>Feature sequence001 228 1088 gene locus_tag LOCUS_00010 228 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2574 1105 gene locus_tag LOCUS_00020 2574 1105 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGU0 protein_id gnl|my_center|LOCUS_00020 3248 2583 gene locus_tag LOCUS_00030 3248 2583 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_00030 3327 4943 gene locus_tag LOCUS_00040 gene alkK 3327 4943 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 protein_id gnl|my_center|LOCUS_00040 4945 5406 gene locus_tag LOCUS_00050 4945 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_00050 6837 5410 gene locus_tag LOCUS_00060 gene gatB 6837 5410 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_00060 8288 6834 gene locus_tag LOCUS_00070 gene gatA 8288 6834 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_00070 8566 8285 gene locus_tag LOCUS_00080 gene gatC 8566 8285 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA2 protein_id gnl|my_center|LOCUS_00080 8645 9694 gene locus_tag LOCUS_00090 8645 9694 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_00090 9700 10533 gene locus_tag LOCUS_00100 9700 10533 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LC2 protein_id gnl|my_center|LOCUS_00100 10530 11003 gene locus_tag LOCUS_00110 10530 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11089 13344 gene locus_tag LOCUS_00120 11089 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14676 13336 gene locus_tag LOCUS_00130 14676 13336 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_00130 15980 14706 gene locus_tag LOCUS_00140 15980 14706 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY95 protein_id gnl|my_center|LOCUS_00140 16699 15986 gene locus_tag LOCUS_00150 gene lptB 16699 15986 CDS product lipopolysaccharide export system ATP-binding protein LptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45073 protein_id gnl|my_center|LOCUS_00150 17124 16702 gene locus_tag LOCUS_00160 17124 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18087 17125 gene locus_tag LOCUS_00170 18087 17125 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LE6 protein_id gnl|my_center|LOCUS_00170 18141 18776 gene locus_tag LOCUS_00180 18141 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_00180 18769 18987 gene locus_tag LOCUS_00190 18769 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18988 20247 gene locus_tag LOCUS_00200 gene murA 18988 20247 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX85 protein_id gnl|my_center|LOCUS_00200 21228 20236 gene locus_tag LOCUS_00210 21228 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21236 22273 gene locus_tag LOCUS_00220 21236 22273 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019743.1 protein_id gnl|my_center|LOCUS_00220 22339 22779 gene locus_tag LOCUS_00230 gene rplM 22339 22779 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5A5 protein_id gnl|my_center|LOCUS_00230 22776 23168 gene locus_tag LOCUS_00240 gene rpsI 22776 23168 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_00240 23250 23834 gene locus_tag LOCUS_00250 23250 23834 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_00250 23835 25052 gene locus_tag LOCUS_00260 23835 25052 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_00260 25049 25882 gene locus_tag LOCUS_00270 25049 25882 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_00270 25898 26509 gene locus_tag LOCUS_00280 25898 26509 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 protein_id gnl|my_center|LOCUS_00280 27467 26511 gene locus_tag LOCUS_00290 27467 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27483 28304 gene locus_tag LOCUS_00300 gene rsmI 27483 28304 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y3 protein_id gnl|my_center|LOCUS_00300 28746 29213 gene locus_tag LOCUS_00310 gene mraZ 28746 29213 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY1 protein_id gnl|my_center|LOCUS_00310 29227 30336 gene locus_tag LOCUS_00320 gene ftsZ 29227 30336 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_00320 30338 31231 gene locus_tag LOCUS_00330 gene rsmH 30338 31231 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AJH1 protein_id gnl|my_center|LOCUS_00330 31228 31515 gene locus_tag LOCUS_00340 31228 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31505 33121 gene locus_tag LOCUS_00350 31505 33121 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528508.1 protein_id gnl|my_center|LOCUS_00350 33114 34610 gene locus_tag LOCUS_00360 gene murE 33114 34610 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67631 protein_id gnl|my_center|LOCUS_00360 34594 35934 gene locus_tag LOCUS_00370 gene murF 34594 35934 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VHF8 protein_id gnl|my_center|LOCUS_00370 35927 37012 gene locus_tag LOCUS_00380 gene mraY 35927 37012 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_00380 37022 38047 gene locus_tag LOCUS_00390 gene murD 37022 38047 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHK3 protein_id gnl|my_center|LOCUS_00390 38040 39146 gene locus_tag LOCUS_00400 gene ftsW 38040 39146 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW00 protein_id gnl|my_center|LOCUS_00400 39151 40197 gene locus_tag LOCUS_00410 gene murG 39151 40197 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6L8 protein_id gnl|my_center|LOCUS_00410 40194 41588 gene locus_tag LOCUS_00420 gene murC 40194 41588 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45066 protein_id gnl|my_center|LOCUS_00420 41576 42481 gene locus_tag LOCUS_00430 gene ddlB 41576 42481 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_00430 42468 43097 gene locus_tag LOCUS_00440 42468 43097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43087 44313 gene locus_tag LOCUS_00450 gene ftsA 43087 44313 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_00450 44395 44847 gene locus_tag LOCUS_00460 44395 44847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44840 45034 gene locus_tag LOCUS_00470 gene rpsR 44840 45034 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG00 protein_id gnl|my_center|LOCUS_00470 45040 45486 gene locus_tag LOCUS_00480 gene rplI 45040 45486 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z163 protein_id gnl|my_center|LOCUS_00480 45525 46895 gene locus_tag LOCUS_00490 45525 46895 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 protein_id gnl|my_center|LOCUS_00490 46892 47953 gene locus_tag LOCUS_00500 gene dadX 46892 47953 CDS product alanine racemase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ2 protein_id gnl|my_center|LOCUS_00500 48033 49661 gene locus_tag LOCUS_00510 gene pyrG 48033 49661 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA4 protein_id gnl|my_center|LOCUS_00510 49661 50500 gene locus_tag LOCUS_00520 gene kdsA 49661 50500 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_00520 >Feature sequence002 1721 366 gene locus_tag LOCUS_00530 gene glmU 1721 366 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_00530 2161 1748 gene locus_tag LOCUS_00540 gene atpC 2161 1748 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_00540 3561 2164 gene locus_tag LOCUS_00550 gene atpD 3561 2164 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_00550 4435 3572 gene locus_tag LOCUS_00560 gene atpG 4435 3572 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_00560 5988 4444 gene locus_tag LOCUS_00570 gene atpA 5988 4444 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG7 protein_id gnl|my_center|LOCUS_00570 6534 5998 gene locus_tag LOCUS_00580 gene atpH 6534 5998 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_00580 7008 6538 gene locus_tag LOCUS_00590 gene atpF 7008 6538 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT0 protein_id gnl|my_center|LOCUS_00590 7252 7028 gene locus_tag LOCUS_00600 gene atpE 7252 7028 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57119 protein_id gnl|my_center|LOCUS_00600 8214 7276 gene locus_tag LOCUS_00610 gene atpB 8214 7276 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_00610 8516 8214 gene locus_tag LOCUS_00620 8516 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 9473 8631 gene locus_tag LOCUS_00630 gene parB 9473 8631 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_00630 10227 9463 gene locus_tag LOCUS_00640 10227 9463 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516546.1 protein_id gnl|my_center|LOCUS_00640 10810 10220 gene locus_tag LOCUS_00650 gene rsmG 10810 10220 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53363 protein_id gnl|my_center|LOCUS_00650 12650 10803 gene locus_tag LOCUS_00660 gene mnmG 12650 10803 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8A9 protein_id gnl|my_center|LOCUS_00660 14180 12867 gene locus_tag LOCUS_00670 gene mnmE 14180 12867 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFF3 protein_id gnl|my_center|LOCUS_00670 15739 14186 gene locus_tag LOCUS_00680 gene yidC 15739 14186 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44973 protein_id gnl|my_center|LOCUS_00680 16038 15736 gene locus_tag LOCUS_00690 16038 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16449 17654 gene locus_tag LOCUS_00700 gene dnaA 16449 17654 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD8 protein_id gnl|my_center|LOCUS_00700 17657 18760 gene locus_tag LOCUS_00710 17657 18760 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TQ6 protein_id gnl|my_center|LOCUS_00710 18928 19872 gene locus_tag LOCUS_00720 gene recF 18928 19872 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_00720 19878 21794 gene locus_tag LOCUS_00730 19878 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 22315 21791 gene locus_tag LOCUS_00740 22315 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 23860 22499 gene locus_tag LOCUS_00750 23860 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 24122 24838 gene locus_tag LOCUS_00760 24122 24838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 26167 24839 gene locus_tag LOCUS_00770 gene trkH 26167 24839 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_00770 27625 26276 gene locus_tag LOCUS_00780 gene trkA 27625 26276 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_00780 28604 27681 gene locus_tag LOCUS_00790 gene fmt 28604 27681 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_00790 29146 28652 gene locus_tag LOCUS_00800 gene def 29146 28652 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_00800 29221 29721 gene locus_tag LOCUS_00810 gene purE 29221 29721 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA3 protein_id gnl|my_center|LOCUS_00810 29726 30286 gene locus_tag LOCUS_00820 gene yrdC 29726 30286 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_00820 30288 31193 gene locus_tag LOCUS_00830 gene hemF 30288 31193 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFZ8 protein_id gnl|my_center|LOCUS_00830 31186 31998 gene locus_tag LOCUS_00840 gene aroE 31186 31998 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 protein_id gnl|my_center|LOCUS_00840 31995 32192 gene locus_tag LOCUS_00850 31995 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 32323 33468 gene locus_tag LOCUS_00860 gene coxB 32323 33468 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_00860 33490 35073 gene locus_tag LOCUS_00870 gene coxA 33490 35073 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_00870 35073 35645 gene locus_tag LOCUS_00880 35073 35645 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence003 1485 505 gene locus_tag LOCUS_00890 gene glnII 1485 505 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_00890 2204 1629 gene locus_tag LOCUS_00900 gene yqiA 2204 1629 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_00900 2643 2197 gene locus_tag LOCUS_00910 2643 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3782 2646 gene locus_tag LOCUS_00920 3782 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_00920 4654 3794 gene locus_tag LOCUS_00930 gene ubiA 4654 3794 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_00930 5174 4641 gene locus_tag LOCUS_00940 5174 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5203 5379 gene locus_tag LOCUS_00950 gene rubA1 5203 5379 CDS product Rubredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK7 protein_id gnl|my_center|LOCUS_00950 5379 6629 gene locus_tag LOCUS_00960 5379 6629 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895466.1 protein_id gnl|my_center|LOCUS_00960 6694 8688 gene locus_tag LOCUS_00970 gene hppA1 6694 8688 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_00970 8750 9418 gene locus_tag LOCUS_00980 8750 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 9465 10316 gene locus_tag LOCUS_00990 9465 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_00990 10309 10929 gene locus_tag LOCUS_01000 gene gmk 10309 10929 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4U2 protein_id gnl|my_center|LOCUS_01000 10971 11240 gene locus_tag LOCUS_01010 gene rpoZ 10971 11240 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_01010 11261 13447 gene locus_tag LOCUS_01020 gene spoT 11261 13447 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957490.1 protein_id gnl|my_center|LOCUS_01020 13508 13894 gene locus_tag LOCUS_01030 13508 13894 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947724.1 protein_id gnl|my_center|LOCUS_01030 13887 14792 gene locus_tag LOCUS_01040 gene pyrB 13887 14792 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_01040 15383 14772 gene locus_tag LOCUS_01050 gene ribC 15383 14772 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_01050 16022 15384 gene locus_tag LOCUS_01060 gene pyrE 16022 15384 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8N9 protein_id gnl|my_center|LOCUS_01060 16727 16023 gene locus_tag LOCUS_01070 gene rph 16727 16023 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8P0 protein_id gnl|my_center|LOCUS_01070 17167 16763 gene locus_tag LOCUS_01080 17167 16763 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262667.1 protein_id gnl|my_center|LOCUS_01080 17430 17212 gene locus_tag LOCUS_01090 gene rpsU 17430 17212 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V8 protein_id gnl|my_center|LOCUS_01090 17491 18495 gene locus_tag LOCUS_01100 gene tsaD 17491 18495 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW9 protein_id gnl|my_center|LOCUS_01100 18492 18839 gene locus_tag LOCUS_01110 gene folB 18492 18839 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_01110 18839 19213 gene locus_tag LOCUS_01120 18839 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 19215 19826 gene locus_tag LOCUS_01130 19215 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 20880 19819 gene locus_tag LOCUS_01140 20880 19819 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_01140 21611 20877 gene locus_tag LOCUS_01150 21611 20877 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_01150 22621 21602 gene locus_tag LOCUS_01160 22621 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 23424 22618 gene locus_tag LOCUS_01170 gene apaH 23424 22618 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHI4 protein_id gnl|my_center|LOCUS_01170 24195 23425 gene locus_tag LOCUS_01180 gene rsmA 24195 23425 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF4 protein_id gnl|my_center|LOCUS_01180 25175 24195 gene locus_tag LOCUS_01190 gene pdxA 25175 24195 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNV5 protein_id gnl|my_center|LOCUS_01190 26413 25172 gene locus_tag LOCUS_01200 gene surA 26413 25172 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_01200 28692 26428 gene locus_tag LOCUS_01210 28692 26428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 29422 28820 gene locus_tag LOCUS_01220 29422 28820 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 protein_id gnl|my_center|LOCUS_01220 29369 30208 gene locus_tag LOCUS_01230 29369 30208 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_01230 30232 31089 gene locus_tag LOCUS_01240 30232 31089 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_01240 31091 32050 gene locus_tag LOCUS_01250 31091 32050 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_01250 32047 32718 gene locus_tag LOCUS_01260 32047 32718 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence004 131 1084 gene locus_tag LOCUS_01270 gene ispB 131 1084 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021158.1 protein_id gnl|my_center|LOCUS_01270 1081 1605 gene locus_tag LOCUS_01280 gene fabA 1081 1605 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_01280 1609 2817 gene locus_tag LOCUS_01290 1609 2817 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_01290 3703 2843 gene locus_tag LOCUS_01300 3703 2843 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_01300 4157 3720 gene locus_tag LOCUS_01310 gene ssb 4157 3720 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_01310 4228 7044 gene locus_tag LOCUS_01320 gene uvrA 4228 7044 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44410 protein_id gnl|my_center|LOCUS_01320 7460 7047 gene locus_tag LOCUS_01330 gene rplQ 7460 7047 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SY9 protein_id gnl|my_center|LOCUS_01330 8428 7469 gene locus_tag LOCUS_01340 gene rpoA 8428 7469 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_01340 9074 8451 gene locus_tag LOCUS_01350 gene rpsD 9074 8451 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59131 protein_id gnl|my_center|LOCUS_01350 9463 9086 gene locus_tag LOCUS_01360 gene rpsK 9463 9086 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_01360 9824 9465 gene locus_tag LOCUS_01370 gene rpsM 9824 9465 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_01370 11247 9946 gene locus_tag LOCUS_01380 gene secY 11247 9946 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_01380 11754 11251 gene locus_tag LOCUS_01390 gene rplO 11754 11251 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44353 protein_id gnl|my_center|LOCUS_01390 11944 11756 gene locus_tag LOCUS_01400 gene rpmD 11944 11756 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E896 protein_id gnl|my_center|LOCUS_01400 12450 11941 gene locus_tag LOCUS_01410 gene rpsE 12450 11941 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_01410 12805 12458 gene locus_tag LOCUS_01420 gene rplR 12805 12458 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_01420 13350 12808 gene locus_tag LOCUS_01430 gene rplF 13350 12808 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_01430 13747 13352 gene locus_tag LOCUS_01440 gene rpsH 13747 13352 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV4 protein_id gnl|my_center|LOCUS_01440 14060 13755 gene locus_tag LOCUS_01450 gene rpsN 14060 13755 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV5 protein_id gnl|my_center|LOCUS_01450 14609 14070 gene locus_tag LOCUS_01460 gene rplE 14609 14070 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_01460 14936 14610 gene locus_tag LOCUS_01470 gene rplX 14936 14610 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNZ5 protein_id gnl|my_center|LOCUS_01470 15307 14939 gene locus_tag LOCUS_01480 gene rplN 15307 14939 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_01480 15594 15307 gene locus_tag LOCUS_01490 gene rpsQ 15594 15307 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDT3 protein_id gnl|my_center|LOCUS_01490 15800 15594 gene locus_tag LOCUS_01500 gene rpmC 15800 15594 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_01500 16211 15801 gene locus_tag LOCUS_01510 gene rplP 16211 15801 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSH9 protein_id gnl|my_center|LOCUS_01510 16873 16214 gene locus_tag LOCUS_01520 gene rpsC 16873 16214 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNZ0 protein_id gnl|my_center|LOCUS_01520 17211 16873 gene locus_tag LOCUS_01530 gene rplV 17211 16873 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_01530 17483 17211 gene locus_tag LOCUS_01540 gene rpsS 17483 17211 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_01540 18316 17489 gene locus_tag LOCUS_01550 gene rplB 18316 17489 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW5 protein_id gnl|my_center|LOCUS_01550 18615 18319 gene locus_tag LOCUS_01560 gene rplW 18615 18319 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF91 protein_id gnl|my_center|LOCUS_01560 19222 18608 gene locus_tag LOCUS_01570 gene rplD 19222 18608 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF22 protein_id gnl|my_center|LOCUS_01570 19854 19219 gene locus_tag LOCUS_01580 gene rplC 19854 19219 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES4 protein_id gnl|my_center|LOCUS_01580 20227 19916 gene locus_tag LOCUS_01590 gene rpsJ 20227 19916 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY3 protein_id gnl|my_center|LOCUS_01590 22451 20349 gene locus_tag LOCUS_01600 gene fusA 22451 20349 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX0 protein_id gnl|my_center|LOCUS_01600 22944 22474 gene locus_tag LOCUS_01610 gene rpsG 22944 22474 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD1 protein_id gnl|my_center|LOCUS_01610 23318 22947 gene locus_tag LOCUS_01620 gene rpsL 23318 22947 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59166 protein_id gnl|my_center|LOCUS_01620 27556 23375 gene locus_tag LOCUS_01630 gene rpoC 27556 23375 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_01630 <30007 27566 gene locus_tag LOCUS_01640 <30007 27566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51561:DNA-directed RNA polymerase subunit beta >Feature sequence005 <1 1949 gene locus_tag LOCUS_01650 <1 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AR5:primosomal protein N' 3196 1946 gene locus_tag LOCUS_01660 3196 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3650 3189 gene locus_tag LOCUS_01670 gene yjeE 3650 3189 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_01670 4468 3647 gene locus_tag LOCUS_01680 4468 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5786 4473 gene locus_tag LOCUS_01690 5786 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6757 5861 gene locus_tag LOCUS_01700 6757 5861 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_01700 6784 7578 gene locus_tag LOCUS_01710 6784 7578 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_01710 7588 8385 gene locus_tag LOCUS_01720 7588 8385 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_01720 8756 8382 gene locus_tag LOCUS_01730 8756 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 10693 8768 gene locus_tag LOCUS_01740 gene acsA2 10693 8768 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_01740 11368 10703 gene locus_tag LOCUS_01750 11368 10703 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_01750 12630 11395 gene locus_tag LOCUS_01760 gene pcnB 12630 11395 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q3 protein_id gnl|my_center|LOCUS_01760 13253 12657 gene locus_tag LOCUS_01770 13253 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 14317 13316 gene locus_tag LOCUS_01780 14317 13316 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_01780 15474 14314 gene locus_tag LOCUS_01790 gene hemL 15474 14314 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_01790 15518 15667 gene locus_tag LOCUS_01800 15518 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 16242 15673 gene locus_tag LOCUS_01810 gene hemG 16242 15673 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 protein_id gnl|my_center|LOCUS_01810 16387 16725 gene locus_tag LOCUS_01820 gene erpA 16387 16725 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD57 protein_id gnl|my_center|LOCUS_01820 17785 16715 gene locus_tag LOCUS_01830 gene anmK 17785 16715 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_01830 19058 17805 gene locus_tag LOCUS_01840 19058 17805 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_01840 22027 19058 gene locus_tag LOCUS_01850 gene putA 22027 19058 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAW7 protein_id gnl|my_center|LOCUS_01850 22177 23367 gene locus_tag LOCUS_01860 gene tyrS 22177 23367 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_01860 23367 23822 gene locus_tag LOCUS_01870 23367 23822 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLT0 protein_id gnl|my_center|LOCUS_01870 25928 23823 gene locus_tag LOCUS_01880 25928 23823 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_01880 25957 26628 gene locus_tag LOCUS_01890 25957 26628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence006 <1 1069 gene locus_tag LOCUS_01900 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257654.1:sugar transporter 2487 1066 gene locus_tag LOCUS_01910 2487 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2521 3513 gene locus_tag LOCUS_01920 2521 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3513 4703 gene locus_tag LOCUS_01930 3513 4703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_01930 4700 5716 gene locus_tag LOCUS_01940 gene hemH 4700 5716 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_01940 5709 6581 gene locus_tag LOCUS_01950 5709 6581 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_01950 6593 8023 gene locus_tag LOCUS_01960 gene calB 6593 8023 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_01960 8028 9251 gene locus_tag LOCUS_01970 gene lolC 8028 9251 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_01970 9244 9909 gene locus_tag LOCUS_01980 gene lolD 9244 9909 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R20 protein_id gnl|my_center|LOCUS_01980 9910 10509 gene locus_tag LOCUS_01990 gene exbB 9910 10509 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_01990 10506 10910 gene locus_tag LOCUS_02000 gene exbD 10506 10910 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_02000 10907 13666 gene locus_tag LOCUS_02010 10907 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 13667 14389 gene locus_tag LOCUS_02020 gene kdsB 13667 14389 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX8 protein_id gnl|my_center|LOCUS_02020 14379 15371 gene locus_tag LOCUS_02030 gene murB 14379 15371 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_02030 15374 15979 gene locus_tag LOCUS_02040 15374 15979 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_02040 15966 16499 gene locus_tag LOCUS_02050 15966 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_02050 18415 16616 gene locus_tag LOCUS_02060 18415 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_02060 20046 18415 gene locus_tag LOCUS_02070 20046 18415 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 protein_id gnl|my_center|LOCUS_02070 20198 20920 gene locus_tag LOCUS_02080 gene etfB 20198 20920 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_02080 20917 21846 gene locus_tag LOCUS_02090 20917 21846 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_02090 21945 23219 gene locus_tag LOCUS_02100 21945 23219 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_02100 23541 23323 gene locus_tag LOCUS_02110 gene infA 23541 23323 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_02110 23627 24082 gene locus_tag LOCUS_02120 23627 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence007 <1 525 gene locus_tag LOCUS_02130 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039905.1:D-amino acid dehydrogenase 1184 522 gene locus_tag LOCUS_02140 1184 522 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_02140 1202 1690 gene locus_tag LOCUS_02150 gene rppH 1202 1690 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR55 protein_id gnl|my_center|LOCUS_02150 1683 2468 gene locus_tag LOCUS_02160 1683 2468 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_02160 2465 3262 gene locus_tag LOCUS_02170 gene lgt 2465 3262 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHX0 protein_id gnl|my_center|LOCUS_02170 3259 4122 gene locus_tag LOCUS_02180 gene thyA2 3259 4122 CDS product thymidylate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11044 protein_id gnl|my_center|LOCUS_02180 4125 4631 gene locus_tag LOCUS_02190 4125 4631 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM58 protein_id gnl|my_center|LOCUS_02190 6053 4626 gene locus_tag LOCUS_02200 6053 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071949.1 protein_id gnl|my_center|LOCUS_02200 6744 6046 gene locus_tag LOCUS_02210 6744 6046 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E130 protein_id gnl|my_center|LOCUS_02210 7161 6751 gene locus_tag LOCUS_02220 7161 6751 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_02220 7701 7171 gene locus_tag LOCUS_02230 gene exbB 7701 7171 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_02230 9097 7712 gene locus_tag LOCUS_02240 9097 7712 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_02240 9846 9097 gene locus_tag LOCUS_02250 9846 9097 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707900.1 protein_id gnl|my_center|LOCUS_02250 10791 9937 gene locus_tag LOCUS_02260 10791 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12611 10794 gene locus_tag LOCUS_02270 12611 10794 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_02270 12660 13223 gene locus_tag LOCUS_02280 gene efp 12660 13223 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B3 protein_id gnl|my_center|LOCUS_02280 13223 14968 gene locus_tag LOCUS_02290 gene argS 13223 14968 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF4 protein_id gnl|my_center|LOCUS_02290 14974 15507 gene locus_tag LOCUS_02300 14974 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 15492 16166 gene locus_tag LOCUS_02310 gene yggS 15492 16166 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_02310 16166 16957 gene locus_tag LOCUS_02320 gene proI 16166 16957 CDS product pyrroline-5-carboxylate reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54552 protein_id gnl|my_center|LOCUS_02320 16959 17471 gene locus_tag LOCUS_02330 16959 17471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377215.1 protein_id gnl|my_center|LOCUS_02330 17468 18565 gene locus_tag LOCUS_02340 gene metX 17468 18565 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_02340 18562 19155 gene locus_tag LOCUS_02350 gene metW 18562 19155 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_02350 19142 19744 gene locus_tag LOCUS_02360 19142 19744 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSN3 protein_id gnl|my_center|LOCUS_02360 19719 20858 gene locus_tag LOCUS_02370 gene hemN 19719 20858 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019808.1 protein_id gnl|my_center|LOCUS_02370 21498 20851 gene locus_tag LOCUS_02380 gene trmB 21498 20851 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NM2 protein_id gnl|my_center|LOCUS_02380 22376 21516 gene locus_tag LOCUS_02390 gene rpoH 22376 21516 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_02390 >Feature sequence008 1257 3152 gene locus_tag LOCUS_02400 gene parE 1257 3152 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ01 protein_id gnl|my_center|LOCUS_02400 3155 5416 gene locus_tag LOCUS_02410 gene parC 3155 5416 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M4 protein_id gnl|my_center|LOCUS_02410 6596 5391 gene locus_tag LOCUS_02420 gene argD 6596 5391 CDS product acetylornithine/succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57600 protein_id gnl|my_center|LOCUS_02420 6612 7088 gene locus_tag LOCUS_02430 6612 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 8343 7093 gene locus_tag LOCUS_02440 gene pfp 8343 7093 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_02440 8398 9705 gene locus_tag LOCUS_02450 gene mpl 8398 9705 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP18 protein_id gnl|my_center|LOCUS_02450 9695 10276 gene locus_tag LOCUS_02460 9695 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_02460 10700 10269 gene locus_tag LOCUS_02470 10700 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 10783 11127 gene locus_tag LOCUS_02480 10783 11127 CDS product ribosome silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816526.1 protein_id gnl|my_center|LOCUS_02480 11128 11592 gene locus_tag LOCUS_02490 gene rlmH 11128 11592 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7U4 protein_id gnl|my_center|LOCUS_02490 11589 13427 gene locus_tag LOCUS_02500 gene pbpA 11589 13427 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_02500 13424 14524 gene locus_tag LOCUS_02510 gene rodA 13424 14524 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_02510 14521 15408 gene locus_tag LOCUS_02520 gene sltB1 14521 15408 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_02520 15405 16559 gene locus_tag LOCUS_02530 15405 16559 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268985.1 protein_id gnl|my_center|LOCUS_02530 16546 17400 gene locus_tag LOCUS_02540 16546 17400 CDS product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_02540 18345 17365 gene locus_tag LOCUS_02550 18345 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 18805 18335 gene locus_tag LOCUS_02560 18805 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 21269 18855 gene locus_tag LOCUS_02570 gene leuS 21269 18855 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG64 protein_id gnl|my_center|LOCUS_02570 <22287 21259 gene locus_tag LOCUS_02580 <22287 21259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817284.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence009 3078 2533 gene locus_tag LOCUS_02590 gene rnhB 3078 2533 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BZ8 protein_id gnl|my_center|LOCUS_02590 4190 3075 gene locus_tag LOCUS_02600 gene lpxB 4190 3075 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_02600 4970 4191 gene locus_tag LOCUS_02610 gene lpxA 4970 4191 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N1 protein_id gnl|my_center|LOCUS_02610 5410 4970 gene locus_tag LOCUS_02620 gene fabZ 5410 4970 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_02620 6348 5413 gene locus_tag LOCUS_02630 gene lpxD 6348 5413 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC7 protein_id gnl|my_center|LOCUS_02630 6884 6348 gene locus_tag LOCUS_02640 6884 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9338 6921 gene locus_tag LOCUS_02650 gene opr86 9338 6921 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_02650 10708 9347 gene locus_tag LOCUS_02660 gene rsep 10708 9347 CDS product regulator of sigma E protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44936 protein_id gnl|my_center|LOCUS_02660 11875 10712 gene locus_tag LOCUS_02670 gene dxr 11875 10712 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185R8 protein_id gnl|my_center|LOCUS_02670 12564 11872 gene locus_tag LOCUS_02680 12564 11872 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017055.1 protein_id gnl|my_center|LOCUS_02680 13276 12548 gene locus_tag LOCUS_02690 gene uppS 13276 12548 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH61 protein_id gnl|my_center|LOCUS_02690 13841 13287 gene locus_tag LOCUS_02700 gene frr 13841 13287 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_02700 14556 13843 gene locus_tag LOCUS_02710 gene pyrH 14556 13843 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPV4 protein_id gnl|my_center|LOCUS_02710 15417 14560 gene locus_tag LOCUS_02720 gene tsf 15417 14560 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_02720 16322 15420 gene locus_tag LOCUS_02730 gene rpsB 16322 15420 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_02730 17112 16462 gene locus_tag LOCUS_02740 gene dapB 17112 16462 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE14 protein_id gnl|my_center|LOCUS_02740 18221 17118 gene locus_tag LOCUS_02750 gene dnaJ 18221 17118 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIM6 protein_id gnl|my_center|LOCUS_02750 20135 18228 gene locus_tag LOCUS_02760 gene dnaK 20135 18228 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_02760 20691 20149 gene locus_tag LOCUS_02770 gene grpE 20691 20149 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY2 protein_id gnl|my_center|LOCUS_02770 21176 20757 gene locus_tag LOCUS_02780 gene fur 21176 20757 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_02780 21267 21599 gene locus_tag LOCUS_02790 21267 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence010 1088 768 gene locus_tag LOCUS_02800 1088 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1311 1063 gene locus_tag LOCUS_02810 1311 1063 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 protein_id gnl|my_center|LOCUS_02810 1475 1308 gene locus_tag LOCUS_02820 1475 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2231 1500 gene locus_tag LOCUS_02830 gene rsmJ 2231 1500 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AK9 protein_id gnl|my_center|LOCUS_02830 3019 2228 gene locus_tag LOCUS_02840 gene uppP1 3019 2228 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_02840 3443 3012 gene locus_tag LOCUS_02850 3443 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4093 3449 gene locus_tag LOCUS_02860 gene adK 4093 3449 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEN6 protein_id gnl|my_center|LOCUS_02860 4467 4090 gene locus_tag LOCUS_02870 gene acpS 4467 4090 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CV8 protein_id gnl|my_center|LOCUS_02870 5159 4464 gene locus_tag LOCUS_02880 gene recO 5159 4464 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP1 protein_id gnl|my_center|LOCUS_02880 6054 5149 gene locus_tag LOCUS_02890 gene era 6054 5149 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_02890 6709 6047 gene locus_tag LOCUS_02900 gene rnc 6709 6047 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE1 protein_id gnl|my_center|LOCUS_02900 7656 6709 gene locus_tag LOCUS_02910 7656 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9445 7658 gene locus_tag LOCUS_02920 gene lepA 9445 7658 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB0 protein_id gnl|my_center|LOCUS_02920 10910 9507 gene locus_tag LOCUS_02930 gene mucD 10910 9507 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_02930 11606 10926 gene locus_tag LOCUS_02940 11606 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 12171 11596 gene locus_tag LOCUS_02950 12171 11596 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_02950 12423 12211 gene locus_tag LOCUS_02960 12423 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12695 13294 gene locus_tag LOCUS_02970 12695 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13974 13297 gene locus_tag LOCUS_02980 gene ung 13974 13297 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R634 protein_id gnl|my_center|LOCUS_02980 15455 14274 gene locus_tag LOCUS_02990 15455 14274 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922202.1 protein_id gnl|my_center|LOCUS_02990 16979 15519 gene locus_tag LOCUS_03000 gene glpK 16979 15519 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0Z0 protein_id gnl|my_center|LOCUS_03000 17257 20139 gene locus_tag LOCUS_03010 gene nrdA 17257 20139 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence011 532 732 gene locus_tag LOCUS_03020 532 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2348 1047 gene locus_tag LOCUS_03030 2348 1047 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_03030 2529 4856 gene locus_tag LOCUS_03040 2529 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4921 5490 gene locus_tag LOCUS_03050 4921 5490 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_03050 5553 6689 gene locus_tag LOCUS_03060 5553 6689 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_03060 6712 7122 gene locus_tag LOCUS_03070 6712 7122 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948065.1 protein_id gnl|my_center|LOCUS_03070 7163 7966 gene locus_tag LOCUS_03080 gene fadB 7163 7966 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_03080 7969 8718 gene locus_tag LOCUS_03090 7969 8718 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_03090 8705 9733 gene locus_tag LOCUS_03100 gene nagZ 8705 9733 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK0 protein_id gnl|my_center|LOCUS_03100 9733 10254 gene locus_tag LOCUS_03110 9733 10254 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 protein_id gnl|my_center|LOCUS_03110 12074 10260 gene locus_tag LOCUS_03120 gene atuH 12074 10260 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_03120 13161 12097 gene locus_tag LOCUS_03130 13161 12097 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_03130 14014 13175 gene locus_tag LOCUS_03140 14014 13175 CDS product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919617.1 protein_id gnl|my_center|LOCUS_03140 14157 15326 gene locus_tag LOCUS_03150 14157 15326 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_03150 15326 15760 gene locus_tag LOCUS_03160 15326 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_03160 15747 16097 gene locus_tag LOCUS_03170 gene arsC 15747 16097 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_03170 16481 16089 gene locus_tag LOCUS_03180 16481 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 16884 16474 gene locus_tag LOCUS_03190 16884 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 17984 16887 gene locus_tag LOCUS_03200 17984 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088687.1 protein_id gnl|my_center|LOCUS_03200 18092 19246 gene locus_tag LOCUS_03210 18092 19246 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_03210 19285 19776 gene locus_tag LOCUS_03220 19285 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 19782 20237 gene locus_tag LOCUS_03230 gene yfhC 19782 20237 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_03230 20681 20238 gene locus_tag LOCUS_03240 20681 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence012 1468 524 gene locus_tag LOCUS_03250 gene miaA 1468 524 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX50 protein_id gnl|my_center|LOCUS_03250 1809 1471 gene locus_tag LOCUS_03260 gene glnB 1809 1471 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_03260 3058 1784 gene locus_tag LOCUS_03270 3058 1784 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 protein_id gnl|my_center|LOCUS_03270 3298 3978 gene locus_tag LOCUS_03280 3298 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3971 4585 gene locus_tag LOCUS_03290 3971 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_03290 5548 4559 gene locus_tag LOCUS_03300 5548 4559 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_03300 6252 5545 gene locus_tag LOCUS_03310 6252 5545 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_03310 7492 6239 gene locus_tag LOCUS_03320 7492 6239 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_03320 8421 7498 gene locus_tag LOCUS_03330 gene ilvE 8421 7498 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_03330 8491 9855 gene locus_tag LOCUS_03340 8491 9855 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403984.1 protein_id gnl|my_center|LOCUS_03340 9859 10428 gene locus_tag LOCUS_03350 gene slmA 9859 10428 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T90 protein_id gnl|my_center|LOCUS_03350 12818 10425 gene locus_tag LOCUS_03360 gene mrcA 12818 10425 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706971.1 protein_id gnl|my_center|LOCUS_03360 12972 13481 gene locus_tag LOCUS_03370 gene aroK 12972 13481 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 protein_id gnl|my_center|LOCUS_03370 13474 14544 gene locus_tag LOCUS_03380 gene aroB 13474 14544 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E259 protein_id gnl|my_center|LOCUS_03380 <18591 14541 gene locus_tag LOCUS_03390 <18591 14541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence013 1526 144 gene locus_tag LOCUS_03400 gene der 1526 144 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y6 protein_id gnl|my_center|LOCUS_03400 2632 1541 gene locus_tag LOCUS_03410 gene bamB 2632 1541 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_03410 2547 2732 gene locus_tag LOCUS_03420 2547 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3365 2724 gene locus_tag LOCUS_03430 3365 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4642 3380 gene locus_tag LOCUS_03440 gene hisS 4642 3380 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCG1 protein_id gnl|my_center|LOCUS_03440 5744 4644 gene locus_tag LOCUS_03450 gene ispG 5744 4644 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_03450 6534 5734 gene locus_tag LOCUS_03460 6534 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7616 6531 gene locus_tag LOCUS_03470 gene rlmN 7616 6531 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX26 protein_id gnl|my_center|LOCUS_03470 8045 7620 gene locus_tag LOCUS_03480 gene ndk 8045 7620 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_03480 8289 8086 gene locus_tag LOCUS_03490 8289 8086 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209830.1 protein_id gnl|my_center|LOCUS_03490 8627 8289 gene locus_tag LOCUS_03500 gene fdx 8627 8289 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_03500 8972 8631 gene locus_tag LOCUS_03510 8972 8631 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_03510 9382 8978 gene locus_tag LOCUS_03520 gene iscU 9382 8978 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACD6 protein_id gnl|my_center|LOCUS_03520 10618 9398 gene locus_tag LOCUS_03530 gene iscS 10618 9398 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_03530 11049 10615 gene locus_tag LOCUS_03540 11049 10615 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688879.1 protein_id gnl|my_center|LOCUS_03540 11798 11076 gene locus_tag LOCUS_03550 gene purC 11798 11076 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_03550 12802 11807 gene locus_tag LOCUS_03560 12802 11807 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406091.1 protein_id gnl|my_center|LOCUS_03560 13686 12799 gene locus_tag LOCUS_03570 gene dapA 13686 12799 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW75 protein_id gnl|my_center|LOCUS_03570 13754 14224 gene locus_tag LOCUS_03580 gene bcp 13754 14224 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_03580 15278 14226 gene locus_tag LOCUS_03590 15278 14226 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_03590 15425 16870 gene locus_tag LOCUS_03600 15425 16870 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_03600 18089 16857 gene locus_tag LOCUS_03610 18089 16857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_03610 18186 18111 gene locus_tag LOCUS_t00010 18186 18111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 <1 682 gene locus_tag LOCUS_03620 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL47:phosphoribosylformylglycinamidine synthase 1107 685 gene locus_tag LOCUS_03630 1107 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1276 1875 gene locus_tag LOCUS_03640 1276 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1865 2383 gene locus_tag LOCUS_03650 1865 2383 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_03650 2386 4962 gene locus_tag LOCUS_03660 gene alaS 2386 4962 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ9 protein_id gnl|my_center|LOCUS_03660 4969 6183 gene locus_tag LOCUS_03670 4969 6183 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_03670 6185 7519 gene locus_tag LOCUS_03680 6185 7519 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_03680 7567 7656 gene locus_tag LOCUS_t00020 7567 7656 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7680 8531 gene locus_tag LOCUS_03690 gene metF 7680 8531 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971608.1 protein_id gnl|my_center|LOCUS_03690 9427 8528 gene locus_tag LOCUS_03700 9427 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016250.1 protein_id gnl|my_center|LOCUS_03700 9473 10720 gene locus_tag LOCUS_03710 9473 10720 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 protein_id gnl|my_center|LOCUS_03710 10713 11180 gene locus_tag LOCUS_03720 10713 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 11183 11449 gene locus_tag LOCUS_03730 11183 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13905 11446 gene locus_tag LOCUS_03740 13905 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_03740 13979 14779 gene locus_tag LOCUS_03750 13979 14779 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037662.1 protein_id gnl|my_center|LOCUS_03750 15434 14781 gene locus_tag LOCUS_03760 15434 14781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_03760 16400 15492 gene locus_tag LOCUS_03770 16400 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 16495 16752 gene locus_tag LOCUS_03780 16495 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 17315 16749 gene locus_tag LOCUS_03790 17315 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 17800 >17930 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgctgaagaagaagtagttgctgaagaag >Feature sequence015 36 1193 gene locus_tag LOCUS_03800 36 1193 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085721.1 protein_id gnl|my_center|LOCUS_03800 2425 1199 gene locus_tag LOCUS_03810 2425 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3071 2457 gene locus_tag LOCUS_03820 3071 2457 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_03820 3168 4826 gene locus_tag LOCUS_03830 3168 4826 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_03830 4823 6751 gene locus_tag LOCUS_03840 4823 6751 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_03840 6751 7362 gene locus_tag LOCUS_03850 6751 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7364 9148 gene locus_tag LOCUS_03860 7364 9148 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726857.1 protein_id gnl|my_center|LOCUS_03860 9138 9929 gene locus_tag LOCUS_03870 9138 9929 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_03870 9948 11183 gene locus_tag LOCUS_03880 9948 11183 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_03880 11185 12273 gene locus_tag LOCUS_03890 gene acd 11185 12273 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_03890 12320 14350 gene locus_tag LOCUS_03900 gene prc 12320 14350 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_03900 14352 15164 gene locus_tag LOCUS_03910 gene xthA 14352 15164 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_03910 15175 15618 gene locus_tag LOCUS_03920 15175 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence016 39 115 gene locus_tag LOCUS_t00030 39 115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 166 648 gene locus_tag LOCUS_03930 gene rimP 166 648 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE5 protein_id gnl|my_center|LOCUS_03930 638 2098 gene locus_tag LOCUS_03940 gene nusA 638 2098 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV3 protein_id gnl|my_center|LOCUS_03940 2120 4390 gene locus_tag LOCUS_03950 gene infB 2120 4390 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_03950 4403 4750 gene locus_tag LOCUS_03960 gene rbfA 4403 4750 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32731 protein_id gnl|my_center|LOCUS_03960 4753 5592 gene locus_tag LOCUS_03970 gene truB 4753 5592 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TQ0 protein_id gnl|my_center|LOCUS_03970 5680 5949 gene locus_tag LOCUS_03980 gene rpsO 5680 5949 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9J4 protein_id gnl|my_center|LOCUS_03980 5974 8109 gene locus_tag LOCUS_03990 gene pnp 5974 8109 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_03990 8195 8461 gene locus_tag LOCUS_04000 8195 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 8520 8753 gene locus_tag LOCUS_04010 8520 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8909 8833 gene locus_tag LOCUS_t00040 8909 8833 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10053 8965 gene locus_tag LOCUS_04020 gene ychF 10053 8965 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_04020 10621 10055 gene locus_tag LOCUS_04030 gene pth 10621 10055 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGZ6 protein_id gnl|my_center|LOCUS_04030 11334 10627 gene locus_tag LOCUS_04040 gene rplY 11334 10627 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_04040 12297 11344 gene locus_tag LOCUS_04050 gene prsA 12297 11344 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY30 protein_id gnl|my_center|LOCUS_04050 12391 12317 gene locus_tag LOCUS_t00050 12391 12317 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13210 12395 gene locus_tag LOCUS_04060 gene ispE 13210 12395 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_04060 13569 13207 gene locus_tag LOCUS_04070 13569 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 13673 14905 gene locus_tag LOCUS_04080 gene hemA 13673 14905 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T4 protein_id gnl|my_center|LOCUS_04080 >Feature sequence017 1347 304 gene locus_tag LOCUS_04090 gene ilvC 1347 304 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IM0 protein_id gnl|my_center|LOCUS_04090 1660 1331 gene locus_tag LOCUS_04100 1660 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3363 1657 gene locus_tag LOCUS_04110 3363 1657 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY68 protein_id gnl|my_center|LOCUS_04110 4395 3466 gene locus_tag LOCUS_04120 gene rluD 4395 3466 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_04120 4527 5297 gene locus_tag LOCUS_04130 4527 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9277 6215 gene locus_tag LOCUS_04140 9277 6215 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_04140 10263 9277 gene locus_tag LOCUS_04150 10263 9277 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_04150 10353 10985 gene locus_tag LOCUS_04160 10353 10985 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_04160 11394 10960 gene locus_tag LOCUS_04170 11394 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_04170 11689 11372 gene locus_tag LOCUS_04180 11689 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 11628 11792 gene locus_tag LOCUS_04190 11628 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 11899 12459 gene locus_tag LOCUS_04200 gene rsmD 11899 12459 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFB6 protein_id gnl|my_center|LOCUS_04200 12449 13354 gene locus_tag LOCUS_04210 gene hemC 12449 13354 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHW9 protein_id gnl|my_center|LOCUS_04210 13351 14070 gene locus_tag LOCUS_04220 13351 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 15340 14063 gene locus_tag LOCUS_04230 gene rho 15340 14063 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence018 131 847 gene locus_tag LOCUS_04240 gene fabG 131 847 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_04240 920 1150 gene locus_tag LOCUS_04250 gene acpP 920 1150 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_04250 1264 2214 gene locus_tag LOCUS_04260 1264 2214 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 protein_id gnl|my_center|LOCUS_04260 2211 2804 gene locus_tag LOCUS_04270 gene tmk 2211 2804 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCU7 protein_id gnl|my_center|LOCUS_04270 2801 3784 gene locus_tag LOCUS_04280 2801 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4541 3774 gene locus_tag LOCUS_04290 4541 3774 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_04290 4580 4810 gene locus_tag LOCUS_04300 4580 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4813 6486 gene locus_tag LOCUS_04310 4813 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6872 6531 gene locus_tag LOCUS_04320 6872 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6799 7842 gene locus_tag LOCUS_04330 6799 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8434 7832 gene locus_tag LOCUS_04340 gene hisI 8434 7832 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSW7 protein_id gnl|my_center|LOCUS_04340 9204 8437 gene locus_tag LOCUS_04350 gene hisF 9204 8437 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E633 protein_id gnl|my_center|LOCUS_04350 9913 9194 gene locus_tag LOCUS_04360 gene hisA 9913 9194 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLE4 protein_id gnl|my_center|LOCUS_04360 10482 9910 gene locus_tag LOCUS_04370 gene hisH 10482 9910 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44340 protein_id gnl|my_center|LOCUS_04370 12353 10479 gene locus_tag LOCUS_04380 12353 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 13218 12355 gene locus_tag LOCUS_04390 gene hisG 13218 12355 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM78 protein_id gnl|my_center|LOCUS_04390 13481 13215 gene locus_tag LOCUS_04400 13481 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13993 13565 gene locus_tag LOCUS_04410 13993 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 15096 14086 gene locus_tag LOCUS_04420 gene trmA 15096 14086 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_04420 15264 15097 gene locus_tag LOCUS_04430 15264 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence019 <1 1187 gene locus_tag LOCUS_04440 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEF8:putative protein kinase UbiB 1197 1367 gene locus_tag LOCUS_04450 1197 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1371 1616 gene locus_tag LOCUS_04460 1371 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1609 2316 gene locus_tag LOCUS_04470 gene tatC 1609 2316 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_04470 2313 3020 gene locus_tag LOCUS_04480 2313 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3598 3017 gene locus_tag LOCUS_04490 3598 3017 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ03 protein_id gnl|my_center|LOCUS_04490 4043 3606 gene locus_tag LOCUS_04500 gene dtd 4043 3606 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ89 protein_id gnl|my_center|LOCUS_04500 5060 4047 gene locus_tag LOCUS_04510 5060 4047 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_04510 6222 5077 gene locus_tag LOCUS_04520 gene pgk 6222 5077 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LL1 protein_id gnl|my_center|LOCUS_04520 8206 6215 gene locus_tag LOCUS_04530 gene tktA 8206 6215 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_04530 8384 9538 gene locus_tag LOCUS_04540 gene metK 8384 9538 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX3 protein_id gnl|my_center|LOCUS_04540 9564 10958 gene locus_tag LOCUS_04550 gene ahcY 9564 10958 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_04550 11108 12343 gene locus_tag LOCUS_04560 gene lysA 11108 12343 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_04560 12336 13109 gene locus_tag LOCUS_04570 gene dapF 12336 13109 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57649 protein_id gnl|my_center|LOCUS_04570 13102 13740 gene locus_tag LOCUS_04580 13102 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 13733 14629 gene locus_tag LOCUS_04590 gene xerC 13733 14629 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSD3 protein_id gnl|my_center|LOCUS_04590 >Feature sequence020 994 380 gene locus_tag LOCUS_04600 994 380 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN87 protein_id gnl|my_center|LOCUS_04600 1600 1016 gene locus_tag LOCUS_04610 gene folE 1600 1016 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_04610 2313 1693 gene locus_tag LOCUS_04620 2313 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_04620 4052 2418 gene locus_tag LOCUS_04630 gene groL 4052 2418 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_04630 4370 4083 gene locus_tag LOCUS_04640 gene groS 4370 4083 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19422 protein_id gnl|my_center|LOCUS_04640 6039 4783 gene locus_tag LOCUS_04650 gene ampG 6039 4783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_04650 6571 6032 gene locus_tag LOCUS_04660 gene ampD 6571 6032 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_04660 7519 6572 gene locus_tag LOCUS_04670 gene ispH 7519 6572 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_04670 7976 7503 gene locus_tag LOCUS_04680 gene lspA 7976 7503 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGD1 protein_id gnl|my_center|LOCUS_04680 10740 7969 gene locus_tag LOCUS_04690 gene ileS 10740 7969 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGD0 protein_id gnl|my_center|LOCUS_04690 11693 10737 gene locus_tag LOCUS_04700 gene ribF 11693 10737 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_04700 13245 11695 gene locus_tag LOCUS_04710 gene mviN 13245 11695 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_04710 13633 13238 gene locus_tag LOCUS_04720 gene msrB 13633 13238 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDS5 protein_id gnl|my_center|LOCUS_04720 14099 13695 gene locus_tag LOCUS_04730 14099 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence021 55 1239 gene locus_tag LOCUS_04740 gene lptF 55 1239 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_04740 1550 1365 gene locus_tag LOCUS_04750 1550 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1456 2289 gene locus_tag LOCUS_04760 1456 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2696 2286 gene locus_tag LOCUS_04770 2696 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2732 4207 gene locus_tag LOCUS_04780 2732 4207 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 protein_id gnl|my_center|LOCUS_04780 5334 4204 gene locus_tag LOCUS_04790 gene dapE 5334 4204 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYL2 protein_id gnl|my_center|LOCUS_04790 6241 5327 gene locus_tag LOCUS_04800 6241 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8787 6271 gene locus_tag LOCUS_04810 gene glnD 8787 6271 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P5 protein_id gnl|my_center|LOCUS_04810 9566 8784 gene locus_tag LOCUS_04820 gene map 9566 8784 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU5 protein_id gnl|my_center|LOCUS_04820 9709 10830 gene locus_tag LOCUS_04830 gene carA 9709 10830 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_04830 10817 14029 gene locus_tag LOCUS_04840 gene carB 10817 14029 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence022 80 484 gene locus_tag LOCUS_04850 80 484 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_04850 836 2620 gene locus_tag LOCUS_04860 gene sdhA 836 2620 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_04860 2621 3367 gene locus_tag LOCUS_04870 gene sdhB 2621 3367 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_04870 3413 6187 gene locus_tag LOCUS_04880 gene sucA 3413 6187 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_04880 6196 7419 gene locus_tag LOCUS_04890 gene sucB 6196 7419 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_04890 7434 8855 gene locus_tag LOCUS_04900 gene lpdG 7434 8855 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_04900 8856 10016 gene locus_tag LOCUS_04910 gene sucC 8856 10016 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_04910 10013 10879 gene locus_tag LOCUS_04920 gene sucD 10013 10879 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_04920 12147 10876 gene locus_tag LOCUS_04930 gene norM 12147 10876 CDS product multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82855 protein_id gnl|my_center|LOCUS_04930 12620 13015 gene locus_tag LOCUS_04940 12620 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 13019 14071 gene locus_tag LOCUS_04950 gene pdxB 13019 14071 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR8 protein_id gnl|my_center|LOCUS_04950 >Feature sequence023 590 2788 gene locus_tag LOCUS_04960 590 2788 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_04960 2905 2980 gene locus_tag LOCUS_t00060 2905 2980 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3888 2986 gene locus_tag LOCUS_04970 3888 2986 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_04970 4000 6153 gene locus_tag LOCUS_04980 gene katG 4000 6153 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_04980 6223 6948 gene locus_tag LOCUS_04990 gene cysE 6223 6948 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43886 protein_id gnl|my_center|LOCUS_04990 8205 6955 gene locus_tag LOCUS_05000 gene erg3 8205 6955 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_05000 9048 8233 gene locus_tag LOCUS_05010 9048 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11265 9067 gene locus_tag LOCUS_05020 11265 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 11461 11249 gene locus_tag LOCUS_05030 11461 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 12255 11461 gene locus_tag LOCUS_05040 12255 11461 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence024 715 116 gene locus_tag LOCUS_05050 715 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1833 790 gene locus_tag LOCUS_05060 1833 790 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HV6 protein_id gnl|my_center|LOCUS_05060 3791 1833 gene locus_tag LOCUS_05070 gene metG 3791 1833 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ9 protein_id gnl|my_center|LOCUS_05070 3827 4507 gene locus_tag LOCUS_05080 3827 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4527 5225 gene locus_tag LOCUS_05090 4527 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_05090 6182 5211 gene locus_tag LOCUS_05100 gene dusA 6182 5211 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E844 protein_id gnl|my_center|LOCUS_05100 7240 6185 gene locus_tag LOCUS_05110 7240 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7212 7370 gene locus_tag LOCUS_05120 7212 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7533 7712 gene locus_tag LOCUS_05130 7533 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7721 8536 gene locus_tag LOCUS_05140 7721 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10571 8511 gene locus_tag LOCUS_05150 10571 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 10765 11679 gene locus_tag LOCUS_05160 gene rluC 10765 11679 CDS product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44433 protein_id gnl|my_center|LOCUS_05160 11737 11946 gene locus_tag LOCUS_05170 gene rpmF 11737 11946 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_05170 11950 12870 gene locus_tag LOCUS_05180 gene fabD 11950 12870 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH2 protein_id gnl|my_center|LOCUS_05180 >Feature sequence025 1599 31 gene locus_tag LOCUS_05190 gene guaA 1599 31 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S07 protein_id gnl|my_center|LOCUS_05190 3072 1609 gene locus_tag LOCUS_05200 gene guaB 3072 1609 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFC2 protein_id gnl|my_center|LOCUS_05200 3340 3113 gene locus_tag LOCUS_05210 3340 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3685 3347 gene locus_tag LOCUS_05220 3685 3347 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_05220 5069 3678 gene locus_tag LOCUS_05230 gene fumC 5069 3678 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_05230 5128 5937 gene locus_tag LOCUS_05240 5128 5937 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974185.1 protein_id gnl|my_center|LOCUS_05240 7357 5939 gene locus_tag LOCUS_05250 7357 5939 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_05250 9067 7394 gene locus_tag LOCUS_05260 gene fhs 9067 7394 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_05260 10559 9144 gene locus_tag LOCUS_05270 gene phrB 10559 9144 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_05270 11317 10568 gene locus_tag LOCUS_05280 gene suhB 11317 10568 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022640.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence026 949 233 gene locus_tag LOCUS_05290 949 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 936 1070 gene locus_tag LOCUS_05300 936 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2142 1063 gene locus_tag LOCUS_05310 2142 1063 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_05310 3974 2832 gene locus_tag LOCUS_05320 3974 2832 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_05320 4063 4404 gene locus_tag LOCUS_05330 4063 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4935 4555 gene locus_tag LOCUS_05340 4935 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5327 5175 gene locus_tag LOCUS_05350 5327 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5390 5941 gene locus_tag LOCUS_05360 5390 5941 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404145.1 protein_id gnl|my_center|LOCUS_05360 6313 5942 gene locus_tag LOCUS_05370 6313 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7008 6310 gene locus_tag LOCUS_05380 gene ygaJ 7008 6310 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_05380 7898 7005 gene locus_tag LOCUS_05390 7898 7005 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531135.1 protein_id gnl|my_center|LOCUS_05390 8605 7916 gene locus_tag LOCUS_05400 8605 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8700 9581 gene locus_tag LOCUS_05410 8700 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 10477 9578 gene locus_tag LOCUS_05420 10477 9578 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_05420 10515 11630 gene locus_tag LOCUS_05430 10515 11630 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_05430 11776 12261 gene locus_tag LOCUS_05440 11776 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence027 498 1385 gene locus_tag LOCUS_05450 gene xerD 498 1385 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ8 protein_id gnl|my_center|LOCUS_05450 1387 2097 gene locus_tag LOCUS_05460 gene dsbC 1387 2097 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_05460 2102 3289 gene locus_tag LOCUS_05470 gene yfdZ 2102 3289 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI1 protein_id gnl|my_center|LOCUS_05470 3289 4557 gene locus_tag LOCUS_05480 gene hom 3289 4557 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_05480 4560 5948 gene locus_tag LOCUS_05490 gene thrC 4560 5948 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103569.1 protein_id gnl|my_center|LOCUS_05490 5950 7047 gene locus_tag LOCUS_05500 gene prfB 5950 7047 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_05500 7048 8481 gene locus_tag LOCUS_05510 gene lysS 7048 8481 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E97 protein_id gnl|my_center|LOCUS_05510 9698 8478 gene locus_tag LOCUS_05520 9698 8478 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_05520 10819 9707 gene locus_tag LOCUS_05530 10819 9707 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_05530 10879 11508 gene locus_tag LOCUS_05540 10879 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11751 12140 gene locus_tag LOCUS_05550 11751 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 12188 12272 gene locus_tag LOCUS_t00070 12188 12272 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence028 <1 622 gene locus_tag LOCUS_05560 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729025.1:shikimate transporter 746 2842 gene locus_tag LOCUS_05570 746 2842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_05570 2832 3425 gene locus_tag LOCUS_05580 gene pnuT 2832 3425 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_05580 3403 4239 gene locus_tag LOCUS_05590 3403 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4527 5417 gene locus_tag LOCUS_05600 4527 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5496 6692 gene locus_tag LOCUS_05610 5496 6692 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930E7 protein_id gnl|my_center|LOCUS_05610 7665 6697 gene locus_tag LOCUS_05620 gene ncd-2 7665 6697 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_05620 8467 7655 gene locus_tag LOCUS_05630 8467 7655 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_05630 9509 8472 gene locus_tag LOCUS_05640 9509 8472 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_05640 11164 9530 gene locus_tag LOCUS_05650 11164 9530 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence029 927 433 gene locus_tag LOCUS_05660 927 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1660 920 gene locus_tag LOCUS_05670 gene ubiE 1660 920 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH9 protein_id gnl|my_center|LOCUS_05670 2522 1653 gene locus_tag LOCUS_05680 2522 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2564 3115 gene locus_tag LOCUS_05690 gene orn 2564 3115 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A784 protein_id gnl|my_center|LOCUS_05690 3442 3116 gene locus_tag LOCUS_05700 3442 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_05700 3456 4796 gene locus_tag LOCUS_05710 gene miaB 3456 4796 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_05710 4803 5786 gene locus_tag LOCUS_05720 4803 5786 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_05720 5783 6229 gene locus_tag LOCUS_05730 5783 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6230 7087 gene locus_tag LOCUS_05740 6230 7087 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 protein_id gnl|my_center|LOCUS_05740 7457 7299 gene locus_tag LOCUS_05750 7457 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7612 8559 gene locus_tag LOCUS_05760 7612 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8538 9077 gene locus_tag LOCUS_05770 8538 9077 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_05770 11252 9099 gene locus_tag LOCUS_05780 gene fadJ 11252 9099 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence030 1986 613 gene locus_tag LOCUS_05790 1986 613 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973601.1 protein_id gnl|my_center|LOCUS_05790 2476 1976 gene locus_tag LOCUS_05800 2476 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3307 2525 gene locus_tag LOCUS_05810 3307 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4129 3308 gene locus_tag LOCUS_05820 4129 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4438 4133 gene locus_tag LOCUS_05830 4438 4133 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_05830 5182 4568 gene locus_tag LOCUS_05840 5182 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5810 5265 gene locus_tag LOCUS_05850 5810 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7011 5815 gene locus_tag LOCUS_05860 7011 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_05860 7034 7423 gene locus_tag LOCUS_05870 7034 7423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_05870 7833 7420 gene locus_tag LOCUS_05880 7833 7420 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085725.1 protein_id gnl|my_center|LOCUS_05880 8491 7856 gene locus_tag LOCUS_05890 8491 7856 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_05890 9802 8507 gene locus_tag LOCUS_05900 9802 8507 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence031 70 1269 gene locus_tag LOCUS_05910 gene coaBC 70 1269 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_05910 1272 2087 gene locus_tag LOCUS_05920 gene panB 1272 2087 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_05920 2094 2906 gene locus_tag LOCUS_05930 gene panC 2094 2906 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57036 protein_id gnl|my_center|LOCUS_05930 2954 3343 gene locus_tag LOCUS_05940 gene panD 2954 3343 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJN6 protein_id gnl|my_center|LOCUS_05940 3410 4633 gene locus_tag LOCUS_05950 gene rhlE 3410 4633 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV8 protein_id gnl|my_center|LOCUS_05950 4646 5875 gene locus_tag LOCUS_05960 4646 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_05960 5921 7786 gene locus_tag LOCUS_05970 5921 7786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_05970 7869 7793 gene locus_tag LOCUS_t00080 7869 7793 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8045 7875 gene locus_tag LOCUS_05980 8045 7875 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_05980 8122 8883 gene locus_tag LOCUS_05990 8122 8883 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_05990 8912 9676 gene locus_tag LOCUS_06000 gene pdxJ 8912 9676 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_06000 9679 9990 gene locus_tag LOCUS_06010 9679 9990 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ4 protein_id gnl|my_center|LOCUS_06010 10574 9987 gene locus_tag LOCUS_06020 gene rnt 10574 9987 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_06020 >Feature sequence032 1497 448 gene locus_tag LOCUS_06030 gene aroG 1497 448 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_06030 1681 2478 gene locus_tag LOCUS_06040 1681 2478 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_06040 2475 3044 gene locus_tag LOCUS_06050 gene scpB 2475 3044 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP9 protein_id gnl|my_center|LOCUS_06050 3058 3783 gene locus_tag LOCUS_06060 gene rluB 3058 3783 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_06060 3773 4378 gene locus_tag LOCUS_06070 3773 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5114 4365 gene locus_tag LOCUS_06080 5114 4365 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_06080 5776 5111 gene locus_tag LOCUS_06090 gene gph 5776 5111 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_06090 6452 5760 gene locus_tag LOCUS_06100 gene ubiG 6452 5760 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ90 protein_id gnl|my_center|LOCUS_06100 6628 7746 gene locus_tag LOCUS_06110 gene pntA 6628 7746 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_06110 7748 8020 gene locus_tag LOCUS_06120 7748 8020 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_06120 8023 9405 gene locus_tag LOCUS_06130 gene pntB 8023 9405 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_06130 >Feature sequence033 1181 510 gene locus_tag LOCUS_06140 gene psd 1181 510 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M997 protein_id gnl|my_center|LOCUS_06140 1273 2523 gene locus_tag LOCUS_06150 1273 2523 CDS product MCD, Malonyl-CoA decarboxylase MCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706350.1 protein_id gnl|my_center|LOCUS_06150 2583 3491 gene locus_tag LOCUS_06160 gene pip 2583 3491 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_06160 3484 3987 gene locus_tag LOCUS_06170 3484 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3977 4645 gene locus_tag LOCUS_06180 3977 4645 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480749.1 protein_id gnl|my_center|LOCUS_06180 4892 4626 gene locus_tag LOCUS_06190 4892 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5030 5401 gene locus_tag LOCUS_06200 5030 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5629 5405 gene locus_tag LOCUS_06210 5629 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5965 5639 gene locus_tag LOCUS_06220 5965 5639 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_06220 6002 6334 gene locus_tag LOCUS_06230 6002 6334 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_06230 7538 6336 gene locus_tag LOCUS_06240 7538 6336 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_06240 7681 8511 gene locus_tag LOCUS_06250 7681 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 9347 8508 gene locus_tag LOCUS_06260 9347 8508 CDS product iron permease FTR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083270.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence034 430 3243 gene locus_tag LOCUS_06270 gene sucA 430 3243 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_06270 3252 4472 gene locus_tag LOCUS_06280 gene sucB 3252 4472 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_06280 4487 5908 gene locus_tag LOCUS_06290 gene lpdG 4487 5908 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_06290 5909 7069 gene locus_tag LOCUS_06300 gene sucC 5909 7069 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_06300 7066 7944 gene locus_tag LOCUS_06310 gene sucD 7066 7944 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Z3 protein_id gnl|my_center|LOCUS_06310 9198 7927 gene locus_tag LOCUS_06320 gene pmpM 9198 7927 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_06320 9674 10069 gene locus_tag LOCUS_06330 9674 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence035 2760 1456 gene locus_tag LOCUS_06340 2760 1456 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_06340 2883 2807 gene locus_tag LOCUS_t00090 2883 2807 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2989 3627 gene locus_tag LOCUS_06350 2989 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5444 3630 gene locus_tag LOCUS_06360 gene rpoD 5444 3630 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_06360 7278 5503 gene locus_tag LOCUS_06370 gene dnaG 7278 5503 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2J9 protein_id gnl|my_center|LOCUS_06370 7673 7284 gene locus_tag LOCUS_06380 7673 7284 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 protein_id gnl|my_center|LOCUS_06380 8299 7673 gene locus_tag LOCUS_06390 8299 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9189 8296 gene locus_tag LOCUS_06400 gene gshB 9189 8296 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK1 protein_id gnl|my_center|LOCUS_06400 9977 9225 gene locus_tag LOCUS_06410 9977 9225 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFI2 protein_id gnl|my_center|LOCUS_06410 >Feature sequence036 2940 328 gene locus_tag LOCUS_06420 gene topA 2940 328 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_06420 3436 3002 gene locus_tag LOCUS_06430 3436 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4426 3437 gene locus_tag LOCUS_06440 gene pyrD 4426 3437 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57443 protein_id gnl|my_center|LOCUS_06440 5065 4436 gene locus_tag LOCUS_06450 5065 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5935 5066 gene locus_tag LOCUS_06460 gene nadK 5935 5066 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_06460 6076 6459 gene locus_tag LOCUS_06470 6076 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 6401 7267 gene locus_tag LOCUS_06480 6401 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 7292 8431 gene locus_tag LOCUS_06490 7292 8431 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_06490 8447 9337 gene locus_tag LOCUS_06500 8447 9337 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_06500 9820 9326 gene locus_tag LOCUS_06510 gene rraA2 9820 9326 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Y2 protein_id gnl|my_center|LOCUS_06510 >Feature sequence037 1874 597 gene locus_tag LOCUS_06520 gene rho 1874 597 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_06520 2314 1988 gene locus_tag LOCUS_06530 gene trxA 2314 1988 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ6 protein_id gnl|my_center|LOCUS_06530 3309 2311 gene locus_tag LOCUS_06540 gene hemB 3309 2311 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_06540 4974 3313 gene locus_tag LOCUS_06550 gene ilvD 4974 3313 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_06550 6586 4988 gene locus_tag LOCUS_06560 6586 4988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_06560 7587 6583 gene locus_tag LOCUS_06570 7587 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7657 8076 gene locus_tag LOCUS_06580 7657 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8113 8562 gene locus_tag LOCUS_06590 gene aroQ 8113 8562 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYA8 protein_id gnl|my_center|LOCUS_06590 8562 8999 gene locus_tag LOCUS_06600 gene accB 8562 8999 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABD8 protein_id gnl|my_center|LOCUS_06600 >Feature sequence038 <1 1318 gene locus_tag LOCUS_06610 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVM1:3-phosphoshikimate 1-carboxyvinyltransferase 1308 1967 gene locus_tag LOCUS_06620 gene cmk 1308 1967 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z1 protein_id gnl|my_center|LOCUS_06620 1964 3271 gene locus_tag LOCUS_06630 gene rpsA 1964 3271 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_06630 3264 3557 gene locus_tag LOCUS_06640 gene ihfB 3264 3557 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_06640 3581 4249 gene locus_tag LOCUS_06650 gene pyrF 3581 4249 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI4 protein_id gnl|my_center|LOCUS_06650 4260 5672 gene locus_tag LOCUS_06660 gene pgi 4260 5672 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXH2 protein_id gnl|my_center|LOCUS_06660 5662 7443 gene locus_tag LOCUS_06670 gene uvrC 5662 7443 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS74 protein_id gnl|my_center|LOCUS_06670 7518 7997 gene locus_tag LOCUS_06680 7518 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence039 <1 1528 gene locus_tag LOCUS_06690 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0M3:DNA translocase FtsK 1531 2019 gene locus_tag LOCUS_06700 1531 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2016 2369 gene locus_tag LOCUS_06710 2016 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2370 3614 gene locus_tag LOCUS_06720 gene serS 2370 3614 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFB0 protein_id gnl|my_center|LOCUS_06720 3808 3623 gene locus_tag LOCUS_06730 3808 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3723 6836 gene locus_tag LOCUS_06740 gene oar 3723 6836 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_06740 6894 7793 gene locus_tag LOCUS_06750 6894 7793 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_06750 7798 9048 gene locus_tag LOCUS_06760 7798 9048 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence040 58 134 gene locus_tag LOCUS_t00100 58 134 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 158 1096 gene locus_tag LOCUS_06770 158 1096 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_06770 1093 1752 gene locus_tag LOCUS_06780 1093 1752 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_06780 3161 1761 gene locus_tag LOCUS_06790 3161 1761 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_06790 3260 3336 gene locus_tag LOCUS_t00110 3260 3336 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3354 4649 gene locus_tag LOCUS_06800 gene tig 3354 4649 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66933 protein_id gnl|my_center|LOCUS_06800 4657 5277 gene locus_tag LOCUS_06810 gene clpP 4657 5277 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Q5 protein_id gnl|my_center|LOCUS_06810 5267 6520 gene locus_tag LOCUS_06820 gene clpX 5267 6520 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_06820 >Feature sequence041 1784 282 gene locus_tag LOCUS_06830 1784 282 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_06830 2945 1851 gene locus_tag LOCUS_06840 2945 1851 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_06840 4118 2949 gene locus_tag LOCUS_06850 4118 2949 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_06850 4194 7472 gene locus_tag LOCUS_06860 gene mfd 4194 7472 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH30 protein_id gnl|my_center|LOCUS_06860 7486 8310 gene locus_tag LOCUS_06870 7486 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 <8845 8307 gene locus_tag LOCUS_06880 <8845 8307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2P8:Fe/S biogenesis protein NfuA >Feature sequence042 750 94 gene locus_tag LOCUS_06890 750 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1257 754 gene locus_tag LOCUS_06900 1257 754 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_06900 2555 1278 gene locus_tag LOCUS_06910 gene tolB 2555 1278 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK6 protein_id gnl|my_center|LOCUS_06910 3034 2552 gene locus_tag LOCUS_06920 3034 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3572 3150 gene locus_tag LOCUS_06930 gene tolR 3572 3150 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_06930 4244 3573 gene locus_tag LOCUS_06940 gene tolQ 4244 3573 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947303.1 protein_id gnl|my_center|LOCUS_06940 4665 4249 gene locus_tag LOCUS_06950 4665 4249 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947304.1 protein_id gnl|my_center|LOCUS_06950 5068 4643 gene locus_tag LOCUS_06960 5068 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5810 5073 gene locus_tag LOCUS_06970 5810 5073 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH19 protein_id gnl|my_center|LOCUS_06970 7579 5813 gene locus_tag LOCUS_06980 gene aspS 7579 5813 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_06980 7884 7594 gene locus_tag LOCUS_06990 7884 7594 CDS product regulatory protein, FmdB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence043 2150 1371 gene locus_tag LOCUS_07000 2150 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2527 2150 gene locus_tag LOCUS_07010 2527 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3047 2517 gene locus_tag LOCUS_07020 3047 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4657 3044 gene locus_tag LOCUS_07030 gene ccmF 4657 3044 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946597.1 protein_id gnl|my_center|LOCUS_07030 5344 4940 gene locus_tag LOCUS_07040 gene ccmE 5344 4940 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_07040 6238 5507 gene locus_tag LOCUS_07050 gene ccmC 6238 5507 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_07050 6912 6265 gene locus_tag LOCUS_07060 6912 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7487 6909 gene locus_tag LOCUS_07070 gene ccmA 7487 6909 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX76 protein_id gnl|my_center|LOCUS_07070 8004 7471 gene locus_tag LOCUS_07080 8004 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 <8674 8012 gene locus_tag LOCUS_07090 <8674 8012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389589.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence044 2321 450 gene locus_tag LOCUS_07100 gene dxs 2321 450 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU8 protein_id gnl|my_center|LOCUS_07100 3187 2321 gene locus_tag LOCUS_07110 3187 2321 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440017.1 protein_id gnl|my_center|LOCUS_07110 3419 3195 gene locus_tag LOCUS_07120 3419 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6546 3436 gene locus_tag LOCUS_07130 6546 3436 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_07130 7358 6543 gene locus_tag LOCUS_07140 7358 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 8056 7472 gene locus_tag LOCUS_07150 8056 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence045 1284 661 gene locus_tag LOCUS_07160 1284 661 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_07160 1969 1286 gene locus_tag LOCUS_07170 1969 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2536 1988 gene locus_tag LOCUS_07180 2536 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2626 3084 gene locus_tag LOCUS_07190 2626 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3077 3271 gene locus_tag LOCUS_07200 3077 3271 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_07200 4279 3272 gene locus_tag LOCUS_07210 4279 3272 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971276.1 protein_id gnl|my_center|LOCUS_07210 5642 4269 gene locus_tag LOCUS_07220 5642 4269 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973601.1 protein_id gnl|my_center|LOCUS_07220 6132 5632 gene locus_tag LOCUS_07230 6132 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6951 6166 gene locus_tag LOCUS_07240 6951 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 7773 6952 gene locus_tag LOCUS_07250 7773 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 8082 7777 gene locus_tag LOCUS_07260 8082 7777 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence046 2395 149 gene locus_tag LOCUS_07270 gene clpA 2395 149 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072574.1 protein_id gnl|my_center|LOCUS_07270 2736 2398 gene locus_tag LOCUS_07280 gene clpS 2736 2398 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_07280 3989 2736 gene locus_tag LOCUS_07290 gene icd 3989 2736 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXB6 protein_id gnl|my_center|LOCUS_07290 4086 5165 gene locus_tag LOCUS_07300 gene mnmA 4086 5165 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57349 protein_id gnl|my_center|LOCUS_07300 5205 6560 gene locus_tag LOCUS_07310 gene purB 5205 6560 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXD1 protein_id gnl|my_center|LOCUS_07310 6702 8282 gene locus_tag LOCUS_07320 6702 8282 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_07320 >Feature sequence047 <1 810 gene locus_tag LOCUS_07330 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918682.1:1,4-beta-D-glucan glucohydrolase 803 1720 gene locus_tag LOCUS_07340 gene glk 803 1720 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6N3 protein_id gnl|my_center|LOCUS_07340 1728 5174 gene locus_tag LOCUS_07350 1728 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5171 6421 gene locus_tag LOCUS_07360 5171 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6424 7419 gene locus_tag LOCUS_07370 6424 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence048 846 262 gene locus_tag LOCUS_07380 846 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1139 879 gene locus_tag LOCUS_07390 1139 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1212 3635 gene locus_tag LOCUS_07400 1212 3635 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_07400 5628 3625 gene locus_tag LOCUS_07410 5628 3625 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972796.1 protein_id gnl|my_center|LOCUS_07410 6982 5621 gene locus_tag LOCUS_07420 gene gutA 6982 5621 CDS product putative glucitol transport protein GutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34368 protein_id gnl|my_center|LOCUS_07420 7044 7976 gene locus_tag LOCUS_07430 gene lipG 7044 7976 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908599.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence049 457 140 gene locus_tag LOCUS_07440 457 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1945 695 gene locus_tag LOCUS_07450 1945 695 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_07450 2846 1950 gene locus_tag LOCUS_07460 2846 1950 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_07460 6040 2903 gene locus_tag LOCUS_07470 gene oar 6040 2903 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_07470 7402 6158 gene locus_tag LOCUS_07480 gene serS 7402 6158 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_07480 7756 7403 gene locus_tag LOCUS_07490 7756 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence050 734 321 gene locus_tag LOCUS_07500 734 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1806 727 gene locus_tag LOCUS_07510 gene ribBA 1806 727 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP2 protein_id gnl|my_center|LOCUS_07510 2792 1800 gene locus_tag LOCUS_07520 gene ribD 2792 1800 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186Q7 protein_id gnl|my_center|LOCUS_07520 3295 2807 gene locus_tag LOCUS_07530 gene nrdR 3295 2807 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNS5 protein_id gnl|my_center|LOCUS_07530 4597 3296 gene locus_tag LOCUS_07540 gene glyA 4597 3296 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXK6 protein_id gnl|my_center|LOCUS_07540 5310 4657 gene locus_tag LOCUS_07550 gene nth 5310 4657 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_07550 5343 5630 gene locus_tag LOCUS_07560 5343 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5689 6876 gene locus_tag LOCUS_07570 5689 6876 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_07570 6885 7763 gene locus_tag LOCUS_07580 gene thiL 6885 7763 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT7 protein_id gnl|my_center|LOCUS_07580 >Feature sequence051 3503 867 gene locus_tag LOCUS_07590 gene aceE 3503 867 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_07590 3617 4447 gene locus_tag LOCUS_07600 gene hexR 3617 4447 CDS product HTH-type transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68281 protein_id gnl|my_center|LOCUS_07600 5213 4596 gene locus_tag LOCUS_07610 gene pgl 5213 4596 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_07610 5845 5216 gene locus_tag LOCUS_07620 5845 5216 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIZ8 protein_id gnl|my_center|LOCUS_07620 7262 5847 gene locus_tag LOCUS_07630 gene pykF 7262 5847 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 protein_id gnl|my_center|LOCUS_07630 >Feature sequence052 1490 84 gene locus_tag LOCUS_07640 1490 84 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082900.1 protein_id gnl|my_center|LOCUS_07640 2711 1491 gene locus_tag LOCUS_07650 2711 1491 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_07650 2857 3759 gene locus_tag LOCUS_07660 2857 3759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762543.1 protein_id gnl|my_center|LOCUS_07660 4568 3771 gene locus_tag LOCUS_07670 gene kduD 4568 3771 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_07670 4695 5645 gene locus_tag LOCUS_07680 4695 5645 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_07680 6038 5628 gene locus_tag LOCUS_07690 6038 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6140 6583 gene locus_tag LOCUS_07700 6140 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7360 6587 gene locus_tag LOCUS_07710 7360 6587 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence053 329 1585 gene locus_tag LOCUS_07720 329 1585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_07720 1572 1760 gene locus_tag LOCUS_07730 1572 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2493 1750 gene locus_tag LOCUS_07740 2493 1750 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_07740 2560 3669 gene locus_tag LOCUS_07750 2560 3669 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_07750 4941 3664 gene locus_tag LOCUS_07760 4941 3664 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_07760 6396 5158 gene locus_tag LOCUS_07770 gene amtB 6396 5158 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_07770 6745 6407 gene locus_tag LOCUS_07780 gene glnB 6745 6407 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992714.1 protein_id gnl|my_center|LOCUS_07780 7351 6761 gene locus_tag LOCUS_07790 7351 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence054 <1 1792 gene locus_tag LOCUS_07800 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZS99:chromosome partition protein Smc 1792 2424 gene locus_tag LOCUS_07810 1792 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2443 3726 gene locus_tag LOCUS_07820 2443 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3726 4337 gene locus_tag LOCUS_07830 3726 4337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_07830 7206 4339 gene locus_tag LOCUS_07840 gene preP2 7206 4339 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence055 845 33 gene locus_tag LOCUS_07850 gene cysQ 845 33 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_07850 1987 836 gene locus_tag LOCUS_07860 1987 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2837 1995 gene locus_tag LOCUS_07870 2837 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2889 3050 gene locus_tag LOCUS_07880 2889 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3043 3900 gene locus_tag LOCUS_07890 3043 3900 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_07890 4670 3903 gene locus_tag LOCUS_07900 4670 3903 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 protein_id gnl|my_center|LOCUS_07900 4707 5180 gene locus_tag LOCUS_07910 4707 5180 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_07910 5171 6508 gene locus_tag LOCUS_07920 5171 6508 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence056 51 2585 gene locus_tag LOCUS_07930 51 2585 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_07930 2716 2640 gene locus_tag LOCUS_t00120 2716 2640 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2792 4834 gene locus_tag LOCUS_07940 2792 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_07940 4938 7094 gene locus_tag LOCUS_07950 4938 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence057 <1 926 gene locus_tag LOCUS_07960 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F973:phosphoribosylformylglycinamidine cyclo-ligase 931 1578 gene locus_tag LOCUS_07970 gene purN 931 1578 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ32 protein_id gnl|my_center|LOCUS_07970 1568 2248 gene locus_tag LOCUS_07980 1568 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2803 2234 gene locus_tag LOCUS_07990 gene dcd 2803 2234 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_07990 3389 2793 gene locus_tag LOCUS_08000 gene recR 3389 2793 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL54 protein_id gnl|my_center|LOCUS_08000 5031 3391 gene locus_tag LOCUS_08010 5031 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5493 5053 gene locus_tag LOCUS_08020 gene recX 5493 5053 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIS7 protein_id gnl|my_center|LOCUS_08020 5952 5494 gene locus_tag LOCUS_08030 5952 5494 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308463.1 protein_id gnl|my_center|LOCUS_08030 6343 5945 gene locus_tag LOCUS_08040 6343 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence058 103 1620 gene locus_tag LOCUS_08050 gene pepA 103 1620 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH7 protein_id gnl|my_center|LOCUS_08050 1639 3864 gene locus_tag LOCUS_08060 gene valS 1639 3864 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DD0 protein_id gnl|my_center|LOCUS_08060 4384 3914 gene locus_tag LOCUS_08070 gene elaA 4384 3914 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_08070 4505 4987 gene locus_tag LOCUS_08080 gene bsaA 4505 4987 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT3 protein_id gnl|my_center|LOCUS_08080 4994 5479 gene locus_tag LOCUS_08090 4994 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970790.1 protein_id gnl|my_center|LOCUS_08090 5910 5476 gene locus_tag LOCUS_08100 5910 5476 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_08100 6345 5917 gene locus_tag LOCUS_08110 6345 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence059 82 1167 gene locus_tag LOCUS_08120 gene aroC 82 1167 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_08120 1169 2569 gene locus_tag LOCUS_08130 gene leuC 1169 2569 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_08130 2566 3216 gene locus_tag LOCUS_08140 gene leuD 2566 3216 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T3 protein_id gnl|my_center|LOCUS_08140 3209 4285 gene locus_tag LOCUS_08150 gene leuB 3209 4285 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ4 protein_id gnl|my_center|LOCUS_08150 4278 5297 gene locus_tag LOCUS_08160 gene asd 4278 5297 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_08160 5291 6604 gene locus_tag LOCUS_08170 5291 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence060 211 1524 gene locus_tag LOCUS_08180 211 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1521 2306 gene locus_tag LOCUS_08190 gene truA 1521 2306 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57295 protein_id gnl|my_center|LOCUS_08190 2303 2929 gene locus_tag LOCUS_08200 gene trpF 2303 2929 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVY5 protein_id gnl|my_center|LOCUS_08200 2919 4124 gene locus_tag LOCUS_08210 gene trpB 2919 4124 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_08210 4121 4906 gene locus_tag LOCUS_08220 gene trpA 4121 4906 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0D4 protein_id gnl|my_center|LOCUS_08220 4903 5748 gene locus_tag LOCUS_08230 gene accD 4903 5748 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_08230 5748 6224 gene locus_tag LOCUS_08240 5748 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence061 132 695 gene locus_tag LOCUS_08250 132 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 762 1028 gene locus_tag LOCUS_08260 762 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1028 2569 gene locus_tag LOCUS_08270 gene purH 1028 2569 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERP1 protein_id gnl|my_center|LOCUS_08270 2569 3837 gene locus_tag LOCUS_08280 gene purD 2569 3837 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_08280 3834 4469 gene locus_tag LOCUS_08290 gene coq7 3834 4469 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZI2 protein_id gnl|my_center|LOCUS_08290 5639 4473 gene locus_tag LOCUS_08300 5639 4473 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979669.1 protein_id gnl|my_center|LOCUS_08300 6385 5636 gene locus_tag LOCUS_08310 gene trpC 6385 5636 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EF3 protein_id gnl|my_center|LOCUS_08310 >Feature sequence062 1 288 gene locus_tag LOCUS_08320 1 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 907 293 gene locus_tag LOCUS_08330 907 293 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_08330 1812 910 gene locus_tag LOCUS_08340 1812 910 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_08340 1911 2504 gene locus_tag LOCUS_08350 1911 2504 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_08350 2529 3527 gene locus_tag LOCUS_08360 gene mdh 2529 3527 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A2 protein_id gnl|my_center|LOCUS_08360 3524 3979 gene locus_tag LOCUS_08370 3524 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5699 3984 gene locus_tag LOCUS_08380 5699 3984 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_08380 6226 5714 gene locus_tag LOCUS_08390 6226 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence063 742 2532 gene locus_tag LOCUS_08400 gene typA 742 2532 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_08400 2606 3298 gene locus_tag LOCUS_08410 2606 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3504 3295 gene locus_tag LOCUS_08420 3504 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4213 3710 gene locus_tag LOCUS_08430 4213 3710 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083551.1 protein_id gnl|my_center|LOCUS_08430 4919 4230 gene locus_tag LOCUS_08440 gene echA3 4919 4230 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence064 616 2 gene locus_tag LOCUS_08450 616 2 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_08450 1313 630 gene locus_tag LOCUS_08460 1313 630 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_08460 2387 1320 gene locus_tag LOCUS_08470 gene dhmA 2387 1320 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_08470 2528 3424 gene locus_tag LOCUS_08480 2528 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3538 5973 gene locus_tag LOCUS_08490 3538 5973 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence065 2467 1502 gene locus_tag LOCUS_08500 gene cobS 2467 1502 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083012.1 protein_id gnl|my_center|LOCUS_08500 2607 3503 gene locus_tag LOCUS_08510 2607 3503 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 protein_id gnl|my_center|LOCUS_08510 4533 3496 gene locus_tag LOCUS_08520 gene hemE 4533 3496 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY0 protein_id gnl|my_center|LOCUS_08520 6107 4530 gene locus_tag LOCUS_08530 gene gltD 6107 4530 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence066 707 279 gene locus_tag LOCUS_08540 707 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 740 2392 gene locus_tag LOCUS_08550 gene leuA 740 2392 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT17 protein_id gnl|my_center|LOCUS_08550 3169 2396 gene locus_tag LOCUS_08560 3169 2396 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889135.1 protein_id gnl|my_center|LOCUS_08560 4156 3209 gene locus_tag LOCUS_08570 4156 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5161 4160 gene locus_tag LOCUS_08580 gene accA 5161 4160 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPW8 protein_id gnl|my_center|LOCUS_08580 <6228 5172 gene locus_tag LOCUS_08590 <6228 5172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWR3:DNA-directed DNA polymerase >Feature sequence067 46 843 gene locus_tag LOCUS_08600 gene suhB 46 843 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_08600 1754 840 gene locus_tag LOCUS_08610 gene secF 1754 840 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_08610 3559 1754 gene locus_tag LOCUS_08620 gene secD 3559 1754 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_08620 3912 3616 gene locus_tag LOCUS_08630 3912 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5040 3925 gene locus_tag LOCUS_08640 gene tgt 5040 3925 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_08640 5968 5030 gene locus_tag LOCUS_08650 gene queA 5968 5030 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S37 protein_id gnl|my_center|LOCUS_08650 >Feature sequence068 315 593 gene locus_tag LOCUS_08660 315 593 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_08660 616 2529 gene locus_tag LOCUS_08670 616 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2531 4135 gene locus_tag LOCUS_08680 2531 4135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_08680 4142 5065 gene locus_tag LOCUS_08690 4142 5065 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_08690 5062 5916 gene locus_tag LOCUS_08700 5062 5916 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence069 231 758 gene locus_tag LOCUS_08710 231 758 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GR4 protein_id gnl|my_center|LOCUS_08710 1399 761 gene locus_tag LOCUS_08720 gene rpiA 1399 761 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZB7 protein_id gnl|my_center|LOCUS_08720 1438 2979 gene locus_tag LOCUS_08730 gene ilvA1 1438 2979 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_08730 5268 2980 gene locus_tag LOCUS_08740 5268 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5856 5287 gene locus_tag LOCUS_08750 5856 5287 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97K31 protein_id gnl|my_center|LOCUS_08750 >Feature sequence070 <1 1256 gene locus_tag LOCUS_08760 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K0M3:Na(+)-translocating NADH-quinone reductase subunit A 1253 2479 gene locus_tag LOCUS_08770 gene nqrB 1253 2479 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_08770 2476 3264 gene locus_tag LOCUS_08780 gene nqrC 2476 3264 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E0 protein_id gnl|my_center|LOCUS_08780 3254 3940 gene locus_tag LOCUS_08790 gene nqrD 3254 3940 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_08790 3933 4544 gene locus_tag LOCUS_08800 gene nqrE 3933 4544 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_08800 4560 5786 gene locus_tag LOCUS_08810 gene nqrF 4560 5786 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence071 991 683 gene locus_tag LOCUS_08820 991 683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_08820 1496 1038 gene locus_tag LOCUS_08830 1496 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_08830 1727 1545 gene locus_tag LOCUS_08840 1727 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1839 2825 gene locus_tag LOCUS_08850 1839 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2822 3793 gene locus_tag LOCUS_08860 2822 3793 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865945.1 protein_id gnl|my_center|LOCUS_08860 4987 3779 gene locus_tag LOCUS_08870 4987 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 <5967 4987 gene locus_tag LOCUS_08880 <5967 4987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545543.1:secretion protein HylD >Feature sequence072 917 45 gene locus_tag LOCUS_08890 gene tyrA 917 45 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881139.1 protein_id gnl|my_center|LOCUS_08890 2008 914 gene locus_tag LOCUS_08900 gene hisC2 2008 914 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_08900 3093 2005 gene locus_tag LOCUS_08910 3093 2005 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_08910 4176 3100 gene locus_tag LOCUS_08920 gene serC 4176 3100 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6F2 protein_id gnl|my_center|LOCUS_08920 <5915 4176 gene locus_tag LOCUS_08930 <5915 4176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVM3:DNA gyrase subunit A >Feature sequence073 277 534 gene locus_tag LOCUS_08940 277 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1145 531 gene locus_tag LOCUS_08950 gene lexA 1145 531 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_08950 1213 2112 gene locus_tag LOCUS_08960 1213 2112 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_08960 2125 2733 gene locus_tag LOCUS_08970 gene thrH 2125 2733 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_08970 2730 3392 gene locus_tag LOCUS_08980 2730 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_08980 3440 4306 gene locus_tag LOCUS_08990 gene prpB 3440 4306 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZF8 protein_id gnl|my_center|LOCUS_08990 4328 5449 gene locus_tag LOCUS_09000 gene prpC 4328 5449 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_09000 >Feature sequence074 1316 300 gene locus_tag LOCUS_09010 gene recA 1316 300 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_09010 1439 1762 gene locus_tag LOCUS_09020 gene fdxA 1439 1762 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_09020 2497 1757 gene locus_tag LOCUS_09030 2497 1757 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865064.1 protein_id gnl|my_center|LOCUS_09030 3177 2494 gene locus_tag LOCUS_09040 gene pcm 3177 2494 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_09040 3916 3170 gene locus_tag LOCUS_09050 gene surE 3916 3170 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S4T3 protein_id gnl|my_center|LOCUS_09050 5061 3922 gene locus_tag LOCUS_09060 gene ispDF 5061 3922 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25664 protein_id gnl|my_center|LOCUS_09060 5356 5051 gene locus_tag LOCUS_09070 5356 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence075 1119 268 gene locus_tag LOCUS_09080 1119 268 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_09080 1911 1135 gene locus_tag LOCUS_09090 1911 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2037 2822 gene locus_tag LOCUS_09100 gene mttC 2037 2822 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_09100 3918 2815 gene locus_tag LOCUS_09110 3918 2815 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_09110 <5715 3928 gene locus_tag LOCUS_09120 <5715 3928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858465.1:membrane protein >Feature sequence076 1228 386 gene locus_tag LOCUS_09130 1228 386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_09130 1271 3445 gene locus_tag LOCUS_09140 1271 3445 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KG4 protein_id gnl|my_center|LOCUS_09140 3445 4533 gene locus_tag LOCUS_09150 3445 4533 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_09150 4533 5135 gene locus_tag LOCUS_09160 gene lipB 4533 5135 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RR0 protein_id gnl|my_center|LOCUS_09160 >Feature sequence077 3 560 gene locus_tag LOCUS_09170 3 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 707 1363 gene locus_tag LOCUS_09180 707 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1989 1594 gene locus_tag LOCUS_09190 1989 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3460 1964 gene locus_tag LOCUS_09200 3460 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3517 4044 gene locus_tag LOCUS_09210 3517 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4013 4204 gene locus_tag LOCUS_09220 4013 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence078 47 304 gene locus_tag LOCUS_09230 gene rpmA 47 304 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBZ3 protein_id gnl|my_center|LOCUS_09230 319 1341 gene locus_tag LOCUS_09240 gene obg 319 1341 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_09240 1596 1333 gene locus_tag LOCUS_09250 gene rpsT 1596 1333 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M74 protein_id gnl|my_center|LOCUS_09250 3981 1708 gene locus_tag LOCUS_09260 3981 1708 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_09260 4600 4100 gene locus_tag LOCUS_09270 4600 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4982 4634 gene locus_tag LOCUS_tm00010 4982 4634 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 1526 522 gene locus_tag LOCUS_09280 1526 522 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_09280 3033 1540 gene locus_tag LOCUS_09290 gene gshA 3033 1540 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_09290 4583 3042 gene locus_tag LOCUS_09300 gene pckA 4583 3042 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_09300 5199 4753 gene locus_tag LOCUS_09310 gene dsbB1 5199 4753 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_09310 >Feature sequence080 170 244 gene locus_tag LOCUS_t00130 170 244 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 966 289 gene locus_tag LOCUS_09320 966 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1448 969 gene locus_tag LOCUS_09330 1448 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2119 1514 gene locus_tag LOCUS_09340 2119 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3495 2116 gene locus_tag LOCUS_09350 gene cysS 3495 2116 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 protein_id gnl|my_center|LOCUS_09350 4106 3492 gene locus_tag LOCUS_09360 4106 3492 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN87 protein_id gnl|my_center|LOCUS_09360 4712 4128 gene locus_tag LOCUS_09370 gene folE 4712 4128 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_09370 >Feature sequence081 1581 355 gene locus_tag LOCUS_09380 1581 355 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860940.1 protein_id gnl|my_center|LOCUS_09380 4960 2243 gene locus_tag LOCUS_09390 4960 2243 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_09390 5125 4976 gene locus_tag LOCUS_09400 5125 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence082 271 1290 gene locus_tag LOCUS_09410 271 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1287 1838 gene locus_tag LOCUS_09420 1287 1838 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_09420 1831 2517 gene locus_tag LOCUS_09430 1831 2517 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_09430 4342 2510 gene locus_tag LOCUS_09440 4342 2510 CDS product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS9 protein_id gnl|my_center|LOCUS_09440 4741 4409 gene locus_tag LOCUS_09450 4741 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence083 2873 3526 gene locus_tag LOCUS_09460 2873 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 <4984 3501 gene locus_tag LOCUS_09470 <4984 3501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q884C9:UvrABC system protein B >Feature sequence084 <1 1067 gene locus_tag LOCUS_09480 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein 1924 1064 gene locus_tag LOCUS_09490 1924 1064 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_09490 2052 3095 gene locus_tag LOCUS_09500 2052 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022394.1 protein_id gnl|my_center|LOCUS_09500 3300 3106 gene locus_tag LOCUS_09510 3300 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4247 3363 gene locus_tag LOCUS_09520 4247 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4945 4250 gene locus_tag LOCUS_09530 4945 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence085 618 692 gene locus_tag LOCUS_t00140 618 692 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1076 702 gene locus_tag LOCUS_09540 1076 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1184 2302 gene locus_tag LOCUS_09550 1184 2302 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_09550 2339 2959 gene locus_tag LOCUS_09560 gene ppiB 2339 2959 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_09560 2956 3669 gene locus_tag LOCUS_09570 gene lpxH 2956 3669 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43341 protein_id gnl|my_center|LOCUS_09570 4291 3659 gene locus_tag LOCUS_09580 4291 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4773 4294 gene locus_tag LOCUS_09590 4773 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence086 83 7 gene locus_tag LOCUS_t00150 83 7 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 164 1006 gene locus_tag LOCUS_09600 gene folD 164 1006 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_09600 1386 1003 gene locus_tag LOCUS_09610 1386 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2416 1397 gene locus_tag LOCUS_09620 gene gpsA 2416 1397 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_09620 4244 2418 gene locus_tag LOCUS_09630 gene htpG 4244 2418 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_09630 4718 4311 gene locus_tag LOCUS_09640 4718 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4800 4726 gene locus_tag LOCUS_t00160 4800 4726 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 271 1290 gene locus_tag LOCUS_09650 271 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1287 1838 gene locus_tag LOCUS_09660 gene pgsA 1287 1838 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67908 protein_id gnl|my_center|LOCUS_09660 1831 2517 gene locus_tag LOCUS_09670 gene hda 1831 2517 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 protein_id gnl|my_center|LOCUS_09670 4351 2510 gene locus_tag LOCUS_09680 gene sppA 4351 2510 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_09680 >Feature sequence088 103 27 gene locus_tag LOCUS_t00170 103 27 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 203 289 gene locus_tag LOCUS_t00180 203 289 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 611 300 gene locus_tag LOCUS_09690 611 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1351 608 gene locus_tag LOCUS_09700 gene tpiA 1351 608 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A860 protein_id gnl|my_center|LOCUS_09700 2676 1354 gene locus_tag LOCUS_09710 gene glmM 2676 1354 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT4 protein_id gnl|my_center|LOCUS_09710 4592 2685 gene locus_tag LOCUS_09720 gene ftsH 4592 2685 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_09720 >Feature sequence089 1061 681 gene locus_tag LOCUS_09730 gene rplL 1061 681 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X1 protein_id gnl|my_center|LOCUS_09730 1610 1080 gene locus_tag LOCUS_09740 gene rplJ 1610 1080 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID4 protein_id gnl|my_center|LOCUS_09740 2464 1772 gene locus_tag LOCUS_09750 gene rplA 2464 1772 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAP2 protein_id gnl|my_center|LOCUS_09750 2889 2461 gene locus_tag LOCUS_09760 gene rplK 2889 2461 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP7 protein_id gnl|my_center|LOCUS_09760 3416 2889 gene locus_tag LOCUS_09770 gene nusG 3416 2889 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFS2 protein_id gnl|my_center|LOCUS_09770 3783 3421 gene locus_tag LOCUS_09780 gene secE 3783 3421 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC3 protein_id gnl|my_center|LOCUS_09780 3889 3814 gene locus_tag LOCUS_t00190 3889 3814 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <4610 3960 gene locus_tag LOCUS_09790 <4610 3960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889X3:elongation factor Tu >Feature sequence090 1091 282 gene locus_tag LOCUS_09800 gene cyoE 1091 282 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 protein_id gnl|my_center|LOCUS_09800 2113 1139 gene locus_tag LOCUS_09810 2113 1139 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_09810 2661 2113 gene locus_tag LOCUS_09820 2661 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3352 2651 gene locus_tag LOCUS_09830 3352 2651 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_09830 3386 3604 gene locus_tag LOCUS_09840 3386 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4519 3605 gene locus_tag LOCUS_09850 gene coxC 4519 3605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence091 535 1305 gene locus_tag LOCUS_09860 535 1305 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_09860 1442 1308 gene locus_tag LOCUS_09870 1442 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2428 1445 gene locus_tag LOCUS_09880 2428 1445 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_09880 3370 2435 gene locus_tag LOCUS_09890 gene trxB 3370 2435 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_09890 >Feature sequence092 1238 1954 gene locus_tag LOCUS_09900 1238 1954 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261606.1 protein_id gnl|my_center|LOCUS_09900 2765 2016 gene locus_tag LOCUS_09910 2765 2016 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_09910 2952 3434 gene locus_tag LOCUS_09920 gene coaD 2952 3434 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH3 protein_id gnl|my_center|LOCUS_09920 4240 3431 gene locus_tag LOCUS_09930 gene mutM 4240 3431 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XSB3 protein_id gnl|my_center|LOCUS_09930 >Feature sequence093 231 10 gene locus_tag LOCUS_09940 231 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 309 476 gene locus_tag LOCUS_09950 309 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1344 505 gene locus_tag LOCUS_09960 1344 505 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_09960 1673 1353 gene locus_tag LOCUS_09970 1673 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2900 1929 gene locus_tag LOCUS_09980 2900 1929 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_09980 3686 2904 gene locus_tag LOCUS_09990 3686 2904 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_09990 3803 4210 gene locus_tag LOCUS_10000 3803 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence094 2120 327 gene locus_tag LOCUS_10010 gene edd 2120 327 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919918.1 protein_id gnl|my_center|LOCUS_10010 3577 2117 gene locus_tag LOCUS_10020 gene zwf 3577 2117 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S2 protein_id gnl|my_center|LOCUS_10020 <4212 3567 gene locus_tag LOCUS_10030 <4212 3567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63SM0:acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence095 175 1659 gene locus_tag LOCUS_10040 gene purF 175 1659 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_10040 <4182 1656 gene locus_tag LOCUS_10050 <4182 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPU4:aconitate hydratase B >Feature sequence096 <1 663 gene locus_tag LOCUS_10060 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PD84:ribulose-phosphate 3-epimerase 782 1066 gene locus_tag LOCUS_10070 782 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1063 2529 gene locus_tag LOCUS_10080 1063 2529 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_10080 2526 3089 gene locus_tag LOCUS_10090 gene trpG 2526 3089 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_10090 3086 4096 gene locus_tag LOCUS_10100 gene trpD 3086 4096 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EF2 protein_id gnl|my_center|LOCUS_10100 >Feature sequence097 462 2027 gene locus_tag LOCUS_10110 gene sglT 462 2027 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence098 277 426 gene locus_tag LOCUS_10120 277 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 427 795 gene locus_tag LOCUS_10130 427 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1666 797 gene locus_tag LOCUS_10140 1666 797 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_10140 1853 1659 gene locus_tag LOCUS_10150 1853 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2033 1860 gene locus_tag LOCUS_10160 2033 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3017 2052 gene locus_tag LOCUS_10170 3017 2052 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_10170 <3764 3047 gene locus_tag LOCUS_10180 <3764 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038867.1:N-acyl-L-amino acid amidohydrolase >Feature sequence099 257 2854 gene locus_tag LOCUS_10190 gene polA 257 2854 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002409066.1 protein_id gnl|my_center|LOCUS_10190 3378 2857 gene locus_tag LOCUS_10200 3378 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence100 2352 1162 gene locus_tag LOCUS_10210 gene argG 2352 1162 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J4 protein_id gnl|my_center|LOCUS_10210 3356 2355 gene locus_tag LOCUS_10220 gene argF' 3356 2355 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_10220 3607 3523 gene locus_tag LOCUS_t00200 3607 3523 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 22 1449 gene locus_tag LOCUS_10230 22 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1502 1593 gene locus_tag LOCUS_t00210 1502 1593 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1607 2026 gene locus_tag LOCUS_10240 1607 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2042 3139 gene locus_tag LOCUS_10250 2042 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence102 1242 541 gene locus_tag LOCUS_10260 1242 541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016817.1 protein_id gnl|my_center|LOCUS_10260 3299 1326 gene locus_tag LOCUS_10270 gene dsbD 3299 1326 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_224981.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence103 1432 146 gene locus_tag LOCUS_10280 1432 146 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704360.1 protein_id gnl|my_center|LOCUS_10280 3186 1432 gene locus_tag LOCUS_10290 3186 1432 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883377.1 protein_id gnl|my_center|LOCUS_10290 3409 3179 gene locus_tag LOCUS_10300 3409 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence104 480 316 gene locus_tag LOCUS_10310 480 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence105 <1 623 gene locus_tag LOCUS_10320 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108120.1:3-oxo-5-alpha-steroid 4-dehydrogenase 1623 616 gene locus_tag LOCUS_10330 1623 616 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_10330 2066 1701 gene locus_tag LOCUS_10340 2066 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435473.1 protein_id gnl|my_center|LOCUS_10340 2578 2093 gene locus_tag LOCUS_10350 2578 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3349 2591 gene locus_tag LOCUS_10360 3349 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence106 107 808 gene locus_tag LOCUS_10370 107 808 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_10370 801 1034 gene locus_tag LOCUS_10380 801 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1427 1029 gene locus_tag LOCUS_10390 1427 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2058 1435 gene locus_tag LOCUS_10400 gene dsbA 2058 1435 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_10400 2720 2055 gene locus_tag LOCUS_10410 gene cc4 2720 2055 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_10410 >Feature sequence107 300 698 gene locus_tag LOCUS_10420 300 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1475 702 gene locus_tag LOCUS_10430 1475 702 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_10430 2681 1524 gene locus_tag LOCUS_10440 2681 1524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088779.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence108 2243 45 gene locus_tag LOCUS_10450 2243 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2439 2227 gene locus_tag LOCUS_10460 2439 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 <3115 2439 gene locus_tag LOCUS_10470 <3115 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036182.1:membrane protein >Feature sequence109 942 163 gene locus_tag LOCUS_10480 gene yadH 942 163 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_10480 1852 932 gene locus_tag LOCUS_10490 1852 932 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 protein_id gnl|my_center|LOCUS_10490 <3104 1862 gene locus_tag LOCUS_10500 <3104 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902866.1:permease >Feature sequence110 372 2051 gene locus_tag LOCUS_10510 372 2051 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_10510 2052 2363 gene locus_tag LOCUS_10520 2052 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2483 2773 gene locus_tag LOCUS_10530 2483 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence111 504 2189 gene locus_tag LOCUS_10540 504 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 <3064 2274 gene locus_tag LOCUS_10550 <3064 2274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_769363.2:indolepyruvate ferredoxin oxidoreductase >Feature sequence112 <1 982 gene locus_tag LOCUS_10560 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F7X0:tryptophan--tRNA ligase 982 2172 gene locus_tag LOCUS_10570 982 2172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence113 465 280 gene locus_tag LOCUS_10580 465 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2237 471 gene locus_tag LOCUS_10590 2237 471 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_10590 <3006 2247 gene locus_tag LOCUS_10600 <3006 2247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263282.1:mechanosensitive ion channel protein MscS >Feature sequence114 1641 673 gene locus_tag LOCUS_10610 1641 673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_10610 2454 1651 gene locus_tag LOCUS_10620 gene icaB 2454 1651 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence115 <1 1113 gene locus_tag LOCUS_10630 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105378.1:2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase 1350 1114 gene locus_tag LOCUS_10640 gene rpmB 1350 1114 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEM3 protein_id gnl|my_center|LOCUS_10640 1442 1888 gene locus_tag LOCUS_10650 1442 1888 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_10650 1885 2340 gene locus_tag LOCUS_10660 gene dut 1885 2340 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU09 protein_id gnl|my_center|LOCUS_10660 2594 2346 gene locus_tag LOCUS_10670 gene rpmE2 2594 2346 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJJ1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence116 508 1293 gene locus_tag LOCUS_10680 gene mttC 508 1293 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_10680 2389 1286 gene locus_tag LOCUS_10690 2389 1286 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence117 729 304 gene locus_tag LOCUS_10700 729 304 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_10700 762 1388 gene locus_tag LOCUS_10710 gene gpmA 762 1388 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T25 protein_id gnl|my_center|LOCUS_10710 1378 2400 gene locus_tag LOCUS_10720 gene mutY 1378 2400 CDS product adenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57617 protein_id gnl|my_center|LOCUS_10720 2397 2666 gene locus_tag LOCUS_10730 2397 2666 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_10730 >Feature sequence118 1829 978 gene locus_tag LOCUS_10740 1829 978 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_10740 2683 1841 gene locus_tag LOCUS_10750 2683 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence119 238 669 gene locus_tag LOCUS_10760 238 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 741 830 gene locus_tag LOCUS_t00220 741 830 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 913 1206 gene locus_tag LOCUS_10770 913 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1217 1789 gene locus_tag LOCUS_10780 1217 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence120 203 2014 gene locus_tag LOCUS_10790 203 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2102 2018 gene locus_tag LOCUS_t00230 2102 2018 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 131 209 gene locus_tag LOCUS_t00240 131 209 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 659 222 gene locus_tag LOCUS_10800 659 222 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970954.1 protein_id gnl|my_center|LOCUS_10800 986 804 gene locus_tag LOCUS_10810 986 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence122 533 1015 gene locus_tag LOCUS_10820 gene coaD 533 1015 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH3 protein_id gnl|my_center|LOCUS_10820 1821 1012 gene locus_tag LOCUS_10830 gene mutM 1821 1012 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XSB3 protein_id gnl|my_center|LOCUS_10830 >Feature sequence123 1492 197 gene locus_tag LOCUS_10840 gene pepP 1492 197 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_10840 1557 1754 gene locus_tag LOCUS_10850 1557 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1747 2013 gene locus_tag LOCUS_10860 1747 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence124 200 358 gene locus_tag LOCUS_10870 200 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1587 418 gene locus_tag LOCUS_10880 1587 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence125 1402 683 gene locus_tag LOCUS_10890 1402 683 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297205.1 protein_id gnl|my_center|LOCUS_10890 1836 1405 gene locus_tag LOCUS_10900 gene rnhA 1836 1405 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_10900 >Feature sequence126 113 1150 gene locus_tag LOCUS_10910 113 1150 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 protein_id gnl|my_center|LOCUS_10910 <1997 1163 gene locus_tag LOCUS_10920 <1997 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785778.1:membrane protein >Feature sequence127 1495 716 gene locus_tag LOCUS_10930 gene yadH 1495 716 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_10930 >Feature sequence128 <1 769 gene locus_tag LOCUS_10940 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074100.1:two-component system sensor histidine kinase NtrB >Feature sequence129 >Feature sequence130 578 183 gene locus_tag LOCUS_10950 578 183 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 protein_id gnl|my_center|LOCUS_10950 676 1356 gene locus_tag LOCUS_10960 676 1356 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086963.1 protein_id gnl|my_center|LOCUS_10960 1744 1358 gene locus_tag LOCUS_10970 1744 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence131 1672 440 gene locus_tag LOCUS_10980 1672 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence132 1542 397 gene locus_tag LOCUS_10990 1542 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence133 <1 906 gene locus_tag LOCUS_11000 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919838.1:amidohydrolase