUS_11160 gene cca 6555 7979 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_11160 9054 7993 gene locus_tag LOCUS_11170 9054 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence0107 1395 2402 gene locus_tag LOCUS_11180 gene truD 1395 2402 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_11180 5192 2613 gene locus_tag LOCUS_11190 5192 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6168 5272 gene locus_tag LOCUS_11200 6168 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6773 6417 gene locus_tag LOCUS_11210 6773 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7244 6777 gene locus_tag LOCUS_11220 7244 6777 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE43 protein_id gnl|my_center|LOCUS_11220 7520 7840 gene locus_tag LOCUS_11230 7520 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7988 8974 gene locus_tag LOCUS_11240 7988 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0108 2064 1048 gene locus_tag LOCUS_11250 2064 1048 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_11250 2611 3648 gene locus_tag LOCUS_11260 2611 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3724 5868 gene locus_tag LOCUS_11270 3724 5868 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_11270 7010 5886 gene locus_tag LOCUS_11280 7010 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7168 8376 gene locus_tag LOCUS_11290 7168 8376 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_11290 9393 8548 gene locus_tag LOCUS_11300 gene yhdW 9393 8548 CDS product putative glycerophosphoryl diester phosphodiesterase YhdW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07592 protein_id gnl|my_center|LOCUS_11300 >Feature sequence0109 2374 98 gene locus_tag LOCUS_11310 2374 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3365 2568 gene locus_tag LOCUS_11320 3365 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4891 3380 gene locus_tag LOCUS_11330 4891 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6703 4913 gene locus_tag LOCUS_11340 6703 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7206 6718 gene locus_tag LOCUS_11350 7206 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7525 8385 gene locus_tag LOCUS_11360 7525 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8530 9648 gene locus_tag LOCUS_11370 8530 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence0110 <1 534 gene locus_tag LOCUS_11380 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403929.1:DNA-binding response regulator 1506 541 gene locus_tag LOCUS_11390 1506 541 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708509.1 protein_id gnl|my_center|LOCUS_11390 1829 5740 gene locus_tag LOCUS_11400 1829 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6007 8382 gene locus_tag LOCUS_11410 6007 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8476 9189 gene locus_tag LOCUS_11420 8476 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence0111 464 1624 gene locus_tag LOCUS_11430 464 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1621 2661 gene locus_tag LOCUS_11440 1621 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2673 3206 gene locus_tag LOCUS_11450 2673 3206 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_11450 4206 3229 gene locus_tag LOCUS_11460 4206 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4872 4231 gene locus_tag LOCUS_11470 4872 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6182 4869 gene locus_tag LOCUS_11480 6182 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6464 6255 gene locus_tag LOCUS_11490 6464 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6394 6933 gene locus_tag LOCUS_11500 6394 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6986 8494 gene locus_tag LOCUS_11510 6986 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0112 1873 194 gene locus_tag LOCUS_11520 1873 194 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_11520 2127 1873 gene locus_tag LOCUS_11530 2127 1873 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_11530 2704 2198 gene locus_tag LOCUS_11540 2704 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3305 2733 gene locus_tag LOCUS_11550 3305 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4201 3317 gene locus_tag LOCUS_11560 4201 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6351 4588 gene locus_tag LOCUS_11570 6351 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7496 6348 gene locus_tag LOCUS_11580 gene degP 7496 6348 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_11580 <9621 7515 gene locus_tag LOCUS_11590 <9621 7515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:serine/threonine protein kinase >Feature sequence0113 <1 999 gene locus_tag LOCUS_11600 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230566.1:anion transporter 1374 1973 gene locus_tag LOCUS_11610 1374 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2101 2466 gene locus_tag LOCUS_11620 2101 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2572 3021 gene locus_tag LOCUS_11630 2572 3021 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_11630 3069 4298 gene locus_tag LOCUS_11640 3069 4298 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_11640 4702 5664 gene locus_tag LOCUS_11650 4702 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5667 7064 gene locus_tag LOCUS_11660 5667 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 <9613 7232 gene locus_tag LOCUS_11670 <9613 7232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase >Feature sequence0114 2338 425 gene locus_tag LOCUS_11680 2338 425 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764404.1 protein_id gnl|my_center|LOCUS_11680 2491 3048 gene locus_tag LOCUS_11690 gene blc 2491 3048 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_11690 3829 3035 gene locus_tag LOCUS_11700 3829 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4018 5949 gene locus_tag LOCUS_11710 4018 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5951 7435 gene locus_tag LOCUS_11720 5951 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 7443 8726 gene locus_tag LOCUS_11730 7443 8726 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_11730 <9608 8740 gene locus_tag LOCUS_11740 <9608 8740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939369.1:thiamine biosynthesis protein ThiF >Feature sequence0115 1526 480 gene locus_tag LOCUS_11750 gene recA 1526 480 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_11750 1753 2463 gene locus_tag LOCUS_11760 1753 2463 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_11760 2586 3197 gene locus_tag LOCUS_11770 2586 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3403 4341 gene locus_tag LOCUS_11780 3403 4341 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_11780 4338 5438 gene locus_tag LOCUS_11790 4338 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5435 7630 gene locus_tag LOCUS_11800 5435 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7771 9492 gene locus_tag LOCUS_11810 7771 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0116 1769 156 gene locus_tag LOCUS_11820 1769 156 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_11820 2005 3375 gene locus_tag LOCUS_11830 2005 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3372 3890 gene locus_tag LOCUS_11840 3372 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6158 3897 gene locus_tag LOCUS_11850 6158 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6212 7297 gene locus_tag LOCUS_11860 6212 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8406 7270 gene locus_tag LOCUS_11870 8406 7270 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_11870 8612 9448 gene locus_tag LOCUS_11880 8612 9448 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence0117 1509 793 gene locus_tag LOCUS_11890 gene pyrE 1509 793 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5N7 protein_id gnl|my_center|LOCUS_11890 1906 2820 gene locus_tag LOCUS_11900 1906 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2825 4279 gene locus_tag LOCUS_11910 2825 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4457 5395 gene locus_tag LOCUS_11920 4457 5395 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_11920 6289 5735 gene locus_tag LOCUS_11930 6289 5735 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690264.1 protein_id gnl|my_center|LOCUS_11930 8044 6335 gene locus_tag LOCUS_11940 8044 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 9398 8127 gene locus_tag LOCUS_11950 gene arcA 9398 8127 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZA0 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0118 961 2541 gene locus_tag LOCUS_11960 961 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4448 2517 gene locus_tag LOCUS_11970 4448 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5323 4451 gene locus_tag LOCUS_11980 5323 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5693 6622 gene locus_tag LOCUS_11990 5693 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6651 7529 gene locus_tag LOCUS_12000 6651 7529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_12000 7611 9011 gene locus_tag LOCUS_12010 7611 9011 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_12010 >Feature sequence0119 2922 1123 gene locus_tag LOCUS_12020 2922 1123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405008.1 protein_id gnl|my_center|LOCUS_12020 4832 2925 gene locus_tag LOCUS_12030 gene wbmC 4832 2925 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_12030 5631 4843 gene locus_tag LOCUS_12040 5631 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228687.1 protein_id gnl|my_center|LOCUS_12040 5851 5714 gene locus_tag LOCUS_12050 5851 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7651 6161 gene locus_tag LOCUS_12060 7651 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9179 7683 gene locus_tag LOCUS_12070 9179 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0120 193 336 gene locus_tag LOCUS_12080 193 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 333 1109 gene locus_tag LOCUS_12090 gene tatC 333 1109 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_12090 1404 5291 gene locus_tag LOCUS_12100 1404 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6303 5878 gene locus_tag LOCUS_12110 gene speH 6303 5878 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ3 protein_id gnl|my_center|LOCUS_12110 7052 6324 gene locus_tag LOCUS_12120 7052 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_12120 7504 7079 gene locus_tag LOCUS_12130 7504 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7972 7583 gene locus_tag LOCUS_12140 7972 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 8911 7988 gene locus_tag LOCUS_12150 8911 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0121 3764 5146 gene locus_tag LOCUS_12160 3764 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5225 5818 gene locus_tag LOCUS_12170 5225 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7247 6144 gene locus_tag LOCUS_12180 7247 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8428 7313 gene locus_tag LOCUS_12190 8428 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 8650 9231 gene locus_tag LOCUS_12200 8650 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence0122 797 204 gene locus_tag LOCUS_12210 gene ruvA 797 204 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_12210 2809 872 gene locus_tag LOCUS_12220 2809 872 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_12220 3228 4658 gene locus_tag LOCUS_12230 3228 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4819 5844 gene locus_tag LOCUS_12240 gene mreB-1 4819 5844 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_12240 5903 6748 gene locus_tag LOCUS_12250 gene mreC 5903 6748 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_12250 6741 7265 gene locus_tag LOCUS_12260 6741 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7277 9067 gene locus_tag LOCUS_12270 gene mrdA 7277 9067 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0123 1637 33 gene locus_tag LOCUS_12280 1637 33 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_12280 2275 1724 gene locus_tag LOCUS_12290 2275 1724 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_12290 4700 2316 gene locus_tag LOCUS_12300 4700 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5660 4842 gene locus_tag LOCUS_12310 5660 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6835 5927 gene locus_tag LOCUS_12320 gene dapA 6835 5927 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_12320 8201 6864 gene locus_tag LOCUS_12330 8201 6864 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187897.1 protein_id gnl|my_center|LOCUS_12330 8503 8198 gene locus_tag LOCUS_12340 gene soxA 8503 8198 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0124 110 1201 gene locus_tag LOCUS_12350 110 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2064 2465 gene locus_tag LOCUS_12360 2064 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4168 2588 gene locus_tag LOCUS_12370 4168 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5404 4259 gene locus_tag LOCUS_12380 5404 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_12380 7454 5406 gene locus_tag LOCUS_12390 7454 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_12390 8437 7481 gene locus_tag LOCUS_12400 8437 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918444.1 protein_id gnl|my_center|LOCUS_12400 8831 9238 gene locus_tag LOCUS_12410 8831 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence0125 2204 474 gene locus_tag LOCUS_12420 2204 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2522 2995 gene locus_tag LOCUS_12430 2522 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3089 3583 gene locus_tag LOCUS_12440 gene mglB 3089 3583 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_12440 3596 4180 gene locus_tag LOCUS_12450 gene mglA 3596 4180 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_12450 4318 4797 gene locus_tag LOCUS_12460 4318 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4888 5889 gene locus_tag LOCUS_12470 4888 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5886 7286 gene locus_tag LOCUS_12480 gene glmU 5886 7286 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX6 protein_id gnl|my_center|LOCUS_12480 7359 9185 gene locus_tag LOCUS_12490 gene glmS 7359 9185 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0126 1195 692 gene locus_tag LOCUS_12500 1195 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1339 1743 gene locus_tag LOCUS_12510 1339 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1740 3863 gene locus_tag LOCUS_12520 1740 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4168 5256 gene locus_tag LOCUS_12530 4168 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7027 5432 gene locus_tag LOCUS_12540 7027 5432 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLM3 protein_id gnl|my_center|LOCUS_12540 >Feature sequence0127 <1 2146 gene locus_tag LOCUS_12550 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87QR6:DNA helicase 2209 2502 gene locus_tag LOCUS_12560 2209 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2984 3592 gene locus_tag LOCUS_12570 2984 3592 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259269.1 protein_id gnl|my_center|LOCUS_12570 4084 6552 gene locus_tag LOCUS_12580 4084 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_12580 6708 7406 gene locus_tag LOCUS_12590 6708 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence0128 1893 1396 gene locus_tag LOCUS_12600 1893 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2136 3833 gene locus_tag LOCUS_12610 2136 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3852 4643 gene locus_tag LOCUS_12620 3852 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_12620 4640 5764 gene locus_tag LOCUS_12630 4640 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5809 7206 gene locus_tag LOCUS_12640 5809 7206 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 protein_id gnl|my_center|LOCUS_12640 7357 7704 gene locus_tag LOCUS_12650 7357 7704 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_12650 7701 8543 gene locus_tag LOCUS_12660 7701 8543 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061131.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0129 1605 151 gene locus_tag LOCUS_12670 1605 151 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_12670 3004 1649 gene locus_tag LOCUS_12680 3004 1649 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_12680 3590 5998 gene locus_tag LOCUS_12690 3590 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6968 6069 gene locus_tag LOCUS_12700 6968 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_12700 <9133 6965 gene locus_tag LOCUS_12710 <9133 6965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence0130 1261 2484 gene locus_tag LOCUS_12720 1261 2484 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_12720 2481 3812 gene locus_tag LOCUS_12730 gene leuC 2481 3812 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_12730 3812 4354 gene locus_tag LOCUS_12740 gene leuD 3812 4354 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F7 protein_id gnl|my_center|LOCUS_12740 4347 5468 gene locus_tag LOCUS_12750 4347 5468 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_12750 5480 6373 gene locus_tag LOCUS_12760 5480 6373 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_12760 8946 6379 gene locus_tag LOCUS_12770 gene hrpB 8946 6379 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0131 573 2267 gene locus_tag LOCUS_12780 573 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3846 2188 gene locus_tag LOCUS_12790 3846 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4147 5445 gene locus_tag LOCUS_12800 4147 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_12800 5543 6193 gene locus_tag LOCUS_12810 5543 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6283 7209 gene locus_tag LOCUS_12820 6283 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence0132 391 1725 gene locus_tag LOCUS_12830 391 1725 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_12830 2278 1985 gene locus_tag LOCUS_12840 2278 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3623 2562 gene locus_tag LOCUS_12850 3623 2562 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330332.1 protein_id gnl|my_center|LOCUS_12850 3834 4538 gene locus_tag LOCUS_12860 3834 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4956 4621 gene locus_tag LOCUS_12870 4956 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5564 5055 gene locus_tag LOCUS_12880 5564 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392741.1 protein_id gnl|my_center|LOCUS_12880 8456 5640 gene locus_tag LOCUS_12890 8456 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0133 388 1206 gene locus_tag LOCUS_12900 388 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2392 1292 gene locus_tag LOCUS_12910 2392 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4038 2566 gene locus_tag LOCUS_12920 gene gltX 4038 2566 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG1 protein_id gnl|my_center|LOCUS_12920 6139 4157 gene locus_tag LOCUS_12930 6139 4157 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_12930 7117 6275 gene locus_tag LOCUS_12940 7117 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0134 1264 1710 gene locus_tag LOCUS_12950 1264 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2149 3285 gene locus_tag LOCUS_12960 2149 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4148 3462 gene locus_tag LOCUS_12970 4148 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4360 4145 gene locus_tag LOCUS_12980 4360 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5490 4471 gene locus_tag LOCUS_12990 5490 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 7736 5481 gene locus_tag LOCUS_13000 7736 5481 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0135 2072 1443 gene locus_tag LOCUS_13010 2072 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2632 2102 gene locus_tag LOCUS_13020 2632 2102 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_13020 2967 4439 gene locus_tag LOCUS_13030 gene guaB 2967 4439 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_13030 4541 5962 gene locus_tag LOCUS_13040 4541 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7613 5979 gene locus_tag LOCUS_13050 7613 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0136 1792 311 gene locus_tag LOCUS_13060 gene tilS 1792 311 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM96 protein_id gnl|my_center|LOCUS_13060 2135 2059 gene locus_tag LOCUS_t00150 2135 2059 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2513 2238 gene locus_tag LOCUS_13070 2513 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3585 2986 gene locus_tag LOCUS_13080 gene sodA 3585 2986 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_13080 3941 4017 gene locus_tag LOCUS_t00160 3941 4017 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4180 4256 gene locus_tag LOCUS_t00170 4180 4256 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4699 6081 gene locus_tag LOCUS_13090 gene mtaD 4699 6081 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_13090 6250 7122 gene locus_tag LOCUS_13100 6250 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7298 8524 gene locus_tag LOCUS_13110 7298 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0137 915 1835 gene locus_tag LOCUS_13120 915 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1832 2590 gene locus_tag LOCUS_13130 1832 2590 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_13130 3568 2600 gene locus_tag LOCUS_13140 3568 2600 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_13140 4572 3715 gene locus_tag LOCUS_13150 gene proC 4572 3715 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_13150 5474 4575 gene locus_tag LOCUS_13160 5474 4575 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_13160 6912 5575 gene locus_tag LOCUS_13170 6912 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7451 7017 gene locus_tag LOCUS_13180 7451 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 8618 7635 gene locus_tag LOCUS_13190 8618 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence0138 258 1496 gene locus_tag LOCUS_13200 258 1496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_13200 1493 2878 gene locus_tag LOCUS_13210 1493 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2880 4118 gene locus_tag LOCUS_13220 2880 4118 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_13220 4118 4807 gene locus_tag LOCUS_13230 4118 4807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933017.1 protein_id gnl|my_center|LOCUS_13230 4968 6761 gene locus_tag LOCUS_13240 4968 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0139 1389 292 gene locus_tag LOCUS_13250 1389 292 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B90 protein_id gnl|my_center|LOCUS_13250 1579 4215 gene locus_tag LOCUS_13260 1579 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 5998 4220 gene locus_tag LOCUS_13270 5998 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 <8635 6493 gene locus_tag LOCUS_13280 <8635 6493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:adhesin >Feature sequence0140 440 772 gene locus_tag LOCUS_13290 440 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 782 2485 gene locus_tag LOCUS_13300 782 2485 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_13300 4042 2489 gene locus_tag LOCUS_13310 4042 2489 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_13310 5187 4135 gene locus_tag LOCUS_13320 5187 4135 CDS product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_13320 7991 5187 gene locus_tag LOCUS_13330 7991 5187 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227885.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0141 3060 1963 gene locus_tag LOCUS_13340 3060 1963 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_13340 6805 3125 gene locus_tag LOCUS_13350 6805 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0142 2926 1505 gene locus_tag LOCUS_13360 2926 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3273 5111 gene locus_tag LOCUS_13370 3273 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0143 <1 5058 gene locus_tag LOCUS_13380 <1 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase 5163 5990 gene locus_tag LOCUS_13390 5163 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6344 6027 gene locus_tag LOCUS_13400 6344 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 7866 6448 gene locus_tag LOCUS_13410 7866 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55687 protein_id gnl|my_center|LOCUS_13410 >Feature sequence0144 960 1970 gene locus_tag LOCUS_13420 960 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1967 2677 gene locus_tag LOCUS_13430 1967 2677 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_13430 2882 3805 gene locus_tag LOCUS_13440 gene desC 2882 3805 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_13440 4393 3812 gene locus_tag LOCUS_13450 4393 3812 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_13450 4929 6029 gene locus_tag LOCUS_13460 4929 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6026 7057 gene locus_tag LOCUS_13470 6026 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence0145 1021 386 gene locus_tag LOCUS_13480 1021 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1735 1199 gene locus_tag LOCUS_13490 1735 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1948 3645 gene locus_tag LOCUS_13500 1948 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3642 4658 gene locus_tag LOCUS_13510 3642 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4696 5058 gene locus_tag LOCUS_13520 4696 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5065 5949 gene locus_tag LOCUS_13530 5065 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7153 5957 gene locus_tag LOCUS_13540 7153 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7638 7189 gene locus_tag LOCUS_13550 gene rplI 7638 7189 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9A8 protein_id gnl|my_center|LOCUS_13550 7881 7651 gene locus_tag LOCUS_13560 gene rpsR 7881 7651 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ0 protein_id gnl|my_center|LOCUS_13560 8342 7881 gene locus_tag LOCUS_13570 8342 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0146 2687 471 gene locus_tag LOCUS_13580 2687 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4093 2684 gene locus_tag LOCUS_13590 4093 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4308 7229 gene locus_tag LOCUS_13600 4308 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7673 7449 gene locus_tag LOCUS_13610 7673 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence0147 902 2815 gene locus_tag LOCUS_13620 902 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2819 4810 gene locus_tag LOCUS_13630 2819 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5899 4826 gene locus_tag LOCUS_13640 5899 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_13640 6036 6395 gene locus_tag LOCUS_13650 6036 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6556 7998 gene locus_tag LOCUS_13660 6556 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence0148 1832 2863 gene locus_tag LOCUS_13670 1832 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_13670 4465 3314 gene locus_tag LOCUS_13680 gene hemH2 4465 3314 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_13680 5606 4527 gene locus_tag LOCUS_13690 gene hemE 5606 4527 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_13690 6313 5603 gene locus_tag LOCUS_13700 6313 5603 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_13700 7443 6316 gene locus_tag LOCUS_13710 7443 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8360 7440 gene locus_tag LOCUS_13720 8360 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8402 8475 gene locus_tag LOCUS_t00180 8402 8475 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0149 <1 563 gene locus_tag LOCUS_13730 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256508.1:undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase 598 1716 gene locus_tag LOCUS_13740 gene galE 598 1716 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_13740 2807 1611 gene locus_tag LOCUS_13750 2807 1611 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_13750 4744 2813 gene locus_tag LOCUS_13760 4744 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5903 4758 gene locus_tag LOCUS_13770 5903 4758 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0150 410 1135 gene locus_tag LOCUS_13780 410 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404594.1 protein_id gnl|my_center|LOCUS_13780 1132 2745 gene locus_tag LOCUS_13790 gene yjeF 1132 2745 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C72 protein_id gnl|my_center|LOCUS_13790 2742 3179 gene locus_tag LOCUS_13800 2742 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3236 4093 gene locus_tag LOCUS_13810 3236 4093 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_13810 4139 5116 gene locus_tag LOCUS_13820 4139 5116 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_13820 5343 7865 gene locus_tag LOCUS_13830 5343 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence0151 3247 1316 gene locus_tag LOCUS_13840 gene asnB 3247 1316 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_13840 3398 4096 gene locus_tag LOCUS_13850 3398 4096 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143625.1 protein_id gnl|my_center|LOCUS_13850 4239 5354 gene locus_tag LOCUS_13860 4239 5354 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085209.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence0152 45 671 gene locus_tag LOCUS_13870 45 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 784 3699 gene locus_tag LOCUS_13880 784 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13880 3706 4479 gene locus_tag LOCUS_13890 3706 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13890 5748 4453 gene locus_tag LOCUS_13900 5748 4453 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_13900 6627 5779 gene locus_tag LOCUS_13910 gene dapF 6627 5779 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_13910 6835 7824 gene locus_tag LOCUS_13920 6835 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence0153 744 1436 gene locus_tag LOCUS_13930 744 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2816 1437 gene locus_tag LOCUS_13940 gene sdaA 2816 1437 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_13940 3800 3117 gene locus_tag LOCUS_13950 3800 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4918 4328 gene locus_tag LOCUS_13960 4918 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6638 5166 gene locus_tag LOCUS_13970 6638 5166 CDS product arsenical pump family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253041.1 protein_id gnl|my_center|LOCUS_13970 7520 6657 gene locus_tag LOCUS_13980 7520 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 7670 7915 gene locus_tag LOCUS_13990 7670 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13990 7916 8251 gene locus_tag LOCUS_14000 7916 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0154 1021 77 gene locus_tag LOCUS_14010 1021 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2018 1095 gene locus_tag LOCUS_14020 2018 1095 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 protein_id gnl|my_center|LOCUS_14020 2562 2026 gene locus_tag LOCUS_14030 gene kdsC 2562 2026 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_14030 3551 2562 gene locus_tag LOCUS_14040 gene kdsD 3551 2562 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_14040 4459 3548 gene locus_tag LOCUS_14050 gene kdsA 4459 3548 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61654 protein_id gnl|my_center|LOCUS_14050 6117 4456 gene locus_tag LOCUS_14060 gene pyrG 6117 4456 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT4 protein_id gnl|my_center|LOCUS_14060 7008 6253 gene locus_tag LOCUS_14070 gene kdsB 7008 6253 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_14070 7544 7131 gene locus_tag LOCUS_14080 7544 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0155 221 529 gene locus_tag LOCUS_14090 221 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 638 982 gene locus_tag LOCUS_14100 gene yegP 638 982 CDS product UPF0339 protein YegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76402 protein_id gnl|my_center|LOCUS_14100 1366 1061 gene locus_tag LOCUS_14110 1366 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2555 1554 gene locus_tag LOCUS_14120 2555 1554 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_14120 4905 2779 gene locus_tag LOCUS_14130 4905 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5338 4943 gene locus_tag LOCUS_14140 5338 4943 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_14140 6869 5427 gene locus_tag LOCUS_14150 6869 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 <8326 6866 gene locus_tag LOCUS_14160 <8326 6866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q725J4:GTPase HflX >Feature sequence0156 1055 1435 gene locus_tag LOCUS_14170 1055 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1754 4072 gene locus_tag LOCUS_14180 1754 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4170 4547 gene locus_tag LOCUS_14190 4170 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_14190 7929 4555 gene locus_tag LOCUS_14200 7929 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0157 3521 405 gene locus_tag LOCUS_14210 3521 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5139 3883 gene locus_tag LOCUS_14220 5139 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_14220 5227 7371 gene locus_tag LOCUS_14230 5227 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence0158 2890 650 gene locus_tag LOCUS_14240 2890 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3903 2887 gene locus_tag LOCUS_14250 3903 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4168 6093 gene locus_tag LOCUS_14260 4168 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0159 2637 787 gene locus_tag LOCUS_14270 2637 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2817 4256 gene locus_tag LOCUS_14280 2817 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4259 6055 gene locus_tag LOCUS_14290 4259 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 7106 5982 gene locus_tag LOCUS_14300 7106 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 7225 8067 gene locus_tag LOCUS_14310 7225 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0160 2524 983 gene locus_tag LOCUS_14320 2524 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2829 3044 gene locus_tag LOCUS_14330 2829 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5305 3593 gene locus_tag LOCUS_14340 gene nrfA 5305 3593 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_14340 5836 5327 gene locus_tag LOCUS_14350 gene nrfC 5836 5327 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_14350 6127 7902 gene locus_tag LOCUS_14360 6127 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence0161 662 261 gene locus_tag LOCUS_14370 662 261 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_14370 1447 659 gene locus_tag LOCUS_14380 1447 659 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_14380 3766 1496 gene locus_tag LOCUS_14390 3766 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4594 4767 gene locus_tag LOCUS_14400 4594 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4853 5590 gene locus_tag LOCUS_14410 4853 5590 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_14410 5832 8015 gene locus_tag LOCUS_14420 5832 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence0162 2028 1450 gene locus_tag LOCUS_14430 2028 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4237 2432 gene locus_tag LOCUS_14440 4237 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4554 5300 gene locus_tag LOCUS_14450 gene nodW 4554 5300 CDS product nodulation protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15940 protein_id gnl|my_center|LOCUS_14450 5798 5445 gene locus_tag LOCUS_14460 5798 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6697 5981 gene locus_tag LOCUS_14470 6697 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6949 8130 gene locus_tag LOCUS_14480 gene moeA 6949 8130 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0163 >Feature sequence0164 4123 2957 gene locus_tag LOCUS_14490 4123 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4850 6418 gene locus_tag LOCUS_14500 gene rsr 4850 6418 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_14500 6942 7556 gene locus_tag LOCUS_14510 6942 7556 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0165 1007 2194 gene locus_tag LOCUS_14520 1007 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_14520 2191 4389 gene locus_tag LOCUS_14530 2191 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4415 4828 gene locus_tag LOCUS_14540 4415 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 7664 4890 gene locus_tag LOCUS_14550 7664 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence0166 461 1723 gene locus_tag LOCUS_14560 461 1723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_14560 1716 2291 gene locus_tag LOCUS_14570 1716 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2291 3211 gene locus_tag LOCUS_14580 2291 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3212 4204 gene locus_tag LOCUS_14590 3212 4204 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_14590 4210 5868 gene locus_tag LOCUS_14600 4210 5868 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_14600 5880 6569 gene locus_tag LOCUS_14610 5880 6569 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_14610 6582 7022 gene locus_tag LOCUS_14620 6582 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7338 7547 gene locus_tag LOCUS_14630 7338 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 <8082 7535 gene locus_tag LOCUS_14640 <8082 7535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104349.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0167 346 1254 gene locus_tag LOCUS_14650 346 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1408 2352 gene locus_tag LOCUS_14660 1408 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5070 2569 gene locus_tag LOCUS_14670 5070 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5347 5910 gene locus_tag LOCUS_14680 5347 5910 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_14680 5907 6176 gene locus_tag LOCUS_14690 5907 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7683 6154 gene locus_tag LOCUS_14700 7683 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14700 8052 7741 gene locus_tag LOCUS_14710 8052 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14710 >Feature sequence0168 2 1852 gene locus_tag LOCUS_14720 2 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2002 2898 gene locus_tag LOCUS_14730 2002 2898 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_14730 4359 2926 gene locus_tag LOCUS_14740 4359 2926 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_14740 6335 5334 gene locus_tag LOCUS_14750 gene argF 6335 5334 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG4 protein_id gnl|my_center|LOCUS_14750 6545 7048 gene locus_tag LOCUS_14760 6545 7048 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_14760 7145 7600 gene locus_tag LOCUS_14770 7145 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence0169 1376 273 gene locus_tag LOCUS_14780 1376 273 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_14780 2463 1690 gene locus_tag LOCUS_14790 2463 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5311 2474 gene locus_tag LOCUS_14800 5311 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5381 6694 gene locus_tag LOCUS_14810 5381 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0170 1642 878 gene locus_tag LOCUS_14820 1642 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2102 1671 gene locus_tag LOCUS_14830 2102 1671 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886263.1 protein_id gnl|my_center|LOCUS_14830 2843 2118 gene locus_tag LOCUS_14840 2843 2118 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_14840 3561 3214 gene locus_tag LOCUS_14850 3561 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3725 4081 gene locus_tag LOCUS_14860 3725 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 4081 5058 gene locus_tag LOCUS_14870 gene etfA 4081 5058 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0171 <1 768 gene locus_tag LOCUS_14880 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546863.1:tetratricopeptide repeat domain protein 805 2259 gene locus_tag LOCUS_14890 805 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2882 2325 gene locus_tag LOCUS_14900 2882 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3340 2960 gene locus_tag LOCUS_14910 3340 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3999 3526 gene locus_tag LOCUS_14920 3999 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_14920 4149 4997 gene locus_tag LOCUS_14930 4149 4997 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_14930 5528 7339 gene locus_tag LOCUS_14940 5528 7339 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_14940 >Feature sequence0172 2734 323 gene locus_tag LOCUS_14950 2734 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3291 2731 gene locus_tag LOCUS_14960 gene algU 3291 2731 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_14960 3655 4320 gene locus_tag LOCUS_14970 3655 4320 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808853.1 protein_id gnl|my_center|LOCUS_14970 4462 6378 gene locus_tag LOCUS_14980 gene fadE10 4462 6378 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQF7 protein_id gnl|my_center|LOCUS_14980 6617 6826 gene locus_tag LOCUS_14990 6617 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7939 6902 gene locus_tag LOCUS_15000 7939 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence0173 174 437 gene locus_tag LOCUS_15010 174 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5840 444 gene locus_tag LOCUS_15020 5840 444 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_15020 6241 5918 gene locus_tag LOCUS_15030 6241 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 6690 6292 gene locus_tag LOCUS_15040 6690 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence0174 196 2481 gene locus_tag LOCUS_15050 196 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2985 2491 gene locus_tag LOCUS_15060 2985 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3211 3897 gene locus_tag LOCUS_15070 3211 3897 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123490.1 protein_id gnl|my_center|LOCUS_15070 4356 4093 gene locus_tag LOCUS_15080 4356 4093 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_15080 5408 4617 gene locus_tag LOCUS_15090 5408 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6271 5450 gene locus_tag LOCUS_15100 gene mutM 6271 5450 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_15100 6454 7053 gene locus_tag LOCUS_15110 6454 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <7903 7057 gene locus_tag LOCUS_15120 <7903 7057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:histidine kinase >Feature sequence0175 3554 3105 gene locus_tag LOCUS_15130 3554 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7723 3653 gene locus_tag LOCUS_15140 7723 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0176 <1 3506 gene locus_tag LOCUS_15150 <1 3506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY 4923 3604 gene locus_tag LOCUS_15160 4923 3604 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_15160 6194 4920 gene locus_tag LOCUS_15170 gene selA 6194 4920 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTI0 protein_id gnl|my_center|LOCUS_15170 6384 6908 gene locus_tag LOCUS_15180 6384 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence0177 1309 578 gene locus_tag LOCUS_15190 1309 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1401 1910 gene locus_tag LOCUS_15200 1401 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5315 2295 gene locus_tag LOCUS_15210 5315 2295 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_15210 5585 6187 gene locus_tag LOCUS_15220 5585 6187 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9L5 protein_id gnl|my_center|LOCUS_15220 6234 6878 gene locus_tag LOCUS_15230 6234 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6871 7464 gene locus_tag LOCUS_15240 6871 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0178 496 1530 gene locus_tag LOCUS_15250 496 1530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_15250 1527 2339 gene locus_tag LOCUS_15260 1527 2339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_15260 2381 3154 gene locus_tag LOCUS_15270 2381 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4177 3221 gene locus_tag LOCUS_15280 4177 3221 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_15280 4841 5524 gene locus_tag LOCUS_15290 4841 5524 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_15290 5948 5613 gene locus_tag LOCUS_15300 5948 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7203 5992 gene locus_tag LOCUS_15310 7203 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 <7823 7200 gene locus_tag LOCUS_15320 <7823 7200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968323.1:cytochrome P450 monooxygenase >Feature sequence0179 3 515 gene locus_tag LOCUS_15330 3 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 653 1060 gene locus_tag LOCUS_15340 653 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1166 1091 gene locus_tag LOCUS_t00190 1166 1091 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1308 1234 gene locus_tag LOCUS_t00200 1308 1234 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1422 1347 gene locus_tag LOCUS_t00210 1422 1347 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2217 3788 gene locus_tag LOCUS_15350 2217 3788 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_15350 3807 4343 gene locus_tag LOCUS_15360 3807 4343 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_15360 4382 5152 gene locus_tag LOCUS_15370 gene paaG 4382 5152 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_15370 6484 5237 gene locus_tag LOCUS_15380 6484 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_15380 6995 6597 gene locus_tag LOCUS_15390 6995 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 6877 7305 gene locus_tag LOCUS_15400 6877 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence0180 2988 1687 gene locus_tag LOCUS_15410 2988 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763971.1 protein_id gnl|my_center|LOCUS_15410 3133 5286 gene locus_tag LOCUS_15420 3133 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6612 5314 gene locus_tag LOCUS_15430 6612 5314 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_15430 7222 6743 gene locus_tag LOCUS_15440 7222 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence0181 2334 196 gene locus_tag LOCUS_15450 2334 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3566 2424 gene locus_tag LOCUS_15460 3566 2424 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_15460 3910 4665 gene locus_tag LOCUS_15470 3910 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4819 5898 gene locus_tag LOCUS_15480 4819 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_15480 5895 6965 gene locus_tag LOCUS_15490 5895 6965 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_15490 7001 7681 gene locus_tag LOCUS_15500 7001 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0182 99 1136 gene locus_tag LOCUS_15510 99 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2520 1267 gene locus_tag LOCUS_15520 2520 1267 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879141.1 protein_id gnl|my_center|LOCUS_15520 6101 2592 gene locus_tag LOCUS_15530 6101 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 7535 6348 gene locus_tag LOCUS_15540 7535 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence0183 1250 2038 gene locus_tag LOCUS_15550 1250 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2207 3448 gene locus_tag LOCUS_15560 gene paaJ 2207 3448 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_15560 3460 4770 gene locus_tag LOCUS_15570 3460 4770 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_15570 5548 5021 gene locus_tag LOCUS_15580 5548 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0184 430 2697 gene locus_tag LOCUS_15590 gene secDF 430 2697 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKE6 protein_id gnl|my_center|LOCUS_15590 4561 2708 gene locus_tag LOCUS_15600 4561 2708 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_15600 5138 4656 gene locus_tag LOCUS_15610 5138 4656 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390805.1 protein_id gnl|my_center|LOCUS_15610 5390 5926 gene locus_tag LOCUS_15620 5390 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5954 7129 gene locus_tag LOCUS_15630 5954 7129 CDS product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence0185 457 248 gene locus_tag LOCUS_15640 457 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1780 557 gene locus_tag LOCUS_15650 1780 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15650 4034 1824 gene locus_tag LOCUS_15660 4034 1824 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_15660 6278 4329 gene locus_tag LOCUS_15670 6278 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 <7615 6275 gene locus_tag LOCUS_15680 <7615 6275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103180.1:GGDEF domain-containing protein >Feature sequence0186 2917 584 gene locus_tag LOCUS_15690 2917 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3193 3951 gene locus_tag LOCUS_15700 3193 3951 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_15700 3984 4940 gene locus_tag LOCUS_15710 3984 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 6775 5030 gene locus_tag LOCUS_15720 6775 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 <7579 6912 gene locus_tag LOCUS_15730 <7579 6912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase >Feature sequence0187 294 1073 gene locus_tag LOCUS_15740 294 1073 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_15740 1106 1876 gene locus_tag LOCUS_15750 1106 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1918 3162 gene locus_tag LOCUS_15760 1918 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4292 3135 gene locus_tag LOCUS_15770 4292 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4445 5623 gene locus_tag LOCUS_15780 4445 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5749 7110 gene locus_tag LOCUS_15790 5749 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0188 1579 956 gene locus_tag LOCUS_15800 gene hisG 1579 956 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUE2 protein_id gnl|my_center|LOCUS_15800 2550 1576 gene locus_tag LOCUS_15810 2550 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4028 2547 gene locus_tag LOCUS_15820 4028 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5429 6826 gene locus_tag LOCUS_15830 5429 6826 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_15830 7016 7231 gene locus_tag LOCUS_15840 7016 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence0189 1806 2936 gene locus_tag LOCUS_15850 gene galK 1806 2936 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_15850 3091 3819 gene locus_tag LOCUS_15860 3091 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3989 5434 gene locus_tag LOCUS_15870 3989 5434 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_15870 5538 7010 gene locus_tag LOCUS_15880 5538 7010 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence0190 348 506 gene locus_tag LOCUS_15890 348 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 825 1022 gene locus_tag LOCUS_15900 825 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1078 3075 gene locus_tag LOCUS_15910 1078 3075 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259369.1 protein_id gnl|my_center|LOCUS_15910 3144 3764 gene locus_tag LOCUS_15920 3144 3764 CDS product farnesyl cysteine carboxyl-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975432.1 protein_id gnl|my_center|LOCUS_15920 3903 4415 gene locus_tag LOCUS_15930 3903 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4412 6622 gene locus_tag LOCUS_15940 4412 6622 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_15940 6619 7248 gene locus_tag LOCUS_15950 6619 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0191 <1 553 gene locus_tag LOCUS_15960 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404697.1:MFS transporter 1759 656 gene locus_tag LOCUS_15970 gene dinB 1759 656 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 protein_id gnl|my_center|LOCUS_15970 2680 1982 gene locus_tag LOCUS_15980 2680 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3056 2781 gene locus_tag LOCUS_15990 3056 2781 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_15990 4018 3068 gene locus_tag LOCUS_16000 4018 3068 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_16000 5480 4155 gene locus_tag LOCUS_16010 gene ugdH 5480 4155 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_16010 6581 5583 gene locus_tag LOCUS_16020 6581 5583 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_16020 7235 6846 gene locus_tag LOCUS_16030 7235 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0192 1708 3126 gene locus_tag LOCUS_16040 1708 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5945 3237 gene locus_tag LOCUS_16050 5945 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6553 5942 gene locus_tag LOCUS_16060 6553 5942 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_16060 6893 7285 gene locus_tag LOCUS_16070 6893 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0193 1459 416 gene locus_tag LOCUS_16080 1459 416 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_16080 2998 1544 gene locus_tag LOCUS_16090 2998 1544 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_16090 4279 3152 gene locus_tag LOCUS_16100 4279 3152 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_16100 7013 4503 gene locus_tag LOCUS_16110 7013 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence0194 <7475 4686 gene locus_tag LOCUS_16120 <7475 4686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026867.1:polyketide synthase >Feature sequence0195 714 1964 gene locus_tag LOCUS_16130 714 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3345 1993 gene locus_tag LOCUS_16140 3345 1993 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_16140 4683 3415 gene locus_tag LOCUS_16150 4683 3415 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_16150 4860 5504 gene locus_tag LOCUS_16160 4860 5504 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_16160 5705 7186 gene locus_tag LOCUS_16170 5705 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0196 1673 303 gene locus_tag LOCUS_16180 1673 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4757 1848 gene locus_tag LOCUS_16190 gene oar 4757 1848 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_16190 4866 5156 gene locus_tag LOCUS_16200 4866 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 6477 5362 gene locus_tag LOCUS_16210 gene srkA 6477 5362 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F359 protein_id gnl|my_center|LOCUS_16210 6541 7026 gene locus_tag LOCUS_16220 6541 7026 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0197 805 17 gene locus_tag LOCUS_16230 805 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1595 828 gene locus_tag LOCUS_16240 1595 828 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189909.1 protein_id gnl|my_center|LOCUS_16240 2494 1601 gene locus_tag LOCUS_16250 gene mmgB 2494 1601 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45856 protein_id gnl|my_center|LOCUS_16250 2639 3349 gene locus_tag LOCUS_16260 2639 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_16260 3423 4067 gene locus_tag LOCUS_16270 gene tdk 3423 4067 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_16270 4083 5948 gene locus_tag LOCUS_16280 gene wbpS 4083 5948 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_16280 5945 7036 gene locus_tag LOCUS_16290 5945 7036 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence0198 2441 1350 gene locus_tag LOCUS_16300 2441 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2653 3132 gene locus_tag LOCUS_16310 2653 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3978 3142 gene locus_tag LOCUS_16320 3978 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4619 3906 gene locus_tag LOCUS_16330 4619 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5690 4893 gene locus_tag LOCUS_16340 gene trpA 5690 4893 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_16340 6991 5687 gene locus_tag LOCUS_16350 gene trpB1 6991 5687 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_16350 >Feature sequence0199 <1 2663 gene locus_tag LOCUS_16360 <1 2663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase 2687 3931 gene locus_tag LOCUS_16370 2687 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5536 4190 gene locus_tag LOCUS_16380 5536 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 <7326 5565 gene locus_tag LOCUS_16390 <7326 5565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763446.1:type II secretion system protein E >Feature sequence0200 2070 676 gene locus_tag LOCUS_16400 gene hemN 2070 676 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_16400 3275 2130 gene locus_tag LOCUS_16410 gene bamB 3275 2130 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XAA9 protein_id gnl|my_center|LOCUS_16410 4465 3296 gene locus_tag LOCUS_16420 4465 3296 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_16420 5957 4506 gene locus_tag LOCUS_16430 5957 4506 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_16430 7045 5957 gene locus_tag LOCUS_16440 7045 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0201 1180 2097 gene locus_tag LOCUS_16450 1180 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2170 2832 gene locus_tag LOCUS_16460 2170 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_16460 2817 3125 gene locus_tag LOCUS_16470 2817 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3926 3180 gene locus_tag LOCUS_16480 3926 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_16480 4033 4590 gene locus_tag LOCUS_16490 4033 4590 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0202 99 2153 gene locus_tag LOCUS_16500 99 2153 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_16500 2889 2170 gene locus_tag LOCUS_16510 2889 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3404 2904 gene locus_tag LOCUS_16520 3404 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3884 6904 gene locus_tag LOCUS_16530 3884 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 6930 7145 gene locus_tag LOCUS_16540 6930 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence0203 1202 1126 gene locus_tag LOCUS_t00220 1202 1126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1299 1223 gene locus_tag LOCUS_t00230 1299 1223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1493 1420 gene locus_tag LOCUS_t00240 1493 1420 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1816 2631 gene locus_tag LOCUS_16550 gene kynA 1816 2631 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_16550 2659 3855 gene locus_tag LOCUS_16560 2659 3855 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_16560 3855 4922 gene locus_tag LOCUS_16570 3855 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_16570 5503 5003 gene locus_tag LOCUS_16580 5503 5003 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0204 2166 1570 gene locus_tag LOCUS_16590 2166 1570 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_16590 2493 2218 gene locus_tag LOCUS_16600 2493 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4438 2849 gene locus_tag LOCUS_16610 4438 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5712 4546 gene locus_tag LOCUS_16620 gene ada 5712 4546 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_16620 6634 5828 gene locus_tag LOCUS_16630 6634 5828 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence0205 816 3002 gene locus_tag LOCUS_16640 816 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4266 3154 gene locus_tag LOCUS_16650 4266 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5794 5078 gene locus_tag LOCUS_16660 5794 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6737 5973 gene locus_tag LOCUS_16670 6737 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence0206 1596 235 gene locus_tag LOCUS_16680 1596 235 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_16680 3676 1610 gene locus_tag LOCUS_16690 3676 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16690 4697 3837 gene locus_tag LOCUS_16700 4697 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7139 4713 gene locus_tag LOCUS_16710 7139 4713 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence0207 <1 659 gene locus_tag LOCUS_16720 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975748.1:DNA-binding response regulator 644 2515 gene locus_tag LOCUS_16730 644 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2605 3489 gene locus_tag LOCUS_16740 2605 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3482 4729 gene locus_tag LOCUS_16750 3482 4729 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_16750 4841 6523 gene locus_tag LOCUS_16760 4841 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6961 6539 gene locus_tag LOCUS_16770 6961 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence0208 1677 169 gene locus_tag LOCUS_16780 1677 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2505 1744 gene locus_tag LOCUS_16790 2505 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 3662 2502 gene locus_tag LOCUS_16800 3662 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3907 6729 gene locus_tag LOCUS_16810 gene uvrA 3907 6729 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_16810 6838 7200 gene locus_tag LOCUS_16820 6838 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence0209 200 1291 gene locus_tag LOCUS_16830 200 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1368 1811 gene locus_tag LOCUS_16840 1368 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2369 1728 gene locus_tag LOCUS_16850 2369 1728 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_16850 4464 2359 gene locus_tag LOCUS_16860 4464 2359 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_16860 5428 4724 gene locus_tag LOCUS_16870 5428 4724 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_16870 5555 6292 gene locus_tag LOCUS_16880 5555 6292 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence0210 954 863 gene locus_tag LOCUS_t00250 954 863 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1042 2307 gene locus_tag LOCUS_16890 1042 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24326 protein_id gnl|my_center|LOCUS_16890 2304 3329 gene locus_tag LOCUS_16900 2304 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3624 3379 gene locus_tag LOCUS_16910 3624 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3509 4273 gene locus_tag LOCUS_16920 3509 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4687 4295 gene locus_tag LOCUS_16930 gene merR 4687 4295 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_16930 6722 4830 gene locus_tag LOCUS_16940 gene dnaK 6722 4830 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DW8 protein_id gnl|my_center|LOCUS_16940 >Feature sequence0211 3 776 gene locus_tag LOCUS_16950 3 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1877 933 gene locus_tag LOCUS_16960 1877 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3697 2114 gene locus_tag LOCUS_16970 3697 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5057 3708 gene locus_tag LOCUS_16980 5057 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6248 5274 gene locus_tag LOCUS_16990 6248 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6813 6520 gene locus_tag LOCUS_17000 6813 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence0212 55 1104 gene locus_tag LOCUS_17010 55 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2123 1101 gene locus_tag LOCUS_17020 2123 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2991 2233 gene locus_tag LOCUS_17030 2991 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3700 3038 gene locus_tag LOCUS_17040 3700 3038 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884291.1 protein_id gnl|my_center|LOCUS_17040 3982 6003 gene locus_tag LOCUS_17050 3982 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6000 6707 gene locus_tag LOCUS_17060 6000 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence0213 1376 690 gene locus_tag LOCUS_17070 1376 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1973 1653 gene locus_tag LOCUS_17080 1973 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_17080 2437 1970 gene locus_tag LOCUS_17090 2437 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3021 2437 gene locus_tag LOCUS_17100 gene algU 3021 2437 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_17100 3280 5025 gene locus_tag LOCUS_17110 3280 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence0214 2535 1333 gene locus_tag LOCUS_17120 2535 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2637 5198 gene locus_tag LOCUS_17130 2637 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5293 6402 gene locus_tag LOCUS_17140 5293 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7129 6494 gene locus_tag LOCUS_17150 7129 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence0215 195 1973 gene locus_tag LOCUS_17160 195 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1970 2563 gene locus_tag LOCUS_17170 1970 2563 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_17170 2625 3995 gene locus_tag LOCUS_17180 2625 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4070 5503 gene locus_tag LOCUS_17190 4070 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5635 6129 gene locus_tag LOCUS_17200 5635 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <7101 6206 gene locus_tag LOCUS_17210 <7101 6206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094007.1:GGDEF-domain containing protein >Feature sequence0216 840 244 gene locus_tag LOCUS_17220 840 244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_17220 2272 851 gene locus_tag LOCUS_17230 2272 851 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_17230 5628 2341 gene locus_tag LOCUS_17240 5628 2341 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_17240 6343 5681 gene locus_tag LOCUS_17250 6343 5681 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0217 1487 2293 gene locus_tag LOCUS_17260 1487 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2472 3902 gene locus_tag LOCUS_17270 gene fadI 2472 3902 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT59 protein_id gnl|my_center|LOCUS_17270 3911 5161 gene locus_tag LOCUS_17280 3911 5161 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_17280 5506 5231 gene locus_tag LOCUS_17290 5506 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5394 6278 gene locus_tag LOCUS_17300 5394 6278 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0218 830 1174 gene locus_tag LOCUS_17310 830 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1430 1819 gene locus_tag LOCUS_17320 1430 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1974 2531 gene locus_tag LOCUS_17330 1974 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2545 3051 gene locus_tag LOCUS_17340 2545 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3002 3688 gene locus_tag LOCUS_17350 3002 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4133 4615 gene locus_tag LOCUS_17360 4133 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4619 5503 gene locus_tag LOCUS_17370 4619 5503 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_17370 5851 6363 gene locus_tag LOCUS_17380 5851 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6353 6772 gene locus_tag LOCUS_17390 6353 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence0219 6 1679 gene locus_tag LOCUS_17400 6 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4131 1723 gene locus_tag LOCUS_17410 4131 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_17410 5216 4341 gene locus_tag LOCUS_17420 5216 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5173 5352 gene locus_tag LOCUS_17430 5173 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7030 5510 gene locus_tag LOCUS_17440 7030 5510 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence0220 2655 547 gene locus_tag LOCUS_17450 gene greA 2655 547 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7G4 protein_id gnl|my_center|LOCUS_17450 2833 3720 gene locus_tag LOCUS_17460 2833 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3962 4993 gene locus_tag LOCUS_17470 gene rodZ 3962 4993 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32D46 protein_id gnl|my_center|LOCUS_17470 4990 6006 gene locus_tag LOCUS_17480 4990 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 6096 6779 gene locus_tag LOCUS_17490 6096 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0221 1534 212 gene locus_tag LOCUS_17500 1534 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2441 1536 gene locus_tag LOCUS_17510 2441 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2833 2438 gene locus_tag LOCUS_17520 gene ytrA 2833 2438 CDS product HTH-type transcriptional repressor YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34712 protein_id gnl|my_center|LOCUS_17520 3740 3003 gene locus_tag LOCUS_17530 3740 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4671 3742 gene locus_tag LOCUS_17540 gene mrsF 4671 3742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 protein_id gnl|my_center|LOCUS_17540 4896 5600 gene locus_tag LOCUS_17550 gene nth 4896 5600 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_17550 6740 5634 gene locus_tag LOCUS_17560 6740 5634 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence0222 2860 1952 gene locus_tag LOCUS_17570 2860 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4727 2913 gene locus_tag LOCUS_17580 4727 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5758 4817 gene locus_tag LOCUS_17590 5758 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0223 550 1557 gene locus_tag LOCUS_17600 550 1557 CDS product oxidoreductase ion channel protein IolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 protein_id gnl|my_center|LOCUS_17600 1681 2280 gene locus_tag LOCUS_17610 1681 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2335 3615 gene locus_tag LOCUS_17620 gene ftsA 2335 3615 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_17620 3612 5135 gene locus_tag LOCUS_17630 3612 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640134.1 protein_id gnl|my_center|LOCUS_17630 5264 6358 gene locus_tag LOCUS_17640 gene trpS 5264 6358 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA78 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0224 160 471 gene locus_tag LOCUS_17650 160 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2280 487 gene locus_tag LOCUS_17660 2280 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2275 2478 gene locus_tag LOCUS_17670 2275 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3776 2406 gene locus_tag LOCUS_17680 3776 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4288 3878 gene locus_tag LOCUS_17690 4288 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4878 4285 gene locus_tag LOCUS_17700 4878 4285 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAH3 protein_id gnl|my_center|LOCUS_17700 5926 5015 gene locus_tag LOCUS_17710 5926 5015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033580.1 protein_id gnl|my_center|LOCUS_17710 6091 6471 gene locus_tag LOCUS_17720 gene yciH 6091 6471 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_17720 6915 6496 gene locus_tag LOCUS_17730 6915 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0225 2428 233 gene locus_tag LOCUS_17740 gene katG 2428 233 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_17740 3117 2683 gene locus_tag LOCUS_17750 3117 2683 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_17750 3319 4257 gene locus_tag LOCUS_17760 3319 4257 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163350.1 protein_id gnl|my_center|LOCUS_17760 4254 6014 gene locus_tag LOCUS_17770 4254 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0226 108 1637 gene locus_tag LOCUS_17780 108 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1752 2825 gene locus_tag LOCUS_17790 1752 2825 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_17790 2856 3701 gene locus_tag LOCUS_17800 gene rmlD 2856 3701 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_17800 3698 4669 gene locus_tag LOCUS_17810 3698 4669 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_17810 4835 5737 gene locus_tag LOCUS_17820 4835 5737 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_17820 5734 6735 gene locus_tag LOCUS_17830 5734 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142445.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence0227 3196 1190 gene locus_tag LOCUS_17840 gene ligA 3196 1190 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_17840 3684 3250 gene locus_tag LOCUS_17850 3684 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3814 5319 gene locus_tag LOCUS_17860 3814 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 5357 6235 gene locus_tag LOCUS_17870 5357 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0228 821 195 gene locus_tag LOCUS_17880 821 195 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088682.1 protein_id gnl|my_center|LOCUS_17880 3305 2286 gene locus_tag LOCUS_17890 3305 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5172 3688 gene locus_tag LOCUS_17900 5172 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0229 <1 1191 gene locus_tag LOCUS_17910 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140902.1:membrane protein 1232 2218 gene locus_tag LOCUS_17920 1232 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2352 2951 gene locus_tag LOCUS_17930 2352 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3440 2952 gene locus_tag LOCUS_17940 3440 2952 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257746.1 protein_id gnl|my_center|LOCUS_17940 4015 3503 gene locus_tag LOCUS_17950 4015 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_17950 5031 4024 gene locus_tag LOCUS_17960 5031 4024 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809293.1 protein_id gnl|my_center|LOCUS_17960 5973 5041 gene locus_tag LOCUS_17970 gene rpoE 5973 5041 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_17970 6828 6037 gene locus_tag LOCUS_17980 6828 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence0230 618 211 gene locus_tag LOCUS_17990 618 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1592 687 gene locus_tag LOCUS_18000 gene serB 1592 687 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969711.1 protein_id gnl|my_center|LOCUS_18000 1829 3763 gene locus_tag LOCUS_18010 1829 3763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_18010 5661 3769 gene locus_tag LOCUS_18020 gene selB 5661 3769 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_18020 6131 5685 gene locus_tag LOCUS_18030 6131 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_18030 <6807 6143 gene locus_tag LOCUS_18040 <6807 6143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941477.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0231 <1 545 gene locus_tag LOCUS_18050 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 542 1924 gene locus_tag LOCUS_18060 542 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2006 2530 gene locus_tag LOCUS_18070 2006 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_18070 2637 2822 gene locus_tag LOCUS_18080 gene rpmF 2637 2822 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J363 protein_id gnl|my_center|LOCUS_18080 2855 3898 gene locus_tag LOCUS_18090 gene plsX 2855 3898 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_18090 3959 4900 gene locus_tag LOCUS_18100 gene fabD-2 3959 4900 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_18100 4967 5710 gene locus_tag LOCUS_18110 gene fabG-2 4967 5710 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_18110 5933 6175 gene locus_tag LOCUS_18120 gene acpP 5933 6175 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD2 protein_id gnl|my_center|LOCUS_18120 >Feature sequence0232 <1 1717 gene locus_tag LOCUS_18130 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMY6:ATP-dependent RecD-like DNA helicase 2659 1736 gene locus_tag LOCUS_18140 2659 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2968 4380 gene locus_tag LOCUS_18150 gene comM 2968 4380 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_18150 4377 4787 gene locus_tag LOCUS_18160 4377 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4784 5077 gene locus_tag LOCUS_18170 4784 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence0233 3223 3402 gene locus_tag LOCUS_18180 3223 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3406 3702 gene locus_tag LOCUS_18190 3406 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3706 4779 gene locus_tag LOCUS_18200 gene ahbD 3706 4779 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_18200 4795 5808 gene locus_tag LOCUS_18210 4795 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0234 <1 1079 gene locus_tag LOCUS_18220 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942882.1:lipopolysaccharide heptosyltransferase I 1269 2993 gene locus_tag LOCUS_18230 gene pilB 1269 2993 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_18230 3234 5864 gene locus_tag LOCUS_18240 3234 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 <6723 5990 gene locus_tag LOCUS_18250 <6723 5990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 >Feature sequence0235 <1 589 gene locus_tag LOCUS_18260 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224545.1:DNA-directed RNA polymerase sigma-70 factor 586 1044 gene locus_tag LOCUS_18270 586 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1150 2301 gene locus_tag LOCUS_18280 1150 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4729 2402 gene locus_tag LOCUS_18290 4729 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5275 5060 gene locus_tag LOCUS_18300 5275 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 5156 5416 gene locus_tag LOCUS_18310 5156 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence0236 <1 612 gene locus_tag LOCUS_18320 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117886.1:alkylhalidase 620 1921 gene locus_tag LOCUS_18330 620 1921 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_18330 1955 2401 gene locus_tag LOCUS_18340 1955 2401 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_18340 2398 3087 gene locus_tag LOCUS_18350 gene lolD1 2398 3087 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_18350 3072 6521 gene locus_tag LOCUS_18360 3072 6521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence0237 1971 3101 gene locus_tag LOCUS_18370 1971 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_18370 3101 4837 gene locus_tag LOCUS_18380 3101 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6608 4848 gene locus_tag LOCUS_18390 6608 4848 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence0238 418 44 gene locus_tag LOCUS_18400 418 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485429.1 protein_id gnl|my_center|LOCUS_18400 908 468 gene locus_tag LOCUS_18410 908 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1209 3632 gene locus_tag LOCUS_18420 1209 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3644 4630 gene locus_tag LOCUS_18430 3644 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 5116 4577 gene locus_tag LOCUS_18440 5116 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5348 5836 gene locus_tag LOCUS_18450 5348 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6362 5901 gene locus_tag LOCUS_18460 6362 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0239 661 2679 gene locus_tag LOCUS_18470 661 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2767 3660 gene locus_tag LOCUS_18480 gene purC 2767 3660 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_18480 4041 3715 gene locus_tag LOCUS_18490 4041 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18490 5754 4099 gene locus_tag LOCUS_18500 gene nadE 5754 4099 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18500 >Feature sequence0240 <1 677 gene locus_tag LOCUS_18510 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW5:1-acyl-sn-glycerol-3-phosphate acyltransferase 817 3075 gene locus_tag LOCUS_18520 817 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3075 3428 gene locus_tag LOCUS_18530 3075 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3531 4061 gene locus_tag LOCUS_18540 gene accB 3531 4061 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_18540 4136 5509 gene locus_tag LOCUS_18550 gene accC 4136 5509 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_18550 5506 6192 gene locus_tag LOCUS_18560 gene thiE 5506 6192 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL8 protein_id gnl|my_center|LOCUS_18560 >Feature sequence0241 83 1036 gene locus_tag LOCUS_18570 83 1036 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_18570 1101 1589 gene locus_tag LOCUS_18580 gene dcd 1101 1589 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G478 protein_id gnl|my_center|LOCUS_18580 1884 3374 gene locus_tag LOCUS_18590 1884 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3457 4929 gene locus_tag LOCUS_18600 3457 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence0242 1407 823 gene locus_tag LOCUS_18610 1407 823 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_18610 2083 1502 gene locus_tag LOCUS_18620 2083 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3434 2256 gene locus_tag LOCUS_18630 gene bcr 3434 2256 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_18630 3364 3591 gene locus_tag LOCUS_18640 3364 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3795 4214 gene locus_tag LOCUS_18650 3795 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_18650 5590 4220 gene locus_tag LOCUS_18660 5590 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0243 <1 1239 gene locus_tag LOCUS_18670 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071328.1:dipeptidyl peptidase S46 family protein 1470 2228 gene locus_tag LOCUS_18680 1470 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2235 3767 gene locus_tag LOCUS_18690 2235 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3771 5285 gene locus_tag LOCUS_18700 3771 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5511 6110 gene locus_tag LOCUS_18710 5511 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0244 <1 764 gene locus_tag LOCUS_18720 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000730383.1:bacillolysin 2247 877 gene locus_tag LOCUS_18730 2247 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4195 2303 gene locus_tag LOCUS_18740 4195 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5208 4195 gene locus_tag LOCUS_18750 5208 4195 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence0245 543 2219 gene locus_tag LOCUS_18760 543 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2588 5221 gene locus_tag LOCUS_18770 2588 5221 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence0246 2126 1290 gene locus_tag LOCUS_18780 gene folE2 2126 1290 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW8 protein_id gnl|my_center|LOCUS_18780 2062 2271 gene locus_tag LOCUS_18790 2062 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2511 5105 gene locus_tag LOCUS_18800 2511 5105 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_18800 5271 5990 gene locus_tag LOCUS_18810 5271 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0247 5 1390 gene locus_tag LOCUS_18820 5 1390 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_18820 2516 1557 gene locus_tag LOCUS_18830 gene mmuM 2516 1557 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258939.1 protein_id gnl|my_center|LOCUS_18830 2644 2569 gene locus_tag LOCUS_t00260 2644 2569 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2754 2679 gene locus_tag LOCUS_t00270 2754 2679 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2882 2806 gene locus_tag LOCUS_t00280 2882 2806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2965 2891 gene locus_tag LOCUS_t00290 2965 2891 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3045 2969 gene locus_tag LOCUS_t00300 3045 2969 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3122 3048 gene locus_tag LOCUS_t00310 3122 3048 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4130 3774 gene locus_tag LOCUS_18840 4130 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4575 4237 gene locus_tag LOCUS_18850 4575 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5999 4575 gene locus_tag LOCUS_18860 gene rtcB 5999 4575 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_18860 >Feature sequence0248 1846 1100 gene locus_tag LOCUS_18870 1846 1100 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_18870 3333 1843 gene locus_tag LOCUS_18880 3333 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3517 4011 gene locus_tag LOCUS_18890 3517 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 5113 4211 gene locus_tag LOCUS_18900 5113 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence0249 2286 688 gene locus_tag LOCUS_18910 2286 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2676 2290 gene locus_tag LOCUS_18920 2676 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4873 2789 gene locus_tag LOCUS_18930 4873 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5832 4870 gene locus_tag LOCUS_18940 5832 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 <6493 5829 gene locus_tag LOCUS_18950 <6493 5829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000490788.1:cytochrome c oxidase, cbb3-type subunit II >Feature sequence0250 3626 291 gene locus_tag LOCUS_18960 3626 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4403 3708 gene locus_tag LOCUS_18970 4403 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0251 1752 289 gene locus_tag LOCUS_18980 1752 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2069 2353 gene locus_tag LOCUS_18990 2069 2353 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_18990 2427 3779 gene locus_tag LOCUS_19000 2427 3779 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530553.1 protein_id gnl|my_center|LOCUS_19000 3850 4356 gene locus_tag LOCUS_19010 3850 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4377 5717 gene locus_tag LOCUS_19020 4377 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0252 <1 793 gene locus_tag LOCUS_19030 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter 793 1125 gene locus_tag LOCUS_19040 793 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1122 2933 gene locus_tag LOCUS_19050 1122 2933 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_19050 3354 2938 gene locus_tag LOCUS_19060 3354 2938 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_19060 5726 3351 gene locus_tag LOCUS_19070 gene mrcB 5726 3351 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_19070 >Feature sequence0253 3651 2512 gene locus_tag LOCUS_19080 3651 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 protein_id gnl|my_center|LOCUS_19080 5710 4127 gene locus_tag LOCUS_19090 5710 4127 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064271.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence0254 1257 316 gene locus_tag LOCUS_19100 1257 316 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_19100 2588 1620 gene locus_tag LOCUS_19110 2588 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6361 2708 gene locus_tag LOCUS_19120 6361 2708 CDS product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638195.2 protein_id gnl|my_center|LOCUS_19120 >Feature sequence0255 1934 849 gene locus_tag LOCUS_19130 1934 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2750 3421 gene locus_tag LOCUS_19140 2750 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3421 4056 gene locus_tag LOCUS_19150 3421 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4074 5177 gene locus_tag LOCUS_19160 4074 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence0256 1260 1808 gene locus_tag LOCUS_19170 1260 1808 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_19170 1836 2246 gene locus_tag LOCUS_19180 1836 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_19180 2239 3855 gene locus_tag LOCUS_19190 2239 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3983 4555 gene locus_tag LOCUS_19200 3983 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence0257 2671 1877 gene locus_tag LOCUS_19210 2671 1877 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_19210 3672 2668 gene locus_tag LOCUS_19220 gene galE 3672 2668 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_19220 4643 3669 gene locus_tag LOCUS_19230 4643 3669 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_19230 5949 4651 gene locus_tag LOCUS_19240 5949 4651 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence0258 <1 1785 gene locus_tag LOCUS_19250 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090515.1:adenylate cyclase >Feature sequence0259 188 1321 gene locus_tag LOCUS_19260 188 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1766 2530 gene locus_tag LOCUS_19270 1766 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2572 3969 gene locus_tag LOCUS_19280 2572 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence0260 5550 2188 gene locus_tag LOCUS_19290 5550 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0261 <1 606 gene locus_tag LOCUS_19300 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS0:Na(+)-translocating NADH-quinone reductase subunit F 782 1858 gene locus_tag LOCUS_19310 782 1858 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_19310 1855 2082 gene locus_tag LOCUS_19320 1855 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2529 2098 gene locus_tag LOCUS_19330 2529 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3545 2676 gene locus_tag LOCUS_19340 3545 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_19340 5239 3716 gene locus_tag LOCUS_19350 5239 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 <6278 5729 gene locus_tag LOCUS_19360 <6278 5729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639931.1:Xaa-Pro dipeptidase >Feature sequence0262 1237 2007 gene locus_tag LOCUS_19370 1237 2007 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 2007 3083 gene locus_tag LOCUS_19380 gene fni 2007 3083 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_19380 3094 4479 gene locus_tag LOCUS_19390 3094 4479 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_19390 4573 5745 gene locus_tag LOCUS_19400 gene mvaK1 4573 5745 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640469.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence0263 <1 2541 gene locus_tag LOCUS_19410 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747X9:isoleucine--tRNA ligase 2678 3511 gene locus_tag LOCUS_19420 2678 3511 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_19420 3777 4841 gene locus_tag LOCUS_19430 3777 4841 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 protein_id gnl|my_center|LOCUS_19430 5240 5923 gene locus_tag LOCUS_19440 5240 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence0264 297 1466 gene locus_tag LOCUS_19450 297 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2726 1791 gene locus_tag LOCUS_19460 2726 1791 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV9 protein_id gnl|my_center|LOCUS_19460 3448 2723 gene locus_tag LOCUS_19470 3448 2723 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_19470 4944 3445 gene locus_tag LOCUS_19480 gene gatB 4944 3445 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_19480 5015 5707 gene locus_tag LOCUS_19490 gene yfiH 5015 5707 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K13 protein_id gnl|my_center|LOCUS_19490 >Feature sequence0265 3042 2716 gene locus_tag LOCUS_19500 3042 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4085 3231 gene locus_tag LOCUS_19510 4085 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4436 5080 gene locus_tag LOCUS_19520 gene upp 4436 5080 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0266 770 1114 gene locus_tag LOCUS_19530 770 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1129 3306 gene locus_tag LOCUS_19540 1129 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_19540 3303 3986 gene locus_tag LOCUS_19550 3303 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_19550 3994 5229 gene locus_tag LOCUS_19560 3994 5229 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188359.1 protein_id gnl|my_center|LOCUS_19560 5226 5921 gene locus_tag LOCUS_19570 5226 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0267 134 670 gene locus_tag LOCUS_19580 134 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 695 1402 gene locus_tag LOCUS_19590 gene sfsA 695 1402 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_19590 1475 2545 gene locus_tag LOCUS_19600 1475 2545 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_19600 2561 3307 gene locus_tag LOCUS_19610 2561 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_19610 3934 3311 gene locus_tag LOCUS_19620 gene ppa 3934 3311 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67501 protein_id gnl|my_center|LOCUS_19620 6236 4074 gene locus_tag LOCUS_19630 6236 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0268 18 1007 gene locus_tag LOCUS_19640 gene msrP 18 1007 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAW9 protein_id gnl|my_center|LOCUS_19640 1046 1462 gene locus_tag LOCUS_19650 1046 1462 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_19650 2363 1482 gene locus_tag LOCUS_19660 2363 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_19660 2839 2360 gene locus_tag LOCUS_19670 2839 2360 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837388.1 protein_id gnl|my_center|LOCUS_19670 3142 5202 gene locus_tag LOCUS_19680 3142 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5360 5590 gene locus_tag LOCUS_19690 5360 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5580 5969 gene locus_tag LOCUS_19700 gene vapC2 5580 5969 CDS product ribonuclease VapC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71363 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0269 1329 253 gene locus_tag LOCUS_19710 1329 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2886 1423 gene locus_tag LOCUS_19720 2886 1423 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_19720 3163 4476 gene locus_tag LOCUS_19730 3163 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4574 5797 gene locus_tag LOCUS_19740 4574 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0270 243 1283 gene locus_tag LOCUS_19750 243 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1679 2326 gene locus_tag LOCUS_19760 1679 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2323 3027 gene locus_tag LOCUS_19770 2323 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 4041 3058 gene locus_tag LOCUS_19780 gene asd 4041 3058 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_19780 5029 4169 gene locus_tag LOCUS_19790 gene pssA 5029 4169 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_19790 5411 5193 gene locus_tag LOCUS_19800 5411 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0271 1346 438 gene locus_tag LOCUS_19810 1346 438 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546017.1 protein_id gnl|my_center|LOCUS_19810 2020 1349 gene locus_tag LOCUS_19820 2020 1349 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP3 protein_id gnl|my_center|LOCUS_19820 2868 2089 gene locus_tag LOCUS_19830 2868 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4217 2898 gene locus_tag LOCUS_19840 4217 2898 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_19840 5652 4408 gene locus_tag LOCUS_19850 5652 4408 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_19850 <6224 5661 gene locus_tag LOCUS_19860 <6224 5661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804130.1:iron ABC transporter permease >Feature sequence0272 87 2225 gene locus_tag LOCUS_19870 87 2225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_19870 2353 4059 gene locus_tag LOCUS_19880 2353 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4084 4893 gene locus_tag LOCUS_19890 4084 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4924 6159 gene locus_tag LOCUS_19900 4924 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence0273 413 592 gene locus_tag LOCUS_19910 413 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 682 1602 gene locus_tag LOCUS_19920 682 1602 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_19920 3946 2042 gene locus_tag LOCUS_19930 gene uup 3946 2042 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_19930 4161 5039 gene locus_tag LOCUS_19940 4161 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence0274 1219 770 gene locus_tag LOCUS_19950 1219 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2472 1216 gene locus_tag LOCUS_19960 2472 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2879 3565 gene locus_tag LOCUS_19970 2879 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3800 6115 gene locus_tag LOCUS_19980 3800 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence0275 537 1340 gene locus_tag LOCUS_19990 537 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1918 1361 gene locus_tag LOCUS_20000 1918 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_20000 2863 1928 gene locus_tag LOCUS_20010 gene yrbG 2863 1928 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_20010 4040 2874 gene locus_tag LOCUS_20020 4040 2874 CDS product putative lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700818.1 protein_id gnl|my_center|LOCUS_20020 4375 5889 gene locus_tag LOCUS_20030 4375 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence0276 436 1161 gene locus_tag LOCUS_20040 436 1161 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR95 protein_id gnl|my_center|LOCUS_20040 3277 1181 gene locus_tag LOCUS_20050 3277 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4440 3355 gene locus_tag LOCUS_20060 4440 3355 CDS product DUF4917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161327.1 protein_id gnl|my_center|LOCUS_20060 4483 5100 gene locus_tag LOCUS_20070 gene algU 4483 5100 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_20070 5097 6110 gene locus_tag LOCUS_20080 5097 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0277 501 914 gene locus_tag LOCUS_20090 501 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 914 2434 gene locus_tag LOCUS_20100 914 2434 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_20100 3368 2454 gene locus_tag LOCUS_20110 3368 2454 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 protein_id gnl|my_center|LOCUS_20110 4303 3371 gene locus_tag LOCUS_20120 4303 3371 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404543.1 protein_id gnl|my_center|LOCUS_20120 4402 5151 gene locus_tag LOCUS_20130 4402 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6146 5166 gene locus_tag LOCUS_20140 6146 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence0278 1081 251 gene locus_tag LOCUS_20150 gene trpC 1081 251 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT7 protein_id gnl|my_center|LOCUS_20150 2213 1188 gene locus_tag LOCUS_20160 gene trpD 2213 1188 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_20160 2871 2215 gene locus_tag LOCUS_20170 2871 2215 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_20170 4349 2868 gene locus_tag LOCUS_20180 gene trpE 4349 2868 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_20180 5044 4349 gene locus_tag LOCUS_20190 gene hisI 5044 4349 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC9 protein_id gnl|my_center|LOCUS_20190 5883 5044 gene locus_tag LOCUS_20200 gene hisF 5883 5044 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2T7 protein_id gnl|my_center|LOCUS_20200 >Feature sequence0279 1484 873 gene locus_tag LOCUS_20210 1484 873 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_20210 1736 3739 gene locus_tag LOCUS_20220 1736 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4579 3761 gene locus_tag LOCUS_20230 4579 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4627 5397 gene locus_tag LOCUS_20240 4627 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence0280 1184 204 gene locus_tag LOCUS_20250 gene panB 1184 204 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729A6 protein_id gnl|my_center|LOCUS_20250 2068 1418 gene locus_tag LOCUS_20260 gene dck 2068 1418 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20260 2327 3835 gene locus_tag LOCUS_20270 2327 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3948 4931 gene locus_tag LOCUS_20280 3948 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4971 5573 gene locus_tag LOCUS_20290 4971 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0281 2029 920 gene locus_tag LOCUS_20300 2029 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2569 3231 gene locus_tag LOCUS_20310 2569 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3215 3700 gene locus_tag LOCUS_20320 3215 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4535 5485 gene locus_tag LOCUS_20330 4535 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6082 5678 gene locus_tag LOCUS_20340 6082 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence0282 824 1087 gene locus_tag LOCUS_20350 824 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2467 1193 gene locus_tag LOCUS_20360 gene gltA 2467 1193 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_20360 3342 2743 gene locus_tag LOCUS_20370 3342 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3663 3577 gene locus_tag LOCUS_t00320 3663 3577 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4281 3763 gene locus_tag LOCUS_20380 4281 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5105 4359 gene locus_tag LOCUS_20390 gene tpi 5105 4359 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EP62 protein_id gnl|my_center|LOCUS_20390 <6077 5102 gene locus_tag LOCUS_20400 <6077 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLU1:phosphoglycerate kinase >Feature sequence0283 <1 886 gene locus_tag LOCUS_20410 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108543.1:hexapeptide transferase 1082 2881 gene locus_tag LOCUS_20420 gene lepA2 1082 2881 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_20420 2878 4092 gene locus_tag LOCUS_20430 2878 4092 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_20430 5695 4190 gene locus_tag LOCUS_20440 5695 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence0284 <1 516 gene locus_tag LOCUS_20450 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903462.1:acyl-CoA dehydrogenase 523 1662 gene locus_tag LOCUS_20460 523 1662 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_20460 1913 5251 gene locus_tag LOCUS_20470 gene icmF 1913 5251 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_20470 >Feature sequence0285 52 2466 gene locus_tag LOCUS_20480 52 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3095 2484 gene locus_tag LOCUS_20490 3095 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3356 4933 gene locus_tag LOCUS_20500 3356 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5044 5790 gene locus_tag LOCUS_20510 5044 5790 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence0286 57 1715 gene locus_tag LOCUS_20520 57 1715 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040799.1 protein_id gnl|my_center|LOCUS_20520 1847 1999 gene locus_tag LOCUS_20530 1847 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2256 3155 gene locus_tag LOCUS_20540 2256 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3140 4537 gene locus_tag LOCUS_20550 3140 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5176 4544 gene locus_tag LOCUS_20560 5176 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence0287 3378 217 gene locus_tag LOCUS_20570 3378 217 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_20570 4955 3375 gene locus_tag LOCUS_20580 4955 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 <6002 4969 gene locus_tag LOCUS_20590 <6002 4969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter >Feature sequence0288 3112 1232 gene locus_tag LOCUS_20600 gene pepF 3112 1232 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_20600 4299 3361 gene locus_tag LOCUS_20610 4299 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4522 4598 gene locus_tag LOCUS_t00330 4522 4598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5326 4682 gene locus_tag LOCUS_20620 5326 4682 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0289 >Feature sequence0290 1331 618 gene locus_tag LOCUS_20630 1331 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1833 1342 gene locus_tag LOCUS_20640 1833 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2273 1836 gene locus_tag LOCUS_20650 gene tolR 2273 1836 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_20650 2979 2290 gene locus_tag LOCUS_20660 2979 2290 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_20660 3906 3376 gene locus_tag LOCUS_20670 gene ruvC 3906 3376 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC90 protein_id gnl|my_center|LOCUS_20670 4655 3912 gene locus_tag LOCUS_20680 4655 3912 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_20680 >Feature sequence0291 2299 107 gene locus_tag LOCUS_20690 2299 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4278 2383 gene locus_tag LOCUS_20700 4278 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence0292 <1 821 gene locus_tag LOCUS_20710 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403272.1:lipid II flippase MurJ 987 2198 gene locus_tag LOCUS_20720 987 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4143 2206 gene locus_tag LOCUS_20730 4143 2206 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 protein_id gnl|my_center|LOCUS_20730 <5954 4180 gene locus_tag LOCUS_20740 <5954 4180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P336:phosphoenolpyruvate carboxylase >Feature sequence0293 >Feature sequence0294 815 2068 gene locus_tag LOCUS_20750 815 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2065 2793 gene locus_tag LOCUS_20760 2065 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3458 2820 gene locus_tag LOCUS_20770 3458 2820 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_20770 4703 3762 gene locus_tag LOCUS_20780 4703 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4976 5401 gene locus_tag LOCUS_20790 4976 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0295 160 1245 gene locus_tag LOCUS_20800 gene prfA 160 1245 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW0 protein_id gnl|my_center|LOCUS_20800 1275 3113 gene locus_tag LOCUS_20810 1275 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4365 3157 gene locus_tag LOCUS_20820 gene metB 4365 3157 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_20820 5000 4578 gene locus_tag LOCUS_20830 5000 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5139 5348 gene locus_tag LOCUS_20840 5139 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_20840 5399 5860 gene locus_tag LOCUS_20850 5399 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0296 255 1199 gene locus_tag LOCUS_20860 255 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3221 1689 gene locus_tag LOCUS_20870 3221 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3139 3339 gene locus_tag LOCUS_20880 3139 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence0297 115 1173 gene locus_tag LOCUS_20890 115 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1622 3202 gene locus_tag LOCUS_20900 gene glyQS 1622 3202 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_20900 3221 4498 gene locus_tag LOCUS_20910 3221 4498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028868.1 protein_id gnl|my_center|LOCUS_20910 4495 5301 gene locus_tag LOCUS_20920 4495 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0298 1505 186 gene locus_tag LOCUS_20930 1505 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2104 1697 gene locus_tag LOCUS_20940 gene atpC 2104 1697 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_20940 3622 2180 gene locus_tag LOCUS_20950 gene atpD 3622 2180 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_20950 4557 3688 gene locus_tag LOCUS_20960 gene atpG 4557 3688 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_20960 5908 4625 gene locus_tag LOCUS_20970 5908 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0299 <1 1597 gene locus_tag LOCUS_20980 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEQ0:protein TolB 1625 3025 gene locus_tag LOCUS_20990 1625 3025 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064557.1 protein_id gnl|my_center|LOCUS_20990 3022 4743 gene locus_tag LOCUS_21000 gene yahF 3022 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111846.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0300 605 763 gene locus_tag LOCUS_21010 605 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 846 1271 gene locus_tag LOCUS_21020 gene rsbW 846 1271 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_21020 1287 1637 gene locus_tag LOCUS_21030 1287 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1651 3249 gene locus_tag LOCUS_21040 1651 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3990 3286 gene locus_tag LOCUS_21050 3990 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5838 4012 gene locus_tag LOCUS_21060 5838 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0301 >Feature sequence0302 1782 829 gene locus_tag LOCUS_21070 1782 829 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_21070 1862 2995 gene locus_tag LOCUS_21080 gene hrcA 1862 2995 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_21080 3105 3869 gene locus_tag LOCUS_21090 3105 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence0303 49 447 gene locus_tag LOCUS_21100 49 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1619 444 gene locus_tag LOCUS_21110 1619 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4091 1890 gene locus_tag LOCUS_21120 gene fadJ 4091 1890 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_21120 4374 5666 gene locus_tag LOCUS_21130 4374 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence0304 <1 745 gene locus_tag LOCUS_21140 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405558.1:ATPase >Feature sequence0305 331 3093 gene locus_tag LOCUS_21150 331 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4021 3110 gene locus_tag LOCUS_21160 4021 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4819 4187 gene locus_tag LOCUS_21170 4819 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 5666 4863 gene locus_tag LOCUS_21180 5666 4863 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence0306 86 748 gene locus_tag LOCUS_21190 gene tal 86 748 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYD1 protein_id gnl|my_center|LOCUS_21190 738 1322 gene locus_tag LOCUS_21200 738 1322 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228239.1 protein_id gnl|my_center|LOCUS_21200 1394 2806 gene locus_tag LOCUS_21210 1394 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_21210 2849 3403 gene locus_tag LOCUS_21220 2849 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3423 4457 gene locus_tag LOCUS_21230 3423 4457 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_21230 5787 4525 gene locus_tag LOCUS_21240 5787 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0307 22 1761 gene locus_tag LOCUS_21250 22 1761 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_21250 1776 2414 gene locus_tag LOCUS_21260 1776 2414 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_21260 2411 3700 gene locus_tag LOCUS_21270 2411 3700 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence0308 2678 117 gene locus_tag LOCUS_21280 gene gyrA 2678 117 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_21280 5326 2783 gene locus_tag LOCUS_21290 gene gyrB 5326 2783 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_21290 >Feature sequence0309 1598 654 gene locus_tag LOCUS_21300 1598 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1745 2914 gene locus_tag LOCUS_21310 1745 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4564 2963 gene locus_tag LOCUS_21320 4564 2963 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_21320 5283 4561 gene locus_tag LOCUS_21330 gene drrA 5283 4561 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence0310 3606 2605 gene locus_tag LOCUS_21340 3606 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 5266 5357 gene locus_tag LOCUS_t00340 5266 5357 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0311 1329 973 gene locus_tag LOCUS_21350 gene rbfA 1329 973 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_21350 1619 1326 gene locus_tag LOCUS_21360 1619 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_21360 4556 1791 gene locus_tag LOCUS_21370 4556 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 <5791 4678 gene locus_tag LOCUS_21380 <5791 4678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT5:transcription termination/antitermination protein NusA >Feature sequence0312 >Feature sequence0313 272 1330 gene locus_tag LOCUS_21390 272 1330 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_21390 1332 2603 gene locus_tag LOCUS_21400 1332 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2606 3550 gene locus_tag LOCUS_21410 gene xerD 2606 3550 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPM0 protein_id gnl|my_center|LOCUS_21410 3675 4307 gene locus_tag LOCUS_21420 3675 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 4843 4286 gene locus_tag LOCUS_21430 4843 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 5787 5374 gene locus_tag LOCUS_21440 5787 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence0314 1198 3285 gene locus_tag LOCUS_21450 1198 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0315 725 1624 gene locus_tag LOCUS_21460 725 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1958 2896 gene locus_tag LOCUS_21470 1958 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4144 2975 gene locus_tag LOCUS_21480 4144 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5695 4268 gene locus_tag LOCUS_21490 5695 4268 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence0316 1080 94 gene locus_tag LOCUS_21500 1080 94 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_21500 1209 1820 gene locus_tag LOCUS_21510 1209 1820 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180V5 protein_id gnl|my_center|LOCUS_21510 1817 3529 gene locus_tag LOCUS_21520 1817 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3567 4844 gene locus_tag LOCUS_21530 3567 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 <5720 5034 gene locus_tag LOCUS_21540 <5720 5034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AW6:chaperone protein ClpB >Feature sequence0317 2032 806 gene locus_tag LOCUS_21550 gene proB 2032 806 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X86 protein_id gnl|my_center|LOCUS_21550 3202 2393 gene locus_tag LOCUS_21560 3202 2393 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_21560 3436 4986 gene locus_tag LOCUS_21570 3436 4986 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_21570 4995 5648 gene locus_tag LOCUS_21580 4995 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence0318 1060 413 gene locus_tag LOCUS_21590 1060 413 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_21590 2373 1057 gene locus_tag LOCUS_21600 2373 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3180 2389 gene locus_tag LOCUS_21610 3180 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3483 4220 gene locus_tag LOCUS_21620 3483 4220 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974325.1 protein_id gnl|my_center|LOCUS_21620 4273 5244 gene locus_tag LOCUS_21630 4273 5244 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QA1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence0319 1409 2329 gene locus_tag LOCUS_21640 1409 2329 CDS product NADH-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_21640 2326 3126 gene locus_tag LOCUS_21650 2326 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4381 3161 gene locus_tag LOCUS_21660 gene rimK 4381 3161 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_21660 4794 4378 gene locus_tag LOCUS_21670 4794 4378 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_21670 5606 5031 gene locus_tag LOCUS_21680 5606 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence0320 3237 1039 gene locus_tag LOCUS_21690 3237 1039 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_21690 3161 3433 gene locus_tag LOCUS_21700 3161 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 5238 3406 gene locus_tag LOCUS_21710 5238 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence0321 310 1533 gene locus_tag LOCUS_21720 310 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_21720 1530 2909 gene locus_tag LOCUS_21730 1530 2909 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_21730 2906 3922 gene locus_tag LOCUS_21740 gene rluC 2906 3922 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S74 protein_id gnl|my_center|LOCUS_21740 5123 3912 gene locus_tag LOCUS_21750 5123 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence0322 233 1126 gene locus_tag LOCUS_21760 233 1126 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204244.1 protein_id gnl|my_center|LOCUS_21760 1172 1957 gene locus_tag LOCUS_21770 1172 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2287 3450 gene locus_tag LOCUS_21780 gene rsgA 2287 3450 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A60 protein_id gnl|my_center|LOCUS_21780 4417 3479 gene locus_tag LOCUS_21790 4417 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5226 4561 gene locus_tag LOCUS_21800 5226 4561 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence0323 <1 669 gene locus_tag LOCUS_21810 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000823061.1:short-chain dehydrogenase 1069 2139 gene locus_tag LOCUS_21820 gene ldh 1069 2139 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_21820 4024 2177 gene locus_tag LOCUS_21830 4024 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 5161 4283 gene locus_tag LOCUS_21840 5161 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703674.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0324 2172 3095 gene locus_tag LOCUS_21850 2172 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_21850 4904 3309 gene locus_tag LOCUS_21860 gene prfC 4904 3309 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0325 1151 819 gene locus_tag LOCUS_21870 1151 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1897 1322 gene locus_tag LOCUS_21880 1897 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2904 2005 gene locus_tag LOCUS_21890 2904 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3921 3118 gene locus_tag LOCUS_21900 3921 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5185 4124 gene locus_tag LOCUS_21910 5185 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0326 822 1904 gene locus_tag LOCUS_21920 822 1904 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_21920 1901 4348 gene locus_tag LOCUS_21930 1901 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0327 624 301 gene locus_tag LOCUS_21940 624 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 759 3734 gene locus_tag LOCUS_21950 759 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3916 4869 gene locus_tag LOCUS_21960 3916 4869 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175798.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0328 2050 1538 gene locus_tag LOCUS_21970 2050 1538 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808853.1 protein_id gnl|my_center|LOCUS_21970 2449 3348 gene locus_tag LOCUS_21980 2449 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4186 3356 gene locus_tag LOCUS_21990 4186 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 4324 4905 gene locus_tag LOCUS_22000 4324 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence0329 254 3 gene locus_tag LOCUS_22010 254 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2280 352 gene locus_tag LOCUS_22020 2280 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3247 2396 gene locus_tag LOCUS_22030 gene hbd 3247 2396 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_22030 3460 5448 gene locus_tag LOCUS_22040 3460 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0330 <1 3846 gene locus_tag LOCUS_22050 <1 3846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338366.1:helicase 4069 4959 gene locus_tag LOCUS_22060 4069 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence0331 70 1053 gene locus_tag LOCUS_22070 gene wbtF 70 1053 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_22070 1151 2332 gene locus_tag LOCUS_22080 1151 2332 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_22080 2336 3952 gene locus_tag LOCUS_22090 2336 3952 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_22090 3936 4832 gene locus_tag LOCUS_22100 3936 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence0332 1046 204 gene locus_tag LOCUS_22110 1046 204 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_22110 2215 1058 gene locus_tag LOCUS_22120 2215 1058 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_22120 4090 2231 gene locus_tag LOCUS_22130 4090 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4911 4087 gene locus_tag LOCUS_22140 4911 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence0333 824 2473 gene locus_tag LOCUS_22150 824 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3190 2516 gene locus_tag LOCUS_22160 3190 2516 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_22160 3969 3187 gene locus_tag LOCUS_22170 3969 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_22170 4365 5093 gene locus_tag LOCUS_22180 4365 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence0334 2490 3878 gene locus_tag LOCUS_22190 2490 3878 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184834.1 protein_id gnl|my_center|LOCUS_22190 4144 3761 gene locus_tag LOCUS_22200 4144 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0335 3144 100 gene locus_tag LOCUS_22210 3144 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3299 5161 gene locus_tag LOCUS_22220 3299 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5452 5168 gene locus_tag LOCUS_22230 5452 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence0336 1617 1435 gene locus_tag LOCUS_22240 1617 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1564 2007 gene locus_tag LOCUS_22250 1564 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2655 3989 gene locus_tag LOCUS_22260 2655 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4086 4688 gene locus_tag LOCUS_22270 4086 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence0337 3227 5179 gene locus_tag LOCUS_22280 3227 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence0338 >Feature sequence0339 <1 1055 gene locus_tag LOCUS_22290 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941040.1:sigma-54-dependent Fis family transcriptional regulator 2053 1133 gene locus_tag LOCUS_22300 2053 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2386 3006 gene locus_tag LOCUS_22310 2386 3006 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence0340 2775 1768 gene locus_tag LOCUS_22320 2775 1768 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_22320 3090 5057 gene locus_tag LOCUS_22330 gene speA 3090 5057 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_22330 >Feature sequence0341 630 1349 gene locus_tag LOCUS_22340 630 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1428 4034 gene locus_tag LOCUS_22350 1428 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5126 4047 gene locus_tag LOCUS_22360 gene ddl 5126 4047 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_22360 >Feature sequence0342 1812 292 gene locus_tag LOCUS_22370 1812 292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_22370 1969 3408 gene locus_tag LOCUS_22380 1969 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0343 <1 1555 gene locus_tag LOCUS_22390 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase 1726 2967 gene locus_tag LOCUS_22400 1726 2967 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0344 306 902 gene locus_tag LOCUS_22410 306 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 953 1525 gene locus_tag LOCUS_22420 953 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1538 4255 gene locus_tag LOCUS_22430 1538 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 <5353 4237 gene locus_tag LOCUS_22440 <5353 4237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869175.1:chlorohydrolase >Feature sequence0345 472 957 gene locus_tag LOCUS_22450 472 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1004 2647 gene locus_tag LOCUS_22460 1004 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_22460 2762 4576 gene locus_tag LOCUS_22470 2762 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4580 5023 gene locus_tag LOCUS_22480 4580 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0346 482 1198 gene locus_tag LOCUS_22490 482 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1223 1516 gene locus_tag LOCUS_22500 1223 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3849 1555 gene locus_tag LOCUS_22510 3849 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4290 3904 gene locus_tag LOCUS_22520 4290 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 <5307 4321 gene locus_tag LOCUS_22530 <5307 4321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122266.1:Fis family transcriptional regulator >Feature sequence0347 1776 1018 gene locus_tag LOCUS_22540 1776 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2538 1948 gene locus_tag LOCUS_22550 2538 1948 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_22550 <5297 2535 gene locus_tag LOCUS_22560 <5297 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence0348 951 229 gene locus_tag LOCUS_22570 951 229 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_22570 1163 2542 gene locus_tag LOCUS_22580 1163 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2539 2916 gene locus_tag LOCUS_22590 2539 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2913 3545 gene locus_tag LOCUS_22600 2913 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence0349 3267 1831 gene locus_tag LOCUS_22610 3267 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3182 3535 gene locus_tag LOCUS_22620 3182 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 <5293 3550 gene locus_tag LOCUS_22630 <5293 3550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence0350 1093 500 gene locus_tag LOCUS_22640 1093 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2181 1090 gene locus_tag LOCUS_22650 2181 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2759 2181 gene locus_tag LOCUS_22660 gene nusB 2759 2181 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_22660 3241 2756 gene locus_tag LOCUS_22670 gene ribH 3241 2756 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_22670 3507 3431 gene locus_tag LOCUS_t00350 3507 3431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4023 3589 gene locus_tag LOCUS_22680 4023 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4346 4071 gene locus_tag LOCUS_22690 gene hup 4346 4071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_22690 <5292 4652 gene locus_tag LOCUS_22700 <5292 4652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AX4:GTPase Der >Feature sequence0351 4907 1368 gene locus_tag LOCUS_22710 4907 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence0352 2 277 gene locus_tag LOCUS_22720 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1076 1633 gene locus_tag LOCUS_22730 1076 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_22730 1816 3150 gene locus_tag LOCUS_22740 gene hemA 1816 3150 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS2 protein_id gnl|my_center|LOCUS_22740 3147 4055 gene locus_tag LOCUS_22750 gene hemC 3147 4055 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS3 protein_id gnl|my_center|LOCUS_22750 4070 4828 gene locus_tag LOCUS_22760 4070 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0353 <1 584 gene locus_tag LOCUS_22770 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941339.1:SAM-dependent methyltransferase 1825 599 gene locus_tag LOCUS_22780 1825 599 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_22780 3775 1865 gene locus_tag LOCUS_22790 3775 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4252 3812 gene locus_tag LOCUS_22800 4252 3812 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PV4 protein_id gnl|my_center|LOCUS_22800 4928 4332 gene locus_tag LOCUS_22810 4928 4332 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence0354 417 70 gene locus_tag LOCUS_22820 417 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1523 444 gene locus_tag LOCUS_22830 gene rsmH 1523 444 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R024 protein_id gnl|my_center|LOCUS_22830 1963 1523 gene locus_tag LOCUS_22840 gene mraZ 1963 1523 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX20 protein_id gnl|my_center|LOCUS_22840 2581 4284 gene locus_tag LOCUS_22850 2581 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4284 5117 gene locus_tag LOCUS_22860 4284 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0355 1604 615 gene locus_tag LOCUS_22870 1604 615 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_22870 3832 1601 gene locus_tag LOCUS_22880 3832 1601 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_22880 <5271 3829 gene locus_tag LOCUS_22890 <5271 3829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390233.1:methylmalonyl-CoA mutase >Feature sequence0356 116 1645 gene locus_tag LOCUS_22900 116 1645 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_22900 1897 1721 gene locus_tag LOCUS_22910 1897 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2110 4044 gene locus_tag LOCUS_22920 gene gaa 2110 4044 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence0357 604 2409 gene locus_tag LOCUS_22930 604 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence0358 <1 1641 gene locus_tag LOCUS_22940 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63TF9:alanine--tRNA ligase 1918 3177 gene locus_tag LOCUS_22950 1918 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4283 3420 gene locus_tag LOCUS_22960 4283 3420 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_22960 4671 4868 gene locus_tag LOCUS_22970 4671 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence0359 2 142 gene locus_tag LOCUS_22980 2 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 165 1367 gene locus_tag LOCUS_22990 165 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1364 2407 gene locus_tag LOCUS_23000 1364 2407 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_23000 2433 3857 gene locus_tag LOCUS_23010 2433 3857 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_23010 3854 5014 gene locus_tag LOCUS_23020 3854 5014 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence0360 1181 291 gene locus_tag LOCUS_23030 1181 291 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_23030 1880 1287 gene locus_tag LOCUS_23040 1880 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3193 2219 gene locus_tag LOCUS_23050 3193 2219 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098633.1 protein_id gnl|my_center|LOCUS_23050 3439 3672 gene locus_tag LOCUS_23060 3439 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3669 5048 gene locus_tag LOCUS_23070 3669 5048 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187694.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence0361 2048 489 gene locus_tag LOCUS_23080 gene pgi 2048 489 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK5 protein_id gnl|my_center|LOCUS_23080 2261 3262 gene locus_tag LOCUS_23090 2261 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3695 3216 gene locus_tag LOCUS_23100 3695 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4782 3958 gene locus_tag LOCUS_23110 4782 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4666 5148 gene locus_tag LOCUS_23120 4666 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence0362 1718 1089 gene locus_tag LOCUS_23130 1718 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2108 1734 gene locus_tag LOCUS_23140 2108 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2824 2162 gene locus_tag LOCUS_23150 2824 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3635 2799 gene locus_tag LOCUS_23160 gene parA 3635 2799 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_23160 4687 3794 gene locus_tag LOCUS_23170 4687 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4641 4904 gene locus_tag LOCUS_23180 4641 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence0363 <1 1543 gene locus_tag LOCUS_23190 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389280.1:energy-dependent translational throttle protein EttA 2628 1672 gene locus_tag LOCUS_23200 2628 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence0364 188 634 gene locus_tag LOCUS_23210 188 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 981 1433 gene locus_tag LOCUS_23220 981 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1447 1794 gene locus_tag LOCUS_23230 1447 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence0365 1606 158 gene locus_tag LOCUS_23240 1606 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2032 4530 gene locus_tag LOCUS_23250 2032 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence0366 2281 569 gene locus_tag LOCUS_23260 2281 569 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC24 protein_id gnl|my_center|LOCUS_23260 3370 2426 gene locus_tag LOCUS_23270 3370 2426 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_23270 5109 3445 gene locus_tag LOCUS_23280 gene ilvD 5109 3445 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51785 protein_id gnl|my_center|LOCUS_23280 >Feature sequence0367 1611 2729 gene locus_tag LOCUS_23290 gene pilT-4 1611 2729 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_23290 2733 3938 gene locus_tag LOCUS_23300 gene pilC 2733 3938 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence0368 1895 2725 gene locus_tag LOCUS_23310 1895 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3031 3765 gene locus_tag LOCUS_23320 3031 3765 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602630.1 protein_id gnl|my_center|LOCUS_23320 3762 4667 gene locus_tag LOCUS_23330 3762 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence0369 1099 512 gene locus_tag LOCUS_23340 1099 512 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_23340 2426 1218 gene locus_tag LOCUS_23350 2426 1218 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence0370 43 1605 gene locus_tag LOCUS_23360 gene rny 43 1605 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E27 protein_id gnl|my_center|LOCUS_23360 1602 2432 gene locus_tag LOCUS_23370 1602 2432 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_23370 2967 2422 gene locus_tag LOCUS_23380 2967 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3287 2964 gene locus_tag LOCUS_23390 3287 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3485 4564 gene locus_tag LOCUS_23400 gene aroC 3485 4564 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_23400 >Feature sequence0371 1637 2872 gene locus_tag LOCUS_23410 1637 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2869 4275 gene locus_tag LOCUS_23420 2869 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0372 1453 2601 gene locus_tag LOCUS_23430 1453 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3731 2556 gene locus_tag LOCUS_23440 3731 2556 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036857.1 protein_id gnl|my_center|LOCUS_23440 3879 4808 gene locus_tag LOCUS_23450 3879 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence0373 1754 1269 gene locus_tag LOCUS_23460 1754 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2346 1738 gene locus_tag LOCUS_23470 2346 1738 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_23470 3390 3602 gene locus_tag LOCUS_23480 3390 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3770 4735 gene locus_tag LOCUS_23490 3770 4735 CDS product plasmid replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence0374 734 345 gene locus_tag LOCUS_23500 734 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1050 2984 gene locus_tag LOCUS_23510 1050 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3636 3010 gene locus_tag LOCUS_23520 3636 3010 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024390.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence0375 749 1639 gene locus_tag LOCUS_23530 gene galE1 749 1639 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN67 protein_id gnl|my_center|LOCUS_23530 3609 1732 gene locus_tag LOCUS_23540 3609 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5048 3609 gene locus_tag LOCUS_23550 5048 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence0376 >Feature sequence0377 1784 507 gene locus_tag LOCUS_23560 1784 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3980 2979 gene locus_tag LOCUS_23570 3980 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence0378 2004 913 gene locus_tag LOCUS_23580 gene bioB 2004 913 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_23580 3118 2153 gene locus_tag LOCUS_23590 3118 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3358 3927 gene locus_tag LOCUS_23600 3358 3927 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence0379 <1 1269 gene locus_tag LOCUS_23610 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259099.1:glutamate synthase 1375 1557 gene locus_tag LOCUS_23620 1375 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2229 1567 gene locus_tag LOCUS_23630 gene trmH 2229 1567 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSB4 protein_id gnl|my_center|LOCUS_23630 2768 2292 gene locus_tag LOCUS_23640 2768 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3330 4700 gene locus_tag LOCUS_23650 gene nqrA 3330 4700 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0380 1352 696 gene locus_tag LOCUS_23660 1352 696 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_23660 3444 1459 gene locus_tag LOCUS_23670 3444 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3655 4521 gene locus_tag LOCUS_23680 3655 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_23680 >Feature sequence0381 2805 91 gene locus_tag LOCUS_23690 2805 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4913 2967 gene locus_tag LOCUS_23700 4913 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence0382 <1 2397 gene locus_tag LOCUS_23710 <1 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA 2481 3017 gene locus_tag LOCUS_23720 2481 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3026 4099 gene locus_tag LOCUS_23730 gene lpxD 3026 4099 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS9 protein_id gnl|my_center|LOCUS_23730 4240 4677 gene locus_tag LOCUS_23740 gene fabZ 4240 4677 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIM2 protein_id gnl|my_center|LOCUS_23740 >Feature sequence0383 1522 407 gene locus_tag LOCUS_23750 1522 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1682 2248 gene locus_tag LOCUS_23760 1682 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2245 3018 gene locus_tag LOCUS_23770 2245 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3015 3593 gene locus_tag LOCUS_23780 3015 3593 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_23780 3634 4356 gene locus_tag LOCUS_23790 3634 4356 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM4 protein_id gnl|my_center|LOCUS_23790 >Feature sequence0384 508 1704 gene locus_tag LOCUS_23800 508 1704 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_23800 2615 1701 gene locus_tag LOCUS_23810 2615 1701 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947299.1 protein_id gnl|my_center|LOCUS_23810 4073 2619 gene locus_tag LOCUS_23820 4073 2619 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence0385 3940 1946 gene locus_tag LOCUS_23830 3940 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3854 4147 gene locus_tag LOCUS_23840 3854 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4220 4459 gene locus_tag LOCUS_23850 4220 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence0386 472 1521 gene locus_tag LOCUS_23860 472 1521 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 protein_id gnl|my_center|LOCUS_23860 1523 4699 gene locus_tag LOCUS_23870 1523 4699 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0387 1481 2116 gene locus_tag LOCUS_23880 1481 2116 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence0388 900 2699 gene locus_tag LOCUS_23890 900 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2762 3415 gene locus_tag LOCUS_23900 2762 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 4123 3449 gene locus_tag LOCUS_23910 4123 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 <4942 4120 gene locus_tag LOCUS_23920 <4942 4120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070727.1:aminoglycoside phosphotransferase >Feature sequence0389 320 2905 gene locus_tag LOCUS_23930 gene celD 320 2905 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_23930 2923 4551 gene locus_tag LOCUS_23940 2923 4551 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0390 1040 2188 gene locus_tag LOCUS_23950 1040 2188 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_23950 2185 3381 gene locus_tag LOCUS_23960 2185 3381 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_23960 3378 4805 gene locus_tag LOCUS_23970 3378 4805 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence0391 2076 997 gene locus_tag LOCUS_23980 2076 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2447 2073 gene locus_tag LOCUS_23990 2447 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2398 2706 gene locus_tag LOCUS_24000 2398 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2703 3899 gene locus_tag LOCUS_24010 gene fadA 2703 3899 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence0392 611 3460 gene locus_tag LOCUS_24020 611 3460 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence0393 >Feature sequence0394 693 3083 gene locus_tag LOCUS_24030 693 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence0395 951 4127 gene locus_tag LOCUS_24040 951 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence0396 1487 561 gene locus_tag LOCUS_24050 1487 561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_24050 1886 2077 gene locus_tag LOCUS_24060 1886 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2074 3111 gene locus_tag LOCUS_24070 2074 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3148 3450 gene locus_tag LOCUS_24080 3148 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4598 3333 gene locus_tag LOCUS_24090 4598 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence0397 1612 158 gene locus_tag LOCUS_24100 1612 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2411 1614 gene locus_tag LOCUS_24110 2411 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3503 2559 gene locus_tag LOCUS_24120 3503 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence0398 317 3247 gene locus_tag LOCUS_24130 317 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence0399 2878 2444 gene locus_tag LOCUS_24140 2878 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3328 2882 gene locus_tag LOCUS_24150 3328 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_24150 3635 3318 gene locus_tag LOCUS_24160 3635 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <4873 3663 gene locus_tag LOCUS_24170 <4873 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029529.1:type IV secretion protein Rhs >Feature sequence0400 596 1123 gene locus_tag LOCUS_24180 596 1123 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_24180 1928 1158 gene locus_tag LOCUS_24190 1928 1158 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_24190 2764 1988 gene locus_tag LOCUS_24200 2764 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2856 4664 gene locus_tag LOCUS_24210 2856 4664 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0401 448 1695 gene locus_tag LOCUS_24220 gene argD 448 1695 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_24220 1692 2840 gene locus_tag LOCUS_24230 1692 2840 CDS product acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_24230 3483 2860 gene locus_tag LOCUS_24240 3483 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence0402 2048 1068 gene locus_tag LOCUS_24250 2048 1068 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814467.1 protein_id gnl|my_center|LOCUS_24250 2578 2045 gene locus_tag LOCUS_24260 gene foxI 2578 2045 CDS product ECF sigma factor FoxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 protein_id gnl|my_center|LOCUS_24260 2804 4741 gene locus_tag LOCUS_24270 2804 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0403 1053 487 gene locus_tag LOCUS_24280 1053 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1372 2340 gene locus_tag LOCUS_24290 1372 2340 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_24290 2342 3256 gene locus_tag LOCUS_24300 2342 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3259 3750 gene locus_tag LOCUS_24310 3259 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3747 4745 gene locus_tag LOCUS_24320 3747 4745 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405282.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence0404 1697 144 gene locus_tag LOCUS_24330 1697 144 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24330 2056 1682 gene locus_tag LOCUS_24340 2056 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2862 2098 gene locus_tag LOCUS_24350 2862 2098 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_24350 3689 2964 gene locus_tag LOCUS_24360 gene prmA 3689 2964 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU72 protein_id gnl|my_center|LOCUS_24360 4518 3700 gene locus_tag LOCUS_24370 4518 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence0405 250 1221 gene locus_tag LOCUS_24380 250 1221 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_24380 1230 1886 gene locus_tag LOCUS_24390 1230 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3003 1906 gene locus_tag LOCUS_24400 3003 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_24400 3746 3039 gene locus_tag LOCUS_24410 gene pdxH 3746 3039 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_24410 4668 3736 gene locus_tag LOCUS_24420 4668 3736 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence0406 615 2771 gene locus_tag LOCUS_24430 615 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2962 3699 gene locus_tag LOCUS_24440 2962 3699 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence0407 1374 409 gene locus_tag LOCUS_24450 1374 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1547 1813 gene locus_tag LOCUS_24460 1547 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2012 3247 gene locus_tag LOCUS_24470 2012 3247 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_24470 3244 4053 gene locus_tag LOCUS_24480 3244 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence0408 1278 163 gene locus_tag LOCUS_24490 1278 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 <4784 1649 gene locus_tag LOCUS_24500 <4784 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258114.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0409 4176 1948 gene locus_tag LOCUS_24510 4176 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4778 4167 gene locus_tag LOCUS_24520 4778 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0410 43 1068 gene locus_tag LOCUS_24530 gene pheS 43 1068 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_24530 1121 3634 gene locus_tag LOCUS_24540 gene pheT 1121 3634 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH19 protein_id gnl|my_center|LOCUS_24540 3863 4294 gene locus_tag LOCUS_24550 3863 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence0411 454 92 gene locus_tag LOCUS_24560 454 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1172 528 gene locus_tag LOCUS_24570 1172 528 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_24570 2443 1547 gene locus_tag LOCUS_24580 2443 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence0412 213 890 gene locus_tag LOCUS_24590 213 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2420 906 gene locus_tag LOCUS_24600 2420 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2709 4445 gene locus_tag LOCUS_24610 2709 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence0413 470 1978 gene locus_tag LOCUS_24620 470 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1997 2614 gene locus_tag LOCUS_24630 1997 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2880 3260 gene locus_tag LOCUS_24640 2880 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3270 4139 gene locus_tag LOCUS_24650 3270 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence0414 983 1222 gene locus_tag LOCUS_24660 983 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1996 1313 gene locus_tag LOCUS_24670 1996 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 3171 1993 gene locus_tag LOCUS_24680 gene ncx 3171 1993 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 protein_id gnl|my_center|LOCUS_24680 3784 3371 gene locus_tag LOCUS_24690 3784 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4396 3863 gene locus_tag LOCUS_24700 4396 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0415 136 720 gene locus_tag LOCUS_24710 136 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 713 1258 gene locus_tag LOCUS_24720 713 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1255 2616 gene locus_tag LOCUS_24730 1255 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2630 3202 gene locus_tag LOCUS_24740 2630 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence0416 853 1440 gene locus_tag LOCUS_24750 853 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1606 2424 gene locus_tag LOCUS_24760 1606 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3351 2431 gene locus_tag LOCUS_24770 3351 2431 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812234.1 protein_id gnl|my_center|LOCUS_24770 3503 4624 gene locus_tag LOCUS_24780 3503 4624 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence0417 2247 172 gene locus_tag LOCUS_24790 gene fusA2 2247 172 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_24790 2836 2366 gene locus_tag LOCUS_24800 gene rpsG 2836 2366 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7U8 protein_id gnl|my_center|LOCUS_24800 3251 2877 gene locus_tag LOCUS_24810 gene rpsL 3251 2877 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_24810 3681 4043 gene locus_tag LOCUS_24820 3681 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 <4718 4162 gene locus_tag LOCUS_24830 <4718 4162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7EPD8:DNA-directed RNA polymerase subunit beta' >Feature sequence0418 393 1265 gene locus_tag LOCUS_24840 393 1265 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106287.1 protein_id gnl|my_center|LOCUS_24840 1262 2002 gene locus_tag LOCUS_24850 1262 2002 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_24850 1999 2325 gene locus_tag LOCUS_24860 1999 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2394 2753 gene locus_tag LOCUS_24870 2394 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3026 3448 gene locus_tag LOCUS_24880 3026 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3445 3873 gene locus_tag LOCUS_24890 3445 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence0419 48 1451 gene locus_tag LOCUS_24900 48 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1649 2683 gene locus_tag LOCUS_24910 1649 2683 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_24910 <4667 2713 gene locus_tag LOCUS_24920 <4667 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:peptidase M16 >Feature sequence0420 <1 1621 gene locus_tag LOCUS_24930 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087049.1:two-component system sensor histidine kinase/response regulator 3695 1710 gene locus_tag LOCUS_24940 3695 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0421 <1 755 gene locus_tag LOCUS_24950 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523564.1:asparagine synthetase B 794 2581 gene locus_tag LOCUS_24960 gene sglT 794 2581 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0422 317 565 gene locus_tag LOCUS_24970 317 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1501 581 gene locus_tag LOCUS_24980 gene cysK 1501 581 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPW5 protein_id gnl|my_center|LOCUS_24980 1792 3723 gene locus_tag LOCUS_24990 gene acsA 1792 3723 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_24990 >Feature sequence0423 2585 291 gene locus_tag LOCUS_25000 2585 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2888 3502 gene locus_tag LOCUS_25010 2888 3502 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence0424 <1 536 gene locus_tag LOCUS_25020 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943188.1:lipoprotein 804 2120 gene locus_tag LOCUS_25030 804 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2281 2541 gene locus_tag LOCUS_25040 2281 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2742 3455 gene locus_tag LOCUS_25050 2742 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4499 3549 gene locus_tag LOCUS_25060 4499 3549 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 protein_id gnl|my_center|LOCUS_25060 4648 4496 gene locus_tag LOCUS_25070 4648 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence0425 935 117 gene locus_tag LOCUS_25080 935 117 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517446.1 protein_id gnl|my_center|LOCUS_25080 2185 977 gene locus_tag LOCUS_25090 2185 977 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_25090 2435 3001 gene locus_tag LOCUS_25100 2435 3001 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence0426 <1 1206 gene locus_tag LOCUS_25110 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:histidine kinase 1206 1604 gene locus_tag LOCUS_25120 gene crcB 1206 1604 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHZ4 protein_id gnl|my_center|LOCUS_25120 1694 2203 gene locus_tag LOCUS_25130 1694 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2289 3377 gene locus_tag LOCUS_25140 gene ansA 2289 3377 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence0427 956 1558 gene locus_tag LOCUS_25150 956 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1578 2282 gene locus_tag LOCUS_25160 1578 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2279 3763 gene locus_tag LOCUS_25170 2279 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0428 1179 454 gene locus_tag LOCUS_25180 1179 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1594 1869 gene locus_tag LOCUS_25190 1594 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2045 2920 gene locus_tag LOCUS_25200 2045 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence0429 1043 2206 gene locus_tag LOCUS_25210 1043 2206 CDS product 1,3-propanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_25210 3353 2223 gene locus_tag LOCUS_25220 3353 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence0430 2542 962 gene locus_tag LOCUS_25230 gene serA 2542 962 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35136 protein_id gnl|my_center|LOCUS_25230 3703 2633 gene locus_tag LOCUS_25240 3703 2633 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_25240 4336 3881 gene locus_tag LOCUS_25250 4336 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4586 4359 gene locus_tag LOCUS_25260 4586 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence0431 <4583 759 gene locus_tag LOCUS_25270 <4583 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766165.1:multidrug ABC transporter ATP-binding protein >Feature sequence0432 <1 1173 gene locus_tag LOCUS_25280 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942964.1:amine oxidase 1170 1988 gene locus_tag LOCUS_25290 1170 1988 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_25290 2002 3315 gene locus_tag LOCUS_25300 gene cfa 2002 3315 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_25300 3312 4349 gene locus_tag LOCUS_25310 gene cfa 3312 4349 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence0433 230 571 gene locus_tag LOCUS_25320 230 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1431 691 gene locus_tag LOCUS_25330 1431 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2201 1428 gene locus_tag LOCUS_25340 gene udp 2201 1428 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9X9 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0434 1536 637 gene locus_tag LOCUS_25350 1536 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_25350 2555 1533 gene locus_tag LOCUS_25360 2555 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_25360 3397 2621 gene locus_tag LOCUS_25370 3397 2621 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence0435 1118 87 gene locus_tag LOCUS_25380 gene gpsA 1118 87 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_25380 2461 1118 gene locus_tag LOCUS_25390 2461 1118 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_25390 2606 4021 gene locus_tag LOCUS_25400 2606 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence0436 1635 1045 gene locus_tag LOCUS_25410 1635 1045 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_25410 1881 2300 gene locus_tag LOCUS_25420 1881 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence0437 807 16 gene locus_tag LOCUS_25430 807 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1405 800 gene locus_tag LOCUS_25440 1405 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2326 1580 gene locus_tag LOCUS_25450 2326 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 2495 3043 gene locus_tag LOCUS_25460 gene kptA 2495 3043 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_25460 3176 3769 gene locus_tag LOCUS_25470 3176 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence0438 2378 306 gene locus_tag LOCUS_25480 2378 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2864 3922 gene locus_tag LOCUS_25490 2864 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence0439 <1 995 gene locus_tag LOCUS_25500 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258445.1:diguanylate cyclase 1357 2616 gene locus_tag LOCUS_25510 1357 2616 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_25510 2788 3480 gene locus_tag LOCUS_25520 2788 3480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_25520 3510 4190 gene locus_tag LOCUS_25530 3510 4190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768705.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence0440 293 1363 gene locus_tag LOCUS_25540 gene tsaD 293 1363 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C11 protein_id gnl|my_center|LOCUS_25540 1489 2769 gene locus_tag LOCUS_25550 gene aspC 1489 2769 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_25550 3799 2780 gene locus_tag LOCUS_25560 3799 2780 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202183.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence0441 2122 488 gene locus_tag LOCUS_25570 2122 488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_25570 2555 3481 gene locus_tag LOCUS_25580 2555 3481 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence0442 330 1145 gene locus_tag LOCUS_25590 330 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2242 1160 gene locus_tag LOCUS_25600 2242 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3207 2431 gene locus_tag LOCUS_25610 3207 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence0443 <1 994 gene locus_tag LOCUS_25620 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702802.1:putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 999 3119 gene locus_tag LOCUS_25630 999 3119 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence0444 2 652 gene locus_tag LOCUS_25640 2 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1212 649 gene locus_tag LOCUS_25650 1212 649 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_25650 2505 1348 gene locus_tag LOCUS_25660 2505 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3337 3495 gene locus_tag LOCUS_25670 3337 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3946 3560 gene locus_tag LOCUS_25680 3946 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence0445 <1 953 gene locus_tag LOCUS_25690 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121881.1:deoxyribodipyrimidine photo-lyase 957 2354 gene locus_tag LOCUS_25700 957 2354 CDS product capsular polysaccharide biosynthesis protein CapK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_25700 2547 3359 gene locus_tag LOCUS_25710 2547 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 <4455 3445 gene locus_tag LOCUS_25720 <4455 3445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJA3:Lon protease >Feature sequence0446 98 328 gene locus_tag LOCUS_25730 98 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 649 966 gene locus_tag LOCUS_25740 gene rplU 649 966 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B7Z0 protein_id gnl|my_center|LOCUS_25740 998 1258 gene locus_tag LOCUS_25750 gene rpmA 998 1258 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_25750 1414 2595 gene locus_tag LOCUS_25760 gene obg 1414 2595 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM0 protein_id gnl|my_center|LOCUS_25760 2592 3206 gene locus_tag LOCUS_25770 2592 3206 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_25770 3219 3680 gene locus_tag LOCUS_25780 3219 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence0447 1973 2659 gene locus_tag LOCUS_25790 1973 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2656 3429 gene locus_tag LOCUS_25800 2656 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence0448 384 1151 gene locus_tag LOCUS_25810 384 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1756 1157 gene locus_tag LOCUS_25820 1756 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence0449 <4423 3379 gene locus_tag LOCUS_25830 <4423 3379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026866.1:oxidoreductase >Feature sequence0450 1595 345 gene locus_tag LOCUS_25840 1595 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1736 3457 gene locus_tag LOCUS_25850 gene ggtB 1736 3457 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_25850 3652 3969 gene locus_tag LOCUS_25860 3652 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence0451 2263 203 gene locus_tag LOCUS_25870 2263 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1727 1820 gene locus_tag LOCUS_t00360 1727 1820 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <4403 2583 gene locus_tag LOCUS_25880 <4403 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113792.1:sodium:sulfate symporter >Feature sequence0452 1707 193 gene locus_tag LOCUS_25890 1707 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence0453 2378 801 gene locus_tag LOCUS_25900 2378 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3544 2756 gene locus_tag LOCUS_25910 3544 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3798 3541 gene locus_tag LOCUS_25920 3798 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence0454 986 1543 gene locus_tag LOCUS_25930 986 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_25930 1584 2855 gene locus_tag LOCUS_25940 gene sbcD 1584 2855 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVQ9 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0455 1593 178 gene locus_tag LOCUS_25950 1593 178 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_25950 2856 1663 gene locus_tag LOCUS_25960 2856 1663 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_25960 4136 2856 gene locus_tag LOCUS_25970 4136 2856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0456 1488 706 gene locus_tag LOCUS_25980 1488 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2647 1652 gene locus_tag LOCUS_25990 2647 1652 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_25990 2781 4250 gene locus_tag LOCUS_26000 2781 4250 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence0457 1202 858 gene locus_tag LOCUS_26010 1202 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2569 1370 gene locus_tag LOCUS_26020 2569 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence0458 1480 137 gene locus_tag LOCUS_26030 1480 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1843 3960 gene locus_tag LOCUS_26040 1843 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence0459 1461 61 gene locus_tag LOCUS_26050 gene argH 1461 61 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817C7 protein_id gnl|my_center|LOCUS_26050 2815 1610 gene locus_tag LOCUS_26060 gene argG 2815 1610 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_26060 3279 2812 gene locus_tag LOCUS_26070 gene argR 3279 2812 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4Y9 protein_id gnl|my_center|LOCUS_26070 >Feature sequence0460 2725 3564 gene locus_tag LOCUS_26080 2725 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence0461 342 2045 gene locus_tag LOCUS_26090 342 2045 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_26090 <4355 2161 gene locus_tag LOCUS_26100 <4355 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531373.1:DEAD/DEAH box helicase >Feature sequence0462 972 2444 gene locus_tag LOCUS_26110 gene metB 972 2444 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_26110 2491 3870 gene locus_tag LOCUS_26120 2491 3870 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE20 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0463 1858 2319 gene locus_tag LOCUS_26130 1858 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2460 3329 gene locus_tag LOCUS_26140 2460 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3813 3310 gene locus_tag LOCUS_26150 3813 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence0464 32 1048 gene locus_tag LOCUS_26160 32 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1162 1614 gene locus_tag LOCUS_26170 1162 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1727 2602 gene locus_tag LOCUS_26180 1727 2602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence0465 <1 1881 gene locus_tag LOCUS_26190 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase 3415 2111 gene locus_tag LOCUS_26200 3415 2111 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026863.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence0466 1107 904 gene locus_tag LOCUS_26210 1107 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1380 1180 gene locus_tag LOCUS_26220 1380 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1849 1484 gene locus_tag LOCUS_26230 1849 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1968 2405 gene locus_tag LOCUS_26240 1968 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0467 701 75 gene locus_tag LOCUS_26250 701 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1381 731 gene locus_tag LOCUS_26260 1381 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3005 1458 gene locus_tag LOCUS_26270 gene purH 3005 1458 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9N7 protein_id gnl|my_center|LOCUS_26270 3916 3113 gene locus_tag LOCUS_26280 3916 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence0468 972 2390 gene locus_tag LOCUS_26290 972 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2420 3352 gene locus_tag LOCUS_26300 2420 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 <4318 3376 gene locus_tag LOCUS_26310 <4318 3376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527296.1:NYN domain-containing protein >Feature sequence0469 <1 1007 gene locus_tag LOCUS_26320 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidyl-prolyl cis-trans isomerase 1109 1657 gene locus_tag LOCUS_26330 1109 1657 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_26330 1754 2359 gene locus_tag LOCUS_26340 1754 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2352 3353 gene locus_tag LOCUS_26350 2352 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence0470 449 2380 gene locus_tag LOCUS_26360 gene mutL 449 2380 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY2 protein_id gnl|my_center|LOCUS_26360 >Feature sequence0471 1786 356 gene locus_tag LOCUS_26370 1786 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3173 1935 gene locus_tag LOCUS_26380 gene ftsA 3173 1935 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_26380 >Feature sequence0472 974 1453 gene locus_tag LOCUS_26390 974 1453 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977400.1 protein_id gnl|my_center|LOCUS_26390 1443 2471 gene locus_tag LOCUS_26400 1443 2471 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_26400 3118 2606 gene locus_tag LOCUS_26410 3118 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence0473 1778 3112 gene locus_tag LOCUS_26420 1778 3112 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867911.1 protein_id gnl|my_center|LOCUS_26420 3691 3116 gene locus_tag LOCUS_26430 3691 3116 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_26430 <4291 3688 gene locus_tag LOCUS_26440 <4291 3688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease >Feature sequence0474 1905 121 gene locus_tag LOCUS_26450 1905 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3173 1902 gene locus_tag LOCUS_26460 3173 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3967 3170 gene locus_tag LOCUS_26470 3967 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence0475 <1 3603 gene locus_tag LOCUS_26480 <1 3603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122787.1:helicase 3607 3873 gene locus_tag LOCUS_26490 3607 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence0476 120 812 gene locus_tag LOCUS_26500 120 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 809 2200 gene locus_tag LOCUS_26510 809 2200 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_26510 2631 2227 gene locus_tag LOCUS_26520 2631 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2897 3934 gene locus_tag LOCUS_26530 2897 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence0477 <1 851 gene locus_tag LOCUS_26540 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388194.1:acyl-CoA dehydrogenase 848 1732 gene locus_tag LOCUS_26550 848 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1729 4038 gene locus_tag LOCUS_26560 1729 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence0478 1929 1030 gene locus_tag LOCUS_26570 1929 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 <4250 2012 gene locus_tag LOCUS_26580 <4250 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404446.1:acyl-CoA oxidase >Feature sequence0479 >Feature sequence0480 133 1500 gene locus_tag LOCUS_26590 133 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1500 1880 gene locus_tag LOCUS_26600 1500 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_26600 1877 2686 gene locus_tag LOCUS_26610 1877 2686 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_26610 2677 4137 gene locus_tag LOCUS_26620 2677 4137 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence0481 842 369 gene locus_tag LOCUS_26630 842 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1336 887 gene locus_tag LOCUS_26640 1336 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1850 1377 gene locus_tag LOCUS_26650 1850 1377 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_26650 3525 1906 gene locus_tag LOCUS_26660 3525 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence0482 306 920 gene locus_tag LOCUS_26670 306 920 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_26670 904 1470 gene locus_tag LOCUS_26680 904 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1782 2092 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctttaattacgcctgctca 2165 3250 gene locus_tag LOCUS_26690 2165 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3530 3757 gene locus_tag LOCUS_26700 3530 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence0483 18 407 gene locus_tag LOCUS_26710 18 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_26710 759 433 gene locus_tag LOCUS_26720 759 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 905 1453 gene locus_tag LOCUS_26730 905 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 <4224 1446 gene locus_tag LOCUS_26740 <4224 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence0484 1362 2357 gene locus_tag LOCUS_26750 1362 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2662 3378 gene locus_tag LOCUS_26760 2662 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence0485 1568 1954 gene locus_tag LOCUS_26770 1568 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86237 protein_id gnl|my_center|LOCUS_26770 2102 2437 gene locus_tag LOCUS_26780 2102 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2517 3053 gene locus_tag LOCUS_26790 2517 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3473 3057 gene locus_tag LOCUS_26800 3473 3057 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_26800 3886 3470 gene locus_tag LOCUS_26810 3886 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0486 2518 1604 gene locus_tag LOCUS_26820 gene psuG 2518 1604 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0487 831 403 gene locus_tag LOCUS_26830 831 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 1153 3714 gene locus_tag LOCUS_26840 1153 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0488 379 1815 gene locus_tag LOCUS_26850 379 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence0489 <1 870 gene locus_tag LOCUS_26860 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403544.1:carboxyl-terminal processing protease 1130 1906 gene locus_tag LOCUS_26870 1130 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2623 1913 gene locus_tag LOCUS_26880 2623 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence0490 1443 3068 gene locus_tag LOCUS_26890 1443 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence0491 1157 336 gene locus_tag LOCUS_26900 1157 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1250 2428 gene locus_tag LOCUS_26910 1250 2428 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_26910 2444 3115 gene locus_tag LOCUS_26920 2444 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3298 4029 gene locus_tag LOCUS_26930 gene modA 3298 4029 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence0492 372 563 gene locus_tag LOCUS_26940 372 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1045 863 gene locus_tag LOCUS_26950 1045 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233032.2 protein_id gnl|my_center|LOCUS_26950 <4174 1042 gene locus_tag LOCUS_26960 <4174 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:multidrug transporter AcrB >Feature sequence0493 386 1228 gene locus_tag LOCUS_26970 386 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2648 1272 gene locus_tag LOCUS_26980 2648 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3835 2648 gene locus_tag LOCUS_26990 3835 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708720.1 protein_id gnl|my_center|LOCUS_26990 4119 3877 gene locus_tag LOCUS_27000 4119 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence0494 717 454 gene locus_tag LOCUS_27010 717 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 819 1448 gene locus_tag LOCUS_27020 819 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1720 3243 gene locus_tag LOCUS_27030 1720 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence0495 352 2094 gene locus_tag LOCUS_27040 352 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2115 2543 gene locus_tag LOCUS_27050 2115 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2592 2834 gene locus_tag LOCUS_27060 2592 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2831 3718 gene locus_tag LOCUS_27070 2831 3718 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence0496 3115 1511 gene locus_tag LOCUS_27080 3115 1511 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122586.1 protein_id gnl|my_center|LOCUS_27080 3607 3200 gene locus_tag LOCUS_27090 3607 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence0497 3017 564 gene locus_tag LOCUS_27100 3017 564 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_27100 3605 3195 gene locus_tag LOCUS_27110 3605 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3682 3888 gene locus_tag LOCUS_27120 3682 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3885 4103 gene locus_tag LOCUS_27130 3885 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0498 1347 397 gene locus_tag LOCUS_27140 1347 397 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD65 protein_id gnl|my_center|LOCUS_27140 2778 1360 gene locus_tag LOCUS_27150 gene rimO 2778 1360 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_27150 >Feature sequence0499 1467 826 gene locus_tag LOCUS_27160 1467 826 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_27160 2209 1472 gene locus_tag LOCUS_27170 gene cinA 2209 1472 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_27170 2737 2949 gene locus_tag LOCUS_27180 2737 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence0500 1332 2222 gene locus_tag LOCUS_27190 1332 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3914 2298 gene locus_tag LOCUS_27200 3914 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence0501 1095 1610 gene locus_tag LOCUS_27210 1095 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_27210 1653 2846 gene locus_tag LOCUS_27220 1653 2846 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_27220 3033 3566 gene locus_tag LOCUS_27230 3033 3566 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence0502 2475 739 gene locus_tag LOCUS_27240 2475 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0503 586 1773 gene locus_tag LOCUS_27250 586 1773 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence0504 1972 635 gene locus_tag LOCUS_27260 1972 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27260 2197 2027 gene locus_tag LOCUS_27270 2197 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence0505 1358 99 gene locus_tag LOCUS_27280 1358 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1514 3844 gene locus_tag LOCUS_27290 gene glnS 1514 3844 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_27290 >Feature sequence0506 1802 543 gene locus_tag LOCUS_27300 1802 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3838 1799 gene locus_tag LOCUS_27310 3838 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence0507 3 1235 gene locus_tag LOCUS_27320 3 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2327 1272 gene locus_tag LOCUS_27330 gene queA 2327 1272 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_27330 3393 2359 gene locus_tag LOCUS_27340 3393 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 <4094 3386 gene locus_tag LOCUS_27350 <4094 3386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42062:oligopeptide transport system permease protein AppB >Feature sequence0508 6 1580 gene locus_tag LOCUS_27360 6 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1791 2708 gene locus_tag LOCUS_27370 1791 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence0509 <1 1581 gene locus_tag LOCUS_27380 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:acyl-peptide hydrolase 1807 2778 gene locus_tag LOCUS_27390 1807 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2974 3414 gene locus_tag LOCUS_27400 2974 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence0510 2531 3496 gene locus_tag LOCUS_27410 2531 3496 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948636.1 protein_id gnl|my_center|LOCUS_27410 3828 3640 gene locus_tag LOCUS_27420 3828 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence0511 1589 315 gene locus_tag LOCUS_27430 gene ribBA 1589 315 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_27430 1892 3232 gene locus_tag LOCUS_27440 1892 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence0512 2203 737 gene locus_tag LOCUS_27450 2203 737 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_27450 2353 3279 gene locus_tag LOCUS_27460 2353 3279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_27460 3740 3285 gene locus_tag LOCUS_27470 3740 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0513 2814 859 gene locus_tag LOCUS_27480 2814 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence0514 949 1734 gene locus_tag LOCUS_27490 949 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1818 3284 gene locus_tag LOCUS_27500 1818 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence0515 2228 1554 gene locus_tag LOCUS_27510 2228 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2729 2235 gene locus_tag LOCUS_27520 2729 2235 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_27520 3576 2794 gene locus_tag LOCUS_27530 3576 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence0516 1184 339 gene locus_tag LOCUS_27540 1184 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3318 1246 gene locus_tag LOCUS_27550 3318 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0517 63 323 gene locus_tag LOCUS_27560 63 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 316 1182 gene locus_tag LOCUS_27570 gene pstA2 316 1182 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_27570 1179 2024 gene locus_tag LOCUS_27580 gene pstB 1179 2024 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D46 protein_id gnl|my_center|LOCUS_27580 2710 2108 gene locus_tag LOCUS_27590 2710 2108 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_27590 3934 2843 gene locus_tag LOCUS_27600 3934 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence0518 1792 308 gene locus_tag LOCUS_27610 gene murD 1792 308 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_27610 2877 1792 gene locus_tag LOCUS_27620 gene mraY 2877 1792 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_27620 <4007 2877 gene locus_tag LOCUS_27630 <4007 2877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085108.1:tricarballylate dehydrogenase >Feature sequence0519 <1 2433 gene locus_tag LOCUS_27640 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635825.2:nuclease 2548 3162 gene locus_tag LOCUS_27650 2548 3162 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence0520 1126 182 gene locus_tag LOCUS_27660 gene fmt 1126 182 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_27660 <3992 1136 gene locus_tag LOCUS_27670 <3992 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938956.1:DNA translocase FtsK >Feature sequence0521 1344 706 gene locus_tag LOCUS_27680 1344 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2506 1475 gene locus_tag LOCUS_27690 2506 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3156 2503 gene locus_tag LOCUS_27700 3156 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3252 3746 gene locus_tag LOCUS_27710 3252 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0522 345 1376 gene locus_tag LOCUS_27720 345 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_27720 1961 1383 gene locus_tag LOCUS_27730 1961 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_27730 <3988 2042 gene locus_tag LOCUS_27740 <3988 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532900.1:oxidoreductase subunit beta >Feature sequence0523 1600 3675 gene locus_tag LOCUS_27750 gene fusA-1 1600 3675 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence0524 364 2103 gene locus_tag LOCUS_27760 364 2103 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_27760 2938 2111 gene locus_tag LOCUS_27770 gene parA 2938 2111 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_27770 3588 2992 gene locus_tag LOCUS_27780 3588 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0525 >Feature sequence0526 903 2705 gene locus_tag LOCUS_27790 903 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3358 2675 gene locus_tag LOCUS_27800 3358 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence0527 389 1837 gene locus_tag LOCUS_27810 389 1837 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_27810 1990 2676 gene locus_tag LOCUS_27820 1990 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0528 1442 681 gene locus_tag LOCUS_27830 1442 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence0529 473 123 gene locus_tag LOCUS_27840 473 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1732 797 gene locus_tag LOCUS_27850 1732 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2977 1850 gene locus_tag LOCUS_27860 2977 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0530 566 1327 gene locus_tag LOCUS_27870 566 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2140 1364 gene locus_tag LOCUS_27880 2140 1364 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_27880 2442 2182 gene locus_tag LOCUS_27890 2442 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3301 2477 gene locus_tag LOCUS_27900 3301 2477 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_27900 <3916 3329 gene locus_tag LOCUS_27910 <3916 3329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MZP3:release factor glutamine methyltransferase >Feature sequence0531 52 2907 gene locus_tag LOCUS_27920 52 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2939 3787 gene locus_tag LOCUS_27930 2939 3787 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence0532 1820 951 gene locus_tag LOCUS_27940 1820 951 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_27940 <3907 1879 gene locus_tag LOCUS_27950 <3907 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BJ1:protein translocase subunit SecA >Feature sequence0533 2032 986 gene locus_tag LOCUS_27960 2032 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2588 3220 gene locus_tag LOCUS_27970 2588 3220 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 protein_id gnl|my_center|LOCUS_27970 3228 3533 gene locus_tag LOCUS_27980 3228 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence0534 553 2184 gene locus_tag LOCUS_27990 gene pruA 553 2184 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_27990 2287 2730 gene locus_tag LOCUS_28000 2287 2730 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0535 2336 660 gene locus_tag LOCUS_28010 gene nadB 2336 660 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S64 protein_id gnl|my_center|LOCUS_28010 3379 2333 gene locus_tag LOCUS_28020 gene nadA 3379 2333 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S63 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0536 <1 793 gene locus_tag LOCUS_28030 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZY34:membrane-bound lytic murein transglycosylase A 849 2144 gene locus_tag LOCUS_28040 849 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2228 2740 gene locus_tag LOCUS_28050 2228 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2886 3155 gene locus_tag LOCUS_28060 2886 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3152 3601 gene locus_tag LOCUS_28070 3152 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0537 1962 2741 gene locus_tag LOCUS_28080 1962 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2788 3576 gene locus_tag LOCUS_28090 2788 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence0538 709 2238 gene locus_tag LOCUS_28100 709 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3255 2266 gene locus_tag LOCUS_28110 3255 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3866 3255 gene locus_tag LOCUS_28120 gene ribE 3866 3255 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65328 protein_id gnl|my_center|LOCUS_28120 >Feature sequence0539 947 723 gene locus_tag LOCUS_28130 947 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1181 2683 gene locus_tag LOCUS_28140 1181 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 <3885 2777 gene locus_tag LOCUS_28150 <3885 2777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635913.2:ribonuclease >Feature sequence0540 1328 627 gene locus_tag LOCUS_28160 gene fabG 1328 627 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_28160 1354 2811 gene locus_tag LOCUS_28170 1354 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2856 3632 gene locus_tag LOCUS_28180 2856 3632 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence0541 1356 1880 gene locus_tag LOCUS_28190 1356 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1877 2743 gene locus_tag LOCUS_28200 1877 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence0542 846 466 gene locus_tag LOCUS_28210 846 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 873 1125 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgcattaagtgcgcgaaaagg 2477 1179 gene locus_tag LOCUS_28220 2477 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3262 2474 gene locus_tag LOCUS_28230 3262 2474 CDS product prophage P3 protein 7, DNA replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102136.1 protein_id gnl|my_center|LOCUS_28230 3423 3265 gene locus_tag LOCUS_28240 3423 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence0543 3345 1489 gene locus_tag LOCUS_28250 gene uvrC 3345 1489 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_28250 <3870 3367 gene locus_tag LOCUS_28260 <3870 3367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q837R9:UvrABC system protein B >Feature sequence0544 2148 1519 gene locus_tag LOCUS_28270 2148 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3464 2295 gene locus_tag LOCUS_28280 gene fabH2 3464 2295 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 protein_id gnl|my_center|LOCUS_28280 >Feature sequence0545 203 1996 gene locus_tag LOCUS_28290 203 1996 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_28290 1993 3201 gene locus_tag LOCUS_28300 1993 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0546 <1 1878 gene locus_tag LOCUS_28310 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMU1:histidine kinase 2014 3240 gene locus_tag LOCUS_28320 2014 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence0547 1735 398 gene locus_tag LOCUS_28330 1735 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1987 2481 gene locus_tag LOCUS_28340 1987 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2773 3393 gene locus_tag LOCUS_28350 2773 3393 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence0548 2428 473 gene locus_tag LOCUS_28360 2428 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388240.1 protein_id gnl|my_center|LOCUS_28360 3308 2466 gene locus_tag LOCUS_28370 3308 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_28370 <3856 3338 gene locus_tag LOCUS_28380 <3856 3338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071838.1:ABC-F family ATPase >Feature sequence0549 1944 1027 gene locus_tag LOCUS_28390 1944 1027 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_28390 2264 3487 gene locus_tag LOCUS_28400 2264 3487 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence0550 <1 1608 gene locus_tag LOCUS_28410 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039194.1:gamma-glutamyltranspeptidase 1785 2435 gene locus_tag LOCUS_28420 1785 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2447 3565 gene locus_tag LOCUS_28430 2447 3565 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence0551 206 577 gene locus_tag LOCUS_28440 206 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1437 775 gene locus_tag LOCUS_28450 1437 775 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_28450 2087 1413 gene locus_tag LOCUS_28460 2087 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2574 2846 gene locus_tag LOCUS_28470 2574 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence0552 500 2527 gene locus_tag LOCUS_28480 500 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3324 2545 gene locus_tag LOCUS_28490 3324 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3762 3463 gene locus_tag LOCUS_28500 3762 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0553 1405 776 gene locus_tag LOCUS_28510 1405 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2022 1729 gene locus_tag LOCUS_28520 2022 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0554 501 13 gene locus_tag LOCUS_28530 501 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 666 1094 gene locus_tag LOCUS_28540 666 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1299 3728 gene locus_tag LOCUS_28550 1299 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence0555 <3825 1130 gene locus_tag LOCUS_28560 <3825 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase >Feature sequence0556 2884 1253 gene locus_tag LOCUS_28570 2884 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3233 2874 gene locus_tag LOCUS_28580 3233 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence0557 771 118 gene locus_tag LOCUS_28590 771 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1229 2182 gene locus_tag LOCUS_28600 1229 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225285.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence0558 369 2120 gene locus_tag LOCUS_28610 369 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2117 2719 gene locus_tag LOCUS_28620 2117 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2754 3152 gene locus_tag LOCUS_28630 2754 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3145 3573 gene locus_tag LOCUS_28640 3145 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence0559 <1 1631 gene locus_tag LOCUS_28650 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038648.1:aminopeptidase 3298 1640 gene locus_tag LOCUS_28660 3298 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0560 1858 2460 gene locus_tag LOCUS_28670 1858 2460 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence0561 1220 1930 gene locus_tag LOCUS_28680 1220 1930 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970955.1 protein_id gnl|my_center|LOCUS_28680 2137 2745 gene locus_tag LOCUS_28690 gene pdxH 2137 2745 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Z5 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0562 1030 2259 gene locus_tag LOCUS_28700 1030 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2372 3793 gene locus_tag LOCUS_28710 2372 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence0563 1641 1297 gene locus_tag LOCUS_28720 1641 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3318 1741 gene locus_tag LOCUS_28730 3318 1741 CDS product kumamolisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230162.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0564 3182 684 gene locus_tag LOCUS_28740 3182 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence0565 2717 555 gene locus_tag LOCUS_28750 2717 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3234 2791 gene locus_tag LOCUS_28760 3234 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence0566 110 1708 gene locus_tag LOCUS_28770 110 1708 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_28770 <3777 1762 gene locus_tag LOCUS_28780 <3777 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815004.1:bifunctional hydroxylase/oxidoreductase >Feature sequence0567 596 2275 gene locus_tag LOCUS_28790 596 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence0568 >Feature sequence0569 205 1158 gene locus_tag LOCUS_28800 205 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0570 1231 1509 gene locus_tag LOCUS_28810 1231 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1527 3602 gene locus_tag LOCUS_28820 1527 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence0571 2022 1225 gene locus_tag LOCUS_28830 2022 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2284 2060 gene locus_tag LOCUS_28840 2284 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 <3761 2265 gene locus_tag LOCUS_28850 <3761 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228902.1:S-layer-like protein >Feature sequence0572 42 740 gene locus_tag LOCUS_28860 42 740 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_28860 2654 774 gene locus_tag LOCUS_28870 2654 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3467 2802 gene locus_tag LOCUS_28880 3467 2802 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence0573 <1 1794 gene locus_tag LOCUS_28890 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084777.1:RiPP maturation radical SAM protein 1 >Feature sequence0574 159 545 gene locus_tag LOCUS_28900 159 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 542 3430 gene locus_tag LOCUS_28910 542 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence0575 296 1576 gene locus_tag LOCUS_28920 296 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1637 2713 gene locus_tag LOCUS_28930 1637 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975794.1 protein_id gnl|my_center|LOCUS_28930 2725 3639 gene locus_tag LOCUS_28940 2725 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0576 >Feature sequence0577 478 1584 gene locus_tag LOCUS_28950 478 1584 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_28950 1575 2930 gene locus_tag LOCUS_28960 1575 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_28960 3465 2959 gene locus_tag LOCUS_28970 3465 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence0578 >Feature sequence0579 175 1011 gene locus_tag LOCUS_28980 175 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 998 1498 gene locus_tag LOCUS_28990 998 1498 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072653.1 protein_id gnl|my_center|LOCUS_28990 1595 1747 gene locus_tag LOCUS_29000 1595 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1784 2896 gene locus_tag LOCUS_29010 1784 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29010 >Feature sequence0580 197 2818 gene locus_tag LOCUS_29020 197 2818 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108017.1 protein_id gnl|my_center|LOCUS_29020 2838 3434 gene locus_tag LOCUS_29030 2838 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence0581 >Feature sequence0582 439 1056 gene locus_tag LOCUS_29040 439 1056 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695341.1 protein_id gnl|my_center|LOCUS_29040 1148 2617 gene locus_tag LOCUS_29050 gene zwf 1148 2617 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_29050 2671 3441 gene locus_tag LOCUS_29060 gene pgl 2671 3441 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence0583 >Feature sequence0584 1513 611 gene locus_tag LOCUS_29070 1513 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2431 1637 gene locus_tag LOCUS_29080 2431 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3399 2545 gene locus_tag LOCUS_29090 3399 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence0585 783 1400 gene locus_tag LOCUS_29100 783 1400 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence0586 444 980 gene locus_tag LOCUS_29110 444 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1001 2050 gene locus_tag LOCUS_29120 1001 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3385 2207 gene locus_tag LOCUS_29130 3385 2207 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence0587 1431 238 gene locus_tag LOCUS_29140 1431 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 2816 1482 gene locus_tag LOCUS_29150 2816 1482 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0588 479 261 gene locus_tag LOCUS_29160 479 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 741 666 gene locus_tag LOCUS_t00370 741 666 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2141 801 gene locus_tag LOCUS_29170 gene purA 2141 801 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_29170 2472 2864 gene locus_tag LOCUS_29180 2472 2864 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence0589 <1 1288 gene locus_tag LOCUS_29190 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256826.1:cytochrome c biogenesis protein 3276 1309 gene locus_tag LOCUS_29200 3276 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3646 3359 gene locus_tag LOCUS_29210 3646 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0590 667 1254 gene locus_tag LOCUS_29220 667 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_29220 2379 1267 gene locus_tag LOCUS_29230 2379 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3000 2776 gene locus_tag LOCUS_29240 3000 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3639 3142 gene locus_tag LOCUS_29250 3639 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence0591 2077 380 gene locus_tag LOCUS_29260 2077 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2314 3564 gene locus_tag LOCUS_29270 2314 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence0592 238 945 gene locus_tag LOCUS_29280 238 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence0593 3043 1106 gene locus_tag LOCUS_29290 3043 1106 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0594 <1 1089 gene locus_tag LOCUS_29300 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455175.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence0595 2468 3466 gene locus_tag LOCUS_29310 gene xerD 2468 3466 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K068 protein_id gnl|my_center|LOCUS_29310 >Feature sequence0596 1917 541 gene locus_tag LOCUS_29320 gene dhs1 1917 541 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0597 731 237 gene locus_tag LOCUS_29330 731 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1338 877 gene locus_tag LOCUS_29340 1338 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_29340 2997 1381 gene locus_tag LOCUS_29350 2997 1381 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_29350 3330 3602 gene locus_tag LOCUS_29360 3330 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence0598 1396 410 gene locus_tag LOCUS_29370 1396 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence0599 964 1122 gene locus_tag LOCUS_29380 964 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1760 1137 gene locus_tag LOCUS_29390 1760 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2338 1757 gene locus_tag LOCUS_29400 2338 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2965 2351 gene locus_tag LOCUS_29410 2965 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence0600 2530 2892 gene locus_tag LOCUS_29420 2530 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2935 3354 gene locus_tag LOCUS_29430 2935 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence0601 >Feature sequence0602 1956 1399 gene locus_tag LOCUS_29440 1956 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 <3601 1986 gene locus_tag LOCUS_29450 <3601 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:pilus modification protein PilQ >Feature sequence0603 2285 2010 gene locus_tag LOCUS_29460 2285 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887737.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence0604 154 489 gene locus_tag LOCUS_29470 154 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 833 1882 gene locus_tag LOCUS_29480 833 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3593 2901 gene locus_tag LOCUS_29490 3593 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0605 236 847 gene locus_tag LOCUS_29500 236 847 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_29500 870 1316 gene locus_tag LOCUS_29510 870 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1313 1651 gene locus_tag LOCUS_29520 1313 1651 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_29520 3022 1658 gene locus_tag LOCUS_29530 3022 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence0606 3320 1866 gene locus_tag LOCUS_29540 3320 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence0607 828 1472 gene locus_tag LOCUS_29550 828 1472 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_29550 2734 1880 gene locus_tag LOCUS_29560 2734 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0608 >Feature sequence0609 411 1376 gene locus_tag LOCUS_29570 411 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1532 2065 gene locus_tag LOCUS_29580 1532 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29580 <3579 2162 gene locus_tag LOCUS_29590 <3579 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539668.1:long-chain-fatty-acid--CoA ligase >Feature sequence0610 <3574 1385 gene locus_tag LOCUS_29600 <3574 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944011.1:multidrug transporter AcrB >Feature sequence0611 1477 617 gene locus_tag LOCUS_29610 gene parB 1477 617 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_29610 2357 1596 gene locus_tag LOCUS_29620 gene parA 2357 1596 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_29620 2995 2390 gene locus_tag LOCUS_29630 2995 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0612 777 3527 gene locus_tag LOCUS_29640 777 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence0613 >Feature sequence0614 321 1193 gene locus_tag LOCUS_29650 321 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1208 1978 gene locus_tag LOCUS_29660 1208 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence0615 29 2986 gene locus_tag LOCUS_29670 29 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3461 2997 gene locus_tag LOCUS_29680 3461 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence0616 29 1297 gene locus_tag LOCUS_29690 29 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 2840 1308 gene locus_tag LOCUS_29700 2840 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence0617 <1 708 gene locus_tag LOCUS_29710 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023151.1:Zn-dependent exopeptidase M28 791 1396 gene locus_tag LOCUS_29720 791 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1801 1409 gene locus_tag LOCUS_29730 1801 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1888 2634 gene locus_tag LOCUS_29740 1888 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_29740 2912 2631 gene locus_tag LOCUS_29750 2912 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3435 2956 gene locus_tag LOCUS_29760 3435 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence0618 1754 18 gene locus_tag LOCUS_29770 gene bmrA 1754 18 CDS product multidrug resistance ABC transporter ATP-binding/permease protein BmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06967 protein_id gnl|my_center|LOCUS_29770 1942 2826 gene locus_tag LOCUS_29780 gene yerO 1942 2826 CDS product putative HTH-type transcriptional regulator YerO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31500 protein_id gnl|my_center|LOCUS_29780 2973 3332 gene locus_tag LOCUS_29790 2973 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence0619 >Feature sequence0620 1 306 gene locus_tag LOCUS_29800 1 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 409 3102 gene locus_tag LOCUS_29810 gene aceE 409 3102 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_29810 >Feature sequence0621 3516 2500 gene locus_tag LOCUS_29820 3516 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence0622 1825 827 gene locus_tag LOCUS_29830 1825 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3448 1991 gene locus_tag LOCUS_29840 3448 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence0623 131 1717 gene locus_tag LOCUS_29850 131 1717 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_29850 2154 2489 gene locus_tag LOCUS_29860 2154 2489 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence0624 1601 123 gene locus_tag LOCUS_29870 1601 123 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_29870 3440 1839 gene locus_tag LOCUS_29880 3440 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702019.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence0625 1777 1160 gene locus_tag LOCUS_29890 1777 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3292 1946 gene locus_tag LOCUS_29900 3292 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence0626 122 1156 gene locus_tag LOCUS_29910 122 1156 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVT8 protein_id gnl|my_center|LOCUS_29910 >Feature sequence0627 736 2328 gene locus_tag LOCUS_29920 gene badA 736 2328 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_29920 2506 3441 gene locus_tag LOCUS_29930 2506 3441 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence0628 514 1200 gene locus_tag LOCUS_29940 514 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1197 2426 gene locus_tag LOCUS_29950 1197 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence0629 819 670 gene locus_tag LOCUS_29960 819 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 976 3360 gene locus_tag LOCUS_29970 976 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence0630 2088 3074 gene locus_tag LOCUS_29980 2088 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence0631 <1 1044 gene locus_tag LOCUS_29990 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964845.1:TIGR00266 family protein 1211 1286 gene locus_tag LOCUS_t00380 1211 1286 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1543 2118 gene locus_tag LOCUS_30000 1543 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2130 3242 gene locus_tag LOCUS_30010 gene ald 2130 3242 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_30010 >Feature sequence0632 80 1558 gene locus_tag LOCUS_30020 gene pepQ 80 1558 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_30020 1561 2433 gene locus_tag LOCUS_30030 1561 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 2615 2986 gene locus_tag LOCUS_30040 2615 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence0633 2269 2943 gene locus_tag LOCUS_30050 2269 2943 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0634 >Feature sequence0635 495 968 gene locus_tag LOCUS_30060 495 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 965 1438 gene locus_tag LOCUS_30070 965 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1631 2305 gene locus_tag LOCUS_30080 1631 2305 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0636 <1 1240 gene locus_tag LOCUS_30090 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8F8:UPF0061 protein 1352 2254 gene locus_tag LOCUS_30100 1352 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0637 512 1465 gene locus_tag LOCUS_30110 512 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1942 3312 gene locus_tag LOCUS_30120 1942 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence0638 663 1091 gene locus_tag LOCUS_30130 663 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 2557 1100 gene locus_tag LOCUS_30140 2557 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 >Feature sequence0639 892 671 gene locus_tag LOCUS_30150 892 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2277 931 gene locus_tag LOCUS_30160 2277 931 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048416.1 protein_id gnl|my_center|LOCUS_30160 2849 2274 gene locus_tag LOCUS_30170 2849 2274 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_30170 3451 2846 gene locus_tag LOCUS_30180 3451 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 >Feature sequence0640 3037 23 gene locus_tag LOCUS_30190 3037 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence0641 1242 316 gene locus_tag LOCUS_30200 gene phhA 1242 316 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204188.1 protein_id gnl|my_center|LOCUS_30200 2263 1481 gene locus_tag LOCUS_30210 2263 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 <3444 2437 gene locus_tag LOCUS_30220 <3444 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257513.1:glycosyl transferase >Feature sequence0642 764 294 gene locus_tag LOCUS_30230 gene gcvH 764 294 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_30230 1990 764 gene locus_tag LOCUS_30240 gene iscS 1990 764 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_30240 3177 1987 gene locus_tag LOCUS_30250 3177 1987 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence0643 2090 1245 gene locus_tag LOCUS_30260 2090 1245 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_30260 3076 2087 gene locus_tag LOCUS_30270 gene mtsA 3076 2087 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence0644 740 429 gene locus_tag LOCUS_30280 740 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 992 1918 gene locus_tag LOCUS_30290 992 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 2041 2544 gene locus_tag LOCUS_30300 gene def 2041 2544 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_30300 2573 2950 gene locus_tag LOCUS_30310 2573 2950 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJT6 protein_id gnl|my_center|LOCUS_30310 3077 3151 gene locus_tag LOCUS_t00390 3077 3151 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3229 3303 gene locus_tag LOCUS_t00400 3229 3303 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3355 3429 gene locus_tag LOCUS_t00410 3355 3429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0645 846 1772 gene locus_tag LOCUS_30320 846 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1937 2722 gene locus_tag LOCUS_30330 1937 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence0646 1287 1994 gene locus_tag LOCUS_30340 1287 1994 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_30340 2063 2791 gene locus_tag LOCUS_30350 2063 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence0647 <1 1108 gene locus_tag LOCUS_30360 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142186.1:glycosyl transferase 1150 2139 gene locus_tag LOCUS_30370 1150 2139 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_30370 2186 3163 gene locus_tag LOCUS_30380 2186 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence0648 2197 2790 gene locus_tag LOCUS_30390 2197 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence0649 2166 271 gene locus_tag LOCUS_30400 2166 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence0650 1944 1675 gene locus_tag LOCUS_30410 gene ptsH 1944 1675 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_30410 2430 1999 gene locus_tag LOCUS_30420 2430 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <3414 2576 gene locus_tag LOCUS_30430 <3414 2576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z513:nucleotide-binding protein >Feature sequence0651 1599 103 gene locus_tag LOCUS_30440 1599 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 2656 1613 gene locus_tag LOCUS_30450 2656 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3048 2653 gene locus_tag LOCUS_30460 3048 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence0652 1813 416 gene locus_tag LOCUS_30470 1813 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 2430 1810 gene locus_tag LOCUS_30480 2430 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence0653 2648 807 gene locus_tag LOCUS_30490 2648 807 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0654 139 2502 gene locus_tag LOCUS_30500 139 2502 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence0655 827 33 gene locus_tag LOCUS_30510 827 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2349 817 gene locus_tag LOCUS_30520 2349 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence0656 1309 56 gene locus_tag LOCUS_30530 1309 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0657 1590 64 gene locus_tag LOCUS_30540 gene rtcB 1590 64 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULP9 protein_id gnl|my_center|LOCUS_30540 1854 2042 gene locus_tag LOCUS_30550 1854 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2050 2904 gene locus_tag LOCUS_30560 2050 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence0658 1719 2405 gene locus_tag LOCUS_30570 1719 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence0659 359 790 gene locus_tag LOCUS_30580 359 790 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316407.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence0660 2531 2830 gene locus_tag LOCUS_30590 2531 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2852 3337 gene locus_tag LOCUS_30600 2852 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence0661 449 2878 gene locus_tag LOCUS_30610 449 2878 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence0662 1719 784 gene locus_tag LOCUS_30620 1719 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence0663 772 1737 gene locus_tag LOCUS_30630 772 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_30630 2742 2248 gene locus_tag LOCUS_30640 2742 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence0664 <1 1369 gene locus_tag LOCUS_30650 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388361.1:DNA-binding response regulator 1394 1966 gene locus_tag LOCUS_30660 1394 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2614 2108 gene locus_tag LOCUS_30670 gene fldA 2614 2108 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP7 protein_id gnl|my_center|LOCUS_30670 3361 2732 gene locus_tag LOCUS_30680 3361 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence0665 805 509 gene locus_tag LOCUS_30690 805 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1501 944 gene locus_tag LOCUS_30700 1501 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 <3357 1668 gene locus_tag LOCUS_30710 <3357 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase >Feature sequence0666 1937 2716 gene locus_tag LOCUS_30720 1937 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0667 <1 1348 gene locus_tag LOCUS_30730 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112859.1:ABC transporter 1772 1383 gene locus_tag LOCUS_30740 1772 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2258 1869 gene locus_tag LOCUS_30750 gene gcvH 2258 1869 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_30750 <3349 2324 gene locus_tag LOCUS_30760 <3349 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54378:aminomethyltransferase >Feature sequence0668 784 191 gene locus_tag LOCUS_30770 784 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1135 1392 gene locus_tag LOCUS_30780 1135 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_30780 1491 2060 gene locus_tag LOCUS_30790 1491 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0669 1246 992 gene locus_tag LOCUS_30800 1246 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2360 1359 gene locus_tag LOCUS_30810 2360 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence0670 2641 308 gene locus_tag LOCUS_30820 2641 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3197 2781 gene locus_tag LOCUS_30830 3197 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence0671 719 393 gene locus_tag LOCUS_30840 719 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1006 719 gene locus_tag LOCUS_30850 1006 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1413 2483 gene locus_tag LOCUS_30860 1413 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2408 3202 gene locus_tag LOCUS_30870 2408 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0672 688 1968 gene locus_tag LOCUS_30880 688 1968 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021883.1 protein_id gnl|my_center|LOCUS_30880 1968 2741 gene locus_tag LOCUS_30890 1968 2741 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727958.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0673 <1 552 gene locus_tag LOCUS_30900 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257951.1:thiamine pyrophosphate protein central region 709 1362 gene locus_tag LOCUS_30910 709 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1441 1701 gene locus_tag LOCUS_30920 1441 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2274 1747 gene locus_tag LOCUS_30930 2274 1747 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072034.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence0674 1948 2379 gene locus_tag LOCUS_30940 1948 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 <3324 2376 gene locus_tag LOCUS_30950 <3324 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L >Feature sequence0675 2426 561 gene locus_tag LOCUS_30960 2426 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3280 2495 gene locus_tag LOCUS_30970 3280 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence0676 27 716 gene locus_tag LOCUS_30980 27 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1302 784 gene locus_tag LOCUS_30990 1302 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 <3319 1378 gene locus_tag LOCUS_31000 <3319 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919852.1:prolyl oligopeptidase >Feature sequence0677 15 1064 gene locus_tag LOCUS_31010 gene miaA 15 1064 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_31010 1051 1260 gene locus_tag LOCUS_31020 gene hfq 1051 1260 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A74 protein_id gnl|my_center|LOCUS_31020 1359 2684 gene locus_tag LOCUS_31030 1359 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0678 301 26 gene locus_tag LOCUS_31040 gene acpP-1 301 26 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_31040 505 1128 gene locus_tag LOCUS_31050 505 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1420 1896 gene locus_tag LOCUS_31060 1420 1896 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence0679 683 1966 gene locus_tag LOCUS_31070 683 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2082 3044 gene locus_tag LOCUS_31080 2082 3044 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence0680 324 1334 gene locus_tag LOCUS_31090 324 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 1589 2674 gene locus_tag LOCUS_31100 1589 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence0681 >Feature sequence0682 >Feature sequence0683 382 1041 gene locus_tag LOCUS_31110 382 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1139 1699 gene locus_tag LOCUS_31120 gene def 1139 1699 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 protein_id gnl|my_center|LOCUS_31120 1713 2183 gene locus_tag LOCUS_31130 1713 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2347 2733 gene locus_tag LOCUS_31140 2347 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0684 1019 258 gene locus_tag LOCUS_31150 1019 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1650 1024 gene locus_tag LOCUS_31160 1650 1024 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_31160 1810 2628 gene locus_tag LOCUS_31170 1810 2628 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404077.1 protein_id gnl|my_center|LOCUS_31170 2825 3028 gene locus_tag LOCUS_31180 2825 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence0685 662 2764 gene locus_tag LOCUS_31190 662 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3047 2754 gene locus_tag LOCUS_31200 3047 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence0686 873 13 gene locus_tag LOCUS_31210 873 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1636 884 gene locus_tag LOCUS_31220 1636 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2184 1633 gene locus_tag LOCUS_31230 2184 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence0687 2483 1824 gene locus_tag LOCUS_31240 2483 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 <3268 2596 gene locus_tag LOCUS_31250 <3268 2596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888193.1:gamma-glutamyltranspeptidase >Feature sequence0688 >Feature sequence0689 <1 786 gene locus_tag LOCUS_31260 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174155.1:protein phosphatase 1982 855 gene locus_tag LOCUS_31270 1982 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2419 2495 gene locus_tag LOCUS_t00420 2419 2495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0690 <1 735 gene locus_tag LOCUS_31280 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_231646.2:sodium-dependent transporter 732 1187 gene locus_tag LOCUS_31290 732 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1688 1230 gene locus_tag LOCUS_31300 1688 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2314 1988 gene locus_tag LOCUS_31310 2314 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2856 2311 gene locus_tag LOCUS_31320 2856 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3137 2853 gene locus_tag LOCUS_31330 3137 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0691 1181 993 gene locus_tag LOCUS_31340 1181 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence0692 552 1679 gene locus_tag LOCUS_31350 552 1679 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_31350 2346 1720 gene locus_tag LOCUS_31360 2346 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_31360 3137 2343 gene locus_tag LOCUS_31370 3137 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence0693 338 1330 gene locus_tag LOCUS_31380 338 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2138 1401 gene locus_tag LOCUS_31390 2138 1401 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_31390 <3246 2135 gene locus_tag LOCUS_31400 <3246 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682335.1:TRAP transporter subunit DctM >Feature sequence0694 >Feature sequence0695 2753 870 gene locus_tag LOCUS_31410 2753 870 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence0696 592 858 gene locus_tag LOCUS_31420 592 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence0697 <1 1597 gene locus_tag LOCUS_31430 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020929.1:DNA polymerase elongation subunit 1587 2267 gene locus_tag LOCUS_31440 gene gmk 1587 2267 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60551 protein_id gnl|my_center|LOCUS_31440 2376 2678 gene locus_tag LOCUS_31450 2376 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence0698 >Feature sequence0699 1248 484 gene locus_tag LOCUS_31460 1248 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_31460 1393 3072 gene locus_tag LOCUS_31470 gene gpmI 1393 3072 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG7 protein_id gnl|my_center|LOCUS_31470 >Feature sequence0700 >Feature sequence0701 1168 236 gene locus_tag LOCUS_31480 1168 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1347 2024 gene locus_tag LOCUS_31490 1347 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence0702 581 1564 gene locus_tag LOCUS_31500 581 1564 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_31500 1871 2695 gene locus_tag LOCUS_31510 1871 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence0703 1464 802 gene locus_tag LOCUS_31520 1464 802 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933742.1 protein_id gnl|my_center|LOCUS_31520 2342 1467 gene locus_tag LOCUS_31530 2342 1467 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence0704 2070 130 gene locus_tag LOCUS_31540 2070 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2427 3137 gene locus_tag LOCUS_31550 2427 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence0705 187 534 gene locus_tag LOCUS_31560 187 534 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_31560 547 3168 gene locus_tag LOCUS_31570 547 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence0706 313 819 gene locus_tag LOCUS_31580 313 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1107 1985 gene locus_tag LOCUS_31590 1107 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence0707 1190 75 gene locus_tag LOCUS_31600 gene metK 1190 75 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_31600 2083 1493 gene locus_tag LOCUS_31610 2083 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2082 2897 gene locus_tag LOCUS_31620 2082 2897 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence0708 691 2109 gene locus_tag LOCUS_31630 691 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2109 2933 gene locus_tag LOCUS_31640 2109 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence0709 151 1692 gene locus_tag LOCUS_31650 gene guaA 151 1692 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_31650 >Feature sequence0710 306 542 gene locus_tag LOCUS_31660 306 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 607 1716 gene locus_tag LOCUS_31670 607 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 1706 2254 gene locus_tag LOCUS_31680 1706 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2279 2692 gene locus_tag LOCUS_31690 2279 2692 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence0711 <1 1065 gene locus_tag LOCUS_31700 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UP26:phosphomethylpyrimidine synthase 1337 3187 gene locus_tag LOCUS_31710 1337 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence0712 <3189 2590 gene locus_tag LOCUS_31720 <3189 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706903.1:alpha-glucosidase >Feature sequence0713 192 1865 gene locus_tag LOCUS_31730 192 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1892 2734 gene locus_tag LOCUS_31740 1892 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence0714 <1 609 gene locus_tag LOCUS_31750 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 864 2765 gene locus_tag LOCUS_31760 864 2765 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence0715 >Feature sequence0716 1592 612 gene locus_tag LOCUS_31770 1592 612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056901.1 protein_id gnl|my_center|LOCUS_31770 2401 1589 gene locus_tag LOCUS_31780 2401 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 <3158 2499 gene locus_tag LOCUS_31790 <3158 2499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530022.1:sulfotransferase >Feature sequence0717 >Feature sequence0718 >Feature sequence0719 2155 731 gene locus_tag LOCUS_31800 2155 731 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence0720 >Feature sequence0721 719 1642 gene locus_tag LOCUS_31810 gene glyQ 719 1642 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94616 protein_id gnl|my_center|LOCUS_31810 >Feature sequence0722 1605 1084 gene locus_tag LOCUS_31820 1605 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2933 1863 gene locus_tag LOCUS_31830 gene fabH 2933 1863 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J365 protein_id gnl|my_center|LOCUS_31830 >Feature sequence0723 <1 1418 gene locus_tag LOCUS_31840 <1 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:periplasmic amidohydrolase note possible pseudo, internal stop codon, frameshifted 1415 2941 gene locus_tag LOCUS_31850 1415 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence0724 >Feature sequence0725 1 438 gene locus_tag LOCUS_31860 1 438 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_31860 446 1336 gene locus_tag LOCUS_31870 446 1336 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_31870 1555 2262 gene locus_tag LOCUS_31880 gene fkpA 1555 2262 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_31880 >Feature sequence0726 <1 667 gene locus_tag LOCUS_31890 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030349.1:ATP-binding protein 993 697 gene locus_tag LOCUS_31900 993 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1242 2201 gene locus_tag LOCUS_31910 1242 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence0727 285 1085 gene locus_tag LOCUS_31920 285 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1184 3046 gene locus_tag LOCUS_31930 1184 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence0728 1852 1217 gene locus_tag LOCUS_31940 1852 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 2950 1856 gene locus_tag LOCUS_31950 gene cheB2 2950 1856 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62637 protein_id gnl|my_center|LOCUS_31950 >Feature sequence0729 <1 1457 gene locus_tag LOCUS_31960 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477868.1:two-component system sensor histidine kinase/response regulator 2454 1531 gene locus_tag LOCUS_31970 2454 1531 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_31970 <3111 2526 gene locus_tag LOCUS_31980 <3111 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228155.1:hemolysin >Feature sequence0730 551 1543 gene locus_tag LOCUS_31990 551 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_31990 1556 2335 gene locus_tag LOCUS_32000 1556 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2257 2568 gene locus_tag LOCUS_32010 2257 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence0731 1573 728 gene locus_tag LOCUS_32020 1573 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1816 2232 gene locus_tag LOCUS_32030 1816 2232 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence0732 <1 1024 gene locus_tag LOCUS_32040 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933237.1:aldehyde dehydrogenase 1583 1068 gene locus_tag LOCUS_32050 1583 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_32050 1860 2402 gene locus_tag LOCUS_32060 gene yozB 1860 2402 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_32060 2994 2431 gene locus_tag LOCUS_32070 2994 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence0733 1274 102 gene locus_tag LOCUS_32080 1274 102 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089883.1 protein_id gnl|my_center|LOCUS_32080 2727 2074 gene locus_tag LOCUS_32090 2727 2074 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence0734 2800 218 gene locus_tag LOCUS_32100 gene rapA 2800 218 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT6 protein_id gnl|my_center|LOCUS_32100 >Feature sequence0735 16 1914 gene locus_tag LOCUS_32110 16 1914 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence0736 611 387 gene locus_tag LOCUS_32120 611 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 1107 625 gene locus_tag LOCUS_32130 1107 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 1693 1088 gene locus_tag LOCUS_32140 1693 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2253 1690 gene locus_tag LOCUS_32150 2253 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 2834 2241 gene locus_tag LOCUS_32160 2834 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence0737 <1 737 gene locus_tag LOCUS_32170 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709025.1:adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA 1996 809 gene locus_tag LOCUS_32180 1996 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2210 2917 gene locus_tag LOCUS_32190 gene truC 2210 2917 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence0738 <1 1330 gene locus_tag LOCUS_32200 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LY0:histidine kinase 1441 2151 gene locus_tag LOCUS_32210 1441 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0739 859 2241 gene locus_tag LOCUS_32220 859 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3064 2318 gene locus_tag LOCUS_32230 3064 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence0740 203 784 gene locus_tag LOCUS_32240 203 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 853 1530 gene locus_tag LOCUS_32250 853 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1775 2596 gene locus_tag LOCUS_32260 1775 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence0741 520 1419 gene locus_tag LOCUS_32270 520 1419 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_32270 2295 1435 gene locus_tag LOCUS_32280 2295 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence0742 <1 1103 gene locus_tag LOCUS_32290 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPX2:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase 1096 2514 gene locus_tag LOCUS_32300 gene murC 1096 2514 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_32300 >Feature sequence0743 <3028 161 gene locus_tag LOCUS_32310 <3028 161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence0744 23 799 gene locus_tag LOCUS_32320 23 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 872 2926 gene locus_tag LOCUS_32330 gene uvrD 872 2926 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_32330 >Feature sequence0745 440 1711 gene locus_tag LOCUS_32340 440 1711 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ70 protein_id gnl|my_center|LOCUS_32340 1842 2633 gene locus_tag LOCUS_32350 1842 2633 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_32350 2669 3016 gene locus_tag LOCUS_32360 2669 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence0746 70 1167 gene locus_tag LOCUS_32370 70 1167 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_32370 2097 1180 gene locus_tag LOCUS_32380 2097 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_32380 <3024 2097 gene locus_tag LOCUS_32390 <3024 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61532:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence0747 2271 52 gene locus_tag LOCUS_32400 2271 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32400 >Feature sequence0748 749 1897 gene locus_tag LOCUS_32410 749 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1906 2991 gene locus_tag LOCUS_32420 1906 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence0749 986 435 gene locus_tag LOCUS_32430 986 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence0750 176 937 gene locus_tag LOCUS_32440 176 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1739 963 gene locus_tag LOCUS_32450 1739 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 2362 1841 gene locus_tag LOCUS_32460 2362 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0751 2320 1190 gene locus_tag LOCUS_32470 gene rfbG 2320 1190 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_32470 >Feature sequence0752 >Feature sequence0753 529 924 gene locus_tag LOCUS_32480 529 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0754 2126 309 gene locus_tag LOCUS_32490 2126 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 <3000 2207 gene locus_tag LOCUS_32500 <3000 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089326.1:FAD-dependent oxidoreductase >Feature sequence0755 337 65 gene locus_tag LOCUS_32510 337 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 425 943 gene locus_tag LOCUS_32520 425 943 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence0756 2071 728 gene locus_tag LOCUS_32530 2071 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence0757 >Feature sequence0758 <1 1306 gene locus_tag LOCUS_32540 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816615.1:peptidase S8 2765 1359 gene locus_tag LOCUS_32550 2765 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence0759 >Feature sequence0760 203 481 gene locus_tag LOCUS_32560 203 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence0761 >Feature sequence0762 <1 693 gene locus_tag LOCUS_32570 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase 1907 678 gene locus_tag LOCUS_32580 1907 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence0763 2864 1377 gene locus_tag LOCUS_32590 2864 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0764 387 178 gene locus_tag LOCUS_32600 387 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2396 387 gene locus_tag LOCUS_32610 gene feoB 2396 387 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_32610 2683 2420 gene locus_tag LOCUS_32620 2683 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence0765 >Feature sequence0766 <1 761 gene locus_tag LOCUS_32630 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein 758 2332 gene locus_tag LOCUS_32640 gene murE 758 2332 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_32640 >Feature sequence0767 1359 2363 gene locus_tag LOCUS_32650 gene moaA 1359 2363 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S72 protein_id gnl|my_center|LOCUS_32650 >Feature sequence0768 2006 264 gene locus_tag LOCUS_32660 2006 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence0769 543 2141 gene locus_tag LOCUS_32670 543 2141 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence0770 1908 1042 gene locus_tag LOCUS_32680 1908 1042 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_32680 <2930 1905 gene locus_tag LOCUS_32690 <2930 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393496.1:pyridoxal-5'-phosphate-dependent protein subunit beta >Feature sequence0771 >Feature sequence0772 1741 1103 gene locus_tag LOCUS_32700 1741 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_32700 <2928 1948 gene locus_tag LOCUS_32710 <2928 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AB01:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0773 1359 2558 gene locus_tag LOCUS_32720 1359 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105699.1 protein_id gnl|my_center|LOCUS_32720 2873 2640 gene locus_tag LOCUS_32730 2873 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence0774 773 1936 gene locus_tag LOCUS_32740 773 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence0775 >Feature sequence0776 967 1536 gene locus_tag LOCUS_32750 gene efp 967 1536 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_32750 1533 2525 gene locus_tag LOCUS_32760 gene epmA 1533 2525 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIQ4 protein_id gnl|my_center|LOCUS_32760 >Feature sequence0777 >Feature sequence0778 <1 880 gene locus_tag LOCUS_32770 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708730.1:NADH-quinone oxidoreductase subunit F >Feature sequence0779 477 821 gene locus_tag LOCUS_32780 477 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 815 1198 gene locus_tag LOCUS_32790 815 1198 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_32790 1208 2653 gene locus_tag LOCUS_32800 1208 2653 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084512.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence0780 1593 658 gene locus_tag LOCUS_32810 1593 658 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence0781 1325 126 gene locus_tag LOCUS_32820 1325 126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708220.1 protein_id gnl|my_center|LOCUS_32820 1867 1322 gene locus_tag LOCUS_32830 gene folA 1867 1322 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_32830 2757 1864 gene locus_tag LOCUS_32840 gene thyA 2757 1864 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence0782 755 1540 gene locus_tag LOCUS_32850 755 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0783 1071 1613 gene locus_tag LOCUS_32860 1071 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence0784 127 2331 gene locus_tag LOCUS_32870 127 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence0785 2658 607 gene locus_tag LOCUS_32880 2658 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0786 1365 2204 gene locus_tag LOCUS_32890 1365 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2803 2372 gene locus_tag LOCUS_32900 2803 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence0787 >Feature sequence0788 >Feature sequence0789 <1 577 gene locus_tag LOCUS_32910 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144059.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0790 1346 612 gene locus_tag LOCUS_32920 1346 612 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_32920 2403 1537 gene locus_tag LOCUS_32930 2403 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2863 2465 gene locus_tag LOCUS_32940 2863 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence0791 <1 1326 gene locus_tag LOCUS_32950 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948260.1:ATP-dependent helicase 1323 2171 gene locus_tag LOCUS_32960 1323 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 2745 2176 gene locus_tag LOCUS_32970 2745 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence0792 786 1313 gene locus_tag LOCUS_32980 786 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence0793 1059 2078 gene locus_tag LOCUS_32990 1059 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence0794 1523 315 gene locus_tag LOCUS_33000 1523 315 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_33000 1723 2070 gene locus_tag LOCUS_33010 gene fbp 1723 2070 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_33010 >Feature sequence0795 987 364 gene locus_tag LOCUS_33020 987 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1202 2806 gene locus_tag LOCUS_33030 1202 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence0796 1924 551 gene locus_tag LOCUS_33040 gene pilR 1924 551 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_33040 <2835 1921 gene locus_tag LOCUS_33050 <2835 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31661:sporulation kinase E >Feature sequence0797 1347 1802 gene locus_tag LOCUS_33060 1347 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971067.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence0798 407 1186 gene locus_tag LOCUS_33070 407 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 2693 1188 gene locus_tag LOCUS_33080 2693 1188 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence0799 639 103 gene locus_tag LOCUS_33090 639 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 758 1231 gene locus_tag LOCUS_33100 758 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 <2829 1285 gene locus_tag LOCUS_33110 <2829 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941515.1:rhomboid family intramembrane serine protease >Feature sequence0800 2824 212 gene locus_tag LOCUS_33120 2824 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence0801 2213 2593 gene locus_tag LOCUS_33130 2213 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence0802 914 1879 gene locus_tag LOCUS_33140 914 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence0803 1963 1079 gene locus_tag LOCUS_33150 1963 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 2631 2026 gene locus_tag LOCUS_33160 2631 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence0804 >Feature sequence0805 483 1415 gene locus_tag LOCUS_33170 483 1415 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence0806 661 2085 gene locus_tag LOCUS_33180 661 2085 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_33180 2082 2450 gene locus_tag LOCUS_33190 2082 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence0807 >Feature sequence0808 >Feature sequence0809 1854 2213 gene locus_tag LOCUS_33200 1854 2213 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence0810 91 1788 gene locus_tag LOCUS_33210 91 1788 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_33210 <2810 1767 gene locus_tag LOCUS_33220 <2810 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920227.1:5-oxoprolinase >Feature sequence0811 >Feature sequence0812 781 242 gene locus_tag LOCUS_33230 781 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 1961 774 gene locus_tag LOCUS_33240 gene pilT-1 1961 774 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence0813 265 540 gene locus_tag LOCUS_33250 265 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 588 857 gene locus_tag LOCUS_33260 588 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 1046 1669 gene locus_tag LOCUS_33270 1046 1669 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence0814 242 1168 gene locus_tag LOCUS_33280 gene coaA 242 1168 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB3 protein_id gnl|my_center|LOCUS_33280 1297 1998 gene locus_tag LOCUS_33290 1297 1998 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence0815 1723 494 gene locus_tag LOCUS_33300 1723 494 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_33300 <2795 1720 gene locus_tag LOCUS_33310 <2795 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334319.1:hybrid sensor histidine kinase/response regulator >Feature sequence0816 >Feature sequence0817 512 1090 gene locus_tag LOCUS_33320 gene infC 512 1090 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQP8 protein_id gnl|my_center|LOCUS_33320 2027 1212 gene locus_tag LOCUS_33330 2027 1212 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_33330 <2786 2040 gene locus_tag LOCUS_33340 <2786 2040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RUF3:methionine--tRNA ligase >Feature sequence0818 1797 1018 gene locus_tag LOCUS_33350 1797 1018 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_33350 2308 1826 gene locus_tag LOCUS_33360 2308 1826 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence0819 243 815 gene locus_tag LOCUS_33370 243 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1540 872 gene locus_tag LOCUS_33380 1540 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 <2772 1558 gene locus_tag LOCUS_33390 <2772 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase note possible pseudo, frameshifted >Feature sequence0820 >Feature sequence0821 <2761 688 gene locus_tag LOCUS_33400 <2761 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine protein kinase >Feature sequence0822 262 654 gene locus_tag LOCUS_33410 262 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 889 803 gene locus_tag LOCUS_t00430 889 803 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1241 1804 gene locus_tag LOCUS_33420 1241 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence0823 733 1296 gene locus_tag LOCUS_33430 733 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1435 1617 gene locus_tag LOCUS_33440 1435 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1651 2058 gene locus_tag LOCUS_33450 1651 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2604 2293 gene locus_tag LOCUS_33460 2604 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence0824 <1 1033 gene locus_tag LOCUS_33470 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226524.1:RNA polymerase subunit sigma-24 1790 1629 gene locus_tag LOCUS_33480 1790 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence0825 >Feature sequence0826 1341 886 gene locus_tag LOCUS_33490 gene ptsN 1341 886 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_33490 1920 1372 gene locus_tag LOCUS_33500 1920 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269666.1 protein_id gnl|my_center|LOCUS_33500 <2742 1940 gene locus_tag LOCUS_33510 <2742 1940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ1:RNA polymerase sigma-54 factor >Feature sequence0827 1 771 gene locus_tag LOCUS_33520 1 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 973 1542 gene locus_tag LOCUS_33530 973 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967255.1 protein_id gnl|my_center|LOCUS_33530 2607 1564 gene locus_tag LOCUS_33540 2607 1564 CDS product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530332.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence0828 1282 1082 gene locus_tag LOCUS_33550 1282 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2740 1427 gene locus_tag LOCUS_33560 2740 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence0829 215 670 gene locus_tag LOCUS_33570 215 670 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence0830 122 1084 gene locus_tag LOCUS_33580 122 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1705 1103 gene locus_tag LOCUS_33590 1705 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 1852 2247 gene locus_tag LOCUS_33600 gene msrB 1852 2247 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDS5 protein_id gnl|my_center|LOCUS_33600 >Feature sequence0831 2161 875 gene locus_tag LOCUS_33610 2161 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 2573 2223 gene locus_tag LOCUS_33620 2573 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence0832 182 2551 gene locus_tag LOCUS_33630 182 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence0833 382 2133 gene locus_tag LOCUS_33640 382 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 <2737 2218 gene locus_tag LOCUS_33650 <2737 2218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141092.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0834 2036 1257 gene locus_tag LOCUS_33660 2036 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence0835 <1 894 gene locus_tag LOCUS_33670 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258470.1:stage II sporulation protein E 891 2243 gene locus_tag LOCUS_33680 891 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence0836 >Feature sequence0837 1056 2438 gene locus_tag LOCUS_33690 gene lysS 1056 2438 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK7 protein_id gnl|my_center|LOCUS_33690 >Feature sequence0838 581 387 gene locus_tag LOCUS_33700 581 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 924 1271 gene locus_tag LOCUS_33710 924 1271 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence0839 1919 366 gene locus_tag LOCUS_33720 gene hutH 1919 366 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKW9 protein_id gnl|my_center|LOCUS_33720 <2721 1939 gene locus_tag LOCUS_33730 <2721 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI08:urocanate hydratase >Feature sequence0840 1271 648 gene locus_tag LOCUS_33740 1271 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2461 1283 gene locus_tag LOCUS_33750 2461 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence0841 561 636 gene locus_tag LOCUS_t00440 561 636 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1184 873 gene locus_tag LOCUS_33760 1184 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence0842 <2714 1269 gene locus_tag LOCUS_33770 <2714 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CR52:polyribonucleotide nucleotidyltransferase >Feature sequence0843 1305 1018 gene locus_tag LOCUS_33780 1305 1018 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_33780 2441 1302 gene locus_tag LOCUS_33790 gene pntA 2441 1302 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence0844 1580 660 gene locus_tag LOCUS_33800 1580 660 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_33800 <2703 1603 gene locus_tag LOCUS_33810 <2703 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337759.1:penicillin acylase >Feature sequence0845 443 2272 gene locus_tag LOCUS_33820 gene batD 443 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence0846 >Feature sequence0847 <1 1554 gene locus_tag LOCUS_33830 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:protein kinase <2690 2041 gene locus_tag LOCUS_33840 <2690 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VA42:ATP-dependent dethiobiotin synthetase BioD >Feature sequence0848 304 1797 gene locus_tag LOCUS_33850 304 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence0849 1955 183 gene locus_tag LOCUS_33860 1955 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence0850 1633 353 gene locus_tag LOCUS_33870 1633 353 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_33870 1790 2398 gene locus_tag LOCUS_33880 1790 2398 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0851 <1 981 gene locus_tag LOCUS_33890 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase 1016 1270 gene locus_tag LOCUS_33900 1016 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 1504 2637 gene locus_tag LOCUS_33910 1504 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence0852 390 572 gene locus_tag LOCUS_33920 390 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 964 1518 gene locus_tag LOCUS_33930 964 1518 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_33930 <2678 1626 gene locus_tag LOCUS_33940 <2678 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545938.1:membrane protein >Feature sequence0853 129 410 gene locus_tag LOCUS_33950 129 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 766 419 gene locus_tag LOCUS_33960 766 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 948 1730 gene locus_tag LOCUS_33970 948 1730 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729816.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence0854 1101 316 gene locus_tag LOCUS_33980 1101 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 <2662 1333 gene locus_tag LOCUS_33990 <2662 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLK6:dihydrolipoyl dehydrogenase >Feature sequence0855 338 1600 gene locus_tag LOCUS_34000 338 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1611 2480 gene locus_tag LOCUS_34010 1611 2480 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence0856 385 35 gene locus_tag LOCUS_34020 385 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 1557 577 gene locus_tag LOCUS_34030 gene prs 1557 577 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_34030 >Feature sequence0857 3 290 gene locus_tag LOCUS_34040 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 320 1660 gene locus_tag LOCUS_34050 320 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence0858 2077 1778 gene locus_tag LOCUS_34060 2077 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence0859 <2652 54 gene locus_tag LOCUS_34070 <2652 54 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase >Feature sequence0860 >Feature sequence0861 45 902 gene locus_tag LOCUS_34080 gene thpD 45 902 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895349.1 protein_id gnl|my_center|LOCUS_34080 923 1930 gene locus_tag LOCUS_34090 923 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence0862 1187 246 gene locus_tag LOCUS_34100 1187 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence0863 439 1284 gene locus_tag LOCUS_34110 439 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1277 2014 gene locus_tag LOCUS_34120 gene lipB 1277 2014 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence0864 >Feature sequence0865 1689 1985 gene locus_tag LOCUS_34130 1689 1985 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882942.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence0866 1130 306 gene locus_tag LOCUS_34140 gene paaG 1130 306 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence0867 1413 607 gene locus_tag LOCUS_34150 1413 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1652 1828 gene locus_tag LOCUS_34160 1652 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 <2619 1825 gene locus_tag LOCUS_34170 <2619 1825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WV5:acetyl-coenzyme A synthetase >Feature sequence0868 >Feature sequence0869 772 407 gene locus_tag LOCUS_34180 772 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 2613 814 gene locus_tag LOCUS_34190 2613 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence0870 >Feature sequence0871 1341 934 gene locus_tag LOCUS_34200 1341 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 <2607 1499 gene locus_tag LOCUS_34210 <2607 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDM3:histidine kinase >Feature sequence0872 115 1224 gene locus_tag LOCUS_34220 115 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence0873 224 883 gene locus_tag LOCUS_34230 224 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence0874 1305 1120 gene locus_tag LOCUS_34240 1305 1120 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480576.1 protein_id gnl|my_center|LOCUS_34240 2414 1377 gene locus_tag LOCUS_34250 2414 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence0875 >Feature sequence0876 <1 1497 gene locus_tag LOCUS_34260 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_230271.2:sensory box sensor histidine kinase/response regulator 2459 1503 gene locus_tag LOCUS_34270 2459 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence0877 436 816 gene locus_tag LOCUS_34280 436 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence0878 37 198 gene locus_tag LOCUS_34290 37 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 224 2209 gene locus_tag LOCUS_34300 224 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 <1 2256 gene locus_tag LOCUS_34310 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941123.1:exporter >Feature sequence0882 <2569 1136 gene locus_tag LOCUS_34320 <2569 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121318.1:cytochrome c >Feature sequence0883 <1 512 gene locus_tag LOCUS_34330 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481254.1:peptidase 818 1747 gene locus_tag LOCUS_34340 818 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 1918 2088 gene locus_tag LOCUS_34350 1918 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence0884 <1 699 gene locus_tag LOCUS_34360 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:acetoacetate metabolism regulatory protein AtoC 886 1284 gene locus_tag LOCUS_34370 886 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 <2563 1514 gene locus_tag LOCUS_34380 <2563 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257666.1:alanine racemase >Feature sequence0885 1702 2265 gene locus_tag LOCUS_34390 1702 2265 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A18 protein_id gnl|my_center|LOCUS_34390 >Feature sequence0886 1642 851 gene locus_tag LOCUS_34400 1642 851 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence0887 <1 542 gene locus_tag LOCUS_34410 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932702.1:thioredoxin 929 1402 gene locus_tag LOCUS_34420 929 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence0888 15 1910 gene locus_tag LOCUS_34430 15 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence0889 680 345 gene locus_tag LOCUS_34440 680 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 <2551 865 gene locus_tag LOCUS_34450 <2551 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035924.1:serine protease >Feature sequence0890 398 1627 gene locus_tag LOCUS_34460 398 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence0891 <1 1699 gene locus_tag LOCUS_34470 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393637.1:phosphohydrolase 1749 2114 gene locus_tag LOCUS_34480 1749 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence0892 >Feature sequence0893 <1 841 gene locus_tag LOCUS_34490 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203586.1:nucleotidyltransferase 1108 1794 gene locus_tag LOCUS_34500 1108 1794 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483532.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence0894 1920 349 gene locus_tag LOCUS_34510 1920 349 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence0895 <1 840 gene locus_tag LOCUS_34520 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842701.1:thiol oxidoreductase 982 1881 gene locus_tag LOCUS_34530 982 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence0896 <1 845 gene locus_tag LOCUS_34540 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201884.1:radical SAM/SPASM domain-containing protein 1132 1347 gene locus_tag LOCUS_34550 1132 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 1553 2062 gene locus_tag LOCUS_34560 1553 2062 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence0897 1287 514 gene locus_tag LOCUS_34570 1287 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence0898 18 1142 gene locus_tag LOCUS_34580 18 1142 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_34580 1756 1154 gene locus_tag LOCUS_34590 1756 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932590.1 protein_id gnl|my_center|LOCUS_34590 <2535 1753 gene locus_tag LOCUS_34600 <2535 1753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932589.1:ATPase >Feature sequence0899 1006 245 gene locus_tag LOCUS_34610 gene hutC 1006 245 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU78 protein_id gnl|my_center|LOCUS_34610 1133 2392 gene locus_tag LOCUS_34620 gene hutI 1133 2392 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence0900 432 1751 gene locus_tag LOCUS_34630 432 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence0901 <1 2324 gene locus_tag LOCUS_34640 <1 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071716.1:periplasmic peptidase family S9 >Feature sequence0902 624 274 gene locus_tag LOCUS_34650 624 274 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888710.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence0903 968 807 gene locus_tag LOCUS_34660 968 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1429 1205 gene locus_tag LOCUS_34670 1429 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1854 2390 gene locus_tag LOCUS_34680 1854 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639511.2 protein_id gnl|my_center|LOCUS_34680 >Feature sequence0904 629 1255 gene locus_tag LOCUS_34690 629 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1619 1326 gene locus_tag LOCUS_34700 1619 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2337 1630 gene locus_tag LOCUS_34710 2337 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence0905 665 1243 gene locus_tag LOCUS_34720 665 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1412 2029 gene locus_tag LOCUS_34730 1412 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence0906 >Feature sequence0907 >Feature sequence0908 2497 1253 gene locus_tag LOCUS_34740 2497 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence0909 >Feature sequence0910 1659 1955 gene locus_tag LOCUS_34750 1659 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence0911 470 66 gene locus_tag LOCUS_34760 470 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_34760 731 2035 gene locus_tag LOCUS_34770 731 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence0912 >Feature sequence0913 1287 469 gene locus_tag LOCUS_34780 1287 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence0914 318 118 gene locus_tag LOCUS_34790 318 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 283 1440 gene locus_tag LOCUS_34800 283 1440 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039561.1 protein_id gnl|my_center|LOCUS_34800 2296 1514 gene locus_tag LOCUS_34810 2296 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence0915 2076 238 gene locus_tag LOCUS_34820 2076 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_34820 >Feature sequence0916 161 1996 gene locus_tag LOCUS_34830 gene typA 161 1996 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403243.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence0917 1567 1397 gene locus_tag LOCUS_34840 1567 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence0918 1542 370 gene locus_tag LOCUS_34850 1542 370 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707734.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence0919 1979 1128 gene locus_tag LOCUS_34860 1979 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence0920 2406 1033 gene locus_tag LOCUS_34870 2406 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34870 >Feature sequence0921 923 237 gene locus_tag LOCUS_34880 923 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1154 1759 gene locus_tag LOCUS_34890 1154 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence0922 344 622 gene locus_tag LOCUS_34900 gene hlpA 344 622 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284639.1 protein_id gnl|my_center|LOCUS_34900 808 1482 gene locus_tag LOCUS_34910 808 1482 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_34910 1553 2023 gene locus_tag LOCUS_34920 gene moaC 1553 2023 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_34920 >Feature sequence0923 335 1078 gene locus_tag LOCUS_34930 gene ubiE 335 1078 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_34930 >Feature sequence0924 3 599 gene locus_tag LOCUS_34940 3 599 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_34940 580 1251 gene locus_tag LOCUS_34950 580 1251 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_34950 1295 1972 gene locus_tag LOCUS_34960 1295 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence0925 512 868 gene locus_tag LOCUS_34970 512 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 960 1340 gene locus_tag LOCUS_34980 960 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1525 1899 gene locus_tag LOCUS_34990 1525 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1899 2261 gene locus_tag LOCUS_35000 1899 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence0926 1805 1452 gene locus_tag LOCUS_35010 1805 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 2363 1872 gene locus_tag LOCUS_35020 2363 1872 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 protein_id gnl|my_center|LOCUS_35020 >Feature sequence0927 <1 1039 gene locus_tag LOCUS_35030 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404200.1:sigma-54-dependent Fis family transcriptional regulator 1951 1058 gene locus_tag LOCUS_35040 gene menB 1951 1058 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYX3 protein_id gnl|my_center|LOCUS_35040 >Feature sequence0928 <1 1069 gene locus_tag LOCUS_35050 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E844:tRNA-dihydrouridine(20/20a) synthase 1079 2122 gene locus_tag LOCUS_35060 1079 2122 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873588.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence0929 1663 308 gene locus_tag LOCUS_35070 gene manB 1663 308 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_35070 <2431 1795 gene locus_tag LOCUS_35080 <2431 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902464.1:alpha/beta hydrolase >Feature sequence0930 43 1428 gene locus_tag LOCUS_35090 43 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence0931 1953 478 gene locus_tag LOCUS_35100 1953 478 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence0932 413 1228 gene locus_tag LOCUS_35110 413 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1357 1211 gene locus_tag LOCUS_35120 1357 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 <2425 1550 gene locus_tag LOCUS_35130 <2425 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366900.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0933 1628 237 gene locus_tag LOCUS_35140 1628 237 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence0934 1956 1240 gene locus_tag LOCUS_35150 1956 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 2380 2018 gene locus_tag LOCUS_35160 2380 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225039.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence0935 <2420 683 gene locus_tag LOCUS_35170 <2420 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404041.1:sodium:proton antiporter >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 591 2264 gene locus_tag LOCUS_35180 591 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence0939 224 1582 gene locus_tag LOCUS_35190 224 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence0940 757 2040 gene locus_tag LOCUS_35200 757 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence0941 >Feature sequence0942 246 977 gene locus_tag LOCUS_35210 246 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 1001 1750 gene locus_tag LOCUS_35220 1001 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 2202 1771 gene locus_tag LOCUS_35230 2202 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence0943 >Feature sequence0944 690 1055 gene locus_tag LOCUS_35240 690 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 1077 1787 gene locus_tag LOCUS_35250 1077 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 1780 2133 gene locus_tag LOCUS_35260 1780 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence0945 >Feature sequence0946 <1 688 gene locus_tag LOCUS_35270 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405466.1:RNA polymerase sigma24 factor 685 1482 gene locus_tag LOCUS_35280 685 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence0947 1041 1346 gene locus_tag LOCUS_35290 1041 1346 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_35290 1488 2048 gene locus_tag LOCUS_35300 1488 2048 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence0948 664 320 gene locus_tag LOCUS_35310 664 320 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227522.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence0949 347 45 gene locus_tag LOCUS_35320 347 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 491 1027 gene locus_tag LOCUS_35330 491 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 1229 2326 gene locus_tag LOCUS_35340 1229 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence0950 >Feature sequence0951 1870 251 gene locus_tag LOCUS_35350 1870 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence0952 >Feature sequence0953 673 1647 gene locus_tag LOCUS_35360 673 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 <2370 1721 gene locus_tag LOCUS_35370 <2370 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXI8:malate dehydrogenase >Feature sequence0954 >Feature sequence0955 <2368 1123 gene locus_tag LOCUS_35380 <2368 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402869.1:cation efflux system protein >Feature sequence0956 1182 562 gene locus_tag LOCUS_35390 gene leuD 1182 562 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_35390 <2365 1179 gene locus_tag LOCUS_35400 <2365 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WC29:3-isopropylmalate dehydratase large subunit >Feature sequence0957 1952 78 gene locus_tag LOCUS_35410 1952 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence0958 >Feature sequence0959 1461 496 gene locus_tag LOCUS_35420 1461 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2171 1797 gene locus_tag LOCUS_35430 2171 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 >Feature sequence0960 >Feature sequence0961 3 1517 gene locus_tag LOCUS_35440 gene sdhA 3 1517 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_35440 1517 2275 gene locus_tag LOCUS_35450 1517 2275 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence0962 516 1016 gene locus_tag LOCUS_35460 516 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence0963 1446 196 gene locus_tag LOCUS_35470 gene pslH 1446 196 CDS product biofilm formation protein PslH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_35470 <2348 1498 gene locus_tag LOCUS_35480 <2348 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897930.1:nucleoside-diphosphate sugar epimerase >Feature sequence0964 >Feature sequence0965 <1 1290 gene locus_tag LOCUS_35490 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023149.1:zinc metalloprotease <2343 1306 gene locus_tag LOCUS_35500 <2343 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140385.1:cation transporter >Feature sequence0966 >Feature sequence0967 820 263 gene locus_tag LOCUS_35510 820 263 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344923.1 protein_id gnl|my_center|LOCUS_35510 1917 817 gene locus_tag LOCUS_35520 gene rfbB-2 1917 817 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UA9 protein_id gnl|my_center|LOCUS_35520 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 2172 679 gene locus_tag LOCUS_35530 2172 679 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence0971 <1 588 gene locus_tag LOCUS_35540 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230189.1:amidohydrolase 805 2292 gene locus_tag LOCUS_35550 805 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence0972 >Feature sequence0973 493 1500 gene locus_tag LOCUS_35560 493 1500 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence0974 >Feature sequence0975 762 2282 gene locus_tag LOCUS_35570 762 2282 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence0976 2285 1965 gene locus_tag LOCUS_35580 2285 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 308 2080 gene locus_tag LOCUS_35590 308 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence0983 >Feature sequence0984 601 125 gene locus_tag LOCUS_35600 601 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 970 1458 gene locus_tag LOCUS_35610 970 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1547 2230 gene locus_tag LOCUS_35620 1547 2230 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence0985 <1 1041 gene locus_tag LOCUS_35630 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816365.1:peptide ABC transporter substrate-binding protein SapA >Feature sequence0986 253 558 gene locus_tag LOCUS_35640 253 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence0987 1188 1721 gene locus_tag LOCUS_35650 1188 1721 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_35650 1749 2267 gene locus_tag LOCUS_35660 1749 2267 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence0988 1800 1006 gene locus_tag LOCUS_35670 1800 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence0989 <1 1116 gene locus_tag LOCUS_35680 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704219.1:putative acyl-CoA synthetase FadD >Feature sequence0990 106 1911 gene locus_tag LOCUS_35690 106 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence0991 1866 2021 gene locus_tag LOCUS_35700 1866 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence0992 >Feature sequence0993 322 1929 gene locus_tag LOCUS_35710 322 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence0994 <1 900 gene locus_tag LOCUS_35720 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031095.1:metallophosphoesterase 897 1838 gene locus_tag LOCUS_35730 gene glsA 897 1838 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MM2 protein_id gnl|my_center|LOCUS_35730 >Feature sequence0995 1839 1018 gene locus_tag LOCUS_35740 1839 1018 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_35740 >Feature sequence0996 <2255 645 gene locus_tag LOCUS_35750 <2255 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941654.1:putative baseplate assembly protein >Feature sequence0997 >Feature sequence0998 408 1172 gene locus_tag LOCUS_35760 408 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence0999 <1 1352 gene locus_tag LOCUS_35770 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459446.1:nucleotide pyrophosphatase >Feature sequence1000 267 809 gene locus_tag LOCUS_35780 267 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346868.1 protein_id gnl|my_center|LOCUS_35780 845 1798 gene locus_tag LOCUS_35790 gene tnpA 845 1798 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213218.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence1001 >Feature sequence1002 >Feature sequence1003 769 1953 gene locus_tag LOCUS_35800 769 1953 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289270.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence1004 <2237 1275 gene locus_tag LOCUS_35810 <2237 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54531:leucine dehydrogenase >Feature sequence1005 <2235 340 gene locus_tag LOCUS_35820 <2235 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:polyketide synthase 571 656 gene locus_tag LOCUS_t00450 571 656 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1006 >Feature sequence1007 <1 749 gene locus_tag LOCUS_35830 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X1E4:glycerol kinase 2 1770 772 gene locus_tag LOCUS_35840 gene hemB 1770 772 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_35840 >Feature sequence1008 >Feature sequence1009 638 237 gene locus_tag LOCUS_35850 638 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 2174 711 gene locus_tag LOCUS_35860 2174 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence1010 1940 213 gene locus_tag LOCUS_35870 1940 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence1011 184 540 gene locus_tag LOCUS_35880 184 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 610 1764 gene locus_tag LOCUS_35890 610 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence1012 1615 998 gene locus_tag LOCUS_35900 gene nqrE 1615 998 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_35900 <2224 1618 gene locus_tag LOCUS_35910 <2224 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87MA9:Na(+)-translocating NADH-quinone reductase subunit D >Feature sequence1013 1167 529 gene locus_tag LOCUS_35920 1167 529 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence1014 47 1618 gene locus_tag LOCUS_35930 47 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence1015 1642 320 gene locus_tag LOCUS_35940 1642 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence1016 1219 788 gene locus_tag LOCUS_35950 1219 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2123 1335 gene locus_tag LOCUS_35960 gene plsC 2123 1335 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q9 protein_id gnl|my_center|LOCUS_35960 >Feature sequence1017 1 1302 gene locus_tag LOCUS_35970 gene pyrC 1 1302 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_35970 1299 2162 gene locus_tag LOCUS_35980 gene suhB 1299 2162 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence1018 610 1962 gene locus_tag LOCUS_35990 gene ndh 610 1962 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence1019 76 339 gene locus_tag LOCUS_36000 76 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 417 599 gene locus_tag LOCUS_36010 417 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 677 979 gene locus_tag LOCUS_36020 677 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence1020 >Feature sequence1021 120 2156 gene locus_tag LOCUS_36030 120 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence1022 360 1595 gene locus_tag LOCUS_36040 360 1595 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence1023 >Feature sequence1024 >Feature sequence1025 <2186 1034 gene locus_tag LOCUS_36050 <2186 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122128.1:RTX toxin >Feature sequence1026 927 2114 gene locus_tag LOCUS_36060 927 2114 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence1027 1394 18 gene locus_tag LOCUS_36070 1394 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 1807 2112 gene locus_tag LOCUS_36080 1807 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence1028 1194 220 gene locus_tag LOCUS_36090 1194 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence1029 <1 1344 gene locus_tag LOCUS_36100 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538168.1:signal transduction histidine kinase 1653 1354 gene locus_tag LOCUS_36110 1653 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence1030 2071 1250 gene locus_tag LOCUS_36120 2071 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence1031 1531 743 gene locus_tag LOCUS_36130 1531 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 <2174 1576 gene locus_tag LOCUS_36140 <2174 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYT0:phosphonates import ATP-binding protein PhnC 1 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 >Feature sequence1035 <1 690 gene locus_tag LOCUS_36150 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9EYG9:succinate--CoA ligase [ADP-forming] subunit beta 690 1565 gene locus_tag LOCUS_36160 gene sucD 690 1565 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EA4 protein_id gnl|my_center|LOCUS_36160 >Feature sequence1036 1960 638 gene locus_tag LOCUS_36170 1960 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence1037 <2162 1298 gene locus_tag LOCUS_36180 <2162 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065600.1:hydroxymethylglutaryl-CoA reductase (NADPH) >Feature sequence1038 430 2106 gene locus_tag LOCUS_36190 430 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence1039 >Feature sequence1040 638 1423 gene locus_tag LOCUS_36200 638 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence1041 1559 546 gene locus_tag LOCUS_36210 1559 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 92 1306 gene locus_tag LOCUS_36220 92 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence1045 2150 1029 gene locus_tag LOCUS_36230 2150 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence1046 521 748 gene locus_tag LOCUS_36240 521 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 806 1315 gene locus_tag LOCUS_36250 806 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 1763 1467 gene locus_tag LOCUS_36260 1763 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 1981 1760 gene locus_tag LOCUS_36270 1981 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence1047 934 341 gene locus_tag LOCUS_36280 934 341 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_36280 2060 987 gene locus_tag LOCUS_36290 gene murB 2060 987 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUJ2 protein_id gnl|my_center|LOCUS_36290 >Feature sequence1048 >Feature sequence1049 627 31 gene locus_tag LOCUS_36300 627 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_36300 1021 2001 gene locus_tag LOCUS_36310 1021 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence1050 >Feature sequence1051 565 2025 gene locus_tag LOCUS_36320 gene hisS 565 2025 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAL6 protein_id gnl|my_center|LOCUS_36320 >Feature sequence1052 462 1469 gene locus_tag LOCUS_36330 462 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1466 1933 gene locus_tag LOCUS_36340 1466 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence1053 259 1710 gene locus_tag LOCUS_36350 gene purB 259 1710 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_36350 >Feature sequence1054 475 152 gene locus_tag LOCUS_36360 475 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 1097 468 gene locus_tag LOCUS_36370 1097 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 1924 1085 gene locus_tag LOCUS_36380 1924 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence1055 1 435 gene locus_tag LOCUS_36390 1 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 561 1076 gene locus_tag LOCUS_36400 gene aroK 561 1076 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL5 protein_id gnl|my_center|LOCUS_36400 1064 1813 gene locus_tag LOCUS_36410 1064 1813 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence1056 520 924 gene locus_tag LOCUS_36420 gene panD 520 924 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBZ3 protein_id gnl|my_center|LOCUS_36420 1789 1001 gene locus_tag LOCUS_36430 1789 1001 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_36430 >Feature sequence1057 <1 1012 gene locus_tag LOCUS_36440 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532355.1:peptidase M16 >Feature sequence1058 <1 1114 gene locus_tag LOCUS_36450 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase 2054 1101 gene locus_tag LOCUS_36460 2054 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence1059 1992 1102 gene locus_tag LOCUS_36470 1992 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence1060 <2124 975 gene locus_tag LOCUS_36480 <2124 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015020.1:iron ABC transporter ATP-binding protein >Feature sequence1061 243 1148 gene locus_tag LOCUS_36490 243 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 1285 1959 gene locus_tag LOCUS_36500 1285 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence1062 >Feature sequence1063 <1 621 gene locus_tag LOCUS_36510 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 716 1564 gene locus_tag LOCUS_36520 716 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972729.1 protein_id gnl|my_center|LOCUS_36520 >Feature sequence1064 1248 640 gene locus_tag LOCUS_36530 1248 640 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIC6 protein_id gnl|my_center|LOCUS_36530 >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 2005 1442 gene locus_tag LOCUS_36540 2005 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence1069 525 1097 gene locus_tag LOCUS_36550 525 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence1070 1248 31 gene locus_tag LOCUS_36560 1248 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1071 >Feature sequence1072 277 1293 gene locus_tag LOCUS_36570 277 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence1073 1117 923 gene locus_tag LOCUS_36580 1117 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1509 1114 gene locus_tag LOCUS_36590 1509 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence1074 >Feature sequence1075 <2088 1474 gene locus_tag LOCUS_36600 <2088 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CKE5:acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 <2083 112 gene locus_tag LOCUS_36610 <2083 112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114679.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence1079 <2076 562 gene locus_tag LOCUS_36620 <2076 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence1080 89 1996 gene locus_tag LOCUS_36630 gene msbA 89 1996 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence1081 >Feature sequence1082 1969 245 gene locus_tag LOCUS_36640 1969 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence1083 902 1573 gene locus_tag LOCUS_36650 902 1573 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227636.1 protein_id gnl|my_center|LOCUS_36650 1570 1932 gene locus_tag LOCUS_36660 1570 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence1084 <1 1963 gene locus_tag LOCUS_36670 <1 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092464.1:resistance-nodulation-cell division efflux transporter >Feature sequence1085 38 1573 gene locus_tag LOCUS_36680 38 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence1086 >Feature sequence1087 >Feature sequence1088 1506 922 gene locus_tag LOCUS_36690 1506 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence1089 1665 418 gene locus_tag LOCUS_36700 1665 418 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence1090 107 1120 gene locus_tag LOCUS_36710 gene ansA 107 1120 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_36710 1446 1742 gene locus_tag LOCUS_36720 1446 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence1091 1626 349 gene locus_tag LOCUS_36730 1626 349 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_36730 >Feature sequence1092 1744 731 gene locus_tag LOCUS_36740 1744 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2058 1801 gene locus_tag LOCUS_36750 2058 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence1093 1194 1859 gene locus_tag LOCUS_36760 1194 1859 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence1094 2056 374 gene locus_tag LOCUS_36770 2056 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1095 >Feature sequence1096 22 792 gene locus_tag LOCUS_36780 22 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 1926 988 gene locus_tag LOCUS_36790 gene yfbL 1926 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence1097 2 889 gene locus_tag LOCUS_36800 2 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 1055 1423 gene locus_tag LOCUS_36810 1055 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence1098 816 1577 gene locus_tag LOCUS_36820 816 1577 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_36820 1574 1924 gene locus_tag LOCUS_36830 1574 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence1099 >Feature sequence1100 773 1015 gene locus_tag LOCUS_36840 gene rpmB 773 1015 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F483 protein_id gnl|my_center|LOCUS_36840 1043 1288 gene locus_tag LOCUS_36850 gene rpmE2 1043 1288 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66201 protein_id gnl|my_center|LOCUS_36850 1372 1947 gene locus_tag LOCUS_36860 1372 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence1101 <1 1067 gene locus_tag LOCUS_36870 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191282.1:CoA transferase >Feature sequence1102 3 1082 gene locus_tag LOCUS_36880 3 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1560 1264 gene locus_tag LOCUS_36890 1560 1264 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141822.1 protein_id gnl|my_center|LOCUS_36890 1841 1557 gene locus_tag LOCUS_36900 1841 1557 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMD9 protein_id gnl|my_center|LOCUS_36900 >Feature sequence1103 >Feature sequence1104 658 1584 gene locus_tag LOCUS_36910 658 1584 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640062.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence1105 359 1300 gene locus_tag LOCUS_36920 359 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence1106 >Feature sequence1107 606 1304 gene locus_tag LOCUS_36930 606 1304 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence1108 <1 1307 gene locus_tag LOCUS_36940 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393495.1:selenium-dependent xanthine dehydrogenase >Feature sequence1109 487 1974 gene locus_tag LOCUS_36950 gene hsdM 487 1974 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence1110 >Feature sequence1111 521 1984 gene locus_tag LOCUS_36960 521 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence1112 >Feature sequence1113 72 812 gene locus_tag LOCUS_36970 72 812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence1114 >Feature sequence1115 23 904 gene locus_tag LOCUS_36980 gene pyrF 23 904 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR8 protein_id gnl|my_center|LOCUS_36980 >Feature sequence1116 <2015 1203 gene locus_tag LOCUS_36990 <2015 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941907.1:multicopper oxidase >Feature sequence1117 150 386 gene locus_tag LOCUS_37000 150 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 391 1437 gene locus_tag LOCUS_37010 gene ilvC 391 1437 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC26 protein_id gnl|my_center|LOCUS_37010 >Feature sequence1118 <1 637 gene locus_tag LOCUS_37020 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW2:putative transcriptional regulatory protein 2006 705 gene locus_tag LOCUS_37030 2006 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143791.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence1119 334 1959 gene locus_tag LOCUS_37040 334 1959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 protein_id gnl|my_center|LOCUS_37040 >Feature sequence1120 471 1967 gene locus_tag LOCUS_37050 471 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence1121 >Feature sequence1122 >Feature sequence1123 <1999 362 gene locus_tag LOCUS_37060 <1999 362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552098.1:hybrid sensor histidine kinase/response regulator >Feature sequence1124 >Feature sequence1125 643 1983 gene locus_tag LOCUS_37070 643 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence1126 571 828 gene locus_tag LOCUS_37080 571 828 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_37080 <1997 946 gene locus_tag LOCUS_37090 <1997 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551866.1:aldehyde dehydrogenase >Feature sequence1127 1995 757 gene locus_tag LOCUS_37100 1995 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence1128 <1987 447 gene locus_tag LOCUS_37110 <1987 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140133.1:oligopeptidase B >Feature sequence1129 >Feature sequence1130 >Feature sequence1131 564 1619 gene locus_tag LOCUS_37120 564 1619 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence1132 746 1903 gene locus_tag LOCUS_37130 746 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence1133 519 1385 gene locus_tag LOCUS_37140 519 1385 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence1134 <1980 356 gene locus_tag LOCUS_37150 <1980 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107962.1:sensor histidine kinase >Feature sequence1135 1374 724 gene locus_tag LOCUS_37160 1374 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence1136 >Feature sequence1137 922 692 gene locus_tag LOCUS_37170 922 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 1267 1034 gene locus_tag LOCUS_37180 1267 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence1138 >Feature sequence1139 <1 1697 gene locus_tag LOCUS_37190 <1 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930621.1:5-oxoprolinase >Feature sequence1140 474 1751 gene locus_tag LOCUS_37200 474 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence1141 431 1333 gene locus_tag LOCUS_37210 431 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1960 1601 gene locus_tag LOCUS_37220 1960 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence1142 1894 1619 gene locus_tag LOCUS_37230 1894 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence1143 1263 334 gene locus_tag LOCUS_37240 gene adhP 1263 334 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_37240 >Feature sequence1144 >Feature sequence1145 <1 1387 gene locus_tag LOCUS_37250 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9T2:poly(A) polymerase I >Feature sequence1146 209 1489 gene locus_tag LOCUS_37260 gene galK 209 1489 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB97 protein_id gnl|my_center|LOCUS_37260 >Feature sequence1147 1259 1564 gene locus_tag LOCUS_37270 1259 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence1148 >Feature sequence1149 >Feature sequence1150 426 1178 gene locus_tag LOCUS_37280 426 1178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence1151 1068 265 gene locus_tag LOCUS_37290 1068 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 <1949 1190 gene locus_tag LOCUS_37300 <1949 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000730383.1:bacillolysin >Feature sequence1152 >Feature sequence1153 1009 1680 gene locus_tag LOCUS_37310 1009 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence1154 1640 438 gene locus_tag LOCUS_37320 1640 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence1155 >Feature sequence1156 1517 615 gene locus_tag LOCUS_37330 1517 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence1157 >Feature sequence1158 <1 1914 gene locus_tag LOCUS_37340 <1 1914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140588.1:serine/threonine protein kinase >Feature sequence1159 <1 1629 gene locus_tag LOCUS_37350 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109778.1:peptidase S9 >Feature sequence1160 <1 511 gene locus_tag LOCUS_37360 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889131.1:ferric enterobactin esterase 1316 516 gene locus_tag LOCUS_37370 1316 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence1161 1023 229 gene locus_tag LOCUS_37380 1023 229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence1162 1858 1190 gene locus_tag LOCUS_37390 1858 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 >Feature sequence1163 889 8 gene locus_tag LOCUS_37400 889 8 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257811.1 protein_id gnl|my_center|LOCUS_37400 <1926 886 gene locus_tag LOCUS_37410 <1926 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027082.1:peptidase M28 >Feature sequence1164 1659 205 gene locus_tag LOCUS_37420 1659 205 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_37420 >Feature sequence1165 >Feature sequence1166 1269 28 gene locus_tag LOCUS_37430 1269 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 <1919 1277 gene locus_tag LOCUS_37440 <1919 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084878.1:ATP-grasp domain-containing protein >Feature sequence1167 67 1248 gene locus_tag LOCUS_37450 67 1248 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_37450 >Feature sequence1168 >Feature sequence1169 1185 484 gene locus_tag LOCUS_37460 gene rnc 1185 484 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_37460 >Feature sequence1170 1826 702 gene locus_tag LOCUS_37470 1826 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence1171 1374 295 gene locus_tag LOCUS_37480 gene asd 1374 295 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_37480 >Feature sequence1172 1262 387 gene locus_tag LOCUS_37490 1262 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence1173 <1 528 gene locus_tag LOCUS_37500 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D56:aspartate--tRNA(Asp/Asn) ligase 525 1682 gene locus_tag LOCUS_37510 gene aroB 525 1682 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_37510 >Feature sequence1174 2 1084 gene locus_tag LOCUS_37520 2 1084 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_37520 1143 1757 gene locus_tag LOCUS_37530 1143 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence1175 1786 674 gene locus_tag LOCUS_37540 gene arcT 1786 674 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_37540 >Feature sequence1176 >Feature sequence1177 349 1191 gene locus_tag LOCUS_37550 349 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37550 >Feature sequence1178 218 1381 gene locus_tag LOCUS_37560 218 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence1179 <1 822 gene locus_tag LOCUS_37570 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha 1752 898 gene locus_tag LOCUS_37580 1752 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence1180 >Feature sequence1181 257 1429 gene locus_tag LOCUS_37590 257 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37590 >Feature sequence1182 >Feature sequence1183 446 1159 gene locus_tag LOCUS_37600 446 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence1184 >Feature sequence1185 >Feature sequence1186 >Feature sequence1187 >Feature sequence1188 >Feature sequence1189 1079 399 gene locus_tag LOCUS_37610 1079 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 1541 1245 gene locus_tag LOCUS_37620 1541 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 >Feature sequence1190 1061 696 gene locus_tag LOCUS_37630 1061 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 946 1740 gene locus_tag LOCUS_37640 946 1740 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013910.1 protein_id gnl|my_center|LOCUS_37640 >Feature sequence1191 1346 198 gene locus_tag LOCUS_37650 1346 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence1192 >Feature sequence1193 <1865 515 gene locus_tag LOCUS_37660 <1865 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459204.1:ATP-binding protein >Feature sequence1194 838 233 gene locus_tag LOCUS_37670 838 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 1006 845 gene locus_tag LOCUS_37680 1006 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1276 1779 gene locus_tag LOCUS_37690 1276 1779 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918775.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence1195 1386 754 gene locus_tag LOCUS_37700 1386 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1527 1745 gene locus_tag LOCUS_37710 1527 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 >Feature sequence1196 >Feature sequence1197 103 516 gene locus_tag LOCUS_37720 103 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence1198 3 371 gene locus_tag LOCUS_37730 3 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 <1857 493 gene locus_tag LOCUS_37740 <1857 493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118737.1:iduronate-2-sulfatase >Feature sequence1199 >Feature sequence1200 <1 1347 gene locus_tag LOCUS_37750 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IW81:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence1201 <1 1083 gene locus_tag LOCUS_37760 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119047.1:alcohol dehydrogenase >Feature sequence1202 <1 579 gene locus_tag LOCUS_37770 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263153.1:potassium transporter KefG >Feature sequence1203 >Feature sequence1204 >Feature sequence1205 >Feature sequence1206 303 142 gene locus_tag LOCUS_37780 303 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 354 614 gene locus_tag LOCUS_37790 354 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 691 942 gene locus_tag LOCUS_37800 691 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 1033 1248 gene locus_tag LOCUS_37810 1033 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 1245 1448 gene locus_tag LOCUS_37820 1245 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1492 1797 gene locus_tag LOCUS_37830 1492 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence1207 >Feature sequence1208 1840 521 gene locus_tag LOCUS_37840 1840 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence1209 <1 505 gene locus_tag LOCUS_37850 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097939.1:acetyltransferase GCN5 599 1600 gene locus_tag LOCUS_37860 599 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence1210 71 391 gene locus_tag LOCUS_37870 71 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 506 976 gene locus_tag LOCUS_37880 506 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 1762 1022 gene locus_tag LOCUS_37890 1762 1022 CDS product CRISPR-associated protein Cse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence1211 1734 886 gene locus_tag LOCUS_37900 1734 886 CDS product alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence1212 1507 656 gene locus_tag LOCUS_37910 1507 656 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_37910 1666 1739 gene locus_tag LOCUS_t00460 1666 1739 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1213 1722 1021 gene locus_tag LOCUS_37920 1722 1021 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence1214 >Feature sequence1215 30 1004 gene locus_tag LOCUS_37930 30 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence1216 >Feature sequence1217 90 308 gene locus_tag LOCUS_37940 90 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence1218 182 1318 gene locus_tag LOCUS_37950 182 1318 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGN4 protein_id gnl|my_center|LOCUS_37950 >Feature sequence1219 925 338 gene locus_tag LOCUS_37960 925 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 1252 1046 gene locus_tag LOCUS_37970 1252 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 1813 1358 gene locus_tag LOCUS_37980 1813 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence1220 >Feature sequence1221 1811 1440 gene locus_tag LOCUS_37990 1811 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence1222 27 374 gene locus_tag LOCUS_38000 gene ytxJ 27 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39914 protein_id gnl|my_center|LOCUS_38000 1386 418 gene locus_tag LOCUS_38010 1386 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence1223 328 1638 gene locus_tag LOCUS_38020 328 1638 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence1224 94 1263 gene locus_tag LOCUS_38030 94 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 >Feature sequence1225 <1 1051 gene locus_tag LOCUS_38040 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence1226 152 1783 gene locus_tag LOCUS_38050 152 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence1227 <1 1000 gene locus_tag LOCUS_38060 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJV8:signal recognition particle protein 1288 1659 gene locus_tag LOCUS_38070 1288 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence1228 609 1214 gene locus_tag LOCUS_38080 609 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 1211 1786 gene locus_tag LOCUS_38090 1211 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1229 1804 269 gene locus_tag LOCUS_38100 1804 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205552.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence1230 489 1430 gene locus_tag LOCUS_38110 489 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_38110 >Feature sequence1231 >Feature sequence1232 <1 994 gene locus_tag LOCUS_38120 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54223:oxygen-dependent choline dehydrogenase >Feature sequence1233 >Feature sequence1234 >Feature sequence1235 >Feature sequence1236 1591 326 gene locus_tag LOCUS_38130 1591 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence1237 566 192 gene locus_tag LOCUS_38140 566 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1087 677 gene locus_tag LOCUS_38150 1087 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 >Feature sequence1238 <1 942 gene locus_tag LOCUS_38160 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259305.1:aldehyde dehydrogenase 952 1779 gene locus_tag LOCUS_38170 952 1779 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence1239 1443 1598 gene locus_tag LOCUS_38180 1443 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence1240 >Feature sequence1241 <1 629 gene locus_tag LOCUS_38190 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812167.1:membrane protein 829 1302 gene locus_tag LOCUS_38200 gene rimP 829 1302 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X299 protein_id gnl|my_center|LOCUS_38200 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 1779 496 gene locus_tag LOCUS_38210 1779 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 <1 1657 gene locus_tag LOCUS_38220 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943007.1:methyl-accepting chemotaxis protein >Feature sequence1248 728 348 gene locus_tag LOCUS_38230 728 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 998 1411 gene locus_tag LOCUS_38240 998 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence1249 >Feature sequence1250 1473 199 gene locus_tag LOCUS_38250 1473 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1756 1526 gene locus_tag LOCUS_38260 1756 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence1251 <1756 1169 gene locus_tag LOCUS_38270 <1756 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942409.1:farnesyl-diphosphate synthase >Feature sequence1252 28 336 gene locus_tag LOCUS_38280 28 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 499 990 gene locus_tag LOCUS_38290 499 990 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence1253 >Feature sequence1254 1189 134 gene locus_tag LOCUS_38300 1189 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence1255 >Feature sequence1256 570 1349 gene locus_tag LOCUS_38310 570 1349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence1257 >Feature sequence1258 <1 1090 gene locus_tag LOCUS_38320 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:sensor histidine kinase >Feature sequence1259 >Feature sequence1260 >Feature sequence1261 <1748 793 gene locus_tag LOCUS_38330 <1748 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065995.1:UDP-glucose 4-epimerase >Feature sequence1262 >Feature sequence1263 >Feature sequence1264 <1740 448 gene locus_tag LOCUS_38340 <1740 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119604.1:arylsulfatase >Feature sequence1265 >Feature sequence1266 >Feature sequence1267 1147 1605 gene locus_tag LOCUS_38350 1147 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence1268 >Feature sequence1269 1599 79 gene locus_tag LOCUS_38360 1599 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 >Feature sequence1270 <1 666 gene locus_tag LOCUS_38370 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108842.1:dehydrogenase 1236 649 gene locus_tag LOCUS_38380 1236 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_38380 1724 1236 gene locus_tag LOCUS_38390 1724 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence1271 1357 479 gene locus_tag LOCUS_38400 1357 479 CDS product PPK2 family polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_38400 >Feature sequence1272 >Feature sequence1273 3 497 gene locus_tag LOCUS_38410 3 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 1219 494 gene locus_tag LOCUS_38420 1219 494 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_38420 >Feature sequence1274 >Feature sequence1275 >Feature sequence1276 >Feature sequence1277 376 1653 gene locus_tag LOCUS_38430 376 1653 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence1278 939 49 gene locus_tag LOCUS_38440 939 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence1279 >Feature sequence1280 1198 854 gene locus_tag LOCUS_38450 1198 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 >Feature sequence1281 169 423 gene locus_tag LOCUS_38460 169 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 1323 469 gene locus_tag LOCUS_38470 1323 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence1282 >Feature sequence1283 1660 569 gene locus_tag LOCUS_38480 1660 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence1284 1278 601 gene locus_tag LOCUS_38490 1278 601 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence1285 503 1420 gene locus_tag LOCUS_38500 gene fmt 503 1420 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K5 protein_id gnl|my_center|LOCUS_38500 >Feature sequence1286 1277 657 gene locus_tag LOCUS_38510 1277 657 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_38510 >Feature sequence1287 1091 405 gene locus_tag LOCUS_38520 1091 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence1288 >Feature sequence1289 <1 573 gene locus_tag LOCUS_38530 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DB5:acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha >Feature sequence1290 >Feature sequence1291 1571 786 gene locus_tag LOCUS_38540 1571 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence1292 >Feature sequence1293 148 1641 gene locus_tag LOCUS_38550 148 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence1294 242 1366 gene locus_tag LOCUS_38560 242 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence1295 >Feature sequence1296 869 1444 gene locus_tag LOCUS_38570 869 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence1297 563 937 gene locus_tag LOCUS_38580 563 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268151.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence1298 >Feature sequence1299 >Feature sequence1300 <1 1633 gene locus_tag LOCUS_38590 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118376.1:N-acetylgalactosamine-6-sulfatase >Feature sequence1301 657 4 gene locus_tag LOCUS_38600 657 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 1565 654 gene locus_tag LOCUS_38610 1565 654 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence1302 1288 65 gene locus_tag LOCUS_38620 gene add 1288 65 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence1303 <1 1017 gene locus_tag LOCUS_38630 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404380.1:protease >Feature sequence1304 <1 690 gene locus_tag LOCUS_38640 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AY0:apolipoprotein N-acyltransferase >Feature sequence1305 <1 586 gene locus_tag LOCUS_38650 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141949.1:4'-phosphopantetheinyl transferase >Feature sequence1306 >Feature sequence1307 >Feature sequence1308 1186 731 gene locus_tag LOCUS_38660 1186 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38660 >Feature sequence1309 <1 1161 gene locus_tag LOCUS_38670 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMU1:histidine kinase >Feature sequence1310 73 1290 gene locus_tag LOCUS_38680 73 1290 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 >Feature sequence1314 1464 154 gene locus_tag LOCUS_38690 1464 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence1315 <1 1567 gene locus_tag LOCUS_38700 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228471.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence1316 >Feature sequence1317 121 1608 gene locus_tag LOCUS_38710 121 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence1318 <1 755 gene locus_tag LOCUS_38720 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258158.1:CRISPR-associated RAMP protein 743 1162 gene locus_tag LOCUS_38730 743 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence1319 >Feature sequence1320 >Feature sequence1321 >Feature sequence1322 1467 175 gene locus_tag LOCUS_38740 1467 175 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_38740 >Feature sequence1323 >Feature sequence1324 >Feature sequence1325 89 799 gene locus_tag LOCUS_38750 89 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence1326 161 1585 gene locus_tag LOCUS_38760 161 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence1327 <1 623 gene locus_tag LOCUS_38770 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254587.1:sporulation initiation inhibitor Soj 616 1083 gene locus_tag LOCUS_38780 616 1083 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_38780 1611 1165 gene locus_tag LOCUS_38790 1611 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence1328 <1611 570 gene locus_tag LOCUS_38800 <1611 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228641.1:SARP family transcriptional regulator >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 400 855 gene locus_tag LOCUS_38810 400 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 <1606 947 gene locus_tag LOCUS_38820 <1606 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000528010.1:amine oxidase >Feature sequence1333 >Feature sequence1334 1133 183 gene locus_tag LOCUS_38830 gene selD 1133 183 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_38830 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 518 177 gene locus_tag LOCUS_38840 518 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 1192 578 gene locus_tag LOCUS_38850 1192 578 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence1338 >Feature sequence1339 >Feature sequence1340 788 1489 gene locus_tag LOCUS_38860 788 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 >Feature sequence1341 228 752 gene locus_tag LOCUS_38870 228 752 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_38870 <1587 759 gene locus_tag LOCUS_38880 <1587 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121855.1:manganese transporter >Feature sequence1342 651 1580 gene locus_tag LOCUS_38890 651 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence1343 <1583 1083 gene locus_tag LOCUS_38900 <1583 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004434020.1:spermidine/putrescine ABC transporter ATP-binding protein >Feature sequence1344 >Feature sequence1345 <1 904 gene locus_tag LOCUS_38910 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS4:Na(+)-translocating NADH-quinone reductase subunit B >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 454 1200 gene locus_tag LOCUS_38920 gene map 454 1200 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAS8 protein_id gnl|my_center|LOCUS_38920 >Feature sequence1349 1211 438 gene locus_tag LOCUS_38930 1211 438 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943189.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence1350 >Feature sequence1351 985 308 gene locus_tag LOCUS_38940 985 308 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence1352 45 851 gene locus_tag LOCUS_38950 45 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 >Feature sequence1353 >Feature sequence1354 >Feature sequence1355 >Feature sequence1356 208 687 gene locus_tag LOCUS_38960 208 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 753 1373 gene locus_tag LOCUS_38970 753 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence1357 230 619 gene locus_tag LOCUS_38980 gene blaI 230 619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence1358 >Feature sequence1359 >Feature sequence1360 <1556 159 gene locus_tag LOCUS_38990 <1556 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787732.1:membrane protein >Feature sequence1361 >Feature sequence1362 <1552 825 gene locus_tag LOCUS_39000 <1552 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:peptide transporter >Feature sequence1363 >Feature sequence1364 1328 396 gene locus_tag LOCUS_39010 1328 396 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929646.1 protein_id gnl|my_center|LOCUS_39010 >Feature sequence1365 78 530 gene locus_tag LOCUS_39020 78 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 527 1333 gene locus_tag LOCUS_39030 527 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_39030 >Feature sequence1366 1 828 gene locus_tag LOCUS_39040 1 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 1257 928 gene locus_tag LOCUS_39050 1257 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 >Feature sequence1367 >Feature sequence1368 >Feature sequence1369 <1 1217 gene locus_tag LOCUS_39060 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000644696.1:lytic transglycosylase note possible pseudo, frameshifted >Feature sequence1370 >Feature sequence1371 >Feature sequence1372 76 519 gene locus_tag LOCUS_39070 76 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence1373 <1 1008 gene locus_tag LOCUS_39080 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809406.1:multidrug ABC transporter substrate-binding protein >Feature sequence1374 >Feature sequence1375 >Feature sequence1376 404 1411 gene locus_tag LOCUS_39090 404 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence1377 >Feature sequence1378 >Feature sequence1379 <1535 792 gene locus_tag LOCUS_39100 <1535 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403751.1:C4-dicarboxylate ABC transporter >Feature sequence1380 1176 1271 gene locus_tag LOCUS_t00470 1176 1271 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1381 <1532 866 gene locus_tag LOCUS_39110 <1532 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035249530.1:signal recognition particle-docking protein FtsY >Feature sequence1382 1495 536 gene locus_tag LOCUS_39120 1495 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence1383 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 >Feature sequence1389 61 1035 gene locus_tag LOCUS_39130 gene truB 61 1035 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60344 protein_id gnl|my_center|LOCUS_39130 >Feature sequence1390 >Feature sequence1391 >Feature sequence1392 <1 905 gene locus_tag LOCUS_39140 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258991.1:LuxR family transcriptional regulator 1159 938 gene locus_tag LOCUS_39150 1159 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 889 155 gene locus_tag LOCUS_39160 889 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence1397 704 1483 gene locus_tag LOCUS_39170 gene fabG 704 1483 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_39170 >Feature sequence1398 631 822 gene locus_tag LOCUS_39180 631 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence1399 >Feature sequence1400 1237 98 gene locus_tag LOCUS_39190 1237 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence1401 >Feature sequence1402 948 160 gene locus_tag LOCUS_39200 948 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 1507 941 gene locus_tag LOCUS_39210 1507 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence1403 >Feature sequence1404 1505 540 gene locus_tag LOCUS_39220 1505 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence1405 >Feature sequence1406 >Feature sequence1407 >Feature sequence1408 <1 748 gene locus_tag LOCUS_39230 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001108817.1:amino oxidase >Feature sequence1409 1032 844 gene locus_tag LOCUS_39240 1032 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 1239 1057 gene locus_tag LOCUS_39250 1239 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence1410 >Feature sequence1411 1440 208 gene locus_tag LOCUS_39260 1440 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence1412 3 1139 gene locus_tag LOCUS_39270 3 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence1413 >Feature sequence1414 <1 723 gene locus_tag LOCUS_39280 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117973.1:RNA polymerase subunit sigma-24 >Feature sequence1415 >Feature sequence1416 >Feature sequence1417 143 1363 gene locus_tag LOCUS_39290 143 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence1418 1345 422 gene locus_tag LOCUS_39300 1345 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence1419 >Feature sequence1420 572 291 gene locus_tag LOCUS_39310 572 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence1421 201 1022 gene locus_tag LOCUS_39320 201 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence1422 819 298 gene locus_tag LOCUS_39330 819 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence1423 <1 1337 gene locus_tag LOCUS_39340 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121701.1:peptidase C25 >Feature sequence1424 >Feature sequence1425 <1 762 gene locus_tag LOCUS_39350 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328227.1:cation:proton antiporter >Feature sequence1426 980 27 gene locus_tag LOCUS_39360 gene pyrB 980 27 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_39360 >Feature sequence1427 1460 594 gene locus_tag LOCUS_39370 1460 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence1428 223 1104 gene locus_tag LOCUS_39380 gene rsmA 223 1104 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_39380 >Feature sequence1429 430 1116 gene locus_tag LOCUS_39390 430 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence1430 >Feature sequence1431 >Feature sequence1432 >Feature sequence1433 52 1257 gene locus_tag LOCUS_39400 52 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence1434 1207 110 gene locus_tag LOCUS_39410 1207 110 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129732.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence1435 520 314 gene locus_tag LOCUS_39420 520 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence1436 <1455 169 gene locus_tag LOCUS_39430 <1455 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225907.1:alpha/beta hydrolase >Feature sequence1437 490 2 gene locus_tag LOCUS_39440 490 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 829 999 gene locus_tag LOCUS_39450 829 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 >Feature sequence1438 >Feature sequence1439 >Feature sequence1440 >Feature sequence1441 >Feature sequence1442 >Feature sequence1443 1164 601 gene locus_tag LOCUS_39460 1164 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence1444 >Feature sequence1445 >Feature sequence1446 <1 740 gene locus_tag LOCUS_39470 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461138.1:daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein >Feature sequence1447 >Feature sequence1448 >Feature sequence1449 <1428 556 gene locus_tag LOCUS_39480 <1428 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709665.1:IS91 family transposase >Feature sequence1450 1275 337 gene locus_tag LOCUS_39490 1275 337 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence1451 >Feature sequence1452 1011 160 gene locus_tag LOCUS_39500 1011 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041248.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence1453 >Feature sequence1454 234 740 gene locus_tag LOCUS_39510 234 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 812 1219 gene locus_tag LOCUS_39520 gene rplL 812 1219 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7L5 protein_id gnl|my_center|LOCUS_39520 >Feature sequence1455 1195 86 gene locus_tag LOCUS_39530 1195 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence1456 >Feature sequence1457 <1 503 gene locus_tag LOCUS_39540 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063841.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1458 >Feature sequence1459 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 1400 906 gene locus_tag LOCUS_39550 1400 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 >Feature sequence1463 >Feature sequence1464 >Feature sequence1465 >Feature sequence1466 >Feature sequence1467 924 331 gene locus_tag LOCUS_39560 924 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence1468 464 718 gene locus_tag LOCUS_39570 464 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 <1397 823 gene locus_tag LOCUS_39580 <1397 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941191.1:aminodeoxychorismate synthase, component I >Feature sequence1469 128 847 gene locus_tag LOCUS_39590 128 847 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_39590 1027 1102 gene locus_tag LOCUS_t00480 1027 1102 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1134 1219 gene locus_tag LOCUS_t00490 1134 1219 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1272 1346 gene locus_tag LOCUS_t00500 1272 1346 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1470 >Feature sequence1471 <1394 291 gene locus_tag LOCUS_39600 <1394 291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765304.1:dipeptidyl carboxypeptidase II >Feature sequence1472 967 892 gene locus_tag LOCUS_t00510 967 892 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1473 1160 732 gene locus_tag LOCUS_39610 gene ndk 1160 732 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ6 protein_id gnl|my_center|LOCUS_39610 >Feature sequence1474 >Feature sequence1475 >Feature sequence1476 >Feature sequence1477 >Feature sequence1478 >Feature sequence1479 >Feature sequence1480 >Feature sequence1481 2 517 gene locus_tag LOCUS_39620 2 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 854 585 gene locus_tag LOCUS_39630 854 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence1482 489 809 gene locus_tag LOCUS_39640 489 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 >Feature sequence1483 >Feature sequence1484 >Feature sequence1485 >Feature sequence1486 366 178 gene locus_tag LOCUS_39650 366 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 646 440 gene locus_tag LOCUS_39660 646 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence1487 >Feature sequence1488 >Feature sequence1489 >Feature sequence1490 839 432 gene locus_tag LOCUS_39670 839 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence1491 >Feature sequence1492 >Feature sequence1493 371 1039 gene locus_tag LOCUS_39680 gene cynT 371 1039 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_39680 >Feature sequence1494 >Feature sequence1495 806 627 gene locus_tag LOCUS_39690 806 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence1496 >Feature sequence1497 >Feature sequence1498 712 14 gene locus_tag LOCUS_39700 712 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 >Feature sequence1499 >Feature sequence1500 >Feature sequence1501 >Feature sequence1502 1177 263 gene locus_tag LOCUS_39710 1177 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence1503 328 705 gene locus_tag LOCUS_39720 328 705 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546202.1 protein_id gnl|my_center|LOCUS_39720 >Feature sequence1504 <1 638 gene locus_tag LOCUS_39730 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038568.1:sigma-54-dependent Fis family transcriptional regulator 1275 544 gene locus_tag LOCUS_39740 1275 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence1505 <1 1177 gene locus_tag LOCUS_39750 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141846.1:sulfite reductase subunit beta >Feature sequence1506 >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 <1350 567 gene locus_tag LOCUS_39760 <1350 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CF54:acetylornithine deacetylase >Feature sequence1510 <1350 362 gene locus_tag LOCUS_39770 <1350 362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722319.1:sulfate adenylyltransferase >Feature sequence1511 192 1 gene locus_tag LOCUS_39780 192 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 585 1298 gene locus_tag LOCUS_39790 585 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence1512 874 170 gene locus_tag LOCUS_39800 874 170 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_39800 >Feature sequence1513 >Feature sequence1514 >Feature sequence1515 >Feature sequence1516 247 768 gene locus_tag LOCUS_39810 gene lspA 247 768 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_39810 >Feature sequence1517 >Feature sequence1518 >Feature sequence1519 >Feature sequence1520 >Feature sequence1521 <1 626 gene locus_tag LOCUS_39820 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038579.1:aminopeptidase <1336 639 gene locus_tag LOCUS_39830 <1336 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D56:aspartate--tRNA(Asp/Asn) ligase >Feature sequence1522 <1332 768 gene locus_tag LOCUS_39840 <1332 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RM63:hydroxylamine reductase >Feature sequence1523 >Feature sequence1524 >Feature sequence1525 482 150 gene locus_tag LOCUS_39850 482 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 910 485 gene locus_tag LOCUS_39860 910 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 1264 992 gene locus_tag LOCUS_39870 1264 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence1526 587 438 gene locus_tag LOCUS_39880 587 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 >Feature sequence1527 179 364 gene locus_tag LOCUS_39890 179 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 598 425 gene locus_tag LOCUS_39900 598 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 820 1233 gene locus_tag LOCUS_39910 820 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_39910 >Feature sequence1528 >Feature sequence1529 <1 539 gene locus_tag LOCUS_39920 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259645.1:forkhead-associated protein >Feature sequence1530 >Feature sequence1531 <1325 776 gene locus_tag LOCUS_39930 <1325 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814910.1:NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase >Feature sequence1532 >Feature sequence1533 >Feature sequence1534 >Feature sequence1535 140 964 gene locus_tag LOCUS_39940 140 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 >Feature sequence1536 151 582 gene locus_tag LOCUS_39950 151 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 <1318 543 gene locus_tag LOCUS_39960 <1318 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973213.1:hydrolase >Feature sequence1537 636 196 gene locus_tag LOCUS_39970 636 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 >Feature sequence1538 >Feature sequence1539 323 1069 gene locus_tag LOCUS_39980 323 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence1540 <1309 692 gene locus_tag LOCUS_39990 <1309 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458930.1:NHLP family bacteriocin export ABC transporter permease/ATPase subunit >Feature sequence1541 916 89 gene locus_tag LOCUS_40000 916 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence1542 >Feature sequence1543 >Feature sequence1544 >Feature sequence1545 >Feature sequence1546 1266 205 gene locus_tag LOCUS_40010 1266 205 CDS product dinitrogenase reductase activating glycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_40010 >Feature sequence1547 >Feature sequence1548 >Feature sequence1549 >Feature sequence1550 <1 827 gene locus_tag LOCUS_40020 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NPN0:primosomal protein N' >Feature sequence1551 <1291 257 gene locus_tag LOCUS_40030 <1291 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119651.1:sodium:proline symporter >Feature sequence1552 <1289 245 gene locus_tag LOCUS_40040 <1289 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122626.1:polyvinyl alcohol dehydrogenase >Feature sequence1553 >Feature sequence1554 >Feature sequence1555 >Feature sequence1556 >Feature sequence1557 >Feature sequence1558 >Feature sequence1559 1261 251 gene locus_tag LOCUS_40050 1261 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 >Feature sequence1560 >Feature sequence1561 >Feature sequence1562 >Feature sequence1563 >Feature sequence1564 >Feature sequence1565 >Feature sequence1566 >Feature sequence1567 <1 738 gene locus_tag LOCUS_40060 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000538757.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence1568 883 59 gene locus_tag LOCUS_40070 883 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence1569 >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 >Feature sequence1573 >Feature sequence1574 201 1067 gene locus_tag LOCUS_40080 gene cutM 201 1067 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_40080 >Feature sequence1575 >Feature sequence1576 >Feature sequence1577 >Feature sequence1578 >Feature sequence1579 <1262 563 gene locus_tag LOCUS_40090 <1262 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089033.1:peptidase C39 >Feature sequence1580 >Feature sequence1581 1261 809 gene locus_tag LOCUS_40100 1261 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 >Feature sequence1582 84 1013 gene locus_tag LOCUS_40110 84 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence1583 >Feature sequence1584 >Feature sequence1585 <1254 40 gene locus_tag LOCUS_40120 <1254 40 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902151.1:nucleotide pyrophosphatase >Feature sequence1586 <1 573 gene locus_tag LOCUS_40130 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMP6:nuclease SbcCD subunit C >Feature sequence1587 >Feature sequence1588 1232 378 gene locus_tag LOCUS_40140 1232 378 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708196.1 protein_id gnl|my_center|LOCUS_40140 >Feature sequence1589 215 913 gene locus_tag LOCUS_40150 215 913 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence1590 >Feature sequence1591 500 96 gene locus_tag LOCUS_40160 500 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 1136 543 gene locus_tag LOCUS_40170 1136 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence1592 1186 950 gene locus_tag LOCUS_40180 1186 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence1593 >Feature sequence1594 >Feature sequence1595 >Feature sequence1596 565 320 gene locus_tag LOCUS_40190 565 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence1597 >Feature sequence1598 <1238 372 gene locus_tag LOCUS_40200 <1238 372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258974.1:2-oxoisovalerate dehydrogenase subunit beta >Feature sequence1599 >Feature sequence1600 >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 >Feature sequence1604 1210 695 gene locus_tag LOCUS_40210 1210 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence1605 >Feature sequence1606 >Feature sequence1607 >Feature sequence1608 25 1089 gene locus_tag LOCUS_40220 25 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40220 >Feature sequence1609 273 602 gene locus_tag LOCUS_40230 273 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 1110 757 gene locus_tag LOCUS_40240 1110 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence1610 >Feature sequence1611 >Feature sequence1612 437 513 gene locus_tag LOCUS_t00520 437 513 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1613 >Feature sequence1614 >Feature sequence1615 >Feature sequence1616 >Feature sequence1617 49 939 gene locus_tag LOCUS_40250 49 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence1618 >Feature sequence1619 >Feature sequence1620 168 626 gene locus_tag LOCUS_40260 168 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence1621 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 915 484 gene locus_tag LOCUS_40270 915 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 >Feature sequence1625 >Feature sequence1626 >Feature sequence1627 >Feature sequence1628 <1 557 gene locus_tag LOCUS_40280 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SIH7:NAD-dependent protein deacylase 1085 576 gene locus_tag LOCUS_40290 1085 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence1629 164 808 gene locus_tag LOCUS_40300 gene msrA 164 808 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_40300 >Feature sequence1630 368 141 gene locus_tag LOCUS_40310 368 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence1631 >Feature sequence1632 1182 571 gene locus_tag LOCUS_40320 1182 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence1633 >Feature sequence1634 >Feature sequence1635 >Feature sequence1636 >Feature sequence1637 261 1049 gene locus_tag LOCUS_40330 261 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence1638 >Feature sequence1639 >Feature sequence1640 >Feature sequence1641 >Feature sequence1642 >Feature sequence1643 <1174 92 gene locus_tag LOCUS_40340 <1174 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121349.1:peptidase >Feature sequence1644 >Feature sequence1645 >Feature sequence1646 >Feature sequence1647 <1 702 gene locus_tag LOCUS_40350 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A3CM74:DNA helicase >Feature sequence1648 >Feature sequence1649 >Feature sequence1650 661 35 gene locus_tag LOCUS_40360 661 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence1651 >Feature sequence1652 <1 651 gene locus_tag LOCUS_40370 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029132.1:cytochrome P450 >Feature sequence1653 >Feature sequence1654 >Feature sequence1655 <1 932 gene locus_tag LOCUS_40380 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140720.1:hybrid sensor histidine kinase/response regulator >Feature sequence1656 86 988 gene locus_tag LOCUS_40390 86 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 >Feature sequence1657 >Feature sequence1658 >Feature sequence1659 >Feature sequence1660 >Feature sequence1661 >Feature sequence1662 1070 315 gene locus_tag LOCUS_40400 1070 315 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_40400 >Feature sequence1663 >Feature sequence1664 >Feature sequence1665 >Feature sequence1666 253 594 gene locus_tag LOCUS_40410 253 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence1667 <1138 428 gene locus_tag LOCUS_40420 <1138 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390050.1:serine protease >Feature sequence1668 965 93 gene locus_tag LOCUS_40430 gene lipZ 965 93 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence1669 <1136 94 gene locus_tag LOCUS_40440 <1136 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068525.1:coenzyme F390 synthetase >Feature sequence1670 425 712 gene locus_tag LOCUS_40450 425 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 797 994 gene locus_tag LOCUS_40460 797 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence1671 >Feature sequence1672 >Feature sequence1673 >Feature sequence1674 <1131 15 gene locus_tag LOCUS_40470 <1131 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34442:magnesium transporter MgtE >Feature sequence1675 >Feature sequence1676 647 276 gene locus_tag LOCUS_40480 647 276 CDS product UPF0382 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ5 protein_id gnl|my_center|LOCUS_40480 928 656 gene locus_tag LOCUS_40490 928 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence1677 >Feature sequence1678 >Feature sequence1679 >Feature sequence1680 >Feature sequence1681 <1125 469 gene locus_tag LOCUS_40500 <1125 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGW0:imidazole glycerol phosphate synthase subunit HisH >Feature sequence1682 >Feature sequence1683 >Feature sequence1684 >Feature sequence1685 >Feature sequence1686 381 118 gene locus_tag LOCUS_40510 381 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence1687 <1 738 gene locus_tag LOCUS_40520 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113143.1:non-ribosomal peptide synthetase >Feature sequence1688 >Feature sequence1689 1114 323 gene locus_tag LOCUS_40530 gene cpdA 1114 323 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_40530 >Feature sequence1690 <1 758 gene locus_tag LOCUS_40540 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948378.1:methyltransferase >Feature sequence1691 913 764 gene locus_tag LOCUS_40550 913 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence1692 >Feature sequence1693 >Feature sequence1694 <1 918 gene locus_tag LOCUS_40560 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence1695 >Feature sequence1696 >Feature sequence1697 >Feature sequence1698 320 901 gene locus_tag LOCUS_40570 320 901 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_40570 >Feature sequence1699 155 433 gene locus_tag LOCUS_40580 155 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 >Feature sequence1700 >Feature sequence1701 >Feature sequence1702 >Feature sequence1703 <1100 516 gene locus_tag LOCUS_40590 <1100 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:PAS domain-containing sensor histidine kinase >Feature sequence1704 >Feature sequence1705 >Feature sequence1706 >Feature sequence1707 >Feature sequence1708 >Feature sequence1709 >Feature sequence1710 >Feature sequence1711 >Feature sequence1712 <1 841 gene locus_tag LOCUS_40600 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase >Feature sequence1713 22 576 gene locus_tag LOCUS_40610 22 576 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence1714 >Feature sequence1715 >Feature sequence1716 >Feature sequence1717 >Feature sequence1718 >Feature sequence1719 >Feature sequence1720 >Feature sequence1721 >Feature sequence1722 >Feature sequence1723 >Feature sequence1724 >Feature sequence1725 >Feature sequence1726 1066 401 gene locus_tag LOCUS_40620 1066 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence1727 872 471 gene locus_tag LOCUS_40630 872 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence1728 >Feature sequence1729 >Feature sequence1730 979 239 gene locus_tag LOCUS_40640 979 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 >Feature sequence1731 >Feature sequence1732 >Feature sequence1733 >Feature sequence1734 >Feature sequence1735 49 432 gene locus_tag LOCUS_40650 49 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 >Feature sequence1736 426 680 gene locus_tag LOCUS_40660 426 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence1737 >Feature sequence1738 >Feature sequence1739 >Feature sequence1740 >Feature sequence1741 <1056 135 gene locus_tag LOCUS_40670 <1056 135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118846.1:glucose sorbosone dehydrogenase >Feature sequence1742 >Feature sequence1743 818 192 gene locus_tag LOCUS_40680 818 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence1744 >Feature sequence1745 854 612 gene locus_tag LOCUS_40690 854 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence1746 >Feature sequence1747 194 868 gene locus_tag LOCUS_40700 194 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence1748 >Feature sequence1749 >Feature sequence1750 <1 1046 gene locus_tag LOCUS_40710 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119032.1:cytochrome c554 >Feature sequence1751 545 721 gene locus_tag LOCUS_40720 545 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence1752 >Feature sequence1753 2 247 gene locus_tag LOCUS_40730 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence1754 >Feature sequence1755 >Feature sequence1756 >Feature sequence1757 270 419 gene locus_tag LOCUS_40740 270 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 533 682 gene locus_tag LOCUS_40750 533 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 833 982 gene locus_tag LOCUS_40760 833 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence1758 >Feature sequence1759 >Feature sequence1760 >Feature sequence1761 >Feature sequence1762 >Feature sequence1763 >Feature sequence1764 213 884 gene locus_tag LOCUS_40770 213 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence1765 >Feature sequence1766 >Feature sequence1767 >Feature sequence1768 >Feature sequence1769 <1 958 gene locus_tag LOCUS_40780 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55631:putative transposase y4qJ >Feature sequence1770 427 203 gene locus_tag LOCUS_40790 427 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence1771 >Feature sequence1772 83 9 gene locus_tag LOCUS_t00530 83 9 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 303 133 gene locus_tag LOCUS_40800 303 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 888 469 gene locus_tag LOCUS_40810 888 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence1773 337 516 gene locus_tag LOCUS_40820 337 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence1774 >Feature sequence1775 >Feature sequence1776 >Feature sequence1777 >Feature sequence1778 >Feature sequence1779 713 177 gene locus_tag LOCUS_40830 713 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence1780 41 229 gene locus_tag LOCUS_40840 41 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence1781