>Feature sequence001 1549 497 gene locus_tag LOCUS_00010 1549 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3050 1533 gene locus_tag LOCUS_00020 gene nuoN-1 3050 1533 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_00020 4652 3054 gene locus_tag LOCUS_00030 4652 3054 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_00030 7056 4666 gene locus_tag LOCUS_00040 gene ndhF 7056 4666 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932456.1 protein_id gnl|my_center|LOCUS_00040 7359 7060 gene locus_tag LOCUS_00050 gene ndhE 7359 7060 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_00050 7891 7370 gene locus_tag LOCUS_00060 7891 7370 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_00060 8382 7891 gene locus_tag LOCUS_00070 gene nuoI2 8382 7891 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_00070 9437 8382 gene locus_tag LOCUS_00080 gene nuoH 9437 8382 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAY9 protein_id gnl|my_center|LOCUS_00080 10615 9434 gene locus_tag LOCUS_00090 gene nuoD1 10615 9434 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_00090 11265 10612 gene locus_tag LOCUS_00100 11265 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11818 11252 gene locus_tag LOCUS_00110 11818 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12199 11834 gene locus_tag LOCUS_00120 12199 11834 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2W2 protein_id gnl|my_center|LOCUS_00120 12931 12266 gene locus_tag LOCUS_00130 12931 12266 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_00130 12988 14190 gene locus_tag LOCUS_00140 12988 14190 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_00140 14324 15019 gene locus_tag LOCUS_00150 14324 15019 CDS product peptidase C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_00150 15798 15028 gene locus_tag LOCUS_00160 15798 15028 CDS product exonuclease RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_00160 17379 15874 gene locus_tag LOCUS_00170 17379 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18956 17379 gene locus_tag LOCUS_00180 gene nuoM-1 18956 17379 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_00180 20866 18953 gene locus_tag LOCUS_00190 gene nuoL-1 20866 18953 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_00190 21206 20877 gene locus_tag LOCUS_00200 gene nuoK 21206 20877 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_00200 21745 21203 gene locus_tag LOCUS_00210 21745 21203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22389 21745 gene locus_tag LOCUS_00220 22389 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23609 22389 gene locus_tag LOCUS_00230 23609 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25975 23606 gene locus_tag LOCUS_00240 25975 23606 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB7 protein_id gnl|my_center|LOCUS_00240 27372 25972 gene locus_tag LOCUS_00250 27372 25972 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_00250 27983 27369 gene locus_tag LOCUS_00260 27983 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29317 27983 gene locus_tag LOCUS_00270 gene nuoD 29317 27983 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_00270 29814 29314 gene locus_tag LOCUS_00280 29814 29314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30410 29811 gene locus_tag LOCUS_00290 gene nuoB 30410 29811 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI7 protein_id gnl|my_center|LOCUS_00290 30891 30427 gene locus_tag LOCUS_00300 gene nuoA1 30891 30427 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_00300 31713 30895 gene locus_tag LOCUS_00310 31713 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32774 31710 gene locus_tag LOCUS_00320 32774 31710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33634 32777 gene locus_tag LOCUS_00330 33634 32777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34400 33648 gene locus_tag LOCUS_00340 34400 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35210 34428 gene locus_tag LOCUS_00350 35210 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35635 35222 gene locus_tag LOCUS_00360 35635 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36116 35640 gene locus_tag LOCUS_00370 36116 35640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36535 37353 gene locus_tag LOCUS_00380 36535 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37458 38705 gene locus_tag LOCUS_00390 37458 38705 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_00390 39203 38718 gene locus_tag LOCUS_00400 39203 38718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40696 39329 gene locus_tag LOCUS_00410 gene hemL 40696 39329 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 protein_id gnl|my_center|LOCUS_00410 41691 40702 gene locus_tag LOCUS_00420 gene hemB 41691 40702 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF5 protein_id gnl|my_center|LOCUS_00420 42461 41718 gene locus_tag LOCUS_00430 42461 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43353 42472 gene locus_tag LOCUS_00440 gene hemC 43353 42472 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I1 protein_id gnl|my_center|LOCUS_00440 44632 43370 gene locus_tag LOCUS_00450 gene hemA 44632 43370 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_00450 45351 44668 gene locus_tag LOCUS_00460 gene rex 45351 44668 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_00460 45470 46240 gene locus_tag LOCUS_00470 45470 46240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47191 46328 gene locus_tag LOCUS_00480 47191 46328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_00480 48250 47447 gene locus_tag LOCUS_00490 gene proC 48250 47447 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A50 protein_id gnl|my_center|LOCUS_00490 48829 48359 gene locus_tag LOCUS_00500 48829 48359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50037 48826 gene locus_tag LOCUS_00510 gene mshA 50037 48826 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTA6 protein_id gnl|my_center|LOCUS_00510 50601 50098 gene locus_tag LOCUS_00520 50601 50098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50840 50598 gene locus_tag LOCUS_00530 50840 50598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 50893 51513 gene locus_tag LOCUS_00540 50893 51513 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256260.1 protein_id gnl|my_center|LOCUS_00540 51510 52715 gene locus_tag LOCUS_00550 51510 52715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_00550 54361 52712 gene locus_tag LOCUS_00560 gene nadE 54361 52712 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931082.1 protein_id gnl|my_center|LOCUS_00560 54578 55585 gene locus_tag LOCUS_00570 54578 55585 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_00570 55693 57048 gene locus_tag LOCUS_00580 gene glnA2 55693 57048 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_00580 57057 57740 gene locus_tag LOCUS_00590 gene glnR 57057 57740 CDS product transcriptional regulatory protein GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05943 protein_id gnl|my_center|LOCUS_00590 58777 57860 gene locus_tag LOCUS_00600 58777 57860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 protein_id gnl|my_center|LOCUS_00600 59600 58905 gene locus_tag LOCUS_00610 59600 58905 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226748.1 protein_id gnl|my_center|LOCUS_00610 60957 59575 gene locus_tag LOCUS_00620 60957 59575 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_00620 62360 60954 gene locus_tag LOCUS_00630 62360 60954 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 protein_id gnl|my_center|LOCUS_00630 62555 62400 gene locus_tag LOCUS_00640 62555 62400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 63059 62565 gene locus_tag LOCUS_00650 63059 62565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63175 64056 gene locus_tag LOCUS_00660 63175 64056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 64505 64182 gene locus_tag LOCUS_00670 64505 64182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_00670 64616 65803 gene locus_tag LOCUS_00680 gene mrp 64616 65803 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_00680 68002 65804 gene locus_tag LOCUS_00690 68002 65804 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_00690 68201 67992 gene locus_tag LOCUS_00700 68201 67992 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_00700 68991 68203 gene locus_tag LOCUS_00710 gene paaG 68991 68203 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_00710 69130 69057 gene locus_tag LOCUS_t00010 69130 69057 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 921 241 gene locus_tag LOCUS_00720 921 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 1412 921 gene locus_tag LOCUS_00730 1412 921 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_00730 1720 1454 gene locus_tag LOCUS_00740 1720 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2937 1723 gene locus_tag LOCUS_00750 2937 1723 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_00750 3857 2961 gene locus_tag LOCUS_00760 3857 2961 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_00760 4225 3890 gene locus_tag LOCUS_00770 4225 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 5576 4311 gene locus_tag LOCUS_00780 gene dinB 5576 4311 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_00780 6358 5630 gene locus_tag LOCUS_00790 6358 5630 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_00790 6417 6677 gene locus_tag LOCUS_00800 6417 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6684 7475 gene locus_tag LOCUS_00810 gene suhB 6684 7475 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46813 protein_id gnl|my_center|LOCUS_00810 7535 8215 gene locus_tag LOCUS_00820 gene regX 7535 8215 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_00820 8222 9688 gene locus_tag LOCUS_00830 gene mtrB 8222 9688 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_00830 9693 10304 gene locus_tag LOCUS_00840 9693 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 11363 10326 gene locus_tag LOCUS_00850 gene pfkA1 11363 10326 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08333 protein_id gnl|my_center|LOCUS_00850 11464 11739 gene locus_tag LOCUS_00860 11464 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11742 13244 gene locus_tag LOCUS_00870 gene glpK2 11742 13244 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_00870 13893 13249 gene locus_tag LOCUS_00880 13893 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14888 13947 gene locus_tag LOCUS_00890 14888 13947 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_00890 15333 14893 gene locus_tag LOCUS_00900 15333 14893 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_00900 15852 15343 gene locus_tag LOCUS_00910 15852 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 16970 15849 gene locus_tag LOCUS_00920 16970 15849 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_00920 18148 16967 gene locus_tag LOCUS_00930 gene queG 18148 16967 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNR6 protein_id gnl|my_center|LOCUS_00930 18395 18135 gene locus_tag LOCUS_00940 18395 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 19878 18445 gene locus_tag LOCUS_00950 19878 18445 CDS product glucose-methanol-choline oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530429.1 protein_id gnl|my_center|LOCUS_00950 20550 19882 gene locus_tag LOCUS_00960 20550 19882 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_00960 21993 20557 gene locus_tag LOCUS_00970 21993 20557 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_00970 22886 22017 gene locus_tag LOCUS_00980 22886 22017 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_00980 22979 24664 gene locus_tag LOCUS_00990 gene mviN 22979 24664 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_00990 25735 24644 gene locus_tag LOCUS_01000 gene proB 25735 24644 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_01000 26990 25737 gene locus_tag LOCUS_01010 26990 25737 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_01010 27114 28223 gene locus_tag LOCUS_01020 27114 28223 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT7 protein_id gnl|my_center|LOCUS_01020 28543 28289 gene locus_tag LOCUS_01030 gene rpmA 28543 28289 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1I1 protein_id gnl|my_center|LOCUS_01030 28921 28547 gene locus_tag LOCUS_01040 gene rplU 28921 28547 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN50 protein_id gnl|my_center|LOCUS_01040 30888 28921 gene locus_tag LOCUS_01050 30888 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 32443 31280 gene locus_tag LOCUS_01060 32443 31280 CDS product cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256594.1 protein_id gnl|my_center|LOCUS_01060 34635 32443 gene locus_tag LOCUS_01070 34635 32443 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_01070 35214 34678 gene locus_tag LOCUS_01080 35214 34678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 36239 35211 gene locus_tag LOCUS_01090 36239 35211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 37393 36362 gene locus_tag LOCUS_01100 37393 36362 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_01100 37861 37451 gene locus_tag LOCUS_01110 gene ndk 37861 37451 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50589 protein_id gnl|my_center|LOCUS_01110 39187 37892 gene locus_tag LOCUS_01120 39187 37892 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_01120 40498 39215 gene locus_tag LOCUS_01130 gene clpX 40498 39215 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R196 protein_id gnl|my_center|LOCUS_01130 41223 40591 gene locus_tag LOCUS_01140 gene clpP 41223 40591 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_01140 42691 41234 gene locus_tag LOCUS_01150 gene tig 42691 41234 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R199 protein_id gnl|my_center|LOCUS_01150 42784 43065 gene locus_tag LOCUS_01160 42784 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 43074 44255 gene locus_tag LOCUS_01170 43074 44255 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_01170 44318 44968 gene locus_tag LOCUS_01180 44318 44968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 46152 44965 gene locus_tag LOCUS_01190 46152 44965 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_01190 48329 46149 gene locus_tag LOCUS_01200 48329 46149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 48615 49103 gene locus_tag LOCUS_01210 48615 49103 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZU1 protein_id gnl|my_center|LOCUS_01210 49117 49941 gene locus_tag LOCUS_01220 49117 49941 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_01220 50410 50096 gene locus_tag LOCUS_01230 50410 50096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 52828 50546 gene locus_tag LOCUS_01240 52828 50546 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_01240 53727 52867 gene locus_tag LOCUS_01250 53727 52867 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_01250 53770 54294 gene locus_tag LOCUS_01260 53770 54294 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_01260 54301 54906 gene locus_tag LOCUS_01270 54301 54906 CDS product putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700839.1 protein_id gnl|my_center|LOCUS_01270 54893 56305 gene locus_tag LOCUS_01280 gene mhpA 54893 56305 CDS product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_01280 56592 57887 gene locus_tag LOCUS_01290 56592 57887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_01290 57951 59378 gene locus_tag LOCUS_01300 gene imrB 57951 59378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_01300 60373 59387 gene locus_tag LOCUS_01310 60373 59387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 62171 60411 gene locus_tag LOCUS_01320 62171 60411 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_01320 62758 62222 gene locus_tag LOCUS_01330 62758 62222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 62940 62866 gene locus_tag LOCUS_t00020 62940 62866 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 63598 63020 gene locus_tag LOCUS_01340 63598 63020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 64090 63626 gene locus_tag LOCUS_01350 64090 63626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 65580 64090 gene locus_tag LOCUS_01360 65580 64090 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_01360 65670 66437 gene locus_tag LOCUS_01370 gene ddaH 65670 66437 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7M4 protein_id gnl|my_center|LOCUS_01370 67296 66409 gene locus_tag LOCUS_01380 67296 66409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 68100 67306 gene locus_tag LOCUS_01390 gene crt2 68100 67306 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_01390 <68802 68127 gene locus_tag LOCUS_01400 <68802 68127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029869.1:glycoside hydrolase >Feature sequence003 <1 516 gene locus_tag LOCUS_01410 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224343.1:acyl-CoA thioesterase II 621 1730 gene locus_tag LOCUS_01420 621 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_01420 2737 1733 gene locus_tag LOCUS_01430 2737 1733 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_01430 2927 2727 gene locus_tag LOCUS_01440 2927 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3430 2927 gene locus_tag LOCUS_01450 3430 2927 CDS product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_01450 4820 3771 gene locus_tag LOCUS_01460 4820 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4874 6136 gene locus_tag LOCUS_01470 4874 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_01470 7472 6120 gene locus_tag LOCUS_01480 7472 6120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730715.1 protein_id gnl|my_center|LOCUS_01480 8222 7515 gene locus_tag LOCUS_01490 gene regX3 8222 7515 CDS product sensory transduction protein regX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07130 protein_id gnl|my_center|LOCUS_01490 9367 8222 gene locus_tag LOCUS_01500 9367 8222 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804557.1 protein_id gnl|my_center|LOCUS_01500 10077 9370 gene locus_tag LOCUS_01510 10077 9370 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJU3 protein_id gnl|my_center|LOCUS_01510 10936 10184 gene locus_tag LOCUS_01520 10936 10184 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI25 protein_id gnl|my_center|LOCUS_01520 11837 10950 gene locus_tag LOCUS_01530 gene pstB 11837 10950 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU7 protein_id gnl|my_center|LOCUS_01530 12781 11837 gene locus_tag LOCUS_01540 gene pstA 12781 11837 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S082 protein_id gnl|my_center|LOCUS_01540 13726 12788 gene locus_tag LOCUS_01550 13726 12788 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878854.1 protein_id gnl|my_center|LOCUS_01550 14748 13732 gene locus_tag LOCUS_01560 14748 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 16926 14878 gene locus_tag LOCUS_01570 gene ppk 16926 14878 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65769 protein_id gnl|my_center|LOCUS_01570 17251 16982 gene locus_tag LOCUS_01580 17251 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17538 17789 gene locus_tag LOCUS_01590 17538 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 18034 17834 gene locus_tag LOCUS_01600 18034 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18088 18915 gene locus_tag LOCUS_01610 18088 18915 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903266.1 protein_id gnl|my_center|LOCUS_01610 19174 18923 gene locus_tag LOCUS_01620 19174 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19886 19374 gene locus_tag LOCUS_01630 19886 19374 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227996.1 protein_id gnl|my_center|LOCUS_01630 20697 19897 gene locus_tag LOCUS_01640 20697 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_01640 20733 21449 gene locus_tag LOCUS_01650 gene deoD2 20733 21449 CDS product purine nucleoside phosphorylase DeoD-type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNB2 protein_id gnl|my_center|LOCUS_01650 22506 21511 gene locus_tag LOCUS_01660 gene mdh 22506 21511 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_01660 24524 22575 gene locus_tag LOCUS_01670 24524 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 25974 24547 gene locus_tag LOCUS_01680 25974 24547 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_01680 26867 26007 gene locus_tag LOCUS_01690 26867 26007 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2V3 protein_id gnl|my_center|LOCUS_01690 27023 28069 gene locus_tag LOCUS_01700 27023 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 29589 28081 gene locus_tag LOCUS_01710 gene purH 29589 28081 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_01710 30545 29646 gene locus_tag LOCUS_01720 gene sucD 30545 29646 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_01720 31701 30550 gene locus_tag LOCUS_01730 gene sucC 31701 30550 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_01730 32129 31716 gene locus_tag LOCUS_01740 32129 31716 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_01740 32314 32775 gene locus_tag LOCUS_01750 32314 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 33589 32789 gene locus_tag LOCUS_01760 33589 32789 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_01760 33644 34171 gene locus_tag LOCUS_01770 33644 34171 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256351.1 protein_id gnl|my_center|LOCUS_01770 34316 34546 gene locus_tag LOCUS_01780 34316 34546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 34683 36155 gene locus_tag LOCUS_01790 34683 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 36876 36115 gene locus_tag LOCUS_01800 36876 36115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 38895 36925 gene locus_tag LOCUS_01810 38895 36925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 40503 38974 gene locus_tag LOCUS_01820 40503 38974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 40599 41312 gene locus_tag LOCUS_01830 40599 41312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 41820 43004 gene locus_tag LOCUS_01840 41820 43004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 43175 43774 gene locus_tag LOCUS_01850 43175 43774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 43866 44480 gene locus_tag LOCUS_01860 43866 44480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 44568 46394 gene locus_tag LOCUS_01870 gene cshA 44568 46394 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_01870 46414 46812 gene locus_tag LOCUS_01880 46414 46812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701855.1 protein_id gnl|my_center|LOCUS_01880 46869 48134 gene locus_tag LOCUS_01890 46869 48134 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_01890 48224 49237 gene locus_tag LOCUS_01900 48224 49237 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_01900 50342 49248 gene locus_tag LOCUS_01910 50342 49248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 51699 50494 gene locus_tag LOCUS_01920 51699 50494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 52839 53561 gene locus_tag LOCUS_01930 52839 53561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 54619 55395 gene locus_tag LOCUS_01940 54619 55395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 56712 55444 gene locus_tag LOCUS_01950 56712 55444 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_01950 57591 56848 gene locus_tag LOCUS_01960 57591 56848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 57691 58491 gene locus_tag LOCUS_01970 57691 58491 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_01970 59492 58503 gene locus_tag LOCUS_01980 59492 58503 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_01980 60931 59489 gene locus_tag LOCUS_01990 60931 59489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence004 456 1895 gene locus_tag LOCUS_02000 456 1895 CDS product peptidase S13 (D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701272.1 protein_id gnl|my_center|LOCUS_02000 1902 2537 gene locus_tag LOCUS_02010 1902 2537 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_02010 2594 2941 gene locus_tag LOCUS_02020 2594 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2941 3159 gene locus_tag LOCUS_02030 2941 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3169 3405 gene locus_tag LOCUS_02040 3169 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3402 3599 gene locus_tag LOCUS_02050 3402 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3727 4590 gene locus_tag LOCUS_02060 3727 4590 CDS product tRNA(Ile)-lysidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_02060 4587 5378 gene locus_tag LOCUS_02070 4587 5378 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_02070 5620 5375 gene locus_tag LOCUS_02080 5620 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5839 7575 gene locus_tag LOCUS_02090 gene arc 5839 7575 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_02090 7592 9094 gene locus_tag LOCUS_02100 7592 9094 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_02100 9161 9355 gene locus_tag LOCUS_02110 9161 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9359 10168 gene locus_tag LOCUS_02120 gene prcB 9359 10168 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_02120 10165 10842 gene locus_tag LOCUS_02130 gene prcA 10165 10842 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ6 protein_id gnl|my_center|LOCUS_02130 10870 12228 gene locus_tag LOCUS_02140 gene pafA 10870 12228 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7M9 protein_id gnl|my_center|LOCUS_02140 12240 12896 gene locus_tag LOCUS_02150 12240 12896 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811571.1 protein_id gnl|my_center|LOCUS_02150 13628 12915 gene locus_tag LOCUS_02160 13628 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 13687 13989 gene locus_tag LOCUS_02170 13687 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 13986 14777 gene locus_tag LOCUS_02180 gene tatC 13986 14777 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAJ8 protein_id gnl|my_center|LOCUS_02180 14816 17413 gene locus_tag LOCUS_02190 14816 17413 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_02190 17728 18030 gene locus_tag LOCUS_02200 17728 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 18046 19242 gene locus_tag LOCUS_02210 18046 19242 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_02210 19295 20896 gene locus_tag LOCUS_02220 19295 20896 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_02220 21023 21538 gene locus_tag LOCUS_02230 21023 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 21579 22049 gene locus_tag LOCUS_02240 21579 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 22828 22043 gene locus_tag LOCUS_02250 22828 22043 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_02250 24363 22870 gene locus_tag LOCUS_02260 24363 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 24430 24948 gene locus_tag LOCUS_02270 24430 24948 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_02270 24953 25801 gene locus_tag LOCUS_02280 24953 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 26702 25815 gene locus_tag LOCUS_02290 gene rbsK 26702 25815 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPE4 protein_id gnl|my_center|LOCUS_02290 27092 26790 gene locus_tag LOCUS_02300 27092 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 28267 27206 gene locus_tag LOCUS_02310 gene ltaE 28267 27206 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_02310 28485 28721 gene locus_tag LOCUS_02320 28485 28721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 29196 28816 gene locus_tag LOCUS_02330 29196 28816 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVD8 protein_id gnl|my_center|LOCUS_02330 29644 29207 gene locus_tag LOCUS_02340 29644 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 29697 30944 gene locus_tag LOCUS_02350 29697 30944 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_02350 30969 32129 gene locus_tag LOCUS_02360 30969 32129 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701280.1 protein_id gnl|my_center|LOCUS_02360 32915 32139 gene locus_tag LOCUS_02370 32915 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731508.1 protein_id gnl|my_center|LOCUS_02370 33218 36073 gene locus_tag LOCUS_02380 gene gcvP 33218 36073 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK84 protein_id gnl|my_center|LOCUS_02380 36125 36574 gene locus_tag LOCUS_02390 36125 36574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 37623 36577 gene locus_tag LOCUS_02400 gene gcvT 37623 36577 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN51 protein_id gnl|my_center|LOCUS_02400 38090 37626 gene locus_tag LOCUS_02410 38090 37626 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729228.1 protein_id gnl|my_center|LOCUS_02410 38747 38205 gene locus_tag LOCUS_02420 38747 38205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_02420 39643 38753 gene locus_tag LOCUS_02430 39643 38753 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729229.1 protein_id gnl|my_center|LOCUS_02430 40125 39646 gene locus_tag LOCUS_02440 40125 39646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 40508 40131 gene locus_tag LOCUS_02450 gene gcvH 40508 40131 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH47 protein_id gnl|my_center|LOCUS_02450 41205 40573 gene locus_tag LOCUS_02460 gene pgsA 41205 40573 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_02460 41241 42053 gene locus_tag LOCUS_02470 gene fabG 41241 42053 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_02470 42053 42472 gene locus_tag LOCUS_02480 42053 42472 CDS product diadenosine tetraphosphate (Ap4A) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601801.1 protein_id gnl|my_center|LOCUS_02480 42635 42820 gene locus_tag LOCUS_02490 42635 42820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 43305 44510 gene locus_tag LOCUS_02500 43305 44510 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_02500 44512 45417 gene locus_tag LOCUS_02510 44512 45417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 45864 45400 gene locus_tag LOCUS_02520 45864 45400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705079.1 protein_id gnl|my_center|LOCUS_02520 46580 45861 gene locus_tag LOCUS_02530 46580 45861 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525192.1 protein_id gnl|my_center|LOCUS_02530 46725 47837 gene locus_tag LOCUS_02540 46725 47837 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1M7 protein_id gnl|my_center|LOCUS_02540 47860 48255 gene locus_tag LOCUS_02550 47860 48255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 48301 50271 gene locus_tag LOCUS_02560 gene tkt 48301 50271 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_02560 50275 51420 gene locus_tag LOCUS_02570 gene tal1 50275 51420 CDS product transaldolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88018 protein_id gnl|my_center|LOCUS_02570 51653 51417 gene locus_tag LOCUS_02580 51653 51417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 51754 52485 gene locus_tag LOCUS_02590 51754 52485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence005 255 857 gene locus_tag LOCUS_02600 255 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1442 876 gene locus_tag LOCUS_02610 1442 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1533 2126 gene locus_tag LOCUS_02620 1533 2126 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_02620 2159 2911 gene locus_tag LOCUS_02630 gene modA 2159 2911 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_02630 2908 3726 gene locus_tag LOCUS_02640 2908 3726 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_02640 3723 4778 gene locus_tag LOCUS_02650 3723 4778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_02650 4775 5302 gene locus_tag LOCUS_02660 4775 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6271 5303 gene locus_tag LOCUS_02670 6271 5303 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_02670 6313 7527 gene locus_tag LOCUS_02680 gene bcr 6313 7527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_02680 9314 7524 gene locus_tag LOCUS_02690 9314 7524 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_02690 9497 10180 gene locus_tag LOCUS_02700 9497 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10770 10246 gene locus_tag LOCUS_02710 10770 10246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_02710 11200 10763 gene locus_tag LOCUS_02720 11200 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11216 12142 gene locus_tag LOCUS_02730 11216 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_02730 12174 12521 gene locus_tag LOCUS_02740 12174 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 12537 13256 gene locus_tag LOCUS_02750 12537 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13324 14295 gene locus_tag LOCUS_02760 13324 14295 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_02760 14992 14297 gene locus_tag LOCUS_02770 14992 14297 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_02770 17292 15010 gene locus_tag LOCUS_02780 gene glnD 17292 15010 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV29 protein_id gnl|my_center|LOCUS_02780 18259 17321 gene locus_tag LOCUS_02790 18259 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 18772 18377 gene locus_tag LOCUS_02800 18772 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 18897 19586 gene locus_tag LOCUS_02810 18897 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 19636 20895 gene locus_tag LOCUS_02820 19636 20895 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903360.1 protein_id gnl|my_center|LOCUS_02820 21621 20908 gene locus_tag LOCUS_02830 21621 20908 CDS product putative heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAP7 protein_id gnl|my_center|LOCUS_02830 22480 21644 gene locus_tag LOCUS_02840 gene fdhD 22480 21644 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_02840 22726 23508 gene locus_tag LOCUS_02850 22726 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 24550 23624 gene locus_tag LOCUS_02860 24550 23624 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_02860 26192 24573 gene locus_tag LOCUS_02870 gene groL2 26192 24573 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_02870 26395 27849 gene locus_tag LOCUS_02880 26395 27849 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730801.1 protein_id gnl|my_center|LOCUS_02880 28133 27858 gene locus_tag LOCUS_02890 28133 27858 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_02890 28215 29228 gene locus_tag LOCUS_02900 28215 29228 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_02900 29831 29229 gene locus_tag LOCUS_02910 29831 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 30088 29828 gene locus_tag LOCUS_02920 30088 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 30194 30826 gene locus_tag LOCUS_02930 gene udk 30194 30826 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 protein_id gnl|my_center|LOCUS_02930 30908 30834 gene locus_tag LOCUS_t00030 30908 30834 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31994 30936 gene locus_tag LOCUS_02940 31994 30936 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804884.1 protein_id gnl|my_center|LOCUS_02940 32497 31994 gene locus_tag LOCUS_02950 gene ispF 32497 31994 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_02950 33148 32501 gene locus_tag LOCUS_02960 gene ispD 33148 32501 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Q8 protein_id gnl|my_center|LOCUS_02960 33266 33937 gene locus_tag LOCUS_02970 33266 33937 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401959.1 protein_id gnl|my_center|LOCUS_02970 34595 33942 gene locus_tag LOCUS_02980 34595 33942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 38077 34598 gene locus_tag LOCUS_02990 38077 34598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 38093 38899 gene locus_tag LOCUS_03000 38093 38899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 39351 38896 gene locus_tag LOCUS_03010 39351 38896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 39423 40691 gene locus_tag LOCUS_03020 gene selA 39423 40691 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_03020 40693 42402 gene locus_tag LOCUS_03030 gene selB 40693 42402 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_03030 <42954 42415 gene locus_tag LOCUS_03040 <42954 42415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479964.1:alkylated DNA repair protein >Feature sequence006 537 49 gene locus_tag LOCUS_03050 537 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 1249 602 gene locus_tag LOCUS_03060 1249 602 CDS product putative transcriptional regulator, IclR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704025.1 protein_id gnl|my_center|LOCUS_03060 1300 2733 gene locus_tag LOCUS_03070 gene leuC 1300 2733 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_03070 2730 3317 gene locus_tag LOCUS_03080 gene leuD 2730 3317 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM0 protein_id gnl|my_center|LOCUS_03080 4111 3356 gene locus_tag LOCUS_03090 4111 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950680.1 protein_id gnl|my_center|LOCUS_03090 5710 4388 gene locus_tag LOCUS_03100 5710 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 5772 7331 gene locus_tag LOCUS_03110 5772 7331 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_03110 8306 7338 gene locus_tag LOCUS_03120 gene fcl 8306 7338 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_03120 9579 8335 gene locus_tag LOCUS_03130 9579 8335 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_03130 10131 9754 gene locus_tag LOCUS_03140 gene trxC 10131 9754 CDS product putative thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RD25 protein_id gnl|my_center|LOCUS_03140 10375 10560 gene locus_tag LOCUS_03150 10375 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 10837 12555 gene locus_tag LOCUS_03160 gene leuA 10837 12555 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CB76 protein_id gnl|my_center|LOCUS_03160 12602 12793 gene locus_tag LOCUS_03170 12602 12793 CDS product 2(4Fe-4S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546194.1 protein_id gnl|my_center|LOCUS_03170 12803 13621 gene locus_tag LOCUS_03180 gene pyrF 12803 13621 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR1 protein_id gnl|my_center|LOCUS_03180 15168 13603 gene locus_tag LOCUS_03190 15168 13603 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z564 protein_id gnl|my_center|LOCUS_03190 15277 15981 gene locus_tag LOCUS_03200 15277 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_03200 15981 17123 gene locus_tag LOCUS_03210 gene menC 15981 17123 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2S6 protein_id gnl|my_center|LOCUS_03210 17145 17552 gene locus_tag LOCUS_03220 17145 17552 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_03220 18468 17590 gene locus_tag LOCUS_03230 18468 17590 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701133.1 protein_id gnl|my_center|LOCUS_03230 20474 18534 gene locus_tag LOCUS_03240 20474 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 20631 21077 gene locus_tag LOCUS_03250 20631 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 23145 21079 gene locus_tag LOCUS_03260 gene ligA 23145 21079 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_03260 24248 23214 gene locus_tag LOCUS_03270 24248 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_03270 24419 25258 gene locus_tag LOCUS_03280 24419 25258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26348 25263 gene locus_tag LOCUS_03290 gene mnmA 26348 25263 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFH2 protein_id gnl|my_center|LOCUS_03290 27497 26352 gene locus_tag LOCUS_03300 gene nifS-2 27497 26352 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_03300 27521 28258 gene locus_tag LOCUS_03310 27521 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533369.1 protein_id gnl|my_center|LOCUS_03310 28361 29290 gene locus_tag LOCUS_03320 28361 29290 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_03320 29301 29753 gene locus_tag LOCUS_03330 29301 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 30066 29767 gene locus_tag LOCUS_03340 30066 29767 CDS product branched-chain amino acid transport inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099347.1 protein_id gnl|my_center|LOCUS_03340 30770 30063 gene locus_tag LOCUS_03350 30770 30063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 31607 30807 gene locus_tag LOCUS_03360 31607 30807 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_03360 32664 31702 gene locus_tag LOCUS_03370 32664 31702 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_03370 32897 32661 gene locus_tag LOCUS_03380 32897 32661 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_03380 32998 33192 gene locus_tag LOCUS_03390 32998 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 34407 33121 gene locus_tag LOCUS_03400 gene murA 34407 33121 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1Z6 protein_id gnl|my_center|LOCUS_03400 34817 36013 gene locus_tag LOCUS_03410 34817 36013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031662.1 protein_id gnl|my_center|LOCUS_03410 36719 36027 gene locus_tag LOCUS_03420 36719 36027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 37190 36726 gene locus_tag LOCUS_03430 37190 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence007 1246 56 gene locus_tag LOCUS_03440 1246 56 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_03440 2621 1263 gene locus_tag LOCUS_03450 2621 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2672 5260 gene locus_tag LOCUS_03460 gene valS 2672 5260 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1M5 protein_id gnl|my_center|LOCUS_03460 5300 6646 gene locus_tag LOCUS_03470 5300 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7512 6643 gene locus_tag LOCUS_03480 7512 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8483 7566 gene locus_tag LOCUS_03490 8483 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9669 8509 gene locus_tag LOCUS_03500 9669 8509 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897267.1 protein_id gnl|my_center|LOCUS_03500 10872 9760 gene locus_tag LOCUS_03510 10872 9760 CDS product putative zinc-type alcohol dehydrogenase AdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702819.1 protein_id gnl|my_center|LOCUS_03510 10962 11105 gene locus_tag LOCUS_03520 10962 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11137 11415 gene locus_tag LOCUS_03530 11137 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11393 12523 gene locus_tag LOCUS_03540 11393 12523 CDS product putative coenzyme PQQ synthesis protein E PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704563.1 protein_id gnl|my_center|LOCUS_03540 13763 12486 gene locus_tag LOCUS_03550 13763 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13893 15734 gene locus_tag LOCUS_03560 13893 15734 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_03560 17649 15751 gene locus_tag LOCUS_03570 17649 15751 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532710.1 protein_id gnl|my_center|LOCUS_03570 18542 17649 gene locus_tag LOCUS_03580 gene cysD 18542 17649 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 protein_id gnl|my_center|LOCUS_03580 20001 18592 gene locus_tag LOCUS_03590 20001 18592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 20081 20668 gene locus_tag LOCUS_03600 gene plsY 20081 20668 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G9 protein_id gnl|my_center|LOCUS_03600 20744 21388 gene locus_tag LOCUS_03610 20744 21388 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_03610 21398 21946 gene locus_tag LOCUS_03620 21398 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_03620 21965 22657 gene locus_tag LOCUS_03630 21965 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014087.1 protein_id gnl|my_center|LOCUS_03630 22675 23694 gene locus_tag LOCUS_03640 22675 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 24669 23707 gene locus_tag LOCUS_03650 24669 23707 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_03650 25560 24742 gene locus_tag LOCUS_03660 gene fixA 25560 24742 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_03660 25656 26630 gene locus_tag LOCUS_03670 25656 26630 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_03670 27249 26635 gene locus_tag LOCUS_03680 gene glpQ 27249 26635 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_03680 27528 27845 gene locus_tag LOCUS_03690 27528 27845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 29328 27847 gene locus_tag LOCUS_03700 29328 27847 CDS product putative two component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704270.1 protein_id gnl|my_center|LOCUS_03700 29620 29390 gene locus_tag LOCUS_03710 29620 29390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_03710 30457 29705 gene locus_tag LOCUS_03720 30457 29705 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434123.1 protein_id gnl|my_center|LOCUS_03720 30512 31657 gene locus_tag LOCUS_03730 gene mrp 30512 31657 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_03730 32272 31661 gene locus_tag LOCUS_03740 32272 31661 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_03740 32347 32835 gene locus_tag LOCUS_03750 32347 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 33590 32844 gene locus_tag LOCUS_03760 33590 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 34071 33592 gene locus_tag LOCUS_03770 34071 33592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 34634 34071 gene locus_tag LOCUS_03780 34634 34071 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_03780 36606 34627 gene locus_tag LOCUS_03790 36606 34627 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_03790 37112 36594 gene locus_tag LOCUS_03800 37112 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence008 326 826 gene locus_tag LOCUS_03810 326 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1173 832 gene locus_tag LOCUS_03820 1173 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1797 2579 gene locus_tag LOCUS_03830 1797 2579 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_03830 2619 3425 gene locus_tag LOCUS_03840 2619 3425 CDS product inositol phosphorylceramide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_03840 3422 3829 gene locus_tag LOCUS_03850 3422 3829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971791.1 protein_id gnl|my_center|LOCUS_03850 4554 3835 gene locus_tag LOCUS_03860 4554 3835 CDS product putative MutT/NUDIX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704937.1 protein_id gnl|my_center|LOCUS_03860 5721 4561 gene locus_tag LOCUS_03870 5721 4561 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DES2 protein_id gnl|my_center|LOCUS_03870 6189 5746 gene locus_tag LOCUS_03880 6189 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6340 6855 gene locus_tag LOCUS_03890 gene dcd 6340 6855 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJL3 protein_id gnl|my_center|LOCUS_03890 6880 7968 gene locus_tag LOCUS_03900 6880 7968 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_03900 7965 8585 gene locus_tag LOCUS_03910 7965 8585 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_03910 8634 10577 gene locus_tag LOCUS_03920 8634 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 10600 11184 gene locus_tag LOCUS_03930 gene engB 10600 11184 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 protein_id gnl|my_center|LOCUS_03930 11309 12205 gene locus_tag LOCUS_03940 11309 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420405.1 protein_id gnl|my_center|LOCUS_03940 14428 12248 gene locus_tag LOCUS_03950 14428 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_03950 14984 14559 gene locus_tag LOCUS_03960 14984 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15845 15099 gene locus_tag LOCUS_03970 gene gpm 15845 15099 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVH8 protein_id gnl|my_center|LOCUS_03970 15911 17215 gene locus_tag LOCUS_03980 gene xseA 15911 17215 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_03980 17234 17443 gene locus_tag LOCUS_03990 17234 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 17464 18525 gene locus_tag LOCUS_04000 17464 18525 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_04000 18618 18941 gene locus_tag LOCUS_04010 18618 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 19069 19719 gene locus_tag LOCUS_04020 19069 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21687 19723 gene locus_tag LOCUS_04030 21687 19723 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_04030 22408 21680 gene locus_tag LOCUS_04040 gene aat 22408 21680 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFR8 protein_id gnl|my_center|LOCUS_04040 23258 22410 gene locus_tag LOCUS_04050 23258 22410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 23368 24159 gene locus_tag LOCUS_04060 23368 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 24198 24824 gene locus_tag LOCUS_04070 24198 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 25358 24825 gene locus_tag LOCUS_04080 25358 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 26893 25355 gene locus_tag LOCUS_04090 gene pstS 26893 25355 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227472.1 protein_id gnl|my_center|LOCUS_04090 27744 26893 gene locus_tag LOCUS_04100 gene pstB 27744 26893 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9T3 protein_id gnl|my_center|LOCUS_04100 28877 27741 gene locus_tag LOCUS_04110 gene pstA 28877 27741 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8U7 protein_id gnl|my_center|LOCUS_04110 29898 28879 gene locus_tag LOCUS_04120 gene pstC 29898 28879 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9U3 protein_id gnl|my_center|LOCUS_04120 30024 32012 gene locus_tag LOCUS_04130 30024 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 32009 32851 gene locus_tag LOCUS_04140 32009 32851 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227465.1 protein_id gnl|my_center|LOCUS_04140 32969 34582 gene locus_tag LOCUS_04150 32969 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence009 1311 1859 gene locus_tag LOCUS_04160 1311 1859 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_04160 1867 3324 gene locus_tag LOCUS_04170 gene pepA 1867 3324 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD11 protein_id gnl|my_center|LOCUS_04170 3811 3299 gene locus_tag LOCUS_04180 3811 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3897 4694 gene locus_tag LOCUS_04190 3897 4694 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227733.1 protein_id gnl|my_center|LOCUS_04190 4712 5878 gene locus_tag LOCUS_04200 4712 5878 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_04200 6842 5880 gene locus_tag LOCUS_04210 6842 5880 CDS product conserved hypthetical membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704126.1 protein_id gnl|my_center|LOCUS_04210 7588 6779 gene locus_tag LOCUS_04220 7588 6779 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_04220 7683 9257 gene locus_tag LOCUS_04230 7683 9257 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_04230 9829 9263 gene locus_tag LOCUS_04240 9829 9263 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_04240 10293 9826 gene locus_tag LOCUS_04250 10293 9826 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227819.1 protein_id gnl|my_center|LOCUS_04250 10365 10904 gene locus_tag LOCUS_04260 10365 10904 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_04260 11366 10920 gene locus_tag LOCUS_04270 11366 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703192.1 protein_id gnl|my_center|LOCUS_04270 12641 11391 gene locus_tag LOCUS_04280 12641 11391 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_04280 13576 12665 gene locus_tag LOCUS_04290 13576 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 15493 13652 gene locus_tag LOCUS_04300 gene kup1 15493 13652 CDS product putative potassium transport system protein kup 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AK4 protein_id gnl|my_center|LOCUS_04300 15679 16107 gene locus_tag LOCUS_04310 15679 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 16215 17615 gene locus_tag LOCUS_04320 16215 17615 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818T2 protein_id gnl|my_center|LOCUS_04320 17644 18999 gene locus_tag LOCUS_04330 gene bfmBB 17644 18999 CDS product lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37942 protein_id gnl|my_center|LOCUS_04330 19003 20649 gene locus_tag LOCUS_04340 19003 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 20646 21788 gene locus_tag LOCUS_04350 20646 21788 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_04350 22632 21814 gene locus_tag LOCUS_04360 22632 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04360 22966 22649 gene locus_tag LOCUS_04370 22966 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04370 24151 23015 gene locus_tag LOCUS_04380 24151 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_04380 25089 24163 gene locus_tag LOCUS_04390 25089 24163 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_04390 25216 26949 gene locus_tag LOCUS_04400 25216 26949 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_04400 27486 26935 gene locus_tag LOCUS_04410 27486 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 28173 27496 gene locus_tag LOCUS_04420 gene folE 28173 27496 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R587 protein_id gnl|my_center|LOCUS_04420 28873 28136 gene locus_tag LOCUS_04430 28873 28136 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_04430 29643 28870 gene locus_tag LOCUS_04440 gene fabG 29643 28870 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_04440 30832 29660 gene locus_tag LOCUS_04450 30832 29660 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_04450 30941 32212 gene locus_tag LOCUS_04460 30941 32212 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_04460 32287 33099 gene locus_tag LOCUS_04470 32287 33099 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence010 1 918 gene locus_tag LOCUS_04480 1 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 911 2857 gene locus_tag LOCUS_04490 911 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3717 2884 gene locus_tag LOCUS_04500 3717 2884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 protein_id gnl|my_center|LOCUS_04500 4022 3723 gene locus_tag LOCUS_04510 4022 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4090 4971 gene locus_tag LOCUS_04520 gene murI 4090 4971 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1X0 protein_id gnl|my_center|LOCUS_04520 4968 5735 gene locus_tag LOCUS_04530 gene rph 4968 5735 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_04530 5732 6370 gene locus_tag LOCUS_04540 gene rdgB 5732 6370 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_04540 7464 6376 gene locus_tag LOCUS_04550 7464 6376 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_04550 7559 7477 gene locus_tag LOCUS_t00040 7559 7477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7612 7902 gene locus_tag LOCUS_04560 7612 7902 CDS product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967217.1 protein_id gnl|my_center|LOCUS_04560 7990 9510 gene locus_tag LOCUS_04570 7990 9510 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_04570 9550 10794 gene locus_tag LOCUS_04580 9550 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10861 11460 gene locus_tag LOCUS_04590 gene clpP2 10861 11460 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN01 protein_id gnl|my_center|LOCUS_04590 11921 11478 gene locus_tag LOCUS_04600 11921 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12039 13613 gene locus_tag LOCUS_04610 12039 13613 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_04610 13619 14809 gene locus_tag LOCUS_04620 13619 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14882 15778 gene locus_tag LOCUS_04630 gene xerC 14882 15778 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZL6 protein_id gnl|my_center|LOCUS_04630 15809 16585 gene locus_tag LOCUS_04640 gene whiG 15809 16585 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17211 protein_id gnl|my_center|LOCUS_04640 16758 16561 gene locus_tag LOCUS_04650 16758 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 17268 18125 gene locus_tag LOCUS_04660 gene rpsB 17268 18125 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDF2 protein_id gnl|my_center|LOCUS_04660 18129 18917 gene locus_tag LOCUS_04670 gene tsf 18129 18917 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31213 protein_id gnl|my_center|LOCUS_04670 18924 19679 gene locus_tag LOCUS_04680 gene pyrH 18924 19679 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_04680 19676 20233 gene locus_tag LOCUS_04690 gene frr 19676 20233 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33046 protein_id gnl|my_center|LOCUS_04690 20246 21700 gene locus_tag LOCUS_04700 gene cdsA 20246 21700 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0E1 protein_id gnl|my_center|LOCUS_04700 21709 22881 gene locus_tag LOCUS_04710 gene dxr 21709 22881 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV9 protein_id gnl|my_center|LOCUS_04710 22878 24131 gene locus_tag LOCUS_04720 gene rip1 22878 24131 CDS product zinc metalloprotease Rip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBU4 protein_id gnl|my_center|LOCUS_04720 24215 25393 gene locus_tag LOCUS_04730 gene ispG 24215 25393 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_04730 26536 25400 gene locus_tag LOCUS_04740 26536 25400 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_04740 28347 26548 gene locus_tag LOCUS_04750 gene proS 28347 26548 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBA2 protein_id gnl|my_center|LOCUS_04750 28540 29256 gene locus_tag LOCUS_04760 28540 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 29253 30446 gene locus_tag LOCUS_04770 gene nusA 29253 30446 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_04770 30797 33598 gene locus_tag LOCUS_04780 30797 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence011 1786 704 gene locus_tag LOCUS_04790 gene recF 1786 704 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36176 protein_id gnl|my_center|LOCUS_04790 2884 1793 gene locus_tag LOCUS_04800 2884 1793 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_04800 3140 2868 gene locus_tag LOCUS_04810 3140 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4545 3145 gene locus_tag LOCUS_04820 4545 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 5116 5358 gene locus_tag LOCUS_04830 5116 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5643 6635 gene locus_tag LOCUS_04840 5643 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 6686 7513 gene locus_tag LOCUS_04850 6686 7513 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303986.1 protein_id gnl|my_center|LOCUS_04850 7538 8104 gene locus_tag LOCUS_04860 7538 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8267 9079 gene locus_tag LOCUS_04870 gene parA 8267 9079 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04870 9054 9983 gene locus_tag LOCUS_04880 9054 9983 CDS product putative chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705671.1 protein_id gnl|my_center|LOCUS_04880 11050 10100 gene locus_tag LOCUS_04890 11050 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 11379 11050 gene locus_tag LOCUS_04900 11379 11050 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW4 protein_id gnl|my_center|LOCUS_04900 12375 11431 gene locus_tag LOCUS_04910 gene trxB 12375 11431 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_04910 12720 12376 gene locus_tag LOCUS_04920 12720 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 13485 12730 gene locus_tag LOCUS_04930 13485 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 14024 13482 gene locus_tag LOCUS_04940 14024 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 15574 14036 gene locus_tag LOCUS_04950 15574 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 16601 15750 gene locus_tag LOCUS_04960 16601 15750 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDL7 protein_id gnl|my_center|LOCUS_04960 18594 16648 gene locus_tag LOCUS_04970 18594 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 19253 18657 gene locus_tag LOCUS_04980 19253 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 19467 20486 gene locus_tag LOCUS_04990 19467 20486 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_04990 21897 20506 gene locus_tag LOCUS_05000 21897 20506 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_05000 22013 23425 gene locus_tag LOCUS_05010 22013 23425 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_05010 23462 23893 gene locus_tag LOCUS_05020 23462 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 23897 24520 gene locus_tag LOCUS_05030 23897 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 24689 25015 gene locus_tag LOCUS_05040 gene rpsF 24689 25015 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLF9 protein_id gnl|my_center|LOCUS_05040 25061 25528 gene locus_tag LOCUS_05050 gene ssb 25061 25528 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJE6 protein_id gnl|my_center|LOCUS_05050 25594 26025 gene locus_tag LOCUS_05060 25594 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 26028 26477 gene locus_tag LOCUS_05070 gene rplI 26028 26477 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DL87 protein_id gnl|my_center|LOCUS_05070 26731 28104 gene locus_tag LOCUS_05080 gene dnaC 26731 28104 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37469 protein_id gnl|my_center|LOCUS_05080 28672 28118 gene locus_tag LOCUS_05090 28672 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 28767 28979 gene locus_tag LOCUS_05100 28767 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 28991 29587 gene locus_tag LOCUS_05110 28991 29587 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_05110 30340 29588 gene locus_tag LOCUS_05120 30340 29588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 31286 30360 gene locus_tag LOCUS_05130 gene coaA 31286 30360 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB3 protein_id gnl|my_center|LOCUS_05130 32318 31326 gene locus_tag LOCUS_05140 gene map 32318 31326 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVI6 protein_id gnl|my_center|LOCUS_05140 32489 33121 gene locus_tag LOCUS_05150 32489 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence012 1235 177 gene locus_tag LOCUS_05160 gene tsaD 1235 177 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KL6 protein_id gnl|my_center|LOCUS_05160 1774 1232 gene locus_tag LOCUS_05170 1774 1232 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ2 protein_id gnl|my_center|LOCUS_05170 2484 1771 gene locus_tag LOCUS_05180 2484 1771 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_05180 2976 2488 gene locus_tag LOCUS_05190 2976 2488 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_05190 3110 4009 gene locus_tag LOCUS_05200 3110 4009 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_05200 5156 4035 gene locus_tag LOCUS_05210 5156 4035 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81EB9 protein_id gnl|my_center|LOCUS_05210 6556 5153 gene locus_tag LOCUS_05220 6556 5153 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSR4 protein_id gnl|my_center|LOCUS_05220 6965 6564 gene locus_tag LOCUS_05230 gene acpS 6965 6564 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86785 protein_id gnl|my_center|LOCUS_05230 10395 6985 gene locus_tag LOCUS_05240 10395 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 11827 10433 gene locus_tag LOCUS_05250 gene glmM 11827 10433 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW62 protein_id gnl|my_center|LOCUS_05250 12232 11840 gene locus_tag LOCUS_05260 12232 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12702 12256 gene locus_tag LOCUS_05270 gene rplM 12702 12256 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ33 protein_id gnl|my_center|LOCUS_05270 13597 12794 gene locus_tag LOCUS_05280 gene truA 13597 12794 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70973 protein_id gnl|my_center|LOCUS_05280 13934 13626 gene locus_tag LOCUS_05290 13934 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05290 14967 14029 gene locus_tag LOCUS_05300 gene rpoA 14967 14029 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG99 protein_id gnl|my_center|LOCUS_05300 15615 14998 gene locus_tag LOCUS_05310 gene rpsD 15615 14998 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSV4 protein_id gnl|my_center|LOCUS_05310 16017 15619 gene locus_tag LOCUS_05320 gene rpsK 16017 15619 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7H9 protein_id gnl|my_center|LOCUS_05320 16400 16023 gene locus_tag LOCUS_05330 gene rpsM 16400 16023 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_05330 16768 16571 gene locus_tag LOCUS_05340 gene infA 16768 16571 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_05340 17702 17037 gene locus_tag LOCUS_05350 gene adk 17702 17037 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR8 protein_id gnl|my_center|LOCUS_05350 18997 17741 gene locus_tag LOCUS_05360 gene secY 18997 17741 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46785 protein_id gnl|my_center|LOCUS_05360 19603 19112 gene locus_tag LOCUS_05370 gene rplO 19603 19112 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD6 protein_id gnl|my_center|LOCUS_05370 19834 19607 gene locus_tag LOCUS_05380 19834 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 20481 19837 gene locus_tag LOCUS_05390 gene rpsE 20481 19837 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_05390 20846 20481 gene locus_tag LOCUS_05400 20846 20481 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459106.1 protein_id gnl|my_center|LOCUS_05400 21420 20878 gene locus_tag LOCUS_05410 gene rplF 21420 20878 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH81 protein_id gnl|my_center|LOCUS_05410 21834 21433 gene locus_tag LOCUS_05420 gene rpsH 21834 21433 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSX8 protein_id gnl|my_center|LOCUS_05420 22027 21842 gene locus_tag LOCUS_05430 gene rpsZ 22027 21842 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32996 protein_id gnl|my_center|LOCUS_05430 22671 22045 gene locus_tag LOCUS_05440 gene rplE 22671 22045 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSZ2 protein_id gnl|my_center|LOCUS_05440 22973 22668 gene locus_tag LOCUS_05450 gene rplX 22973 22668 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J95 protein_id gnl|my_center|LOCUS_05450 23343 22975 gene locus_tag LOCUS_05460 gene rplN 23343 22975 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV29 protein_id gnl|my_center|LOCUS_05460 23653 23369 gene locus_tag LOCUS_05470 gene rpsQ 23653 23369 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_05470 23877 23650 gene locus_tag LOCUS_05480 gene rpmC 23877 23650 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12873 protein_id gnl|my_center|LOCUS_05480 24296 23880 gene locus_tag LOCUS_05490 gene rplP 24296 23880 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE3 protein_id gnl|my_center|LOCUS_05490 25187 24303 gene locus_tag LOCUS_05500 gene rpsC 25187 24303 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0D4 protein_id gnl|my_center|LOCUS_05500 25825 25187 gene locus_tag LOCUS_05510 25825 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 26109 25825 gene locus_tag LOCUS_05520 gene rpsS 26109 25825 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY4 protein_id gnl|my_center|LOCUS_05520 26962 26126 gene locus_tag LOCUS_05530 gene rplB 26962 26126 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE7 protein_id gnl|my_center|LOCUS_05530 27267 26974 gene locus_tag LOCUS_05540 gene rplW 27267 26974 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE8 protein_id gnl|my_center|LOCUS_05540 27890 27267 gene locus_tag LOCUS_05550 gene rplD 27890 27267 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW20 protein_id gnl|my_center|LOCUS_05550 28533 27895 gene locus_tag LOCUS_05560 gene rplC 28533 27895 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0E0 protein_id gnl|my_center|LOCUS_05560 29340 28951 gene locus_tag LOCUS_05570 29340 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 30616 29423 gene locus_tag LOCUS_05580 30616 29423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705059.1 protein_id gnl|my_center|LOCUS_05580 31788 30655 gene locus_tag LOCUS_05590 31788 30655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 32226 31912 gene locus_tag LOCUS_05600 gene rpsJ 32226 31912 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66337 protein_id gnl|my_center|LOCUS_05600 >Feature sequence013 1744 2790 gene locus_tag LOCUS_05610 1744 2790 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_05610 4640 2817 gene locus_tag LOCUS_05620 4640 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5869 4646 gene locus_tag LOCUS_05630 5869 4646 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_05630 6699 5866 gene locus_tag LOCUS_05640 6699 5866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_05640 7777 6701 gene locus_tag LOCUS_05650 7777 6701 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_05650 8746 7781 gene locus_tag LOCUS_05660 8746 7781 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_05660 9518 8748 gene locus_tag LOCUS_05670 gene pcaD 9518 8748 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_05670 11463 9553 gene locus_tag LOCUS_05680 11463 9553 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_05680 11561 12634 gene locus_tag LOCUS_05690 11561 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14947 12641 gene locus_tag LOCUS_05700 14947 12641 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_05700 15011 15706 gene locus_tag LOCUS_05710 15011 15706 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_05710 15723 16871 gene locus_tag LOCUS_05720 15723 16871 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_05720 16868 17872 gene locus_tag LOCUS_05730 16868 17872 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142694.1 protein_id gnl|my_center|LOCUS_05730 17921 18547 gene locus_tag LOCUS_05740 17921 18547 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_05740 18652 18566 gene locus_tag LOCUS_t00050 18652 18566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18954 18715 gene locus_tag LOCUS_05750 18954 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 19955 18975 gene locus_tag LOCUS_05760 19955 18975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_05760 20970 19948 gene locus_tag LOCUS_05770 20970 19948 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_05770 21959 20967 gene locus_tag LOCUS_05780 gene oppB 21959 20967 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004124746.1 protein_id gnl|my_center|LOCUS_05780 23794 22046 gene locus_tag LOCUS_05790 23794 22046 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_05790 24860 23865 gene locus_tag LOCUS_05800 24860 23865 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_05800 25657 24869 gene locus_tag LOCUS_05810 gene tpiA 25657 24869 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC85 protein_id gnl|my_center|LOCUS_05810 26768 25647 gene locus_tag LOCUS_05820 26768 25647 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462175.1 protein_id gnl|my_center|LOCUS_05820 27802 26777 gene locus_tag LOCUS_05830 gene gapA 27802 26777 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_05830 28720 27875 gene locus_tag LOCUS_05840 28720 27875 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_05840 29526 28741 gene locus_tag LOCUS_05850 29526 28741 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_05850 30265 29516 gene locus_tag LOCUS_05860 30265 29516 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_05860 30434 31234 gene locus_tag LOCUS_05870 30434 31234 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_05870 <31917 31231 gene locus_tag LOCUS_05880 <31917 31231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WFC5:UvrABC system protein C >Feature sequence014 715 263 gene locus_tag LOCUS_05890 715 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2025 712 gene locus_tag LOCUS_05900 2025 712 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_05900 2480 2022 gene locus_tag LOCUS_05910 gene rppH 2480 2022 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 protein_id gnl|my_center|LOCUS_05910 4254 2482 gene locus_tag LOCUS_05920 gene aspS 4254 2482 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_05920 5477 4251 gene locus_tag LOCUS_05930 gene hisS 5477 4251 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XK9 protein_id gnl|my_center|LOCUS_05930 7772 5583 gene locus_tag LOCUS_05940 gene relA 7772 5583 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52560 protein_id gnl|my_center|LOCUS_05940 8377 7856 gene locus_tag LOCUS_05950 gene apt 8377 7856 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1A4 protein_id gnl|my_center|LOCUS_05950 9539 8394 gene locus_tag LOCUS_05960 gene secF 9539 8394 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_05960 11203 9539 gene locus_tag LOCUS_05970 gene secD 11203 9539 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBS7 protein_id gnl|my_center|LOCUS_05970 11574 11200 gene locus_tag LOCUS_05980 11574 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 12788 11673 gene locus_tag LOCUS_05990 gene tgt-2 12788 11673 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_05990 13822 12788 gene locus_tag LOCUS_06000 gene queA 13822 12788 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHU2 protein_id gnl|my_center|LOCUS_06000 14854 13832 gene locus_tag LOCUS_06010 gene ruvB 14854 13832 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_06010 15440 14844 gene locus_tag LOCUS_06020 gene ruvA 15440 14844 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW00 protein_id gnl|my_center|LOCUS_06020 16026 15442 gene locus_tag LOCUS_06030 gene ruvC 16026 15442 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_06030 16350 18005 gene locus_tag LOCUS_06040 16350 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 18757 18011 gene locus_tag LOCUS_06050 18757 18011 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_06050 19366 18761 gene locus_tag LOCUS_06060 gene pdxT 19366 18761 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_06060 20288 19392 gene locus_tag LOCUS_06070 gene pdxS 20288 19392 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8V6 protein_id gnl|my_center|LOCUS_06070 21422 20340 gene locus_tag LOCUS_06080 21422 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_06080 22324 21419 gene locus_tag LOCUS_06090 gene htpX 22324 21419 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPH5 protein_id gnl|my_center|LOCUS_06090 22882 22331 gene locus_tag LOCUS_06100 22882 22331 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_06100 24138 22924 gene locus_tag LOCUS_06110 24138 22924 CDS product GDP-mannose-dependent alpha-(1-2)-phosphatidylinositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_06110 24196 25095 gene locus_tag LOCUS_06120 24196 25095 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_06120 26288 25101 gene locus_tag LOCUS_06130 26288 25101 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_06130 26992 26285 gene locus_tag LOCUS_06140 gene macB 26992 26285 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N80 protein_id gnl|my_center|LOCUS_06140 29139 27001 gene locus_tag LOCUS_06150 29139 27001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 29808 29140 gene locus_tag LOCUS_06160 29808 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 <30663 29848 gene locus_tag LOCUS_06170 <30663 29848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227145.1:lipid A biosynthesis lauroyl acyltransferase >Feature sequence015 1087 290 gene locus_tag LOCUS_06180 gene htrB 1087 290 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_06180 1948 1259 gene locus_tag LOCUS_06190 1948 1259 CDS product putative phosphatidylinositol synthase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703629.1 protein_id gnl|my_center|LOCUS_06190 2514 1984 gene locus_tag LOCUS_06200 2514 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3060 2539 gene locus_tag LOCUS_06210 3060 2539 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_06210 5036 3069 gene locus_tag LOCUS_06220 gene thrS 5036 3069 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_06220 6225 5098 gene locus_tag LOCUS_06230 gene mshC 6225 5098 CDS product L-cysteine:1D-myo-inositol 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADA4 protein_id gnl|my_center|LOCUS_06230 6928 6239 gene locus_tag LOCUS_06240 6928 6239 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_06240 7022 7789 gene locus_tag LOCUS_06250 7022 7789 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_06250 9001 7793 gene locus_tag LOCUS_06260 gene ltp1 9001 7793 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_06260 9444 9052 gene locus_tag LOCUS_06270 9444 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10161 9505 gene locus_tag LOCUS_06280 10161 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 10834 10148 gene locus_tag LOCUS_06290 10834 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14430 10915 gene locus_tag LOCUS_06300 gene dnaE1 14430 10915 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT7 protein_id gnl|my_center|LOCUS_06300 15024 14512 gene locus_tag LOCUS_06310 15024 14512 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_06310 16206 15073 gene locus_tag LOCUS_06320 16206 15073 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_06320 16263 16787 gene locus_tag LOCUS_06330 16263 16787 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888831.1 protein_id gnl|my_center|LOCUS_06330 17200 16784 gene locus_tag LOCUS_06340 gene nusB 17200 16784 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIV1 protein_id gnl|my_center|LOCUS_06340 17769 17206 gene locus_tag LOCUS_06350 gene efp 17769 17206 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ9 protein_id gnl|my_center|LOCUS_06350 18860 17742 gene locus_tag LOCUS_06360 18860 17742 CDS product X-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_06360 19303 18869 gene locus_tag LOCUS_06370 gene aroQ 19303 18869 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI90 protein_id gnl|my_center|LOCUS_06370 20401 19382 gene locus_tag LOCUS_06380 gene rifG 20401 19382 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_06380 20949 20398 gene locus_tag LOCUS_06390 gene aroK 20949 20398 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_06390 22118 20946 gene locus_tag LOCUS_06400 gene aroC 22118 20946 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ4 protein_id gnl|my_center|LOCUS_06400 23007 22141 gene locus_tag LOCUS_06410 gene aroE 23007 22141 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_06410 24169 23009 gene locus_tag LOCUS_06420 24169 23009 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 protein_id gnl|my_center|LOCUS_06420 24584 24162 gene locus_tag LOCUS_06430 24584 24162 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ7 protein_id gnl|my_center|LOCUS_06430 27190 24584 gene locus_tag LOCUS_06440 gene alaS 27190 24584 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ3 protein_id gnl|my_center|LOCUS_06440 27253 28059 gene locus_tag LOCUS_06450 27253 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8H2 protein_id gnl|my_center|LOCUS_06450 29914 28067 gene locus_tag LOCUS_06460 29914 28067 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_06460 30120 29920 gene locus_tag LOCUS_06470 30120 29920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 30151 30405 gene locus_tag LOCUS_06480 30151 30405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence016 1533 3230 gene locus_tag LOCUS_06490 1533 3230 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225796.1 protein_id gnl|my_center|LOCUS_06490 4208 3237 gene locus_tag LOCUS_06500 4208 3237 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_06500 4279 5061 gene locus_tag LOCUS_06510 4279 5061 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_06510 5073 5627 gene locus_tag LOCUS_06520 5073 5627 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225670.1 protein_id gnl|my_center|LOCUS_06520 7274 5613 gene locus_tag LOCUS_06530 7274 5613 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704356.1 protein_id gnl|my_center|LOCUS_06530 8500 7271 gene locus_tag LOCUS_06540 8500 7271 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_06540 9399 8497 gene locus_tag LOCUS_06550 9399 8497 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730379.1 protein_id gnl|my_center|LOCUS_06550 9510 10400 gene locus_tag LOCUS_06560 9510 10400 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225710.1 protein_id gnl|my_center|LOCUS_06560 11070 10402 gene locus_tag LOCUS_06570 gene upp 11070 10402 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXP1 protein_id gnl|my_center|LOCUS_06570 12161 11070 gene locus_tag LOCUS_06580 gene add1 12161 11070 CDS product adenosine deaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK25 protein_id gnl|my_center|LOCUS_06580 13033 12158 gene locus_tag LOCUS_06590 gene legD1 13033 12158 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_06590 13106 13537 gene locus_tag LOCUS_06600 13106 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 14800 13544 gene locus_tag LOCUS_06610 14800 13544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_06610 15882 14797 gene locus_tag LOCUS_06620 15882 14797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_06620 17435 15879 gene locus_tag LOCUS_06630 17435 15879 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_06630 18553 17522 gene locus_tag LOCUS_06640 gene bmpA 18553 17522 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_06640 19453 18653 gene locus_tag LOCUS_06650 19453 18653 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703855.1 protein_id gnl|my_center|LOCUS_06650 20076 19465 gene locus_tag LOCUS_06660 20076 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 20802 20113 gene locus_tag LOCUS_06670 20802 20113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_06670 20861 21628 gene locus_tag LOCUS_06680 gene paaG 20861 21628 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_06680 21712 22032 gene locus_tag LOCUS_06690 21712 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 22681 22043 gene locus_tag LOCUS_06700 22681 22043 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_06700 23607 22678 gene locus_tag LOCUS_06710 gene ppx 23607 22678 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_06710 24068 23604 gene locus_tag LOCUS_06720 24068 23604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_06720 24748 24065 gene locus_tag LOCUS_06730 24748 24065 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_06730 25344 24739 gene locus_tag LOCUS_06740 25344 24739 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974724.1 protein_id gnl|my_center|LOCUS_06740 25481 26209 gene locus_tag LOCUS_06750 25481 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 26886 26230 gene locus_tag LOCUS_06760 26886 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 26959 27738 gene locus_tag LOCUS_06770 26959 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 28997 27798 gene locus_tag LOCUS_06780 28997 27798 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_06780 29103 30239 gene locus_tag LOCUS_06790 29103 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence017 3 1097 gene locus_tag LOCUS_06800 3 1097 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_06800 1135 2124 gene locus_tag LOCUS_06810 1135 2124 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_06810 3499 2126 gene locus_tag LOCUS_06820 3499 2126 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_06820 3644 3568 gene locus_tag LOCUS_t00060 3644 3568 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4785 3703 gene locus_tag LOCUS_06830 4785 3703 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028426.1 protein_id gnl|my_center|LOCUS_06830 5312 4785 gene locus_tag LOCUS_06840 5312 4785 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_06840 6000 5305 gene locus_tag LOCUS_06850 6000 5305 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD9 protein_id gnl|my_center|LOCUS_06850 7115 5997 gene locus_tag LOCUS_06860 gene dnaJ 7115 5997 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_06860 8134 7139 gene locus_tag LOCUS_06870 gene hrcA 8134 7139 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX6 protein_id gnl|my_center|LOCUS_06870 9592 8222 gene locus_tag LOCUS_06880 gene phrB 9592 8222 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_06880 10903 9602 gene locus_tag LOCUS_06890 gene hisD 10903 9602 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_06890 12678 11005 gene locus_tag LOCUS_06900 gene lepA 12678 11005 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0Y9 protein_id gnl|my_center|LOCUS_06900 12739 12915 gene locus_tag LOCUS_06910 12739 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 12944 13198 gene locus_tag LOCUS_06920 gene rpsT 12944 13198 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3DA79 protein_id gnl|my_center|LOCUS_06920 14153 13182 gene locus_tag LOCUS_06930 14153 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15472 14150 gene locus_tag LOCUS_06940 15472 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15608 16054 gene locus_tag LOCUS_06950 15608 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16763 16080 gene locus_tag LOCUS_06960 16763 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 18633 16876 gene locus_tag LOCUS_06970 18633 16876 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600860.1 protein_id gnl|my_center|LOCUS_06970 19364 18660 gene locus_tag LOCUS_06980 19364 18660 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908173.1 protein_id gnl|my_center|LOCUS_06980 19465 20517 gene locus_tag LOCUS_06990 19465 20517 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_06990 20514 21419 gene locus_tag LOCUS_07000 20514 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413968.1 protein_id gnl|my_center|LOCUS_07000 21479 22498 gene locus_tag LOCUS_07010 21479 22498 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_07010 24277 22511 gene locus_tag LOCUS_07020 24277 22511 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907626.1 protein_id gnl|my_center|LOCUS_07020 24385 27285 gene locus_tag LOCUS_07030 gene leuS 24385 27285 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLD3 protein_id gnl|my_center|LOCUS_07030 27282 28355 gene locus_tag LOCUS_07040 27282 28355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 28383 29594 gene locus_tag LOCUS_07050 28383 29594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence018 1556 342 gene locus_tag LOCUS_07060 1556 342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_07060 1653 2570 gene locus_tag LOCUS_07070 1653 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2640 4571 gene locus_tag LOCUS_07080 gene dxs 2640 4571 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCU7 protein_id gnl|my_center|LOCUS_07080 4587 5384 gene locus_tag LOCUS_07090 gene suhB 4587 5384 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_07090 5381 7105 gene locus_tag LOCUS_07100 5381 7105 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_07100 7737 7096 gene locus_tag LOCUS_07110 gene nfuA 7737 7096 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_07110 8594 7818 gene locus_tag LOCUS_07120 8594 7818 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_07120 8650 9561 gene locus_tag LOCUS_07130 8650 9561 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_07130 9680 10378 gene locus_tag LOCUS_07140 9680 10378 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_07140 10375 11373 gene locus_tag LOCUS_07150 10375 11373 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_07150 11370 12902 gene locus_tag LOCUS_07160 11370 12902 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_07160 12899 13522 gene locus_tag LOCUS_07170 12899 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 13579 14028 gene locus_tag LOCUS_07180 13579 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 14280 15515 gene locus_tag LOCUS_07190 14280 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 17125 15512 gene locus_tag LOCUS_07200 gene pcoC 17125 15512 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228657.1 protein_id gnl|my_center|LOCUS_07200 17817 17134 gene locus_tag LOCUS_07210 17817 17134 CDS product maleylpyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_07210 18689 17904 gene locus_tag LOCUS_07220 18689 17904 CDS product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_07220 19693 18686 gene locus_tag LOCUS_07230 19693 18686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_07230 20688 19753 gene locus_tag LOCUS_07240 20688 19753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_07240 22162 20948 gene locus_tag LOCUS_07250 22162 20948 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_07250 22280 23329 gene locus_tag LOCUS_07260 gene serC 22280 23329 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Y1 protein_id gnl|my_center|LOCUS_07260 23340 24206 gene locus_tag LOCUS_07270 23340 24206 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775659.1 protein_id gnl|my_center|LOCUS_07270 25538 24225 gene locus_tag LOCUS_07280 gene metY 25538 24225 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_07280 26658 25630 gene locus_tag LOCUS_07290 gene ilvC 26658 25630 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW9 protein_id gnl|my_center|LOCUS_07290 27216 26662 gene locus_tag LOCUS_07300 gene ilvH 27216 26662 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_07300 28967 27213 gene locus_tag LOCUS_07310 28967 27213 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z567 protein_id gnl|my_center|LOCUS_07310 >Feature sequence019 1 963 gene locus_tag LOCUS_07320 1 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1118 1513 gene locus_tag LOCUS_07330 gene mgsA 1118 1513 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0R7 protein_id gnl|my_center|LOCUS_07330 1510 2325 gene locus_tag LOCUS_07340 gene kynA 1510 2325 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_07340 2700 2341 gene locus_tag LOCUS_07350 2700 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3145 2837 gene locus_tag LOCUS_07360 3145 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3762 3193 gene locus_tag LOCUS_07370 3762 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3859 4569 gene locus_tag LOCUS_07380 3859 4569 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_07380 5552 4578 gene locus_tag LOCUS_07390 gene sigA 5552 4578 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGV1 protein_id gnl|my_center|LOCUS_07390 5616 5690 gene locus_tag LOCUS_t00070 5616 5690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6715 5690 gene locus_tag LOCUS_07400 6715 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7521 6721 gene locus_tag LOCUS_07410 7521 6721 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_07410 7730 10045 gene locus_tag LOCUS_07420 7730 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 10057 10767 gene locus_tag LOCUS_07430 10057 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 10771 11244 gene locus_tag LOCUS_07440 10771 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11241 11855 gene locus_tag LOCUS_07450 11241 11855 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870040.1 protein_id gnl|my_center|LOCUS_07450 11947 13149 gene locus_tag LOCUS_07460 gene atoB 11947 13149 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_07460 14292 13120 gene locus_tag LOCUS_07470 14292 13120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259349.1 protein_id gnl|my_center|LOCUS_07470 15060 14308 gene locus_tag LOCUS_07480 15060 14308 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_07480 16501 15146 gene locus_tag LOCUS_07490 16501 15146 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_07490 17405 16578 gene locus_tag LOCUS_07500 17405 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 17815 18444 gene locus_tag LOCUS_07510 gene nadD 17815 18444 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN57 protein_id gnl|my_center|LOCUS_07510 18441 19706 gene locus_tag LOCUS_07520 18441 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 19706 20107 gene locus_tag LOCUS_07530 gene rsfS 19706 20107 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBS8 protein_id gnl|my_center|LOCUS_07530 20186 20259 gene locus_tag LOCUS_t00080 20186 20259 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21098 20328 gene locus_tag LOCUS_07540 21098 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_07540 22382 21207 gene locus_tag LOCUS_07550 22382 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 22557 24074 gene locus_tag LOCUS_07560 gene rbsA 22557 24074 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_07560 24121 25149 gene locus_tag LOCUS_07570 24121 25149 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888301.1 protein_id gnl|my_center|LOCUS_07570 25314 26054 gene locus_tag LOCUS_07580 25314 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 26056 27189 gene locus_tag LOCUS_07590 26056 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_07590 27581 27273 gene locus_tag LOCUS_07600 27581 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence020 1733 732 gene locus_tag LOCUS_07610 gene terC 1733 732 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_07610 4388 1773 gene locus_tag LOCUS_07620 4388 1773 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_07620 4482 5735 gene locus_tag LOCUS_07630 4482 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 6534 5716 gene locus_tag LOCUS_07640 6534 5716 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225281.1 protein_id gnl|my_center|LOCUS_07640 8078 6531 gene locus_tag LOCUS_07650 8078 6531 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028114.1 protein_id gnl|my_center|LOCUS_07650 8428 8075 gene locus_tag LOCUS_07660 gene hisI 8428 8075 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T1 protein_id gnl|my_center|LOCUS_07660 8828 8442 gene locus_tag LOCUS_07670 8828 8442 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZQ4 protein_id gnl|my_center|LOCUS_07670 8844 9500 gene locus_tag LOCUS_07680 8844 9500 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532163.1 protein_id gnl|my_center|LOCUS_07680 10485 9478 gene locus_tag LOCUS_07690 10485 9478 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_07690 11413 10508 gene locus_tag LOCUS_07700 gene mmuM 11413 10508 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258939.1 protein_id gnl|my_center|LOCUS_07700 12180 11410 gene locus_tag LOCUS_07710 12180 11410 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_07710 12911 12177 gene locus_tag LOCUS_07720 gene hisA 12911 12177 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50936 protein_id gnl|my_center|LOCUS_07720 13549 12908 gene locus_tag LOCUS_07730 13549 12908 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_07730 14136 13546 gene locus_tag LOCUS_07740 gene hisB 14136 13546 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV9 protein_id gnl|my_center|LOCUS_07740 15254 14133 gene locus_tag LOCUS_07750 gene hisC 15254 14133 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3C3 protein_id gnl|my_center|LOCUS_07750 15276 15491 gene locus_tag LOCUS_07760 15276 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15780 16652 gene locus_tag LOCUS_07770 15780 16652 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_07770 16705 17943 gene locus_tag LOCUS_07780 16705 17943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_07780 19072 17885 gene locus_tag LOCUS_07790 19072 17885 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_07790 20127 19072 gene locus_tag LOCUS_07800 20127 19072 CDS product putative luciferase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704476.1 protein_id gnl|my_center|LOCUS_07800 21052 20192 gene locus_tag LOCUS_07810 21052 20192 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_07810 21195 22031 gene locus_tag LOCUS_07820 21195 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 22028 23284 gene locus_tag LOCUS_07830 22028 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 24157 23285 gene locus_tag LOCUS_07840 24157 23285 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_07840 24987 24154 gene locus_tag LOCUS_07850 24987 24154 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888912.1 protein_id gnl|my_center|LOCUS_07850 26018 24984 gene locus_tag LOCUS_07860 26018 24984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence021 101 2551 gene locus_tag LOCUS_07870 101 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2557 3285 gene locus_tag LOCUS_07880 2557 3285 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_07880 4037 3282 gene locus_tag LOCUS_07890 4037 3282 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_07890 5864 4044 gene locus_tag LOCUS_07900 5864 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5949 6287 gene locus_tag LOCUS_07910 5949 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6284 7753 gene locus_tag LOCUS_07920 6284 7753 CDS product putative GMC-type oxidoreductase y4nJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55582 protein_id gnl|my_center|LOCUS_07920 7746 8804 gene locus_tag LOCUS_07930 7746 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55584 protein_id gnl|my_center|LOCUS_07930 8801 9844 gene locus_tag LOCUS_07940 8801 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55579 protein_id gnl|my_center|LOCUS_07940 11014 9833 gene locus_tag LOCUS_07950 11014 9833 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_07950 12846 11011 gene locus_tag LOCUS_07960 12846 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 13511 12843 gene locus_tag LOCUS_07970 13511 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 14029 13814 gene locus_tag LOCUS_07980 14029 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 14057 17569 gene locus_tag LOCUS_07990 14057 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 18275 17514 gene locus_tag LOCUS_08000 18275 17514 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_08000 19662 18298 gene locus_tag LOCUS_08010 19662 18298 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_08010 20589 19717 gene locus_tag LOCUS_08020 20589 19717 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222176.1 protein_id gnl|my_center|LOCUS_08020 21248 20586 gene locus_tag LOCUS_08030 21248 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 22539 21262 gene locus_tag LOCUS_08040 gene aroA 22539 21262 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW43 protein_id gnl|my_center|LOCUS_08040 23637 22558 gene locus_tag LOCUS_08050 23637 22558 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_08050 24314 23634 gene locus_tag LOCUS_08060 gene rluB 24314 23634 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB4 protein_id gnl|my_center|LOCUS_08060 25125 24415 gene locus_tag LOCUS_08070 25125 24415 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_08070 <25847 25159 gene locus_tag LOCUS_08080 <25847 25159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027965.1:segregation/condensation protein A >Feature sequence022 725 90 gene locus_tag LOCUS_08090 725 90 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_08090 654 830 gene locus_tag LOCUS_08100 654 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 876 1535 gene locus_tag LOCUS_08110 876 1535 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_08110 1532 1861 gene locus_tag LOCUS_08120 1532 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2756 1866 gene locus_tag LOCUS_08130 2756 1866 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_08130 2793 3878 gene locus_tag LOCUS_08140 2793 3878 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_08140 3902 5686 gene locus_tag LOCUS_08150 3902 5686 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_08150 5752 5931 gene locus_tag LOCUS_08160 5752 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6035 7288 gene locus_tag LOCUS_08170 6035 7288 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_08170 7412 9895 gene locus_tag LOCUS_08180 7412 9895 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_08180 11568 9976 gene locus_tag LOCUS_08190 gene prfC 11568 9976 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS18 protein_id gnl|my_center|LOCUS_08190 11646 12341 gene locus_tag LOCUS_08200 11646 12341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_08200 12394 13560 gene locus_tag LOCUS_08210 gene atoB 12394 13560 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_08210 15028 13595 gene locus_tag LOCUS_08220 15028 13595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_08220 15830 15042 gene locus_tag LOCUS_08230 15830 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 16839 16015 gene locus_tag LOCUS_08240 gene cutM 16839 16015 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_08240 17308 16850 gene locus_tag LOCUS_08250 17308 16850 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_08250 18322 17414 gene locus_tag LOCUS_08260 18322 17414 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_08260 19189 18383 gene locus_tag LOCUS_08270 19189 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 20016 19186 gene locus_tag LOCUS_08280 20016 19186 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_08280 21047 20013 gene locus_tag LOCUS_08290 21047 20013 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_08290 23404 21116 gene locus_tag LOCUS_08300 gene cutL 23404 21116 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_08300 24032 23508 gene locus_tag LOCUS_08310 24032 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 24797 24090 gene locus_tag LOCUS_08320 24797 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence023 838 278 gene locus_tag LOCUS_08330 gene pyrR 838 278 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK44 protein_id gnl|my_center|LOCUS_08330 1826 897 gene locus_tag LOCUS_08340 1826 897 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_08340 2352 1819 gene locus_tag LOCUS_08350 2352 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2872 3183 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcttcgcaggcgcagccttctt 6443 3339 gene locus_tag LOCUS_08360 gene ileS 6443 3339 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_08360 6735 6493 gene locus_tag LOCUS_08370 6735 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7271 6741 gene locus_tag LOCUS_08380 gene sepF 7271 6741 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R008 protein_id gnl|my_center|LOCUS_08380 7967 7296 gene locus_tag LOCUS_08390 7967 7296 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385539.1 protein_id gnl|my_center|LOCUS_08390 9108 7993 gene locus_tag LOCUS_08400 gene ftsZ 9108 7993 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_08400 10213 9281 gene locus_tag LOCUS_08410 gene ftsQ 10213 9281 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R014 protein_id gnl|my_center|LOCUS_08410 11178 10213 gene locus_tag LOCUS_08420 gene murB 11178 10213 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_08420 12583 11180 gene locus_tag LOCUS_08430 gene murC 12583 11180 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_08430 13704 12580 gene locus_tag LOCUS_08440 gene murG 13704 12580 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK79 protein_id gnl|my_center|LOCUS_08440 14957 13701 gene locus_tag LOCUS_08450 14957 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16330 14954 gene locus_tag LOCUS_08460 gene murD 16330 14954 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R018 protein_id gnl|my_center|LOCUS_08460 17394 16327 gene locus_tag LOCUS_08470 gene mraY 17394 16327 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP34 protein_id gnl|my_center|LOCUS_08470 18842 17391 gene locus_tag LOCUS_08480 18842 17391 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_08480 20614 18824 gene locus_tag LOCUS_08490 gene ftsI 20614 18824 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_08490 21351 20806 gene locus_tag LOCUS_08500 21351 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 22289 21351 gene locus_tag LOCUS_08510 gene rsmH 22289 21351 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z2 protein_id gnl|my_center|LOCUS_08510 22708 22286 gene locus_tag LOCUS_08520 gene mraZ 22708 22286 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF5 protein_id gnl|my_center|LOCUS_08520 23077 22853 gene locus_tag LOCUS_08530 23077 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 23033 24661 gene locus_tag LOCUS_08540 23033 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence024 414 1094 gene locus_tag LOCUS_08550 414 1094 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_08550 1726 1091 gene locus_tag LOCUS_08560 1726 1091 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888028.1 protein_id gnl|my_center|LOCUS_08560 2378 1767 gene locus_tag LOCUS_08570 2378 1767 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_08570 3829 2378 gene locus_tag LOCUS_08580 gene ahcY 3829 2378 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_08580 4243 4010 gene locus_tag LOCUS_08590 4243 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 5622 4258 gene locus_tag LOCUS_08600 gene manB 5622 4258 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_08600 8179 5651 gene locus_tag LOCUS_08610 8179 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8933 8208 gene locus_tag LOCUS_08620 8933 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9325 11286 gene locus_tag LOCUS_08630 gene ftsH 9325 11286 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ4 protein_id gnl|my_center|LOCUS_08630 11732 11283 gene locus_tag LOCUS_08640 11732 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 13179 11743 gene locus_tag LOCUS_08650 13179 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 16352 13176 gene locus_tag LOCUS_08660 16352 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 16498 17820 gene locus_tag LOCUS_08670 16498 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 18834 17836 gene locus_tag LOCUS_08680 gene gmd 18834 17836 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVJ1 protein_id gnl|my_center|LOCUS_08680 18926 19882 gene locus_tag LOCUS_08690 18926 19882 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_08690 19893 20624 gene locus_tag LOCUS_08700 19893 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 21575 20628 gene locus_tag LOCUS_08710 21575 20628 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_08710 22589 21585 gene locus_tag LOCUS_08720 22589 21585 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_08720 23458 22589 gene locus_tag LOCUS_08730 23458 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 <24440 23500 gene locus_tag LOCUS_08740 <24440 23500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974189.1:glycosyltransferase WbuB >Feature sequence025 1302 1640 gene locus_tag LOCUS_08750 1302 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2841 1861 gene locus_tag LOCUS_08760 2841 1861 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_08760 4165 2894 gene locus_tag LOCUS_08770 4165 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4445 5251 gene locus_tag LOCUS_08780 4445 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5290 5901 gene locus_tag LOCUS_08790 gene tdk 5290 5901 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_08790 7172 5898 gene locus_tag LOCUS_08800 7172 5898 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_08800 7268 7570 gene locus_tag LOCUS_08810 7268 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8877 7981 gene locus_tag LOCUS_08820 8877 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9409 8891 gene locus_tag LOCUS_08830 9409 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10985 9477 gene locus_tag LOCUS_08840 gene glpK 10985 9477 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_08840 11404 10982 gene locus_tag LOCUS_08850 11404 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 12921 11401 gene locus_tag LOCUS_08860 12921 11401 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_08860 14564 12933 gene locus_tag LOCUS_08870 gene glpD2 14564 12933 CDS product glycerol-3-phosphate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64185 protein_id gnl|my_center|LOCUS_08870 14923 15267 gene locus_tag LOCUS_08880 14923 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 15264 15677 gene locus_tag LOCUS_08890 15264 15677 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_08890 15805 17109 gene locus_tag LOCUS_08900 15805 17109 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_08900 17137 17739 gene locus_tag LOCUS_08910 17137 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 17878 18108 gene locus_tag LOCUS_08920 17878 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 18134 19219 gene locus_tag LOCUS_08930 gene trpD 18134 19219 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF3 protein_id gnl|my_center|LOCUS_08930 19232 20101 gene locus_tag LOCUS_08940 gene thrB 19232 20101 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX1 protein_id gnl|my_center|LOCUS_08940 21885 20098 gene locus_tag LOCUS_08950 gene dnaQ 21885 20098 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_08950 21884 22102 gene locus_tag LOCUS_08960 21884 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_08960 <22723 22208 gene locus_tag LOCUS_08970 <22723 22208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WC66:SURF1-like protein >Feature sequence026 940 77 gene locus_tag LOCUS_08980 940 77 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226732.1 protein_id gnl|my_center|LOCUS_08980 1728 955 gene locus_tag LOCUS_08990 1728 955 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_08990 2472 1735 gene locus_tag LOCUS_09000 2472 1735 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_09000 2541 3410 gene locus_tag LOCUS_09010 2541 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3410 4093 gene locus_tag LOCUS_09020 3410 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4147 5352 gene locus_tag LOCUS_09030 4147 5352 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_09030 5426 5782 gene locus_tag LOCUS_09040 5426 5782 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_09040 6777 5779 gene locus_tag LOCUS_09050 6777 5779 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_09050 6945 7778 gene locus_tag LOCUS_09060 6945 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8615 7791 gene locus_tag LOCUS_09070 gene surE 8615 7791 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_09070 9458 8673 gene locus_tag LOCUS_09080 9458 8673 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_09080 11398 9464 gene locus_tag LOCUS_09090 11398 9464 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_09090 11872 11456 gene locus_tag LOCUS_09100 gene arsC 11872 11456 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_09100 12571 11876 gene locus_tag LOCUS_09110 12571 11876 CDS product transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_09110 12693 13604 gene locus_tag LOCUS_09120 gene menB 12693 13604 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_09120 13630 14487 gene locus_tag LOCUS_09130 13630 14487 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_09130 14894 14595 gene locus_tag LOCUS_09140 14894 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14868 15422 gene locus_tag LOCUS_09150 14868 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 15789 15415 gene locus_tag LOCUS_09160 15789 15415 CDS product hemoglobin-like protein HbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702305.1 protein_id gnl|my_center|LOCUS_09160 15776 15967 gene locus_tag LOCUS_09170 15776 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16783 15923 gene locus_tag LOCUS_09180 16783 15923 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_09180 17706 16804 gene locus_tag LOCUS_09190 gene ftsX 17706 16804 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWN8 protein_id gnl|my_center|LOCUS_09190 18383 17706 gene locus_tag LOCUS_09200 18383 17706 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_09200 19562 18459 gene locus_tag LOCUS_09210 gene prfB 19562 18459 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_09210 22328 19569 gene locus_tag LOCUS_09220 gene secA1 22328 19569 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71533 protein_id gnl|my_center|LOCUS_09220 >Feature sequence027 641 99 gene locus_tag LOCUS_09230 641 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 979 638 gene locus_tag LOCUS_09240 979 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1850 1074 gene locus_tag LOCUS_09250 gene dapB 1850 1074 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86836 protein_id gnl|my_center|LOCUS_09250 4339 1937 gene locus_tag LOCUS_09260 gene pnp 4339 1937 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ5 protein_id gnl|my_center|LOCUS_09260 4769 4506 gene locus_tag LOCUS_09270 gene rpsO 4769 4506 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_09270 4914 5627 gene locus_tag LOCUS_09280 gene ribE 4914 5627 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_09280 6898 5630 gene locus_tag LOCUS_09290 6898 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7085 7327 gene locus_tag LOCUS_09300 7085 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7366 7536 gene locus_tag LOCUS_09310 7366 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 7591 7851 gene locus_tag LOCUS_09320 7591 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7844 8044 gene locus_tag LOCUS_09330 7844 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 8216 9394 gene locus_tag LOCUS_09340 8216 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 9753 9442 gene locus_tag LOCUS_09350 9753 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 9752 10183 gene locus_tag LOCUS_09360 9752 10183 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_09360 10304 11227 gene locus_tag LOCUS_09370 10304 11227 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_09370 11281 11733 gene locus_tag LOCUS_09380 11281 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 11935 11861 gene locus_tag LOCUS_t00090 11935 11861 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12466 11975 gene locus_tag LOCUS_09390 12466 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13221 12718 gene locus_tag LOCUS_09400 gene moaC 13221 12718 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y0 protein_id gnl|my_center|LOCUS_09400 13398 14033 gene locus_tag LOCUS_09410 13398 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 15104 14064 gene locus_tag LOCUS_09420 gene moaA 15104 14064 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_09420 16389 15109 gene locus_tag LOCUS_09430 16389 15109 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_09430 16355 17029 gene locus_tag LOCUS_09440 16355 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 17922 17038 gene locus_tag LOCUS_09450 gene hasC 17922 17038 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFX5 protein_id gnl|my_center|LOCUS_09450 18272 18129 gene locus_tag LOCUS_09460 18272 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19153 18323 gene locus_tag LOCUS_09470 gene uppP 19153 18323 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60938 protein_id gnl|my_center|LOCUS_09470 20517 19171 gene locus_tag LOCUS_09480 20517 19171 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_09480 21533 20514 gene locus_tag LOCUS_09490 21533 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence028 2567 285 gene locus_tag LOCUS_09500 2567 285 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_09500 3058 2564 gene locus_tag LOCUS_09510 gene coxS 3058 2564 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_09510 3870 3055 gene locus_tag LOCUS_09520 3870 3055 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_09520 4327 3923 gene locus_tag LOCUS_09530 4327 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4435 5121 gene locus_tag LOCUS_09540 gene pcs 4435 5121 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_09540 6142 5135 gene locus_tag LOCUS_09550 6142 5135 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_09550 7202 6180 gene locus_tag LOCUS_09560 7202 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 9820 7205 gene locus_tag LOCUS_09570 9820 7205 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 protein_id gnl|my_center|LOCUS_09570 10773 9817 gene locus_tag LOCUS_09580 10773 9817 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_09580 12023 10776 gene locus_tag LOCUS_09590 12023 10776 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_09590 12141 12872 gene locus_tag LOCUS_09600 12141 12872 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_09600 13653 12892 gene locus_tag LOCUS_09610 13653 12892 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727611.1 protein_id gnl|my_center|LOCUS_09610 13652 15139 gene locus_tag LOCUS_09620 13652 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 16506 15136 gene locus_tag LOCUS_09630 16506 15136 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731301.1 protein_id gnl|my_center|LOCUS_09630 17358 16516 gene locus_tag LOCUS_09640 gene panC 17358 16516 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_09640 18161 17364 gene locus_tag LOCUS_09650 gene panB 18161 17364 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG8 protein_id gnl|my_center|LOCUS_09650 19323 18307 gene locus_tag LOCUS_09660 19323 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_09660 19470 20141 gene locus_tag LOCUS_09670 19470 20141 CDS product sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_09670 20662 20138 gene locus_tag LOCUS_09680 20662 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence029 564 1529 gene locus_tag LOCUS_09690 564 1529 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028049.1 protein_id gnl|my_center|LOCUS_09690 2422 1475 gene locus_tag LOCUS_09700 2422 1475 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_09700 2667 2419 gene locus_tag LOCUS_09710 2667 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2837 3055 gene locus_tag LOCUS_09720 2837 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3390 4760 gene locus_tag LOCUS_09730 3390 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4763 5773 gene locus_tag LOCUS_09740 4763 5773 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532984.1 protein_id gnl|my_center|LOCUS_09740 5763 6635 gene locus_tag LOCUS_09750 5763 6635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057158.1 protein_id gnl|my_center|LOCUS_09750 6632 7372 gene locus_tag LOCUS_09760 6632 7372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_09760 8813 7452 gene locus_tag LOCUS_09770 8813 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 8974 9774 gene locus_tag LOCUS_09780 8974 9774 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_09780 9955 10473 gene locus_tag LOCUS_09790 9955 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 10474 11001 gene locus_tag LOCUS_09800 10474 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 11899 10964 gene locus_tag LOCUS_09810 11899 10964 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_09810 12582 11896 gene locus_tag LOCUS_09820 12582 11896 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 protein_id gnl|my_center|LOCUS_09820 12650 14089 gene locus_tag LOCUS_09830 12650 14089 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027797.1 protein_id gnl|my_center|LOCUS_09830 14093 14746 gene locus_tag LOCUS_09840 gene cmk 14093 14746 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q49885 protein_id gnl|my_center|LOCUS_09840 14743 15420 gene locus_tag LOCUS_09850 14743 15420 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776485.1 protein_id gnl|my_center|LOCUS_09850 16685 15417 gene locus_tag LOCUS_09860 gene apeB 16685 15417 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA76 protein_id gnl|my_center|LOCUS_09860 17364 16735 gene locus_tag LOCUS_09870 17364 16735 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_09870 17739 17443 gene locus_tag LOCUS_09880 17739 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 18256 18834 gene locus_tag LOCUS_09890 gene mobA 18256 18834 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67413 protein_id gnl|my_center|LOCUS_09890 18853 19188 gene locus_tag LOCUS_09900 18853 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence030 367 966 gene locus_tag LOCUS_09910 gene purN 367 966 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LG7 protein_id gnl|my_center|LOCUS_09910 981 2507 gene locus_tag LOCUS_09920 gene guaB 981 2507 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67820 protein_id gnl|my_center|LOCUS_09920 3130 2504 gene locus_tag LOCUS_09930 3130 2504 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_09930 3134 3679 gene locus_tag LOCUS_09940 gene def 3134 3679 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96113 protein_id gnl|my_center|LOCUS_09940 3682 4611 gene locus_tag LOCUS_09950 gene fmt 3682 4611 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5P7 protein_id gnl|my_center|LOCUS_09950 4604 5734 gene locus_tag LOCUS_09960 gene rsmB 4604 5734 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR0 protein_id gnl|my_center|LOCUS_09960 5727 6212 gene locus_tag LOCUS_09970 5727 6212 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_09970 6255 7127 gene locus_tag LOCUS_09980 gene hisG 6255 7127 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_09980 7137 7334 gene locus_tag LOCUS_09990 7137 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7315 7620 gene locus_tag LOCUS_10000 7315 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7921 7604 gene locus_tag LOCUS_10010 7921 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8221 8811 gene locus_tag LOCUS_10020 gene infC 8221 8811 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY63 protein_id gnl|my_center|LOCUS_10020 8846 9043 gene locus_tag LOCUS_10030 gene rpmI 8846 9043 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CC21 protein_id gnl|my_center|LOCUS_10030 9100 9456 gene locus_tag LOCUS_10040 gene rplT 9100 9456 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK7 protein_id gnl|my_center|LOCUS_10040 9578 10237 gene locus_tag LOCUS_10050 9578 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10234 11235 gene locus_tag LOCUS_10060 gene pheS 10234 11235 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 protein_id gnl|my_center|LOCUS_10060 11245 13587 gene locus_tag LOCUS_10070 11245 13587 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458979.1 protein_id gnl|my_center|LOCUS_10070 14570 13659 gene locus_tag LOCUS_10080 14570 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950680.1 protein_id gnl|my_center|LOCUS_10080 15247 14675 gene locus_tag LOCUS_10090 15247 14675 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_10090 15343 16401 gene locus_tag LOCUS_10100 15343 16401 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_10100 16398 17321 gene locus_tag LOCUS_10110 gene argB 16398 17321 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG64 protein_id gnl|my_center|LOCUS_10110 17318 18535 gene locus_tag LOCUS_10120 gene argD 17318 18535 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN66 protein_id gnl|my_center|LOCUS_10120 18532 19449 gene locus_tag LOCUS_10130 gene arcB 18532 19449 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_10130 19446 19940 gene locus_tag LOCUS_10140 gene argR 19446 19940 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB01 protein_id gnl|my_center|LOCUS_10140 >Feature sequence031 2342 1290 gene locus_tag LOCUS_10150 gene ftsY 2342 1290 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_10150 5852 2355 gene locus_tag LOCUS_10160 gene smc 5852 2355 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV25 protein_id gnl|my_center|LOCUS_10160 6766 5918 gene locus_tag LOCUS_10170 6766 5918 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_10170 7547 6759 gene locus_tag LOCUS_10180 gene rnc 7547 6759 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_10180 7862 7554 gene locus_tag LOCUS_10190 7862 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8882 7917 gene locus_tag LOCUS_10200 8882 7917 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_10200 9136 8909 gene locus_tag LOCUS_10210 gene rpmF 9136 8909 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_10210 9696 9184 gene locus_tag LOCUS_10220 9696 9184 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 protein_id gnl|my_center|LOCUS_10220 10313 9693 gene locus_tag LOCUS_10230 10313 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10843 10310 gene locus_tag LOCUS_10240 gene coaD 10843 10310 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 protein_id gnl|my_center|LOCUS_10240 11409 10864 gene locus_tag LOCUS_10250 11409 10864 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_10250 13105 11636 gene locus_tag LOCUS_10260 13105 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 15307 13124 gene locus_tag LOCUS_10270 gene recG 15307 13124 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL48 protein_id gnl|my_center|LOCUS_10270 17004 15319 gene locus_tag LOCUS_10280 17004 15319 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_10280 17166 17381 gene locus_tag LOCUS_10290 gene rpmB1 17166 17381 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_10290 17395 17616 gene locus_tag LOCUS_10300 17395 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence032 1884 652 gene locus_tag LOCUS_10310 1884 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2094 2001 gene locus_tag LOCUS_t00100 2094 2001 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2227 2143 gene locus_tag LOCUS_t00110 2227 2143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3155 2271 gene locus_tag LOCUS_10320 3155 2271 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_10320 4097 3183 gene locus_tag LOCUS_10330 4097 3183 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_10330 4192 4953 gene locus_tag LOCUS_10340 4192 4953 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_10340 4950 6131 gene locus_tag LOCUS_10350 4950 6131 CDS product UPF0272 protein Cgl2470/cg2715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMU4 protein_id gnl|my_center|LOCUS_10350 6792 6133 gene locus_tag LOCUS_10360 6792 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 7336 6767 gene locus_tag LOCUS_10370 7336 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 7365 9953 gene locus_tag LOCUS_10380 7365 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9950 10720 gene locus_tag LOCUS_10390 9950 10720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292603.1 protein_id gnl|my_center|LOCUS_10390 10744 11127 gene locus_tag LOCUS_10400 10744 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 11190 12740 gene locus_tag LOCUS_10410 11190 12740 CDS product iron-sulfur cluster-binding protein, RIESKE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700910.1 protein_id gnl|my_center|LOCUS_10410 15651 12733 gene locus_tag LOCUS_10420 15651 12733 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKF8 protein_id gnl|my_center|LOCUS_10420 16308 15664 gene locus_tag LOCUS_10430 16308 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 16358 16594 gene locus_tag LOCUS_10440 16358 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 17373 16627 gene locus_tag LOCUS_10450 17373 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 17273 17986 gene locus_tag LOCUS_10460 17273 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 18904 17999 gene locus_tag LOCUS_10470 gene dhmA 18904 17999 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_10470 >Feature sequence033 <1 1198 gene locus_tag LOCUS_10480 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920425.1:cyclohexanone monooxygenase 2921 1281 gene locus_tag LOCUS_10490 2921 1281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_10490 3947 2943 gene locus_tag LOCUS_10500 3947 2943 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_10500 4702 3947 gene locus_tag LOCUS_10510 4702 3947 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_10510 4827 5435 gene locus_tag LOCUS_10520 4827 5435 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_10520 5548 6045 gene locus_tag LOCUS_10530 5548 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6096 7430 gene locus_tag LOCUS_10540 6096 7430 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_10540 7471 8814 gene locus_tag LOCUS_10550 7471 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 8860 10851 gene locus_tag LOCUS_10560 8860 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12446 10866 gene locus_tag LOCUS_10570 gene phoD 12446 10866 CDS product alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42251 protein_id gnl|my_center|LOCUS_10570 12607 13197 gene locus_tag LOCUS_10580 12607 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 13179 14039 gene locus_tag LOCUS_10590 13179 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 14887 14006 gene locus_tag LOCUS_10600 14887 14006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947621.1 protein_id gnl|my_center|LOCUS_10600 16407 14929 gene locus_tag LOCUS_10610 16407 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 17306 16449 gene locus_tag LOCUS_10620 17306 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence034 1580 642 gene locus_tag LOCUS_10630 1580 642 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_10630 1614 2279 gene locus_tag LOCUS_10640 1614 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_10640 3051 2281 gene locus_tag LOCUS_10650 3051 2281 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_10650 4489 3113 gene locus_tag LOCUS_10660 gene glnA4 4489 3113 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414579.1 protein_id gnl|my_center|LOCUS_10660 5356 4547 gene locus_tag LOCUS_10670 5356 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5542 5468 gene locus_tag LOCUS_t00120 5542 5468 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6831 5593 gene locus_tag LOCUS_10680 6831 5593 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYM0 protein_id gnl|my_center|LOCUS_10680 7399 6833 gene locus_tag LOCUS_10690 7399 6833 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_10690 8737 7457 gene locus_tag LOCUS_10700 gene rimO 8737 7457 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DD82 protein_id gnl|my_center|LOCUS_10700 9698 8775 gene locus_tag LOCUS_10710 9698 8775 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_10710 12192 9781 gene locus_tag LOCUS_10720 12192 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12771 12214 gene locus_tag LOCUS_10730 12771 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 14433 12772 gene locus_tag LOCUS_10740 gene rnj 14433 12772 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HF18 protein_id gnl|my_center|LOCUS_10740 15332 14433 gene locus_tag LOCUS_10750 gene dapA 15332 14433 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_10750 15997 15332 gene locus_tag LOCUS_10760 15997 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 16110 17159 gene locus_tag LOCUS_10770 gene ddl 16110 17159 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_10770 >Feature sequence035 <1 1067 gene locus_tag LOCUS_10780 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MD05:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 1135 1998 gene locus_tag LOCUS_10790 gene miaA 1135 1998 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDG9 protein_id gnl|my_center|LOCUS_10790 2015 2830 gene locus_tag LOCUS_10800 gene dapF 2015 2830 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_10800 2827 4164 gene locus_tag LOCUS_10810 gene hflX 2827 4164 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P758 protein_id gnl|my_center|LOCUS_10810 4182 5321 gene locus_tag LOCUS_10820 4182 5321 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2I0 protein_id gnl|my_center|LOCUS_10820 6010 5339 gene locus_tag LOCUS_10830 gene lexA 6010 5339 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1N3 protein_id gnl|my_center|LOCUS_10830 6206 6661 gene locus_tag LOCUS_10840 6206 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6833 7192 gene locus_tag LOCUS_10850 6833 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7222 9510 gene locus_tag LOCUS_10860 7222 9510 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_10860 10028 12865 gene locus_tag LOCUS_10870 gene nrdA 10028 12865 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_10870 13658 12936 gene locus_tag LOCUS_10880 13658 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 15233 13668 gene locus_tag LOCUS_10890 15233 13668 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_10890 15672 15244 gene locus_tag LOCUS_10900 15672 15244 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_10900 16084 15692 gene locus_tag LOCUS_10910 16084 15692 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_10910 17384 16173 gene locus_tag LOCUS_10920 17384 16173 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence036 <1 598 gene locus_tag LOCUS_10930 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RA63:chaperone protein ClpB 648 1946 gene locus_tag LOCUS_10940 gene purA 648 1946 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_10940 1943 3253 gene locus_tag LOCUS_10950 1943 3253 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03A61 protein_id gnl|my_center|LOCUS_10950 3667 3266 gene locus_tag LOCUS_10960 3667 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3762 4343 gene locus_tag LOCUS_10970 gene pyrE 3762 4343 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NM11 protein_id gnl|my_center|LOCUS_10970 4381 5208 gene locus_tag LOCUS_10980 gene tesB 4381 5208 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_10980 7295 5169 gene locus_tag LOCUS_10990 7295 5169 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726743.1 protein_id gnl|my_center|LOCUS_10990 7372 7299 gene locus_tag LOCUS_t00130 7372 7299 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7477 7401 gene locus_tag LOCUS_t00140 7477 7401 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7649 7576 gene locus_tag LOCUS_t00150 7649 7576 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8193 7708 gene locus_tag LOCUS_11000 8193 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 8545 8195 gene locus_tag LOCUS_11010 gene clpS 8545 8195 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_11010 8690 9517 gene locus_tag LOCUS_11020 gene ctaB 8690 9517 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC2 protein_id gnl|my_center|LOCUS_11020 9778 11307 gene locus_tag LOCUS_11030 gene ctaD 9778 11307 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24010 protein_id gnl|my_center|LOCUS_11030 11307 11906 gene locus_tag LOCUS_11040 11307 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11920 13065 gene locus_tag LOCUS_11050 11920 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 13102 14361 gene locus_tag LOCUS_11060 gene ctaC 13102 14361 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEM0 protein_id gnl|my_center|LOCUS_11060 14376 16385 gene locus_tag LOCUS_11070 gene ctaD 14376 16385 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEM1 protein_id gnl|my_center|LOCUS_11070 16378 16992 gene locus_tag LOCUS_11080 gene cyoC 16378 16992 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036358.1 protein_id gnl|my_center|LOCUS_11080 17003 17335 gene locus_tag LOCUS_11090 17003 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence037 2847 1276 gene locus_tag LOCUS_11100 2847 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2903 3724 gene locus_tag LOCUS_11110 2903 3724 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_11110 3936 8498 gene locus_tag LOCUS_11120 3936 8498 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_11120 8491 9942 gene locus_tag LOCUS_11130 gene gltD 8491 9942 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_11130 9949 10590 gene locus_tag LOCUS_11140 9949 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 11625 10600 gene locus_tag LOCUS_11150 11625 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13225 11639 gene locus_tag LOCUS_11160 13225 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 14448 13225 gene locus_tag LOCUS_11170 14448 13225 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_11170 16829 14445 gene locus_tag LOCUS_11180 16829 14445 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence038 2373 1330 gene locus_tag LOCUS_11190 2373 1330 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085596.1 protein_id gnl|my_center|LOCUS_11190 3367 2432 gene locus_tag LOCUS_11200 3367 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706641.1 protein_id gnl|my_center|LOCUS_11200 4867 3377 gene locus_tag LOCUS_11210 4867 3377 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729200.1 protein_id gnl|my_center|LOCUS_11210 4898 5356 gene locus_tag LOCUS_11220 gene rpiB 4898 5356 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_11220 5397 6650 gene locus_tag LOCUS_11230 gene glyA 5397 6650 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66776 protein_id gnl|my_center|LOCUS_11230 6701 7873 gene locus_tag LOCUS_11240 6701 7873 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_11240 7933 8289 gene locus_tag LOCUS_11250 7933 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8286 8753 gene locus_tag LOCUS_11260 8286 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8759 9520 gene locus_tag LOCUS_11270 gene atpB 8759 9520 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D8 protein_id gnl|my_center|LOCUS_11270 9561 9830 gene locus_tag LOCUS_11280 9561 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9840 10472 gene locus_tag LOCUS_11290 9840 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 10499 11002 gene locus_tag LOCUS_11300 gene atpF 10499 11002 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180X1 protein_id gnl|my_center|LOCUS_11300 10999 11526 gene locus_tag LOCUS_11310 10999 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 11560 13152 gene locus_tag LOCUS_11320 gene atpA 11560 13152 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R202 protein_id gnl|my_center|LOCUS_11320 13159 14118 gene locus_tag LOCUS_11330 gene atpG 13159 14118 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R201 protein_id gnl|my_center|LOCUS_11330 14163 15608 gene locus_tag LOCUS_11340 gene atpD 14163 15608 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH77 protein_id gnl|my_center|LOCUS_11340 15608 16036 gene locus_tag LOCUS_11350 gene atpC 15608 16036 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Z6 protein_id gnl|my_center|LOCUS_11350 16502 16104 gene locus_tag LOCUS_11360 16502 16104 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230404.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence039 <1 1695 gene locus_tag LOCUS_11370 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272585.1:phosphoenolpyruvate synthase 3038 1731 gene locus_tag LOCUS_11380 3038 1731 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_11380 3865 3035 gene locus_tag LOCUS_11390 3865 3035 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_11390 3918 4889 gene locus_tag LOCUS_11400 3918 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5317 4886 gene locus_tag LOCUS_11410 5317 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5476 6684 gene locus_tag LOCUS_11420 5476 6684 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_11420 7566 6700 gene locus_tag LOCUS_11430 7566 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7598 8260 gene locus_tag LOCUS_11440 7598 8260 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_11440 9114 8257 gene locus_tag LOCUS_11450 9114 8257 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_11450 9227 10255 gene locus_tag LOCUS_11460 9227 10255 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_11460 10388 11320 gene locus_tag LOCUS_11470 10388 11320 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_11470 11313 11915 gene locus_tag LOCUS_11480 gene ybeY 11313 11915 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD88 protein_id gnl|my_center|LOCUS_11480 11915 13216 gene locus_tag LOCUS_11490 11915 13216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_11490 13992 13213 gene locus_tag LOCUS_11500 13992 13213 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_11500 15136 14027 gene locus_tag LOCUS_11510 15136 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 15242 16048 gene locus_tag LOCUS_11520 gene menA 15242 16048 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NT62 protein_id gnl|my_center|LOCUS_11520 16058 16339 gene locus_tag LOCUS_11530 16058 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 16422 16799 gene locus_tag LOCUS_11540 16422 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence040 542 3 gene locus_tag LOCUS_11550 542 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 994 539 gene locus_tag LOCUS_11560 994 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704461.1 protein_id gnl|my_center|LOCUS_11560 1026 1883 gene locus_tag LOCUS_11570 1026 1883 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_11570 3008 1905 gene locus_tag LOCUS_11580 gene mcr 3008 1905 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228953.1 protein_id gnl|my_center|LOCUS_11580 4588 3014 gene locus_tag LOCUS_11590 4588 3014 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_11590 4691 5491 gene locus_tag LOCUS_11600 gene echA19 4691 5491 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_11600 6662 5505 gene locus_tag LOCUS_11610 6662 5505 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_11610 7722 6664 gene locus_tag LOCUS_11620 7722 6664 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730896.1 protein_id gnl|my_center|LOCUS_11620 8219 7722 gene locus_tag LOCUS_11630 8219 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 8689 8216 gene locus_tag LOCUS_11640 8689 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11640 8827 10263 gene locus_tag LOCUS_11650 8827 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10309 12582 gene locus_tag LOCUS_11660 10309 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12582 13292 gene locus_tag LOCUS_11670 12582 13292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_11670 13289 13993 gene locus_tag LOCUS_11680 13289 13993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_11680 14047 14415 gene locus_tag LOCUS_11690 14047 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 15894 14416 gene locus_tag LOCUS_11700 15894 14416 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730585.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence041 339 1148 gene locus_tag LOCUS_11710 gene apaH 339 1148 CDS product diadenosine tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_11710 1159 2382 gene locus_tag LOCUS_11720 gene hcaD 1159 2382 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228905.1 protein_id gnl|my_center|LOCUS_11720 2472 2918 gene locus_tag LOCUS_11730 2472 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2978 4693 gene locus_tag LOCUS_11740 2978 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4759 5943 gene locus_tag LOCUS_11750 gene fadA 4759 5943 CDS product acetyl-CoA acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_11750 5952 6221 gene locus_tag LOCUS_11760 5952 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6608 6291 gene locus_tag LOCUS_11770 6608 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6701 7279 gene locus_tag LOCUS_11780 6701 7279 CDS product glutamine amidotransferase of anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700788.1 protein_id gnl|my_center|LOCUS_11780 9398 7287 gene locus_tag LOCUS_11790 gene pknB 9398 7287 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 protein_id gnl|my_center|LOCUS_11790 10953 9478 gene locus_tag LOCUS_11800 gene pbpA 10953 9478 CDS product penicillin-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG3 protein_id gnl|my_center|LOCUS_11800 12344 10950 gene locus_tag LOCUS_11810 gene rodA 12344 10950 CDS product putative FtsW-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63761 protein_id gnl|my_center|LOCUS_11810 13264 12341 gene locus_tag LOCUS_11820 13264 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13752 13261 gene locus_tag LOCUS_11830 13752 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14439 13777 gene locus_tag LOCUS_11840 14439 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 14507 14592 gene locus_tag LOCUS_t00160 14507 14592 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14638 15402 gene locus_tag LOCUS_11850 14638 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_11850 16087 15407 gene locus_tag LOCUS_11860 16087 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8H2 protein_id gnl|my_center|LOCUS_11860 >Feature sequence042 2094 2020 gene locus_tag LOCUS_t00170 2094 2020 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2428 2153 gene locus_tag LOCUS_11870 2428 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3788 2433 gene locus_tag LOCUS_11880 gene der 3788 2433 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834T4 protein_id gnl|my_center|LOCUS_11880 5209 3785 gene locus_tag LOCUS_11890 5209 3785 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_11890 5267 6310 gene locus_tag LOCUS_11900 gene ispH 5267 6310 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_11900 6314 6724 gene locus_tag LOCUS_11910 6314 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7932 6730 gene locus_tag LOCUS_11920 7932 6730 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_11920 8701 8033 gene locus_tag LOCUS_11930 8701 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8785 10335 gene locus_tag LOCUS_11940 8785 10335 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_11940 10355 11116 gene locus_tag LOCUS_11950 10355 11116 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_11950 11205 11963 gene locus_tag LOCUS_11960 gene ssuB 11205 11963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_11960 11960 12775 gene locus_tag LOCUS_11970 gene ssuC 11960 12775 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_11970 12824 13942 gene locus_tag LOCUS_11980 12824 13942 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_11980 14483 13986 gene locus_tag LOCUS_11990 14483 13986 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_11990 15406 14591 gene locus_tag LOCUS_12000 15406 14591 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence043 605 273 gene locus_tag LOCUS_12010 605 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1029 610 gene locus_tag LOCUS_12020 1029 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1231 1007 gene locus_tag LOCUS_12030 1231 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1796 1266 gene locus_tag LOCUS_12040 1796 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2437 1793 gene locus_tag LOCUS_12050 2437 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3335 2400 gene locus_tag LOCUS_12060 3335 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3957 3346 gene locus_tag LOCUS_12070 3957 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3923 4126 gene locus_tag LOCUS_12080 3923 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4254 4349 gene locus_tag LOCUS_t00180 4254 4349 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4374 4973 gene locus_tag LOCUS_12090 4374 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969298.1 protein_id gnl|my_center|LOCUS_12090 4970 5836 gene locus_tag LOCUS_12100 4970 5836 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 protein_id gnl|my_center|LOCUS_12100 5931 6851 gene locus_tag LOCUS_12110 5931 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7866 6925 gene locus_tag LOCUS_12120 7866 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8132 8944 gene locus_tag LOCUS_12130 8132 8944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_12130 9958 8954 gene locus_tag LOCUS_12140 gene ephA 9958 8954 CDS product epoxide hydrolase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YGS0 protein_id gnl|my_center|LOCUS_12140 10181 9987 gene locus_tag LOCUS_12150 10181 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 10217 10774 gene locus_tag LOCUS_12160 10217 10774 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXR9 protein_id gnl|my_center|LOCUS_12160 10785 11990 gene locus_tag LOCUS_12170 10785 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_12170 12864 12004 gene locus_tag LOCUS_12180 12864 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_12180 12987 14099 gene locus_tag LOCUS_12190 12987 14099 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_12190 14096 15109 gene locus_tag LOCUS_12200 gene ansA 14096 15109 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence044 483 1253 gene locus_tag LOCUS_12210 483 1253 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_12210 1736 1257 gene locus_tag LOCUS_12220 1736 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1805 2428 gene locus_tag LOCUS_12230 gene msrA 1805 2428 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F2 protein_id gnl|my_center|LOCUS_12230 2868 2425 gene locus_tag LOCUS_12240 2868 2425 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_12240 4001 2865 gene locus_tag LOCUS_12250 4001 2865 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545374.1 protein_id gnl|my_center|LOCUS_12250 4799 4077 gene locus_tag LOCUS_12260 gene livF 4799 4077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_12260 7522 4796 gene locus_tag LOCUS_12270 7522 4796 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225675.1 protein_id gnl|my_center|LOCUS_12270 8921 7620 gene locus_tag LOCUS_12280 8921 7620 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225674.1 protein_id gnl|my_center|LOCUS_12280 9016 10227 gene locus_tag LOCUS_12290 9016 10227 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_12290 11161 10235 gene locus_tag LOCUS_12300 11161 10235 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226919.1 protein_id gnl|my_center|LOCUS_12300 11364 12512 gene locus_tag LOCUS_12310 11364 12512 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_12310 12537 13502 gene locus_tag LOCUS_12320 12537 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14522 13509 gene locus_tag LOCUS_12330 14522 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 <16023 14713 gene locus_tag LOCUS_12340 <16023 14713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:methylmalonyl-CoA carboxyltransferase >Feature sequence045 237 1406 gene locus_tag LOCUS_12350 237 1406 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_12350 1423 2025 gene locus_tag LOCUS_12360 1423 2025 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_12360 2179 2472 gene locus_tag LOCUS_12370 gene groS 2179 2472 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15020 protein_id gnl|my_center|LOCUS_12370 2484 4130 gene locus_tag LOCUS_12380 gene groL2 2484 4130 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_12380 4280 4750 gene locus_tag LOCUS_12390 4280 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4760 5182 gene locus_tag LOCUS_12400 4760 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5215 5394 gene locus_tag LOCUS_12410 5215 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5401 6114 gene locus_tag LOCUS_12420 5401 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6129 6614 gene locus_tag LOCUS_12430 6129 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7137 6622 gene locus_tag LOCUS_12440 7137 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 7728 7225 gene locus_tag LOCUS_12450 gene ribH 7728 7225 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE53 protein_id gnl|my_center|LOCUS_12450 8978 7725 gene locus_tag LOCUS_12460 gene ribBA 8978 7725 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK05 protein_id gnl|my_center|LOCUS_12460 9985 8975 gene locus_tag LOCUS_12470 9985 8975 CDS product putative bifunctional riboflavin biosynthesis protein RibG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703541.1 protein_id gnl|my_center|LOCUS_12470 11689 10271 gene locus_tag LOCUS_12480 11689 10271 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_12480 11755 12690 gene locus_tag LOCUS_12490 11755 12690 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222343.1 protein_id gnl|my_center|LOCUS_12490 13648 12722 gene locus_tag LOCUS_12500 13648 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 13923 14609 gene locus_tag LOCUS_12510 13923 14609 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_12510 14606 15322 gene locus_tag LOCUS_12520 gene ccmB 14606 15322 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI32 protein_id gnl|my_center|LOCUS_12520 >Feature sequence046 170 334 gene locus_tag LOCUS_12530 gene rpmG 170 334 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7M1 protein_id gnl|my_center|LOCUS_12530 351 424 gene locus_tag LOCUS_t00190 351 424 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 499 795 gene locus_tag LOCUS_12540 499 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 795 1484 gene locus_tag LOCUS_12550 gene nusG 795 1484 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAA6 protein_id gnl|my_center|LOCUS_12550 1534 1959 gene locus_tag LOCUS_12560 gene rplK 1534 1959 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_12560 2073 2774 gene locus_tag LOCUS_12570 2073 2774 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 protein_id gnl|my_center|LOCUS_12570 2994 3518 gene locus_tag LOCUS_12580 gene rplJ 2994 3518 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41103 protein_id gnl|my_center|LOCUS_12580 3597 3974 gene locus_tag LOCUS_12590 3597 3974 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_12590 4402 8079 gene locus_tag LOCUS_12600 gene rpoB 4402 8079 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60281 protein_id gnl|my_center|LOCUS_12600 8153 12028 gene locus_tag LOCUS_12610 gene rpoC 8153 12028 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJT1 protein_id gnl|my_center|LOCUS_12610 12217 12588 gene locus_tag LOCUS_12620 gene rpsL 12217 12588 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4A3 protein_id gnl|my_center|LOCUS_12620 12624 13094 gene locus_tag LOCUS_12630 gene rspG 12624 13094 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0K4 protein_id gnl|my_center|LOCUS_12630 13199 15298 gene locus_tag LOCUS_12640 gene fusA2 13199 15298 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_12640 >Feature sequence047 2 817 gene locus_tag LOCUS_12650 2 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1691 819 gene locus_tag LOCUS_12660 1691 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1727 3265 gene locus_tag LOCUS_12670 gene metG 1727 3265 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF2 protein_id gnl|my_center|LOCUS_12670 3275 4054 gene locus_tag LOCUS_12680 3275 4054 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_12680 4069 4569 gene locus_tag LOCUS_12690 4069 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4580 5431 gene locus_tag LOCUS_12700 gene rsmA 4580 5431 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G6I3 protein_id gnl|my_center|LOCUS_12700 5428 6192 gene locus_tag LOCUS_12710 gene ispE 5428 6192 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8F4 protein_id gnl|my_center|LOCUS_12710 6466 6539 gene locus_tag LOCUS_t00200 6466 6539 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6691 7659 gene locus_tag LOCUS_12720 gene prs 6691 7659 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G5P2 protein_id gnl|my_center|LOCUS_12720 7780 8412 gene locus_tag LOCUS_12730 gene rplY 7780 8412 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3D2 protein_id gnl|my_center|LOCUS_12730 8421 9065 gene locus_tag LOCUS_12740 gene pth 8421 9065 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC75 protein_id gnl|my_center|LOCUS_12740 9131 12529 gene locus_tag LOCUS_12750 gene mfd 9131 12529 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2P1 protein_id gnl|my_center|LOCUS_12750 12532 13461 gene locus_tag LOCUS_12760 12532 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 13461 14783 gene locus_tag LOCUS_12770 13461 14783 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142588.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence048 <1 645 gene locus_tag LOCUS_12780 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228927.1:acyl-CoA dehydrogenase 710 1582 gene locus_tag LOCUS_12790 710 1582 CDS product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_12790 1821 2990 gene locus_tag LOCUS_12800 gene metX 1821 2990 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHP2 protein_id gnl|my_center|LOCUS_12800 3265 2987 gene locus_tag LOCUS_12810 3265 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3480 4070 gene locus_tag LOCUS_12820 3480 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4134 4361 gene locus_tag LOCUS_12830 4134 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4448 5281 gene locus_tag LOCUS_12840 4448 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5325 5400 gene locus_tag LOCUS_t00210 5325 5400 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5850 5440 gene locus_tag LOCUS_12850 5850 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6544 5852 gene locus_tag LOCUS_12860 6544 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6620 7291 gene locus_tag LOCUS_12870 gene trmB 6620 7291 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F305 protein_id gnl|my_center|LOCUS_12870 8348 7299 gene locus_tag LOCUS_12880 8348 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8975 8406 gene locus_tag LOCUS_12890 8975 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9071 9736 gene locus_tag LOCUS_12900 9071 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10990 9737 gene locus_tag LOCUS_12910 10990 9737 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_12910 11968 11000 gene locus_tag LOCUS_12920 11968 11000 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_12920 12107 13366 gene locus_tag LOCUS_12930 12107 13366 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 protein_id gnl|my_center|LOCUS_12930 13407 13838 gene locus_tag LOCUS_12940 13407 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence049 <1 648 gene locus_tag LOCUS_12950 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RG85:dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit 676 987 gene locus_tag LOCUS_12960 676 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805081.1 protein_id gnl|my_center|LOCUS_12960 984 1577 gene locus_tag LOCUS_12970 gene gmk 984 1577 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y1A2 protein_id gnl|my_center|LOCUS_12970 1655 2041 gene locus_tag LOCUS_12980 1655 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2050 3255 gene locus_tag LOCUS_12990 2050 3255 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027808.1 protein_id gnl|my_center|LOCUS_12990 3324 4517 gene locus_tag LOCUS_13000 gene metK 3324 4517 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Y3 protein_id gnl|my_center|LOCUS_13000 4553 6337 gene locus_tag LOCUS_13010 4553 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6598 9315 gene locus_tag LOCUS_13020 gene purL 6598 9315 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT4 protein_id gnl|my_center|LOCUS_13020 9312 10094 gene locus_tag LOCUS_13030 gene purQ 9312 10094 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MV2 protein_id gnl|my_center|LOCUS_13030 10078 11043 gene locus_tag LOCUS_13040 gene purC 10078 11043 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PW0 protein_id gnl|my_center|LOCUS_13040 11040 11564 gene locus_tag LOCUS_13050 11040 11564 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878766.1 protein_id gnl|my_center|LOCUS_13050 11561 13000 gene locus_tag LOCUS_13060 gene purF 11561 13000 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBL2 protein_id gnl|my_center|LOCUS_13060 >Feature sequence050 97 582 gene locus_tag LOCUS_13070 97 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 579 2060 gene locus_tag LOCUS_13080 gene lnt 579 2060 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQF6 protein_id gnl|my_center|LOCUS_13080 2463 2038 gene locus_tag LOCUS_13090 gene dtd 2463 2038 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K143 protein_id gnl|my_center|LOCUS_13090 3037 3333 gene locus_tag LOCUS_13100 3037 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3407 4159 gene locus_tag LOCUS_13110 3407 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4264 5559 gene locus_tag LOCUS_13120 4264 5559 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_13120 5562 6290 gene locus_tag LOCUS_13130 5562 6290 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_13130 6287 7315 gene locus_tag LOCUS_13140 6287 7315 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_13140 7600 8904 gene locus_tag LOCUS_13150 7600 8904 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 protein_id gnl|my_center|LOCUS_13150 8994 9656 gene locus_tag LOCUS_13160 8994 9656 CDS product iron-dependent repressor IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703761.1 protein_id gnl|my_center|LOCUS_13160 9667 10095 gene locus_tag LOCUS_13170 9667 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12286 10106 gene locus_tag LOCUS_13180 12286 10106 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXS5 protein_id gnl|my_center|LOCUS_13180 12353 12880 gene locus_tag LOCUS_13190 12353 12880 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D781 protein_id gnl|my_center|LOCUS_13190 13211 12996 gene locus_tag LOCUS_13200 13211 12996 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422769.1 protein_id gnl|my_center|LOCUS_13200 13442 13783 gene locus_tag LOCUS_13210 13442 13783 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67466 protein_id gnl|my_center|LOCUS_13210 14607 13798 gene locus_tag LOCUS_13220 14607 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence051 692 159 gene locus_tag LOCUS_13230 692 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 749 1570 gene locus_tag LOCUS_13240 749 1570 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_13240 1793 1720 gene locus_tag LOCUS_t00220 1793 1720 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1889 3178 gene locus_tag LOCUS_13250 1889 3178 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083717.1 protein_id gnl|my_center|LOCUS_13250 3393 3181 gene locus_tag LOCUS_13260 3393 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4281 3496 gene locus_tag LOCUS_13270 4281 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4362 5369 gene locus_tag LOCUS_13280 4362 5369 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_13280 5420 6649 gene locus_tag LOCUS_13290 5420 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702264.1 protein_id gnl|my_center|LOCUS_13290 6723 7250 gene locus_tag LOCUS_13300 6723 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7710 7255 gene locus_tag LOCUS_13310 7710 7255 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831103.1 protein_id gnl|my_center|LOCUS_13310 8706 7720 gene locus_tag LOCUS_13320 8706 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8930 8856 gene locus_tag LOCUS_t00230 8930 8856 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 9582 8974 gene locus_tag LOCUS_13330 9582 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9936 9625 gene locus_tag LOCUS_13340 9936 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12413 9933 gene locus_tag LOCUS_13350 gene gyrA 12413 9933 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ1 protein_id gnl|my_center|LOCUS_13350 <14305 12413 gene locus_tag LOCUS_13360 <14305 12413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMJ2:DNA gyrase subunit B >Feature sequence052 1445 2926 gene locus_tag LOCUS_13370 1445 2926 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_13370 3843 2944 gene locus_tag LOCUS_13380 3843 2944 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_13380 3874 4641 gene locus_tag LOCUS_13390 3874 4641 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894024.1 protein_id gnl|my_center|LOCUS_13390 4641 5669 gene locus_tag LOCUS_13400 4641 5669 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_13400 6454 5648 gene locus_tag LOCUS_13410 6454 5648 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_13410 6481 7416 gene locus_tag LOCUS_13420 6481 7416 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704170.1 protein_id gnl|my_center|LOCUS_13420 7502 8713 gene locus_tag LOCUS_13430 7502 8713 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_13430 8725 9747 gene locus_tag LOCUS_13440 8725 9747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_13440 9744 10868 gene locus_tag LOCUS_13450 9744 10868 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224380.1 protein_id gnl|my_center|LOCUS_13450 10871 11293 gene locus_tag LOCUS_13460 10871 11293 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_13460 11290 12483 gene locus_tag LOCUS_13470 11290 12483 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_13470 12480 13712 gene locus_tag LOCUS_13480 12480 13712 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730847.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence053 2623 1409 gene locus_tag LOCUS_13490 2623 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2731 4302 gene locus_tag LOCUS_13500 2731 4302 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919668.1 protein_id gnl|my_center|LOCUS_13500 4349 5242 gene locus_tag LOCUS_13510 4349 5242 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266773.1 protein_id gnl|my_center|LOCUS_13510 5267 6412 gene locus_tag LOCUS_13520 5267 6412 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_13520 6705 7547 gene locus_tag LOCUS_13530 6705 7547 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944890.1 protein_id gnl|my_center|LOCUS_13530 7547 8119 gene locus_tag LOCUS_13540 7547 8119 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965733.1 protein_id gnl|my_center|LOCUS_13540 9267 8116 gene locus_tag LOCUS_13550 9267 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9500 9294 gene locus_tag LOCUS_13560 9500 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 9682 10509 gene locus_tag LOCUS_13570 9682 10509 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703834.1 protein_id gnl|my_center|LOCUS_13570 10512 10841 gene locus_tag LOCUS_13580 10512 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10859 11884 gene locus_tag LOCUS_13590 10859 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12667 11912 gene locus_tag LOCUS_13600 12667 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 <13676 12949 gene locus_tag LOCUS_13610 <13676 12949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001088336.1:phosphomannomutase >Feature sequence054 168 1337 gene locus_tag LOCUS_13620 168 1337 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_13620 2806 1367 gene locus_tag LOCUS_13630 2806 1367 CDS product putative acid-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703051.1 protein_id gnl|my_center|LOCUS_13630 3969 2809 gene locus_tag LOCUS_13640 3969 2809 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416576.1 protein_id gnl|my_center|LOCUS_13640 4646 4011 gene locus_tag LOCUS_13650 4646 4011 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_13650 5926 4643 gene locus_tag LOCUS_13660 5926 4643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_13660 6729 5923 gene locus_tag LOCUS_13670 6729 5923 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730636.1 protein_id gnl|my_center|LOCUS_13670 7221 6760 gene locus_tag LOCUS_13680 7221 6760 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_13680 8324 7245 gene locus_tag LOCUS_13690 8324 7245 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_13690 9076 8321 gene locus_tag LOCUS_13700 9076 8321 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_13700 9975 9073 gene locus_tag LOCUS_13710 9975 9073 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_13710 10745 9978 gene locus_tag LOCUS_13720 10745 9978 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_13720 10815 11585 gene locus_tag LOCUS_13730 10815 11585 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701359.1 protein_id gnl|my_center|LOCUS_13730 11624 12682 gene locus_tag LOCUS_13740 11624 12682 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence055 323 249 gene locus_tag LOCUS_t00240 323 249 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 439 366 gene locus_tag LOCUS_t00250 439 366 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1589 489 gene locus_tag LOCUS_13750 gene recA 1589 489 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD17 protein_id gnl|my_center|LOCUS_13750 1987 1739 gene locus_tag LOCUS_13760 1987 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3558 2179 gene locus_tag LOCUS_13770 3558 2179 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_13770 3686 3760 gene locus_tag LOCUS_t00260 3686 3760 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3840 3915 gene locus_tag LOCUS_t00270 3840 3915 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4849 3944 gene locus_tag LOCUS_13780 gene psuG 4849 3944 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N2 protein_id gnl|my_center|LOCUS_13780 6090 4846 gene locus_tag LOCUS_13790 6090 4846 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_13790 6126 6815 gene locus_tag LOCUS_13800 6126 6815 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_13800 7562 6816 gene locus_tag LOCUS_13810 7562 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8416 7601 gene locus_tag LOCUS_13820 8416 7601 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808019.1 protein_id gnl|my_center|LOCUS_13820 8598 8807 gene locus_tag LOCUS_13830 8598 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9139 8804 gene locus_tag LOCUS_13840 9139 8804 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDG9 protein_id gnl|my_center|LOCUS_13840 9393 9160 gene locus_tag LOCUS_13850 9393 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 9858 9511 gene locus_tag LOCUS_13860 gene rplS 9858 9511 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2Q6 protein_id gnl|my_center|LOCUS_13860 10669 9920 gene locus_tag LOCUS_13870 gene trmD 10669 9920 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX4 protein_id gnl|my_center|LOCUS_13870 11196 10675 gene locus_tag LOCUS_13880 gene rimM 11196 10675 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDI4 protein_id gnl|my_center|LOCUS_13880 11480 11217 gene locus_tag LOCUS_13890 11480 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 11763 11494 gene locus_tag LOCUS_13900 11763 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 <12910 11891 gene locus_tag LOCUS_13910 <12910 11891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein >Feature sequence056 260 1021 gene locus_tag LOCUS_13920 260 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705652.1 protein_id gnl|my_center|LOCUS_13920 1788 1018 gene locus_tag LOCUS_13930 1788 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2431 1778 gene locus_tag LOCUS_13940 2431 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2698 4023 gene locus_tag LOCUS_13950 2698 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5416 4067 gene locus_tag LOCUS_13960 5416 4067 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_13960 5526 6368 gene locus_tag LOCUS_13970 5526 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6381 7409 gene locus_tag LOCUS_13980 6381 7409 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_13980 7580 7392 gene locus_tag LOCUS_13990 7580 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7793 9478 gene locus_tag LOCUS_14000 7793 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 9478 11280 gene locus_tag LOCUS_14010 9478 11280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_14010 11984 11289 gene locus_tag LOCUS_14020 11984 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 <12870 12018 gene locus_tag LOCUS_14030 <12870 12018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027904.1:methionine synthase >Feature sequence057 1708 605 gene locus_tag LOCUS_14040 1708 605 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_14040 1815 2636 gene locus_tag LOCUS_14050 gene tauD 1815 2636 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_14050 4206 2647 gene locus_tag LOCUS_14060 gene fadD3 4206 2647 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_14060 5418 4210 gene locus_tag LOCUS_14070 5418 4210 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_14070 5531 6412 gene locus_tag LOCUS_14080 5531 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704001.1 protein_id gnl|my_center|LOCUS_14080 7205 6414 gene locus_tag LOCUS_14090 7205 6414 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D9X0 protein_id gnl|my_center|LOCUS_14090 7315 8166 gene locus_tag LOCUS_14100 7315 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 9131 8169 gene locus_tag LOCUS_14110 9131 8169 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701346.1 protein_id gnl|my_center|LOCUS_14110 10284 9136 gene locus_tag LOCUS_14120 10284 9136 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence058 1870 1385 gene locus_tag LOCUS_14130 gene rnhA 1870 1385 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73K21 protein_id gnl|my_center|LOCUS_14130 1944 4682 gene locus_tag LOCUS_14140 1944 4682 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY19 protein_id gnl|my_center|LOCUS_14140 5012 4806 gene locus_tag LOCUS_14150 5012 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6247 5069 gene locus_tag LOCUS_14160 6247 5069 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_14160 6490 7281 gene locus_tag LOCUS_14170 6490 7281 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853866.1 protein_id gnl|my_center|LOCUS_14170 8940 7261 gene locus_tag LOCUS_14180 8940 7261 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_14180 9743 8943 gene locus_tag LOCUS_14190 9743 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10636 9779 gene locus_tag LOCUS_14200 10636 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11204 10746 gene locus_tag LOCUS_14210 11204 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence059 260 958 gene locus_tag LOCUS_14220 260 958 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_14220 967 1146 gene locus_tag LOCUS_14230 967 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1149 2078 gene locus_tag LOCUS_14240 1149 2078 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_14240 2026 3444 gene locus_tag LOCUS_14250 2026 3444 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_14250 3588 4856 gene locus_tag LOCUS_14260 gene gltA 3588 4856 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_14260 4912 6510 gene locus_tag LOCUS_14270 4912 6510 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_14270 8520 6511 gene locus_tag LOCUS_14280 8520 6511 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_14280 9499 8507 gene locus_tag LOCUS_14290 9499 8507 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_14290 10816 9599 gene locus_tag LOCUS_14300 gene icd 10816 9599 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWG2 protein_id gnl|my_center|LOCUS_14300 11783 10944 gene locus_tag LOCUS_14310 11783 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12008 11826 gene locus_tag LOCUS_14320 12008 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence060 1379 222 gene locus_tag LOCUS_14330 gene argJ2 1379 222 CDS product arginine biosynthesis bifunctional protein ArgJ 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ET6 protein_id gnl|my_center|LOCUS_14330 2314 1388 gene locus_tag LOCUS_14340 gene dapD 2314 1388 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2G5 protein_id gnl|my_center|LOCUS_14340 3897 2338 gene locus_tag LOCUS_14350 gene lysS 3897 2338 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034W7 protein_id gnl|my_center|LOCUS_14350 4011 5375 gene locus_tag LOCUS_14360 4011 5375 CDS product putative dihydrolipoamide dehydrogenase LpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704384.1 protein_id gnl|my_center|LOCUS_14360 5382 5855 gene locus_tag LOCUS_14370 5382 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6855 5860 gene locus_tag LOCUS_14380 6855 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7423 6875 gene locus_tag LOCUS_14390 7423 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 7491 9515 gene locus_tag LOCUS_14400 7491 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_14400 9602 10816 gene locus_tag LOCUS_14410 9602 10816 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_14410 11434 11883 gene locus_tag LOCUS_14420 11434 11883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence061 <1 611 gene locus_tag LOCUS_14430 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGP2:GMP synthase [glutamine-hydrolyzing] 653 1822 gene locus_tag LOCUS_14440 653 1822 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 protein_id gnl|my_center|LOCUS_14440 1884 2927 gene locus_tag LOCUS_14450 1884 2927 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_14450 2924 3667 gene locus_tag LOCUS_14460 2924 3667 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_14460 4878 3730 gene locus_tag LOCUS_14470 4878 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5365 5805 gene locus_tag LOCUS_14480 5365 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6608 5826 gene locus_tag LOCUS_14490 gene ditI 6608 5826 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_14490 6696 7244 gene locus_tag LOCUS_14500 6696 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7980 7288 gene locus_tag LOCUS_14510 7980 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_14510 9413 8046 gene locus_tag LOCUS_14520 gene mftF 9413 8046 CDS product putative mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMX1 protein_id gnl|my_center|LOCUS_14520 10074 9418 gene locus_tag LOCUS_14530 10074 9418 CDS product mycofactocin system creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727661.1 protein_id gnl|my_center|LOCUS_14530 10877 10071 gene locus_tag LOCUS_14540 10877 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 11186 10893 gene locus_tag LOCUS_14550 11186 10893 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_14550 <11958 11186 gene locus_tag LOCUS_14560 <11958 11186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001287813.1:oxidoreductase >Feature sequence062 104 409 gene locus_tag LOCUS_14570 104 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 417 1208 gene locus_tag LOCUS_14580 gene trpC 417 1208 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU67 protein_id gnl|my_center|LOCUS_14580 1263 1925 gene locus_tag LOCUS_14590 gene trpF 1263 1925 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_14590 1994 3166 gene locus_tag LOCUS_14600 gene trpB 1994 3166 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE26 protein_id gnl|my_center|LOCUS_14600 3166 3948 gene locus_tag LOCUS_14610 gene trpA 3166 3948 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_14610 3966 4268 gene locus_tag LOCUS_14620 3966 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4525 4953 gene locus_tag LOCUS_14630 gene fabZ 4525 4953 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAA2 protein_id gnl|my_center|LOCUS_14630 6125 4950 gene locus_tag LOCUS_14640 gene fabF 6125 4950 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_14640 6364 6125 gene locus_tag LOCUS_14650 gene acpP 6364 6125 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS3 protein_id gnl|my_center|LOCUS_14650 7167 6448 gene locus_tag LOCUS_14660 7167 6448 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_14660 8117 7167 gene locus_tag LOCUS_14670 gene fabH 8117 7167 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHA3 protein_id gnl|my_center|LOCUS_14670 9294 8119 gene locus_tag LOCUS_14680 gene fabD 9294 8119 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71019 protein_id gnl|my_center|LOCUS_14680 9409 9483 gene locus_tag LOCUS_t00280 9409 9483 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9570 9854 gene locus_tag LOCUS_14690 9570 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 9889 10464 gene locus_tag LOCUS_14700 9889 10464 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence063 393 1073 gene locus_tag LOCUS_14710 393 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2659 1070 gene locus_tag LOCUS_14720 gene fadD19 2659 1070 CDS product long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TWB7 protein_id gnl|my_center|LOCUS_14720 3777 2656 gene locus_tag LOCUS_14730 3777 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_14730 4739 3813 gene locus_tag LOCUS_14740 4739 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6320 4773 gene locus_tag LOCUS_14750 6320 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7130 6336 gene locus_tag LOCUS_14760 7130 6336 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_14760 8143 7133 gene locus_tag LOCUS_14770 8143 7133 CDS product myristoyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382988.1 protein_id gnl|my_center|LOCUS_14770 8957 8199 gene locus_tag LOCUS_14780 8957 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 9874 8954 gene locus_tag LOCUS_14790 9874 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 <11701 10022 gene locus_tag LOCUS_14800 <11701 10022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72EX7:adenine deaminase >Feature sequence064 155 2161 gene locus_tag LOCUS_14810 155 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2158 5082 gene locus_tag LOCUS_14820 2158 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5086 6825 gene locus_tag LOCUS_14830 5086 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7459 6827 gene locus_tag LOCUS_14840 gene ung 7459 6827 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39615 protein_id gnl|my_center|LOCUS_14840 7566 8591 gene locus_tag LOCUS_14850 gene dcyD 7566 8591 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5S9 protein_id gnl|my_center|LOCUS_14850 8584 9672 gene locus_tag LOCUS_14860 gene metB 8584 9672 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222013.1 protein_id gnl|my_center|LOCUS_14860 9669 10643 gene locus_tag LOCUS_14870 9669 10643 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence065 736 422 gene locus_tag LOCUS_14880 gene gatC 736 422 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYQ1 protein_id gnl|my_center|LOCUS_14880 2896 746 gene locus_tag LOCUS_14890 gene rafA 2896 746 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 protein_id gnl|my_center|LOCUS_14890 2920 3837 gene locus_tag LOCUS_14900 2920 3837 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3S6 protein_id gnl|my_center|LOCUS_14900 4627 3827 gene locus_tag LOCUS_14910 gene paaG 4627 3827 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_14910 5459 4611 gene locus_tag LOCUS_14920 gene lgt2 5459 4611 CDS product prolipoprotein diacylglyceryl transferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBW3 protein_id gnl|my_center|LOCUS_14920 6229 5456 gene locus_tag LOCUS_14930 6229 5456 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805028.1 protein_id gnl|my_center|LOCUS_14930 7981 6278 gene locus_tag LOCUS_14940 7981 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 8117 9046 gene locus_tag LOCUS_14950 8117 9046 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223903.1 protein_id gnl|my_center|LOCUS_14950 9173 10240 gene locus_tag LOCUS_14960 gene hemE 9173 10240 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4L8 protein_id gnl|my_center|LOCUS_14960 10240 11163 gene locus_tag LOCUS_14970 gene hemH 10240 11163 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32396 protein_id gnl|my_center|LOCUS_14970 >Feature sequence066 1422 907 gene locus_tag LOCUS_14980 1422 907 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067042.1 protein_id gnl|my_center|LOCUS_14980 3139 1487 gene locus_tag LOCUS_14990 gene pyrG 3139 1487 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F61 protein_id gnl|my_center|LOCUS_14990 4815 3220 gene locus_tag LOCUS_15000 gene recN 4815 3220 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC34 protein_id gnl|my_center|LOCUS_15000 5707 4835 gene locus_tag LOCUS_15010 gene nadK 5707 4835 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_15010 6459 5704 gene locus_tag LOCUS_15020 gene tlyA 6459 5704 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJ63 protein_id gnl|my_center|LOCUS_15020 6848 6462 gene locus_tag LOCUS_15030 6848 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7866 6901 gene locus_tag LOCUS_15040 7866 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7779 8978 gene locus_tag LOCUS_15050 7779 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_15050 9879 8992 gene locus_tag LOCUS_15060 9879 8992 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_15060 10608 9970 gene locus_tag LOCUS_15070 10608 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence067 17 183 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaggctgctgtgaagaa 295 1026 gene locus_tag LOCUS_15080 295 1026 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_15080 1019 1708 gene locus_tag LOCUS_15090 1019 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3651 1693 gene locus_tag LOCUS_15100 3651 1693 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTT0 protein_id gnl|my_center|LOCUS_15100 3686 4297 gene locus_tag LOCUS_15110 3686 4297 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 protein_id gnl|my_center|LOCUS_15110 5286 4300 gene locus_tag LOCUS_15120 gene galK 5286 4300 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB97 protein_id gnl|my_center|LOCUS_15120 6191 5283 gene locus_tag LOCUS_15130 6191 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6263 7183 gene locus_tag LOCUS_15140 6263 7183 CDS product putative lipase/esterase LipG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704608.1 protein_id gnl|my_center|LOCUS_15140 7188 8345 gene locus_tag LOCUS_15150 7188 8345 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_15150 8342 9127 gene locus_tag LOCUS_15160 8342 9127 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_15160 9124 9681 gene locus_tag LOCUS_15170 9124 9681 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_15170 9779 9958 gene locus_tag LOCUS_15180 9779 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 9924 10421 gene locus_tag LOCUS_15190 9924 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 10450 10827 gene locus_tag LOCUS_15200 10450 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence068 951 76 gene locus_tag LOCUS_15210 951 76 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_15210 2428 962 gene locus_tag LOCUS_15220 2428 962 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704045.1 protein_id gnl|my_center|LOCUS_15220 3180 2425 gene locus_tag LOCUS_15230 3180 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3764 3288 gene locus_tag LOCUS_15240 gene greA 3764 3288 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADK2 protein_id gnl|my_center|LOCUS_15240 3812 4849 gene locus_tag LOCUS_15250 gene leuB 3812 4849 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_15250 4905 5825 gene locus_tag LOCUS_15260 gene ilvE 4905 5825 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_15260 6878 5880 gene locus_tag LOCUS_15270 gene speB 6878 5880 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_15270 7120 8703 gene locus_tag LOCUS_15280 gene cimA 7120 8703 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86511 protein_id gnl|my_center|LOCUS_15280 8722 9243 gene locus_tag LOCUS_15290 8722 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence069 196 1476 gene locus_tag LOCUS_15300 gene lysA 196 1476 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB5 protein_id gnl|my_center|LOCUS_15300 1587 2849 gene locus_tag LOCUS_15310 1587 2849 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB4 protein_id gnl|my_center|LOCUS_15310 2858 4240 gene locus_tag LOCUS_15320 2858 4240 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_15320 4435 6306 gene locus_tag LOCUS_15330 gene rho 4435 6306 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJR6 protein_id gnl|my_center|LOCUS_15330 6422 6637 gene locus_tag LOCUS_15340 gene rpmE 6422 6637 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXT1 protein_id gnl|my_center|LOCUS_15340 6692 7684 gene locus_tag LOCUS_15350 6692 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7717 8787 gene locus_tag LOCUS_15360 gene prfA 7717 8787 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH89 protein_id gnl|my_center|LOCUS_15360 8800 9681 gene locus_tag LOCUS_15370 gene prmC 8800 9681 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_15370 10756 9731 gene locus_tag LOCUS_15380 10756 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence070 <1 684 gene locus_tag LOCUS_15390 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389280.1:energy-dependent translational throttle protein EttA 684 1004 gene locus_tag LOCUS_15400 684 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1001 1747 gene locus_tag LOCUS_15410 1001 1747 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_15410 1766 3688 gene locus_tag LOCUS_15420 1766 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4769 3639 gene locus_tag LOCUS_15430 4769 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6463 4802 gene locus_tag LOCUS_15440 6463 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6632 8233 gene locus_tag LOCUS_15450 6632 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 8255 8914 gene locus_tag LOCUS_15460 gene nucS 8255 8914 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGZ7 protein_id gnl|my_center|LOCUS_15460 9768 8917 gene locus_tag LOCUS_15470 gene htdY 9768 8917 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_15470 <10745 9822 gene locus_tag LOCUS_15480 <10745 9822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701360.1:putative short-chain dehydrogenase/reductase >Feature sequence071 2377 1244 gene locus_tag LOCUS_15490 2377 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3395 2445 gene locus_tag LOCUS_15500 3395 2445 CDS product putative cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702220.1 protein_id gnl|my_center|LOCUS_15500 4023 3490 gene locus_tag LOCUS_15510 4023 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3973 4449 gene locus_tag LOCUS_15520 gene smpB 3973 4449 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU63 protein_id gnl|my_center|LOCUS_15520 5725 4505 gene locus_tag LOCUS_15530 5725 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 5899 5972 gene locus_tag LOCUS_t00290 5899 5972 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6361 5984 gene locus_tag LOCUS_15540 6361 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_15540 6497 7105 gene locus_tag LOCUS_15550 6497 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 8200 7106 gene locus_tag LOCUS_15560 8200 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 8246 9751 gene locus_tag LOCUS_15570 8246 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence072 <1 694 gene locus_tag LOCUS_15580 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141933.1:cytochrome P450 755 1519 gene locus_tag LOCUS_15590 755 1519 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_15590 1555 2088 gene locus_tag LOCUS_15600 1555 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2085 2723 gene locus_tag LOCUS_15610 2085 2723 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_15610 3544 2744 gene locus_tag LOCUS_15620 3544 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3802 3584 gene locus_tag LOCUS_15630 3802 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5198 3804 gene locus_tag LOCUS_15640 5198 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5885 5235 gene locus_tag LOCUS_15650 5885 5235 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_15650 5967 7610 gene locus_tag LOCUS_15660 5967 7610 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_15660 7607 9052 gene locus_tag LOCUS_15670 7607 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence073 384 1589 gene locus_tag LOCUS_15680 384 1589 CDS product cytochrome P450 hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729646.1 protein_id gnl|my_center|LOCUS_15680 1666 3390 gene locus_tag LOCUS_15690 1666 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3466 4521 gene locus_tag LOCUS_15700 3466 4521 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_15700 4535 5911 gene locus_tag LOCUS_15710 4535 5911 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_15710 6161 7423 gene locus_tag LOCUS_15720 6161 7423 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_15720 8729 7395 gene locus_tag LOCUS_15730 gene murF 8729 7395 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_15730 9897 8767 gene locus_tag LOCUS_15740 9897 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence074 31 212 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgccttcttcttaggagctgc 550 269 gene locus_tag LOCUS_15750 gene hupB 550 269 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947582.1 protein_id gnl|my_center|LOCUS_15750 900 2333 gene locus_tag LOCUS_15760 gene phoH 900 2333 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_15760 2911 3534 gene locus_tag LOCUS_15770 2911 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4481 3486 gene locus_tag LOCUS_15780 4481 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702921.1 protein_id gnl|my_center|LOCUS_15780 5440 4478 gene locus_tag LOCUS_15790 gene pafB 5440 4478 CDS product protein PafB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54076 protein_id gnl|my_center|LOCUS_15790 7028 5454 gene locus_tag LOCUS_15800 gene pgi 7028 5454 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJI5 protein_id gnl|my_center|LOCUS_15800 7179 8036 gene locus_tag LOCUS_15810 7179 8036 CDS product protein RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_15810 8069 8380 gene locus_tag LOCUS_15820 8069 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 9025 8384 gene locus_tag LOCUS_15830 9025 8384 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172993.1 protein_id gnl|my_center|LOCUS_15830 9130 9777 gene locus_tag LOCUS_15840 9130 9777 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence075 461 1549 gene locus_tag LOCUS_15850 461 1549 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_15850 2322 1546 gene locus_tag LOCUS_15860 2322 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2465 3715 gene locus_tag LOCUS_15870 2465 3715 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_15870 3792 4811 gene locus_tag LOCUS_15880 gene asd 3792 4811 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK59 protein_id gnl|my_center|LOCUS_15880 5251 4973 gene locus_tag LOCUS_15890 5251 4973 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_15890 5393 5316 gene locus_tag LOCUS_t00300 5393 5316 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5863 5411 gene locus_tag LOCUS_15900 5863 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6989 5874 gene locus_tag LOCUS_15910 6989 5874 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_15910 7921 6986 gene locus_tag LOCUS_15920 7921 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7954 9336 gene locus_tag LOCUS_15930 7954 9336 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence076 1587 829 gene locus_tag LOCUS_15940 gene recO 1587 829 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_15940 1940 1584 gene locus_tag LOCUS_15950 1940 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2279 2944 gene locus_tag LOCUS_15960 gene uppS 2279 2944 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1G6 protein_id gnl|my_center|LOCUS_15960 3024 4910 gene locus_tag LOCUS_15970 3024 4910 CDS product Rad3-related DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601720.1 protein_id gnl|my_center|LOCUS_15970 5623 4931 gene locus_tag LOCUS_15980 gene regX 5623 4931 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_15980 5954 7240 gene locus_tag LOCUS_15990 gene mtrB 5954 7240 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_15990 7237 7896 gene locus_tag LOCUS_16000 7237 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8749 7910 gene locus_tag LOCUS_16010 8749 7910 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_16010 8893 9285 gene locus_tag LOCUS_16020 8893 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence077 96 539 gene locus_tag LOCUS_16030 96 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703277.1 protein_id gnl|my_center|LOCUS_16030 824 1276 gene locus_tag LOCUS_16040 824 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1295 1978 gene locus_tag LOCUS_16050 1295 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3659 2445 gene locus_tag LOCUS_16060 gene menJ 3659 2445 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRI8 protein_id gnl|my_center|LOCUS_16060 4054 3776 gene locus_tag LOCUS_16070 4054 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4353 4114 gene locus_tag LOCUS_16080 4353 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 4904 5281 gene locus_tag LOCUS_16090 4904 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16090 5303 5926 gene locus_tag LOCUS_16100 5303 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16100 6752 6003 gene locus_tag LOCUS_16110 6752 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 6901 7098 gene locus_tag LOCUS_16120 6901 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16120 7576 7385 gene locus_tag LOCUS_16130 7576 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7826 7611 gene locus_tag LOCUS_16140 7826 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8165 7902 gene locus_tag LOCUS_16150 8165 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8275 9219 gene locus_tag LOCUS_16160 8275 9219 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence078 1360 404 gene locus_tag LOCUS_16170 1360 404 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728080.1 protein_id gnl|my_center|LOCUS_16170 2226 1363 gene locus_tag LOCUS_16180 2226 1363 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_16180 2284 2778 gene locus_tag LOCUS_16190 2284 2778 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_16190 2902 3723 gene locus_tag LOCUS_16200 2902 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4120 6342 gene locus_tag LOCUS_16210 gene fbiC 4120 6342 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP77 protein_id gnl|my_center|LOCUS_16210 7327 6332 gene locus_tag LOCUS_16220 7327 6332 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z530 protein_id gnl|my_center|LOCUS_16220 8311 7343 gene locus_tag LOCUS_16230 gene truB 8311 7343 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD72 protein_id gnl|my_center|LOCUS_16230 8828 8298 gene locus_tag LOCUS_16240 8828 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 9315 8875 gene locus_tag LOCUS_16250 9315 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence079 3409 1673 gene locus_tag LOCUS_16260 3409 1673 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_16260 5895 3484 gene locus_tag LOCUS_16270 5895 3484 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTT7 protein_id gnl|my_center|LOCUS_16270 6155 7024 gene locus_tag LOCUS_16280 6155 7024 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWH9 protein_id gnl|my_center|LOCUS_16280 7021 7761 gene locus_tag LOCUS_16290 7021 7761 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776621.1 protein_id gnl|my_center|LOCUS_16290 7825 8049 gene locus_tag LOCUS_16300 7825 8049 CDS product putative glutaredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704242.1 protein_id gnl|my_center|LOCUS_16300 9109 8153 gene locus_tag LOCUS_16310 9109 8153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225460.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence080 2562 580 gene locus_tag LOCUS_16320 gene dgcA 2562 580 CDS product dimethylglycine catabolism protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_16320 2620 3453 gene locus_tag LOCUS_16330 2620 3453 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_16330 4720 3533 gene locus_tag LOCUS_16340 4720 3533 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_16340 4802 7090 gene locus_tag LOCUS_16350 gene cutL 4802 7090 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_16350 7421 7083 gene locus_tag LOCUS_16360 gene glnB 7421 7083 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64250 protein_id gnl|my_center|LOCUS_16360 8652 7453 gene locus_tag LOCUS_16370 8652 7453 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDJ7 protein_id gnl|my_center|LOCUS_16370 >Feature sequence081 1957 35 gene locus_tag LOCUS_16380 gene sdhA 1957 35 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_16380 2766 1993 gene locus_tag LOCUS_16390 2766 1993 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_16390 3081 2887 gene locus_tag LOCUS_16400 3081 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3042 5420 gene locus_tag LOCUS_16410 gene ppa 3042 5420 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII8 protein_id gnl|my_center|LOCUS_16410 5519 6133 gene locus_tag LOCUS_16420 5519 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6164 6568 gene locus_tag LOCUS_16430 6164 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8623 6578 gene locus_tag LOCUS_16440 8623 6578 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence082 970 521 gene locus_tag LOCUS_16450 gene cdd 970 521 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336862.1 protein_id gnl|my_center|LOCUS_16450 1030 1752 gene locus_tag LOCUS_16460 1030 1752 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405024.1 protein_id gnl|my_center|LOCUS_16460 2202 1756 gene locus_tag LOCUS_16470 gene dut 2202 1756 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NPA9 protein_id gnl|my_center|LOCUS_16470 2284 2817 gene locus_tag LOCUS_16480 gene orn 2284 2817 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY8 protein_id gnl|my_center|LOCUS_16480 2814 3875 gene locus_tag LOCUS_16490 2814 3875 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_16490 3889 5388 gene locus_tag LOCUS_16500 3889 5388 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_16500 5385 6014 gene locus_tag LOCUS_16510 5385 6014 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_16510 6054 8594 gene locus_tag LOCUS_16520 6054 8594 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence083 <1 698 gene locus_tag LOCUS_16530 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776837.1:multidrug ABC transporter ATP-binding protein 1261 1046 gene locus_tag LOCUS_16540 1261 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1236 1634 gene locus_tag LOCUS_16550 1236 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1802 2404 gene locus_tag LOCUS_16560 1802 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2401 3252 gene locus_tag LOCUS_16570 2401 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705002.1 protein_id gnl|my_center|LOCUS_16570 3254 3892 gene locus_tag LOCUS_16580 3254 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4511 3870 gene locus_tag LOCUS_16590 gene pdxH 4511 3870 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_16590 5812 4517 gene locus_tag LOCUS_16600 gene serS 5812 4517 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH8 protein_id gnl|my_center|LOCUS_16600 5960 6838 gene locus_tag LOCUS_16610 5960 6838 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 protein_id gnl|my_center|LOCUS_16610 6835 7572 gene locus_tag LOCUS_16620 6835 7572 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC7 protein_id gnl|my_center|LOCUS_16620 8475 7576 gene locus_tag LOCUS_16630 8475 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence084 46 3198 gene locus_tag LOCUS_16640 gene dnaE 46 3198 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX54 protein_id gnl|my_center|LOCUS_16640 3836 3201 gene locus_tag LOCUS_16650 3836 3201 CDS product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_16650 4355 3846 gene locus_tag LOCUS_16660 4355 3846 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_16660 4658 4900 gene locus_tag LOCUS_16670 4658 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4951 5085 gene locus_tag LOCUS_16680 4951 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5551 5117 gene locus_tag LOCUS_16690 5551 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6329 5646 gene locus_tag LOCUS_16700 6329 5646 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221988.1 protein_id gnl|my_center|LOCUS_16700 8501 6510 gene locus_tag LOCUS_16710 8501 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence085 1576 2340 gene locus_tag LOCUS_16720 1576 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_16720 2751 2341 gene locus_tag LOCUS_16730 2751 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2876 6511 gene locus_tag LOCUS_16740 gene kgd 2876 6511 CDS product alpha-ketoglutarate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_16740 7128 6517 gene locus_tag LOCUS_16750 7128 6517 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence086 252 1469 gene locus_tag LOCUS_16760 252 1469 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_16760 2286 1474 gene locus_tag LOCUS_16770 2286 1474 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_16770 3557 2283 gene locus_tag LOCUS_16780 3557 2283 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_16780 4554 3583 gene locus_tag LOCUS_16790 4554 3583 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_16790 6332 4551 gene locus_tag LOCUS_16800 6332 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 7683 6385 gene locus_tag LOCUS_16810 7683 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence087 2179 1412 gene locus_tag LOCUS_16820 2179 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3657 2308 gene locus_tag LOCUS_16830 gene mprB 3657 2308 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_16830 4364 3657 gene locus_tag LOCUS_16840 gene mprA 4364 3657 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_16840 4442 5704 gene locus_tag LOCUS_16850 4442 5704 CDS product voltage-gated chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_16850 6479 5658 gene locus_tag LOCUS_16860 6479 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7724 6492 gene locus_tag LOCUS_16870 7724 6492 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_16870 7961 7740 gene locus_tag LOCUS_16880 7961 7740 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence088 <1 1086 gene locus_tag LOCUS_16890 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730961.1:acetyl-CoA acetyltransferase 2300 1116 gene locus_tag LOCUS_16900 2300 1116 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_16900 2388 2996 gene locus_tag LOCUS_16910 2388 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703708.1 protein_id gnl|my_center|LOCUS_16910 3871 2969 gene locus_tag LOCUS_16920 3871 2969 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_16920 3900 4649 gene locus_tag LOCUS_16930 3900 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5116 4646 gene locus_tag LOCUS_16940 5116 4646 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_16940 5545 5129 gene locus_tag LOCUS_16950 gene folB 5545 5129 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJU5 protein_id gnl|my_center|LOCUS_16950 7027 5546 gene locus_tag LOCUS_16960 gene gatB 7027 5546 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH0 protein_id gnl|my_center|LOCUS_16960 <8193 7024 gene locus_tag LOCUS_16970 <8193 7024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8G768:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence089 237 641 gene locus_tag LOCUS_16980 237 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2087 690 gene locus_tag LOCUS_16990 2087 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2167 2799 gene locus_tag LOCUS_17000 2167 2799 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703049.1 protein_id gnl|my_center|LOCUS_17000 2816 3757 gene locus_tag LOCUS_17010 2816 3757 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_17010 3788 4579 gene locus_tag LOCUS_17020 3788 4579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_17020 4576 5817 gene locus_tag LOCUS_17030 4576 5817 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_17030 5835 6284 gene locus_tag LOCUS_17040 5835 6284 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_17040 6327 7169 gene locus_tag LOCUS_17050 gene rnz 6327 7169 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_17050 7185 8057 gene locus_tag LOCUS_17060 gene crtR 7185 8057 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence090 <1 783 gene locus_tag LOCUS_17070 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230969.1:ABC transporter ATP-binding protein 780 1529 gene locus_tag LOCUS_17080 780 1529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228284.1 protein_id gnl|my_center|LOCUS_17080 1603 3561 gene locus_tag LOCUS_17090 gene acsA 1603 3561 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X928 protein_id gnl|my_center|LOCUS_17090 3665 5875 gene locus_tag LOCUS_17100 3665 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 7620 5881 gene locus_tag LOCUS_17110 7620 5881 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726743.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17110 7814 7617 gene locus_tag LOCUS_17120 7814 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 >Feature sequence091 1580 1002 gene locus_tag LOCUS_17130 1580 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2299 1892 gene locus_tag LOCUS_17140 gene mscL 2299 1892 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKP7 protein_id gnl|my_center|LOCUS_17140 2373 2552 gene locus_tag LOCUS_17150 2373 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3828 2542 gene locus_tag LOCUS_17160 3828 2542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_17160 3832 5307 gene locus_tag LOCUS_17170 3832 5307 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_17170 5622 5308 gene locus_tag LOCUS_17180 5622 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_17180 6395 5619 gene locus_tag LOCUS_17190 6395 5619 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_17190 6456 7181 gene locus_tag LOCUS_17200 6456 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence092 1117 149 gene locus_tag LOCUS_17210 1117 149 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_17210 1786 1250 gene locus_tag LOCUS_17220 1786 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1952 2176 gene locus_tag LOCUS_17230 1952 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2280 2720 gene locus_tag LOCUS_17240 2280 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2668 2853 gene locus_tag LOCUS_17250 2668 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3207 5030 gene locus_tag LOCUS_17260 3207 5030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932972.1 protein_id gnl|my_center|LOCUS_17260 5027 5464 gene locus_tag LOCUS_17270 5027 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5461 5877 gene locus_tag LOCUS_17280 5461 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5874 7175 gene locus_tag LOCUS_17290 5874 7175 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731195.1 protein_id gnl|my_center|LOCUS_17290 7701 7222 gene locus_tag LOCUS_17300 7701 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702716.1 protein_id gnl|my_center|LOCUS_17300 7943 7698 gene locus_tag LOCUS_17310 7943 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence093 632 114 gene locus_tag LOCUS_17320 632 114 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_17320 757 2391 gene locus_tag LOCUS_17330 757 2391 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_17330 2393 4237 gene locus_tag LOCUS_17340 2393 4237 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_17340 4245 4931 gene locus_tag LOCUS_17350 4245 4931 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459395.1 protein_id gnl|my_center|LOCUS_17350 4931 6022 gene locus_tag LOCUS_17360 4931 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092054.1 protein_id gnl|my_center|LOCUS_17360 6048 6479 gene locus_tag LOCUS_17370 6048 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6504 7295 gene locus_tag LOCUS_17380 gene bdhA 6504 7295 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence094 228 1064 gene locus_tag LOCUS_17390 228 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1057 2298 gene locus_tag LOCUS_17400 1057 2298 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_17400 2343 4019 gene locus_tag LOCUS_17410 2343 4019 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_17410 4063 4239 gene locus_tag LOCUS_17420 4063 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5088 4327 gene locus_tag LOCUS_17430 5088 4327 CDS product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_17430 5921 5085 gene locus_tag LOCUS_17440 5921 5085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_17440 6887 5931 gene locus_tag LOCUS_17450 6887 5931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013329.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence095 1438 575 gene locus_tag LOCUS_17460 gene yedA 1438 575 CDS product putative inner membrane transporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA70 protein_id gnl|my_center|LOCUS_17460 1407 2468 gene locus_tag LOCUS_17470 1407 2468 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 protein_id gnl|my_center|LOCUS_17470 2500 3255 gene locus_tag LOCUS_17480 gene fabG1 2500 3255 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337557.1 protein_id gnl|my_center|LOCUS_17480 4267 3269 gene locus_tag LOCUS_17490 4267 3269 CDS product FMN-linked alkanal monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_17490 4680 4264 gene locus_tag LOCUS_17500 4680 4264 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_17500 6314 4680 gene locus_tag LOCUS_17510 6314 4680 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_17510 6696 6325 gene locus_tag LOCUS_17520 6696 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7341 6829 gene locus_tag LOCUS_17530 7341 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence096 322 62 gene locus_tag LOCUS_17540 322 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1013 938 gene locus_tag LOCUS_t00310 1013 938 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2301 1045 gene locus_tag LOCUS_17550 2301 1045 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_17550 3398 2298 gene locus_tag LOCUS_17560 3398 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730900.1 protein_id gnl|my_center|LOCUS_17560 3591 3516 gene locus_tag LOCUS_t00320 3591 3516 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4763 3657 gene locus_tag LOCUS_17570 4763 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5419 5012 gene locus_tag LOCUS_17580 5419 5012 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106034.1 protein_id gnl|my_center|LOCUS_17580 6833 5475 gene locus_tag LOCUS_17590 6833 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 <7568 6862 gene locus_tag LOCUS_17600 <7568 6862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551438.1:short-chain dehydrogenase/reductase >Feature sequence097 1503 496 gene locus_tag LOCUS_17610 1503 496 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_17610 2459 1500 gene locus_tag LOCUS_17620 2459 1500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_17620 3559 2459 gene locus_tag LOCUS_17630 3559 2459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_17630 5043 3556 gene locus_tag LOCUS_17640 5043 3556 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_17640 6334 5159 gene locus_tag LOCUS_17650 6334 5159 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_17650 7345 6545 gene locus_tag LOCUS_17660 gene kduD 7345 6545 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence098 581 1171 gene locus_tag LOCUS_17670 581 1171 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_17670 1245 1781 gene locus_tag LOCUS_17680 1245 1781 CDS product DUF4916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972186.1 protein_id gnl|my_center|LOCUS_17680 2045 1788 gene locus_tag LOCUS_17690 2045 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2210 3046 gene locus_tag LOCUS_17700 2210 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3446 3060 gene locus_tag LOCUS_17710 3446 3060 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895331.1 protein_id gnl|my_center|LOCUS_17710 6023 3459 gene locus_tag LOCUS_17720 6023 3459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_17720 6765 6025 gene locus_tag LOCUS_17730 6765 6025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_17730 6822 7319 gene locus_tag LOCUS_17740 6822 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence099 1689 685 gene locus_tag LOCUS_17750 gene acoA 1689 685 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 protein_id gnl|my_center|LOCUS_17750 2477 1707 gene locus_tag LOCUS_17760 2477 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3243 2488 gene locus_tag LOCUS_17770 3243 2488 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_17770 4569 3307 gene locus_tag LOCUS_17780 gene acd 4569 3307 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_17780 4687 5373 gene locus_tag LOCUS_17790 4687 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5505 6284 gene locus_tag LOCUS_17800 gene bdhA 5505 6284 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972217.1 protein_id gnl|my_center|LOCUS_17800 6333 7115 gene locus_tag LOCUS_17810 gene bdhA 6333 7115 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972217.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence100 <1 700 gene locus_tag LOCUS_17820 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WQ51:long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase 1044 697 gene locus_tag LOCUS_17830 1044 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1147 2181 gene locus_tag LOCUS_17840 1147 2181 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_17840 3025 2186 gene locus_tag LOCUS_17850 3025 2186 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_17850 3024 3206 gene locus_tag LOCUS_17860 3024 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3293 3970 gene locus_tag LOCUS_17870 3293 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_17870 4039 4956 gene locus_tag LOCUS_17880 4039 4956 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729052.1 protein_id gnl|my_center|LOCUS_17880 6116 5040 gene locus_tag LOCUS_17890 6116 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6625 6113 gene locus_tag LOCUS_17900 6625 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6843 7175 gene locus_tag LOCUS_17910 6843 7175 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence101 <1 1851 gene locus_tag LOCUS_17920 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727588.1:peptidase S15 2335 1874 gene locus_tag LOCUS_17930 2335 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2665 2339 gene locus_tag LOCUS_17940 2665 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2802 2717 gene locus_tag LOCUS_t00330 2802 2717 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3151 2822 gene locus_tag LOCUS_17950 3151 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3239 4177 gene locus_tag LOCUS_17960 3239 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4855 4193 gene locus_tag LOCUS_17970 4855 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896963.1 protein_id gnl|my_center|LOCUS_17970 5190 6278 gene locus_tag LOCUS_17980 gene ychF 5190 6278 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37518 protein_id gnl|my_center|LOCUS_17980 6305 6670 gene locus_tag LOCUS_17990 6305 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence102 312 91 gene locus_tag LOCUS_18000 312 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 624 334 gene locus_tag LOCUS_18010 624 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2060 621 gene locus_tag LOCUS_18020 2060 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_18020 2951 2067 gene locus_tag LOCUS_18030 2951 2067 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_18030 3191 3922 gene locus_tag LOCUS_18040 3191 3922 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_18040 4889 3984 gene locus_tag LOCUS_18050 gene tauD 4889 3984 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_18050 4982 5683 gene locus_tag LOCUS_18060 gene cysH 4982 5683 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0W2 protein_id gnl|my_center|LOCUS_18060 5680 6618 gene locus_tag LOCUS_18070 gene cysD 5680 6618 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1W4 protein_id gnl|my_center|LOCUS_18070 >Feature sequence103 984 451 gene locus_tag LOCUS_18080 984 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2231 999 gene locus_tag LOCUS_18090 gene atoB 2231 999 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_18090 2333 3091 gene locus_tag LOCUS_18100 2333 3091 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_18100 3192 5213 gene locus_tag LOCUS_18110 3192 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5278 6183 gene locus_tag LOCUS_18120 5278 6183 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_18120 6821 6189 gene locus_tag LOCUS_18130 6821 6189 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence104 179 349 gene locus_tag LOCUS_18140 179 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 363 824 gene locus_tag LOCUS_18150 363 824 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_18150 862 1032 gene locus_tag LOCUS_18160 862 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1149 1463 gene locus_tag LOCUS_18170 1149 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1506 1691 gene locus_tag LOCUS_18180 1506 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2304 2474 gene locus_tag LOCUS_18190 2304 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3436 2681 gene locus_tag LOCUS_18200 3436 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3911 4954 gene locus_tag LOCUS_18210 3911 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 protein_id gnl|my_center|LOCUS_18210 4992 6092 gene locus_tag LOCUS_18220 4992 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence105 2 1504 gene locus_tag LOCUS_18230 2 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1510 2226 gene locus_tag LOCUS_18240 1510 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2363 3679 gene locus_tag LOCUS_18250 gene rpsA 2363 3679 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 protein_id gnl|my_center|LOCUS_18250 4309 3680 gene locus_tag LOCUS_18260 4309 3680 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 protein_id gnl|my_center|LOCUS_18260 6102 4309 gene locus_tag LOCUS_18270 6102 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6187 6840 gene locus_tag LOCUS_18280 gene coaE 6187 6840 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_18280 >Feature sequence106 2576 1170 gene locus_tag LOCUS_18290 2576 1170 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_18290 2643 3071 gene locus_tag LOCUS_18300 2643 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4830 3097 gene locus_tag LOCUS_18310 4830 3097 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_18310 4931 5887 gene locus_tag LOCUS_18320 4931 5887 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 protein_id gnl|my_center|LOCUS_18320 5884 6618 gene locus_tag LOCUS_18330 5884 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence107 <1 783 gene locus_tag LOCUS_18340 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KXR2:aspartate carbamoyltransferase 780 2087 gene locus_tag LOCUS_18350 gene pyrC 780 2087 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCJ8 protein_id gnl|my_center|LOCUS_18350 2143 3228 gene locus_tag LOCUS_18360 gene carA 2143 3228 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGA2 protein_id gnl|my_center|LOCUS_18360 >Feature sequence108 2143 908 gene locus_tag LOCUS_18370 gene fadE17 2143 908 CDS product putative acyl-CoA dehydrogenase FadE17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95280 protein_id gnl|my_center|LOCUS_18370 2292 2564 gene locus_tag LOCUS_18380 2292 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2628 4400 gene locus_tag LOCUS_18390 2628 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4564 5937 gene locus_tag LOCUS_18400 4564 5937 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_18400 >Feature sequence109 1746 433 gene locus_tag LOCUS_18410 1746 433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_18410 3460 1781 gene locus_tag LOCUS_18420 3460 1781 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_18420 4680 3523 gene locus_tag LOCUS_18430 4680 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 5626 4712 gene locus_tag LOCUS_18440 5626 4712 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence110 1144 116 gene locus_tag LOCUS_18450 gene selD 1144 116 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ4 protein_id gnl|my_center|LOCUS_18450 2120 1272 gene locus_tag LOCUS_18460 2120 1272 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_18460 3099 2134 gene locus_tag LOCUS_18470 gene rfbB 3099 2134 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_18470 3652 3101 gene locus_tag LOCUS_18480 3652 3101 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_18480 4735 3656 gene locus_tag LOCUS_18490 4735 3656 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_18490 5815 4817 gene locus_tag LOCUS_18500 5815 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence111 607 125 gene locus_tag LOCUS_18510 607 125 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_18510 1347 667 gene locus_tag LOCUS_18520 1347 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1401 3050 gene locus_tag LOCUS_18530 gene alkK 1401 3050 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_18530 3115 3501 gene locus_tag LOCUS_18540 3115 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3571 4980 gene locus_tag LOCUS_18550 3571 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5120 5932 gene locus_tag LOCUS_18560 5120 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence112 1 219 gene locus_tag LOCUS_18570 1 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 859 224 gene locus_tag LOCUS_18580 859 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_18580 2758 884 gene locus_tag LOCUS_18590 2758 884 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_18590 3787 2849 gene locus_tag LOCUS_18600 3787 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4569 4420 gene locus_tag LOCUS_18610 4569 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4523 5053 gene locus_tag LOCUS_18620 4523 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5130 5642 gene locus_tag LOCUS_18630 5130 5642 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIH8 protein_id gnl|my_center|LOCUS_18630 >Feature sequence113 1054 92 gene locus_tag LOCUS_18640 1054 92 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_18640 1146 1937 gene locus_tag LOCUS_18650 1146 1937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_18650 2373 1924 gene locus_tag LOCUS_18660 2373 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3093 2386 gene locus_tag LOCUS_18670 3093 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3248 3173 gene locus_tag LOCUS_t00340 3248 3173 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3897 3304 gene locus_tag LOCUS_18680 3897 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4847 3924 gene locus_tag LOCUS_18690 4847 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C1E8 protein_id gnl|my_center|LOCUS_18690 >Feature sequence114 1281 100 gene locus_tag LOCUS_18700 gene atoB 1281 100 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_18700 1377 2714 gene locus_tag LOCUS_18710 gene qor 1377 2714 CDS product crotonyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_18710 2728 3135 gene locus_tag LOCUS_18720 gene mceE 2728 3135 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_18720 4413 3220 gene locus_tag LOCUS_18730 gene rlmI 4413 3220 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR8 protein_id gnl|my_center|LOCUS_18730 4569 5210 gene locus_tag LOCUS_18740 4569 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence115 982 320 gene locus_tag LOCUS_18750 982 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1613 1894 gene locus_tag LOCUS_18760 1613 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1974 3671 gene locus_tag LOCUS_18770 1974 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3702 4487 gene locus_tag LOCUS_18780 3702 4487 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705355.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence116 865 398 gene locus_tag LOCUS_18790 865 398 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_18790 944 1447 gene locus_tag LOCUS_18800 944 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1618 3954 gene locus_tag LOCUS_18810 gene hrpB 1618 3954 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_18810 3955 4098 gene locus_tag LOCUS_18820 3955 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4091 4258 gene locus_tag LOCUS_18830 4091 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence117 863 789 gene locus_tag LOCUS_t00350 863 789 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1502 933 gene locus_tag LOCUS_18840 1502 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3073 1655 gene locus_tag LOCUS_18850 gene gltX 3073 1655 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86528 protein_id gnl|my_center|LOCUS_18850 3133 3495 gene locus_tag LOCUS_18860 3133 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_18860 3566 4852 gene locus_tag LOCUS_18870 3566 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5381 4845 gene locus_tag LOCUS_18880 5381 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence118 <1 2026 gene locus_tag LOCUS_18890 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DJV1:DNA topoisomerase 1 2023 2646 gene locus_tag LOCUS_18900 gene tmk 2023 2646 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX0 protein_id gnl|my_center|LOCUS_18900 2648 3718 gene locus_tag LOCUS_18910 gene holB 2648 3718 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18910 3784 3859 gene locus_tag LOCUS_t00360 3784 3859 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4169 5026 gene locus_tag LOCUS_18920 4169 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence119 355 756 gene locus_tag LOCUS_18930 355 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 756 2309 gene locus_tag LOCUS_18940 756 2309 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_18940 2415 2978 gene locus_tag LOCUS_18950 2415 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3518 3090 gene locus_tag LOCUS_18960 3518 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 <5120 3563 gene locus_tag LOCUS_18970 <5120 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KY67:DNA helicase >Feature sequence120 <1 1478 gene locus_tag LOCUS_18980 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384739.1:ABC transporter substrate-binding protein 1535 2479 gene locus_tag LOCUS_18990 gene appB 1535 2479 CDS product oligopeptide transport system permease protein AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42062 protein_id gnl|my_center|LOCUS_18990 2476 3381 gene locus_tag LOCUS_19000 2476 3381 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_19000 3378 4445 gene locus_tag LOCUS_19010 3378 4445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence121 1475 2158 gene locus_tag LOCUS_19020 1475 2158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403095.1 protein_id gnl|my_center|LOCUS_19020 2255 4303 gene locus_tag LOCUS_19030 2255 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence122 1603 1100 gene locus_tag LOCUS_19040 1603 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1709 2965 gene locus_tag LOCUS_19050 gene cyp142 1709 2965 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_19050 4361 2991 gene locus_tag LOCUS_19060 4361 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence123 112 2133 gene locus_tag LOCUS_19070 112 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2198 3103 gene locus_tag LOCUS_19080 2198 3103 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_19080 3741 3109 gene locus_tag LOCUS_19090 3741 3109 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_19090 4643 3741 gene locus_tag LOCUS_19100 4643 3741 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence124 758 1708 gene locus_tag LOCUS_19110 758 1708 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141423.1 protein_id gnl|my_center|LOCUS_19110 1727 2143 gene locus_tag LOCUS_19120 1727 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2171 3529 gene locus_tag LOCUS_19130 2171 3529 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_19130 4026 3547 gene locus_tag LOCUS_19140 4026 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4080 4535 gene locus_tag LOCUS_19150 gene mmyY 4080 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039529.1 protein_id gnl|my_center|LOCUS_19150 4924 4619 gene locus_tag LOCUS_19160 4924 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence125 <1 1334 gene locus_tag LOCUS_19170 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703482.1:putative FeS assembly protein SufB 1414 1761 gene locus_tag LOCUS_19180 1414 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1806 2981 gene locus_tag LOCUS_19190 1806 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2978 3301 gene locus_tag LOCUS_19200 2978 3301 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_19200 3298 4089 gene locus_tag LOCUS_19210 gene sufC 3298 4089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 protein_id gnl|my_center|LOCUS_19210 4086 4340 gene locus_tag LOCUS_19220 4086 4340 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZF4 protein_id gnl|my_center|LOCUS_19220 4356 4826 gene locus_tag LOCUS_19230 4356 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence126 408 2663 gene locus_tag LOCUS_19240 408 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence127 597 1838 gene locus_tag LOCUS_19250 597 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 3269 1821 gene locus_tag LOCUS_19260 3269 1821 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9S5 protein_id gnl|my_center|LOCUS_19260 4287 3259 gene locus_tag LOCUS_19270 4287 3259 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_19270 4850 4296 gene locus_tag LOCUS_19280 4850 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence128 3 2078 gene locus_tag LOCUS_19290 3 2078 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979812.1 protein_id gnl|my_center|LOCUS_19290 2095 2244 gene locus_tag LOCUS_19300 2095 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2317 3546 gene locus_tag LOCUS_19310 gene fadA 2317 3546 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_19310 <4610 3553 gene locus_tag LOCUS_19320 <4610 3553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701349.1:putative acyl-CoA dehydrogenase FadE >Feature sequence129 1620 337 gene locus_tag LOCUS_19330 1620 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_19330 2073 2522 gene locus_tag LOCUS_19340 2073 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3146 2697 gene locus_tag LOCUS_19350 3146 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_19350 <4527 3454 gene locus_tag LOCUS_19360 <4527 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546848.1:deoxyribodipyrimidine photo-lyase >Feature sequence130 1252 1713 gene locus_tag LOCUS_19370 1252 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_19370 2424 1921 gene locus_tag LOCUS_19380 2424 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2378 2698 gene locus_tag LOCUS_19390 2378 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3922 3077 gene locus_tag LOCUS_19400 3922 3077 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700858.1 protein_id gnl|my_center|LOCUS_19400 <4509 3919 gene locus_tag LOCUS_19410 <4509 3919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893406.1:LLM class F420-dependent oxidoreductase >Feature sequence131 2033 1125 gene locus_tag LOCUS_19420 2033 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2779 2078 gene locus_tag LOCUS_19430 2779 2078 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920657.1 protein_id gnl|my_center|LOCUS_19430 3200 2811 gene locus_tag LOCUS_19440 3200 2811 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_19440 3433 3197 gene locus_tag LOCUS_19450 3433 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3738 3454 gene locus_tag LOCUS_19460 3738 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4323 3811 gene locus_tag LOCUS_19470 4323 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence132 155 754 gene locus_tag LOCUS_19480 155 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19480 835 2217 gene locus_tag LOCUS_19490 835 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19490 3520 2219 gene locus_tag LOCUS_19500 3520 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence133 <1 985 gene locus_tag LOCUS_19510 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004111673.1:ABC transporter ATP-binding protein 1031 1939 gene locus_tag LOCUS_19520 1031 1939 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224861.1 protein_id gnl|my_center|LOCUS_19520 1956 2774 gene locus_tag LOCUS_19530 1956 2774 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_19530 <4247 2775 gene locus_tag LOCUS_19540 <4247 2775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FBN4:fumarate hydratase class I >Feature sequence134 <1 973 gene locus_tag LOCUS_19550 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WB45:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase 2159 981 gene locus_tag LOCUS_19560 2159 981 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_19560 2908 2171 gene locus_tag LOCUS_19570 gene ubiE 2908 2171 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_19570 >Feature sequence135 1209 415 gene locus_tag LOCUS_19580 1209 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_19580 1351 2274 gene locus_tag LOCUS_19590 1351 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3337 2342 gene locus_tag LOCUS_19600 3337 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039772.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence136 3178 1277 gene locus_tag LOCUS_19610 3178 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence137 33 1178 gene locus_tag LOCUS_19620 33 1178 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030375.1 protein_id gnl|my_center|LOCUS_19620 1247 2260 gene locus_tag LOCUS_19630 1247 2260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_19630 2257 3078 gene locus_tag LOCUS_19640 2257 3078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_19640 <4136 3097 gene locus_tag LOCUS_19650 <4136 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898547.1:arylsulfatase AtsD >Feature sequence138 1485 487 gene locus_tag LOCUS_19660 1485 487 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_19660 1538 3190 gene locus_tag LOCUS_19670 1538 3190 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_19670 <4095 3187 gene locus_tag LOCUS_19680 <4095 3187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229261.1:acyl-CoA dehydrogenase >Feature sequence139 2094 1066 gene locus_tag LOCUS_19690 2094 1066 CDS product putative luciferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703549.1 protein_id gnl|my_center|LOCUS_19690 3587 2103 gene locus_tag LOCUS_19700 gene mmsA 3587 2103 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228410.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence140 <1 860 gene locus_tag LOCUS_19710 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222030.1:citrate lyase subunit beta 874 1740 gene locus_tag LOCUS_19720 gene citE 874 1740 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_19720 2410 1742 gene locus_tag LOCUS_19730 2410 1742 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_19730 2511 3863 gene locus_tag LOCUS_19740 2511 3863 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702442.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence141 694 1155 gene locus_tag LOCUS_19750 694 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1598 1110 gene locus_tag LOCUS_19760 1598 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1782 1588 gene locus_tag LOCUS_19770 1782 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1721 3001 gene locus_tag LOCUS_19780 gene argG 1721 3001 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24532 protein_id gnl|my_center|LOCUS_19780 <4052 3009 gene locus_tag LOCUS_19790 <4052 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225315.1:glutamate carboxypeptidase >Feature sequence142 1468 497 gene locus_tag LOCUS_19800 1468 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2360 1503 gene locus_tag LOCUS_19810 2360 1503 CDS product scramblase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_19810 2916 2401 gene locus_tag LOCUS_19820 2916 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3760 2927 gene locus_tag LOCUS_19830 gene mesJ 3760 2927 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJR2 protein_id gnl|my_center|LOCUS_19830 >Feature sequence143 2347 1502 gene locus_tag LOCUS_19840 gene tauD 2347 1502 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_19840 2379 2864 gene locus_tag LOCUS_19850 2379 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence144 1540 2430 gene locus_tag LOCUS_19860 1540 2430 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_19860 2598 3614 gene locus_tag LOCUS_19870 2598 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence145 <1 917 gene locus_tag LOCUS_19880 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225715.1:acyl-CoA dehydrogenase 1018 1467 gene locus_tag LOCUS_19890 1018 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2842 1472 gene locus_tag LOCUS_19900 2842 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence146 2065 692 gene locus_tag LOCUS_19910 2065 692 CDS product proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence147 209 472 gene locus_tag LOCUS_19920 209 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 488 1249 gene locus_tag LOCUS_19930 488 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2291 1311 gene locus_tag LOCUS_19940 2291 1311 CDS product succinoglycan biosynthesis protein exoa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528102.1 protein_id gnl|my_center|LOCUS_19940 3693 2305 gene locus_tag LOCUS_19950 3693 2305 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence148 259 1464 gene locus_tag LOCUS_19960 259 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence149 <1 841 gene locus_tag LOCUS_19970 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q939D2:catalase-peroxidase 957 1985 gene locus_tag LOCUS_19980 957 1985 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_19980 1989 2933 gene locus_tag LOCUS_19990 1989 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3784 3143 gene locus_tag LOCUS_20000 3784 3143 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence150 2896 1568 gene locus_tag LOCUS_20010 2896 1568 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence151 1102 131 gene locus_tag LOCUS_20020 gene galE 1102 131 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_20020 2058 1099 gene locus_tag LOCUS_20030 2058 1099 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_20030 3344 2061 gene locus_tag LOCUS_20040 gene ugd 3344 2061 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222056.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence152 163 747 gene locus_tag LOCUS_20050 163 747 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_20050 795 2222 gene locus_tag LOCUS_20060 795 2222 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_20060 2350 3480 gene locus_tag LOCUS_20070 gene potA 2350 3480 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXF4 protein_id gnl|my_center|LOCUS_20070 >Feature sequence153 <1 1058 gene locus_tag LOCUS_20080 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ADG6:sulfate adenylyltransferase subunit 1 1055 1666 gene locus_tag LOCUS_20090 1055 1666 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_20090 1663 2403 gene locus_tag LOCUS_20100 1663 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2405 2662 gene locus_tag LOCUS_20110 2405 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence154 1505 477 gene locus_tag LOCUS_20120 1505 477 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893406.1 protein_id gnl|my_center|LOCUS_20120 1590 2567 gene locus_tag LOCUS_20130 1590 2567 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_20130 2564 3193 gene locus_tag LOCUS_20140 2564 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence155 <1 1945 gene locus_tag LOCUS_20150 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WFC7:UvrABC system protein B >Feature sequence156 646 140 gene locus_tag LOCUS_20160 646 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 840 685 gene locus_tag LOCUS_20170 840 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 962 1498 gene locus_tag LOCUS_20180 962 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1501 2271 gene locus_tag LOCUS_20190 1501 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 <3388 2272 gene locus_tag LOCUS_20200 <3388 2272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207010.1:molybdopterin oxidoreductase >Feature sequence157 2096 3223 gene locus_tag LOCUS_20210 gene rsgA 2096 3223 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBT9 protein_id gnl|my_center|LOCUS_20210 >Feature sequence158 145 759 gene locus_tag LOCUS_20220 145 759 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 protein_id gnl|my_center|LOCUS_20220 2348 753 gene locus_tag LOCUS_20230 gene caiA 2348 753 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_20230 2508 3143 gene locus_tag LOCUS_20240 2508 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence159 1117 1974 gene locus_tag LOCUS_20250 1117 1974 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_20250 3198 1963 gene locus_tag LOCUS_20260 gene hipO 3198 1963 CDS product hippurate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence160 985 2160 gene locus_tag LOCUS_20270 gene fadE26 985 2160 CDS product acyl-CoA dehydrogenase FadE26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YCA3 protein_id gnl|my_center|LOCUS_20270 2160 3209 gene locus_tag LOCUS_20280 2160 3209 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence161 641 1912 gene locus_tag LOCUS_20290 641 1912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_20290 1986 1913 gene locus_tag LOCUS_t00370 1986 1913 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence162 224 2581 gene locus_tag LOCUS_20300 224 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20300 >Feature sequence163 460 831 gene locus_tag LOCUS_20310 460 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 831 2033 gene locus_tag LOCUS_20320 831 2033 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 protein_id gnl|my_center|LOCUS_20320 <2969 2054 gene locus_tag LOCUS_20330 <2969 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QV47:UPF0061 protein >Feature sequence164 <1 2052 gene locus_tag LOCUS_20340 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403397.1:arylsulfatase >Feature sequence165 1 282 gene locus_tag LOCUS_20350 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 449 1003 gene locus_tag LOCUS_20360 449 1003 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_20360 1626 1138 gene locus_tag LOCUS_20370 1626 1138 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA5 protein_id gnl|my_center|LOCUS_20370 1708 1790 gene locus_tag LOCUS_t00380 1708 1790 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2435 1881 gene locus_tag LOCUS_20380 2435 1881 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083935.1 protein_id gnl|my_center|LOCUS_20380 2513 2586 gene locus_tag LOCUS_t00390 2513 2586 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2643 2717 gene locus_tag LOCUS_t00400 2643 2717 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 1847 981 gene locus_tag LOCUS_20390 1847 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2348 1872 gene locus_tag LOCUS_20400 2348 1872 CDS product putative mutator protein MutT3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704948.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence167 1606 2592 gene locus_tag LOCUS_20410 gene glpX 1606 2592 CDS product fructose-1,6-bisphosphatase class 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN21 protein_id gnl|my_center|LOCUS_20410 >Feature sequence168 587 1372 gene locus_tag LOCUS_20420 587 1372 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731216.1 protein_id gnl|my_center|LOCUS_20420 1404 1787 gene locus_tag LOCUS_20430 1404 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920166.1 protein_id gnl|my_center|LOCUS_20430 <2769 1791 gene locus_tag LOCUS_20440 <2769 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223791.1:hydroxylase >Feature sequence169 <1 908 gene locus_tag LOCUS_20450 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MKW9:dihydroxy-acid dehydratase 1273 905 gene locus_tag LOCUS_20460 1273 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 <2755 1270 gene locus_tag LOCUS_20470 <2755 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256094.1:formate dehydrogenase >Feature sequence170 2496 13 gene locus_tag LOCUS_20480 gene clpB 2496 13 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence171 571 1554 gene locus_tag LOCUS_20490 gene fabH 571 1554 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence172 <1 1615 gene locus_tag LOCUS_20500 <1 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MIX5:chaperone protein DnaK 1626 2141 gene locus_tag LOCUS_20510 1626 2141 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence173 398 1093 gene locus_tag LOCUS_20520 398 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLE7 protein_id gnl|my_center|LOCUS_20520 1115 1936 gene locus_tag LOCUS_20530 1115 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701453.1 protein_id gnl|my_center|LOCUS_20530 2252 2521 gene locus_tag LOCUS_20540 2252 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence174 <1 978 gene locus_tag LOCUS_20550 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030099.1:peptidase 1190 1103 gene locus_tag LOCUS_t00410 1190 1103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1630 1202 gene locus_tag LOCUS_20560 gene tadA 1630 1202 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_20560 1747 1660 gene locus_tag LOCUS_t00420 1747 1660 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <2595 1921 gene locus_tag LOCUS_20570 <2595 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175760.1:DNA polymerase I >Feature sequence175 238 1905 gene locus_tag LOCUS_20580 238 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence176 915 1745 gene locus_tag LOCUS_20590 915 1745 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701582.1 protein_id gnl|my_center|LOCUS_20590 <2562 1761 gene locus_tag LOCUS_20600 <2562 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583525.1:ABC transporter ATP-binding protein >Feature sequence177 2045 1002 gene locus_tag LOCUS_20610 2045 1002 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583990.1 protein_id gnl|my_center|LOCUS_20610 <2545 2042 gene locus_tag LOCUS_20620 <2545 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085058.1:sugar ABC transporter ATP-binding protein >Feature sequence178 >Feature sequence179 >Feature sequence180 <1 726 gene locus_tag LOCUS_20630 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYQ5:tyrosine recombinase XerD 864 1184 gene locus_tag LOCUS_20640 864 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2177 1188 gene locus_tag LOCUS_20650 gene trpS 2177 1188 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX76 protein_id gnl|my_center|LOCUS_20650 >Feature sequence181 1763 540 gene locus_tag LOCUS_20660 1763 540 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_20660 1839 2249 gene locus_tag LOCUS_20670 1839 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence182 771 376 gene locus_tag LOCUS_20680 771 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1006 773 gene locus_tag LOCUS_20690 1006 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1838 993 gene locus_tag LOCUS_20700 1838 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2470 1835 gene locus_tag LOCUS_20710 2470 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence183 <2457 1343 gene locus_tag LOCUS_20720 <2457 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DC86:UvrABC system protein A >Feature sequence184 <1 1551 gene locus_tag LOCUS_20730 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259393.1:glycoside hydrolase 2377 1601 gene locus_tag LOCUS_20740 2377 1601 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence185 1106 1909 gene locus_tag LOCUS_20750 1106 1909 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence186 305 1303 gene locus_tag LOCUS_20760 305 1303 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865093.1 protein_id gnl|my_center|LOCUS_20760 1300 2049 gene locus_tag LOCUS_20770 1300 2049 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence187 321 52 gene locus_tag LOCUS_20780 321 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 470 2413 gene locus_tag LOCUS_20790 gene ptrB 470 2413 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence188 668 81 gene locus_tag LOCUS_20800 668 81 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_20800 986 708 gene locus_tag LOCUS_20810 986 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1046 1774 gene locus_tag LOCUS_20820 gene echA6 1046 1774 CDS product putative enoyl-CoA hydratase echA6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64015 protein_id gnl|my_center|LOCUS_20820 2086 1775 gene locus_tag LOCUS_20830 2086 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence189 <2355 1387 gene locus_tag LOCUS_20840 <2355 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807814.1:D-aminoacylase >Feature sequence190 966 316 gene locus_tag LOCUS_20850 966 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1839 1063 gene locus_tag LOCUS_20860 1839 1063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence191 <1 1009 gene locus_tag LOCUS_20870 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228113.1:ferredoxin--nitrite reductase 1035 1550 gene locus_tag LOCUS_20880 gene mmyF 1035 1550 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_20880 1557 1931 gene locus_tag LOCUS_20890 1557 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence192 >Feature sequence193 260 1111 gene locus_tag LOCUS_20900 260 1111 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence194 931 236 gene locus_tag LOCUS_20910 gene birA 931 236 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222884.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence195 1 846 gene locus_tag LOCUS_20920 1 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1692 868 gene locus_tag LOCUS_20930 1692 868 CDS product UPF0176 protein Cgl2992/cg3319 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLF0 protein_id gnl|my_center|LOCUS_20930 >Feature sequence196 1655 213 gene locus_tag LOCUS_20940 1655 213 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195250.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence197 1467 124 gene locus_tag LOCUS_20950 1467 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2135 1467 gene locus_tag LOCUS_20960 2135 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence198 815 1429 gene locus_tag LOCUS_20970 815 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence199 1432 257 gene locus_tag LOCUS_20980 1432 257 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_20980 <2046 1510 gene locus_tag LOCUS_20990 <2046 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255994.1:glycosyl transferase family 1 >Feature sequence200 678 22 gene locus_tag LOCUS_21000 678 22 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228072.1 protein_id gnl|my_center|LOCUS_21000 1339 701 gene locus_tag LOCUS_21010 1339 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence201 1384 83 gene locus_tag LOCUS_21020 1384 83 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_21020 <2010 1381 gene locus_tag LOCUS_21030 <2010 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437556.1:electron transfer flavoprotein subunit alpha >Feature sequence202 >Feature sequence203 186 1196 gene locus_tag LOCUS_21040 186 1196 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_21040 <1970 1226 gene locus_tag LOCUS_21050 <1970 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFW7:endonuclease III >Feature sequence204 859 23 gene locus_tag LOCUS_21060 859 23 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226182.1 protein_id gnl|my_center|LOCUS_21060 <1969 856 gene locus_tag LOCUS_21070 <1969 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730669.1:cyclohexanecarboxylate-CoA ligase >Feature sequence205 237 1382 gene locus_tag LOCUS_21080 237 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence206 >Feature sequence207 <1 1519 gene locus_tag LOCUS_21090 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S1N4:DNA primase >Feature sequence208 540 1766 gene locus_tag LOCUS_21100 540 1766 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence209 <1 931 gene locus_tag LOCUS_21110 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085536.1:alkyl sulfatase >Feature sequence210 2 1489 gene locus_tag LOCUS_21120 2 1489 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888686.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence211 706 1641 gene locus_tag LOCUS_21130 706 1641 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence212 >Feature sequence213 268 1158 gene locus_tag LOCUS_21140 268 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1155 1769 gene locus_tag LOCUS_21150 1155 1769 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence214 1004 1549 gene locus_tag LOCUS_21160 1004 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence215 2 1141 gene locus_tag LOCUS_21170 2 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence216 1217 42 gene locus_tag LOCUS_21180 1217 42 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence217 >Feature sequence218 <1710 723 gene locus_tag LOCUS_21190 <1710 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WAH7:RNA polymerase sigma factor SigA >Feature sequence219 >Feature sequence220 749 354 gene locus_tag LOCUS_21200 749 354 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729471.1 protein_id gnl|my_center|LOCUS_21200 <1687 746 gene locus_tag LOCUS_21210 <1687 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268040.1:2OG-Fe(II) oxygenase >Feature sequence221 <1 981 gene locus_tag LOCUS_21220 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086140.1:ABC transporter ATP-binding protein >Feature sequence222 917 480 gene locus_tag LOCUS_21230 917 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1050 1319 gene locus_tag LOCUS_21240 1050 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence223 52 729 gene locus_tag LOCUS_21250 52 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence224 345 46 gene locus_tag LOCUS_21260 345 46 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_21260 1165 557 gene locus_tag LOCUS_21270 gene recR 1165 557 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_21270 >Feature sequence225 1014 181 gene locus_tag LOCUS_21280 1014 181 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807972.1 protein_id gnl|my_center|LOCUS_21280 <1621 1025 gene locus_tag LOCUS_21290 <1621 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090531.1:acyl-CoA synthetase >Feature sequence226 589 173 gene locus_tag LOCUS_21300 589 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1460 681 gene locus_tag LOCUS_21310 1460 681 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726748.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence227 1 1347 gene locus_tag LOCUS_21320 1 1347 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence228 >Feature sequence229 1552 773 gene locus_tag LOCUS_21330 1552 773 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence230 <1 515 gene locus_tag LOCUS_21340 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704696.1:putative sulfotransferase >Feature sequence231 >Feature sequence232 >Feature sequence233 604 822 gene locus_tag LOCUS_21350 604 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 822 1172 gene locus_tag LOCUS_21360 gene mazF9 822 1172 CDS product endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71650 protein_id gnl|my_center|LOCUS_21360 >Feature sequence234 <1 916 gene locus_tag LOCUS_21370 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KZV0:mycothiol acetyltransferase >Feature sequence235 259 942 gene locus_tag LOCUS_21380 gene rnhB 259 942 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_21380 >Feature sequence236 716 306 gene locus_tag LOCUS_21390 716 306 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_21390 1437 724 gene locus_tag LOCUS_21400 1437 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence237 491 1009 gene locus_tag LOCUS_21410 491 1009 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence238 >Feature sequence239 391 1011 gene locus_tag LOCUS_21420 391 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence240 333 647 gene locus_tag LOCUS_21430 333 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105135.1 protein_id gnl|my_center|LOCUS_21430 1397 678 gene locus_tag LOCUS_21440 1397 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence241 >Feature sequence242 >Feature sequence243 <1 676 gene locus_tag LOCUS_21450 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728079.1:sugar phosphate isomerase >Feature sequence244 13 366 gene locus_tag LOCUS_21460 13 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 <1363 350 gene locus_tag LOCUS_21470 <1363 350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFY6:putative dual-specificity RNA methyltransferase RlmN >Feature sequence245 1137 40 gene locus_tag LOCUS_21480 1137 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence246 >Feature sequence247 49 1197 gene locus_tag LOCUS_21490 49 1197 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728242.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence248 363 1274 gene locus_tag LOCUS_21500 363 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence249 <1285 446 gene locus_tag LOCUS_21510 <1285 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJR3:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence250 1280 918 gene locus_tag LOCUS_21520 1280 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence251 50 844 gene locus_tag LOCUS_21530 50 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence252 1223 450 gene locus_tag LOCUS_21540 1223 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence253 >Feature sequence254 >Feature sequence255 185 982 gene locus_tag LOCUS_21550 185 982 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence256 >Feature sequence257 690 25 gene locus_tag LOCUS_21560 690 25 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence258 >Feature sequence259 >Feature sequence260 >Feature sequence261 >Feature sequence262 >Feature sequence263 <1058 448 gene locus_tag LOCUS_21570 <1058 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730113.1:cytochrome P450 >Feature sequence264 785 663 gene locus_tag LOCUS_21580 785 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 983 807 gene locus_tag LOCUS_21590 983 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence265 <1049 403 gene locus_tag LOCUS_21600 <1049 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010218977.1:hydrolase >Feature sequence266 64 140 gene locus_tag LOCUS_t00430 64 140 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 292 368 gene locus_tag LOCUS_t00440 292 368 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267