>Feature sequence001 1081 239 gene locus_tag LOCUS_00010 1081 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4326 1261 gene locus_tag LOCUS_00020 4326 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4524 5552 gene locus_tag LOCUS_00030 4524 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5633 6907 gene locus_tag LOCUS_00040 5633 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7555 8019 gene locus_tag LOCUS_00050 7555 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9943 8186 gene locus_tag LOCUS_00060 9943 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10459 10079 gene locus_tag LOCUS_00070 gene gcvH 10459 10079 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00070 14717 10590 gene locus_tag LOCUS_00080 14717 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 18089 14721 gene locus_tag LOCUS_00090 18089 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 18961 18356 gene locus_tag LOCUS_00100 gene ruvA 18961 18356 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFR0 protein_id gnl|my_center|LOCUS_00100 19246 19319 gene locus_tag LOCUS_t00010 19246 19319 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20430 19396 gene locus_tag LOCUS_00110 20430 19396 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_00110 21059 23713 gene locus_tag LOCUS_00120 21059 23713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 23962 24552 gene locus_tag LOCUS_00130 23962 24552 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_00130 24718 25749 gene locus_tag LOCUS_00140 24718 25749 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_00140 25821 29246 gene locus_tag LOCUS_00150 25821 29246 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_00150 29271 30728 gene locus_tag LOCUS_00160 29271 30728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_00160 >Feature sequence002 859 320 gene locus_tag LOCUS_00170 859 320 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_00170 951 1379 gene locus_tag LOCUS_00180 951 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 1961 1407 gene locus_tag LOCUS_00190 1961 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 2041 3372 gene locus_tag LOCUS_00200 2041 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_00200 3986 3384 gene locus_tag LOCUS_00210 3986 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 4252 4830 gene locus_tag LOCUS_00220 4252 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 4803 5225 gene locus_tag LOCUS_00230 4803 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 5222 6127 gene locus_tag LOCUS_00240 5222 6127 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_00240 7927 6194 gene locus_tag LOCUS_00250 7927 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 10860 8752 gene locus_tag LOCUS_00260 10860 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11202 12464 gene locus_tag LOCUS_00270 11202 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 12500 13390 gene locus_tag LOCUS_00280 12500 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 13404 14462 gene locus_tag LOCUS_00290 13404 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 14459 15403 gene locus_tag LOCUS_00300 14459 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 15583 16590 gene locus_tag LOCUS_00310 15583 16590 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_00310 16659 17639 gene locus_tag LOCUS_00320 16659 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 17765 18841 gene locus_tag LOCUS_00330 17765 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 18886 19977 gene locus_tag LOCUS_00340 18886 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20045 20548 gene locus_tag LOCUS_00350 20045 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00350 20567 20947 gene locus_tag LOCUS_00360 20567 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00360 21679 21344 gene locus_tag LOCUS_00370 21679 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 22033 22278 gene locus_tag LOCUS_00380 22033 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 22958 22272 gene locus_tag LOCUS_00390 22958 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 >Feature sequence003 987 2171 gene locus_tag LOCUS_00400 987 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 3395 2325 gene locus_tag LOCUS_00410 gene fjo30 3395 2325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00410 3879 3400 gene locus_tag LOCUS_00420 3879 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_00420 5012 3936 gene locus_tag LOCUS_00430 5012 3936 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z20 protein_id gnl|my_center|LOCUS_00430 5241 6098 gene locus_tag LOCUS_00440 gene prmC 5241 6098 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D7 protein_id gnl|my_center|LOCUS_00440 6231 6157 gene locus_tag LOCUS_t00020 6231 6157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7712 6267 gene locus_tag LOCUS_00450 7712 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 8192 12184 gene locus_tag LOCUS_00460 8192 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 12587 14347 gene locus_tag LOCUS_00470 12587 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 14515 15006 gene locus_tag LOCUS_00480 gene sixA 14515 15006 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_00480 15120 17204 gene locus_tag LOCUS_00490 gene ppk 15120 17204 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_00490 17735 17487 gene locus_tag LOCUS_00500 17735 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 18946 17801 gene locus_tag LOCUS_00510 18946 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence004 <1 679 gene locus_tag LOCUS_00520 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787927.1:magnesium chelatase subunit I 4177 836 gene locus_tag LOCUS_00530 4177 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5376 4345 gene locus_tag LOCUS_00540 5376 4345 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_00540 6185 5460 gene locus_tag LOCUS_00550 gene pdxJ 6185 5460 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_00550 6361 6822 gene locus_tag LOCUS_00560 6361 6822 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_00560 6934 7488 gene locus_tag LOCUS_00570 6934 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 7525 8106 gene locus_tag LOCUS_00580 gene pabA 7525 8106 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 protein_id gnl|my_center|LOCUS_00580 8326 9108 gene locus_tag LOCUS_00590 gene pcbD 8326 9108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_00590 9321 9995 gene locus_tag LOCUS_00600 9321 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10003 11457 gene locus_tag LOCUS_00610 10003 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 11527 12420 gene locus_tag LOCUS_00620 gene nadK 11527 12420 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_00620 12570 13451 gene locus_tag LOCUS_00630 12570 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13590 14246 gene locus_tag LOCUS_00640 13590 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_00640 14378 15124 gene locus_tag LOCUS_00650 gene uppS 14378 15124 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_00650 15239 17749 gene locus_tag LOCUS_00660 15239 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17786 18484 gene locus_tag LOCUS_00670 17786 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 18524 19156 gene locus_tag LOCUS_00680 18524 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 266 1306 gene locus_tag LOCUS_00690 266 1306 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_00690 1479 2750 gene locus_tag LOCUS_00700 1479 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2983 3624 gene locus_tag LOCUS_00710 2983 3624 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_00710 3711 4010 gene locus_tag LOCUS_00720 3711 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4030 4614 gene locus_tag LOCUS_00730 gene gmk 4030 4614 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_00730 4785 5360 gene locus_tag LOCUS_00740 gene nadD 4785 5360 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY0 protein_id gnl|my_center|LOCUS_00740 5993 5430 gene locus_tag LOCUS_00750 gene frr 5993 5430 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_00750 6890 6099 gene locus_tag LOCUS_00760 gene pyrH 6890 6099 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_00760 7470 6967 gene locus_tag LOCUS_00770 gene pycA 7470 6967 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_00770 7591 10119 gene locus_tag LOCUS_00780 7591 10119 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_00780 10293 10373 gene locus_tag LOCUS_t00030 10293 10373 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 10450 10523 gene locus_tag LOCUS_t00040 10450 10523 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10616 10688 gene locus_tag LOCUS_t00050 10616 10688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10845 12035 gene locus_tag LOCUS_00790 gene tuf 10845 12035 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_00790 12678 12749 gene locus_tag LOCUS_t00060 12678 12749 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12812 13006 gene locus_tag LOCUS_00800 12812 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 13026 13589 gene locus_tag LOCUS_00810 gene nusG 13026 13589 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_00810 13747 14190 gene locus_tag LOCUS_00820 gene rplK 13747 14190 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_00820 14211 14909 gene locus_tag LOCUS_00830 gene rplA 14211 14909 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_00830 14922 15476 gene locus_tag LOCUS_00840 14922 15476 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_00840 15545 15925 gene locus_tag LOCUS_00850 gene rplL 15545 15925 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_00850 >Feature sequence006 1965 1054 gene locus_tag LOCUS_00860 1965 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3439 2006 gene locus_tag LOCUS_00870 3439 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3643 4731 gene locus_tag LOCUS_00880 3643 4731 CDS product polysaccharide chain length determinant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_00880 4728 6203 gene locus_tag LOCUS_00890 4728 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6479 7753 gene locus_tag LOCUS_00900 6479 7753 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686815.1 protein_id gnl|my_center|LOCUS_00900 9082 7763 gene locus_tag LOCUS_00910 9082 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 10364 9222 gene locus_tag LOCUS_00920 10364 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10720 10463 gene locus_tag LOCUS_00930 10720 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12700 10769 gene locus_tag LOCUS_00940 12700 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 14842 12713 gene locus_tag LOCUS_00950 14842 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15269 14958 gene locus_tag LOCUS_00960 15269 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 15555 15310 gene locus_tag LOCUS_00970 15555 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 16252 15620 gene locus_tag LOCUS_00980 16252 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence007 683 45 gene locus_tag LOCUS_00990 683 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 903 1382 gene locus_tag LOCUS_01000 903 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 1497 2039 gene locus_tag LOCUS_01010 1497 2039 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_01010 2157 6821 gene locus_tag LOCUS_01020 2157 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7101 7967 gene locus_tag LOCUS_01030 7101 7967 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_01030 8122 8739 gene locus_tag LOCUS_01040 8122 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8795 9124 gene locus_tag LOCUS_01050 8795 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9236 9985 gene locus_tag LOCUS_01060 9236 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_01060 10157 11794 gene locus_tag LOCUS_01070 10157 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12206 11859 gene locus_tag LOCUS_01080 12206 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13165 12233 gene locus_tag LOCUS_01090 13165 12233 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_01090 13594 13244 gene locus_tag LOCUS_01100 13594 13244 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_01100 13820 14293 gene locus_tag LOCUS_01110 13820 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14584 14390 gene locus_tag LOCUS_01120 14584 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15065 14622 gene locus_tag LOCUS_01130 15065 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 15098 15325 gene locus_tag LOCUS_01140 15098 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16206 15364 gene locus_tag LOCUS_01150 16206 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence008 2168 123 gene locus_tag LOCUS_01160 2168 123 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6J1 protein_id gnl|my_center|LOCUS_01160 2507 5806 gene locus_tag LOCUS_01170 2507 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 5916 7853 gene locus_tag LOCUS_01180 5916 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 7975 9948 gene locus_tag LOCUS_01190 7975 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 10194 14240 gene locus_tag LOCUS_01200 10194 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence009 1888 560 gene locus_tag LOCUS_01210 1888 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2655 1885 gene locus_tag LOCUS_01220 2655 1885 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699614.1 protein_id gnl|my_center|LOCUS_01220 4461 2824 gene locus_tag LOCUS_01230 4461 2824 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_01230 4694 6058 gene locus_tag LOCUS_01240 4694 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6356 9667 gene locus_tag LOCUS_01250 6356 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10421 9711 gene locus_tag LOCUS_01260 10421 9711 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_01260 10968 10744 gene locus_tag LOCUS_01270 10968 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 10913 12058 gene locus_tag LOCUS_01280 10913 12058 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence010 <1 2359 gene locus_tag LOCUS_01290 <1 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405547.1:glycosyl hydrolase 2435 5623 gene locus_tag LOCUS_01300 2435 5623 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_01300 5707 7200 gene locus_tag LOCUS_01310 5707 7200 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_01310 7305 8585 gene locus_tag LOCUS_01320 7305 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 8625 9509 gene locus_tag LOCUS_01330 8625 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9606 11594 gene locus_tag LOCUS_01340 9606 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence011 332 913 gene locus_tag LOCUS_01350 gene gldD 332 913 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_01350 1023 3122 gene locus_tag LOCUS_01360 gene recG 1023 3122 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_01360 3207 5672 gene locus_tag LOCUS_01370 3207 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5680 5832 gene locus_tag LOCUS_01380 5680 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5885 7675 gene locus_tag LOCUS_01390 5885 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8171 13645 gene locus_tag LOCUS_01400 8171 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence012 1794 217 gene locus_tag LOCUS_01410 gene gltX 1794 217 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_01410 2061 1891 gene locus_tag LOCUS_01420 2061 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2721 2338 gene locus_tag LOCUS_01430 2721 2338 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_01430 4695 2857 gene locus_tag LOCUS_01440 gene glmS 4695 2857 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_01440 6281 4809 gene locus_tag LOCUS_01450 6281 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 7065 6250 gene locus_tag LOCUS_01460 7065 6250 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_01460 7183 8052 gene locus_tag LOCUS_01470 gene panC 7183 8052 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_01470 8066 8509 gene locus_tag LOCUS_01480 8066 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8599 9624 gene locus_tag LOCUS_01490 8599 9624 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_01490 11676 9883 gene locus_tag LOCUS_01500 11676 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 14099 11829 gene locus_tag LOCUS_01510 gene maeB 14099 11829 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence013 <1 1587 gene locus_tag LOCUS_01520 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P92:DNA primase 1639 2706 gene locus_tag LOCUS_01530 1639 2706 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_01530 2830 4053 gene locus_tag LOCUS_01540 2830 4053 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_01540 4050 5225 gene locus_tag LOCUS_01550 4050 5225 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_01550 5296 6543 gene locus_tag LOCUS_01560 gene ribBA 5296 6543 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_01560 8366 6672 gene locus_tag LOCUS_01570 8366 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9029 8427 gene locus_tag LOCUS_01580 9029 8427 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_01580 10418 9084 gene locus_tag LOCUS_01590 10418 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_01590 11286 10633 gene locus_tag LOCUS_01600 gene pdxH 11286 10633 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_01600 11540 12097 gene locus_tag LOCUS_01610 11540 12097 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_01610 >Feature sequence014 401 1870 gene locus_tag LOCUS_01620 401 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2169 2444 gene locus_tag LOCUS_01630 gene rpsO 2169 2444 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_01630 2710 4854 gene locus_tag LOCUS_01640 gene pnp 2710 4854 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_01640 5108 5971 gene locus_tag LOCUS_01650 5108 5971 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_01650 6124 7059 gene locus_tag LOCUS_01660 gene trxB1 6124 7059 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_01660 7136 8257 gene locus_tag LOCUS_01670 7136 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8390 9121 gene locus_tag LOCUS_01680 8390 9121 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_01680 9155 9538 gene locus_tag LOCUS_01690 9155 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10060 9653 gene locus_tag LOCUS_01700 10060 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 11864 10350 gene locus_tag LOCUS_01710 gene accC 11864 10350 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_01710 12159 11944 gene locus_tag LOCUS_01720 12159 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13818 12271 gene locus_tag LOCUS_01730 13818 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence015 1284 271 gene locus_tag LOCUS_01740 gene tsaD 1284 271 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_01740 1566 6236 gene locus_tag LOCUS_01750 1566 6236 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404275.1 protein_id gnl|my_center|LOCUS_01750 6413 7312 gene locus_tag LOCUS_01760 6413 7312 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U5 protein_id gnl|my_center|LOCUS_01760 7419 7733 gene locus_tag LOCUS_01770 7419 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7805 8614 gene locus_tag LOCUS_01780 gene uppP 7805 8614 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_01780 8688 9521 gene locus_tag LOCUS_01790 gene truB 8688 9521 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01790 9576 10529 gene locus_tag LOCUS_01800 gene ribF 9576 10529 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N9 protein_id gnl|my_center|LOCUS_01800 10593 11288 gene locus_tag LOCUS_01810 gene atoD 10593 11288 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_01810 11464 12126 gene locus_tag LOCUS_01820 gene atoA 11464 12126 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_01820 12255 13334 gene locus_tag LOCUS_01830 12255 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence016 2366 570 gene locus_tag LOCUS_01840 gene argS 2366 570 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_01840 3334 2474 gene locus_tag LOCUS_01850 3334 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_01850 3680 4645 gene locus_tag LOCUS_01860 3680 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5483 4785 gene locus_tag LOCUS_01870 5483 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 6978 5992 gene locus_tag LOCUS_01880 gene rocF 6978 5992 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_01880 7550 8947 gene locus_tag LOCUS_01890 gene speA 7550 8947 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_01890 10090 9551 gene locus_tag LOCUS_01900 10090 9551 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 protein_id gnl|my_center|LOCUS_01900 10149 11477 gene locus_tag LOCUS_01910 gene hemG 10149 11477 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_01910 11697 12434 gene locus_tag LOCUS_01920 11697 12434 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_01920 <13319 12524 gene locus_tag LOCUS_01930 <13319 12524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962279.1:glycosyl transferase >Feature sequence017 153 686 gene locus_tag LOCUS_01940 gene kdpC 153 686 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H084 protein_id gnl|my_center|LOCUS_01940 939 2102 gene locus_tag LOCUS_01950 939 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_01950 2275 3429 gene locus_tag LOCUS_01960 2275 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764092.1 protein_id gnl|my_center|LOCUS_01960 3585 5336 gene locus_tag LOCUS_01970 3585 5336 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_01970 5540 7240 gene locus_tag LOCUS_01980 5540 7240 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_01980 7372 8046 gene locus_tag LOCUS_01990 7372 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 8797 8051 gene locus_tag LOCUS_02000 8797 8051 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_02000 8920 9894 gene locus_tag LOCUS_02010 8920 9894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_02010 9938 10951 gene locus_tag LOCUS_02020 9938 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10932 11747 gene locus_tag LOCUS_02030 10932 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11747 13138 gene locus_tag LOCUS_02040 11747 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence018 <1 1254 gene locus_tag LOCUS_02050 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942587.1:UDP-N-acetyl-D-galactosamine dehydrogenase 1275 2300 gene locus_tag LOCUS_02060 1275 2300 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_02060 2386 3444 gene locus_tag LOCUS_02070 gene rmlB 2386 3444 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_02070 3587 4594 gene locus_tag LOCUS_02080 3587 4594 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_02080 4723 5598 gene locus_tag LOCUS_02090 gene rfbA 4723 5598 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 protein_id gnl|my_center|LOCUS_02090 7342 5684 gene locus_tag LOCUS_02100 7342 5684 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_02100 8788 7388 gene locus_tag LOCUS_02110 8788 7388 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_02110 8975 10372 gene locus_tag LOCUS_02120 gene radA 8975 10372 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_02120 10790 12208 gene locus_tag LOCUS_02130 10790 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence019 2273 1728 gene locus_tag LOCUS_02140 2273 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3059 2403 gene locus_tag LOCUS_02150 3059 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 4977 3517 gene locus_tag LOCUS_02160 4977 3517 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887301.1 protein_id gnl|my_center|LOCUS_02160 5140 6180 gene locus_tag LOCUS_02170 5140 6180 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390309.1 protein_id gnl|my_center|LOCUS_02170 6725 6177 gene locus_tag LOCUS_02180 6725 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6900 7346 gene locus_tag LOCUS_02190 6900 7346 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_02190 7404 8045 gene locus_tag LOCUS_02200 gene yceI 7404 8045 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_02200 8715 8155 gene locus_tag LOCUS_02210 8715 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 10859 8850 gene locus_tag LOCUS_02220 10859 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <12797 10953 gene locus_tag LOCUS_02230 <12797 10953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201860.1:prolyl tripeptidyl peptidase >Feature sequence020 <1 2861 gene locus_tag LOCUS_02240 <1 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403426.1:histidine kinase 3847 3056 gene locus_tag LOCUS_02250 3847 3056 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_02250 4348 6501 gene locus_tag LOCUS_02260 4348 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6504 7220 gene locus_tag LOCUS_02270 6504 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7886 7293 gene locus_tag LOCUS_02280 7886 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_02280 7928 11776 gene locus_tag LOCUS_02290 7928 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 12027 11773 gene locus_tag LOCUS_02300 12027 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 12370 12161 gene locus_tag LOCUS_02310 12370 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence021 305 1759 gene locus_tag LOCUS_02320 gene mloB 305 1759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_02320 1863 3764 gene locus_tag LOCUS_02330 1863 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4801 4664 gene locus_tag LOCUS_02340 4801 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6701 4899 gene locus_tag LOCUS_02350 6701 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8610 7180 gene locus_tag LOCUS_02360 8610 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8822 8625 gene locus_tag LOCUS_02370 8822 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8764 10410 gene locus_tag LOCUS_02380 gene pyrG 8764 10410 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_02380 10775 10563 gene locus_tag LOCUS_02390 10775 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10972 10772 gene locus_tag LOCUS_02400 10972 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 11800 11321 gene locus_tag LOCUS_02410 11800 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 12122 11805 gene locus_tag LOCUS_02420 12122 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence022 229 1692 gene locus_tag LOCUS_02430 229 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2053 1829 gene locus_tag LOCUS_02440 2053 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6001 2147 gene locus_tag LOCUS_02450 6001 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7816 6035 gene locus_tag LOCUS_02460 7816 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 8901 8299 gene locus_tag LOCUS_02470 8901 8299 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195466.1 protein_id gnl|my_center|LOCUS_02470 9616 8930 gene locus_tag LOCUS_02480 9616 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10976 9711 gene locus_tag LOCUS_02490 gene kynU 10976 9711 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_02490 12045 11038 gene locus_tag LOCUS_02500 12045 11038 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence023 263 796 gene locus_tag LOCUS_02510 gene hscB 263 796 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYX6 protein_id gnl|my_center|LOCUS_02510 822 904 gene locus_tag LOCUS_t00070 822 904 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1154 1348 gene locus_tag LOCUS_02520 1154 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1466 2347 gene locus_tag LOCUS_02530 1466 2347 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_02530 2451 3383 gene locus_tag LOCUS_02540 2451 3383 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_02540 3696 4136 gene locus_tag LOCUS_02550 3696 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4226 5656 gene locus_tag LOCUS_02560 4226 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5752 6435 gene locus_tag LOCUS_02570 5752 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6940 6452 gene locus_tag LOCUS_02580 6940 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7596 7066 gene locus_tag LOCUS_02590 7596 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence024 409 678 gene locus_tag LOCUS_02600 409 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 675 2552 gene locus_tag LOCUS_02610 675 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3355 2738 gene locus_tag LOCUS_02620 3355 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3532 4332 gene locus_tag LOCUS_02630 3532 4332 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_02630 4502 5731 gene locus_tag LOCUS_02640 gene queA 4502 5731 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_02640 5815 6171 gene locus_tag LOCUS_02650 5815 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 6766 6389 gene locus_tag LOCUS_02660 6766 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6785 7249 gene locus_tag LOCUS_02670 6785 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7459 8274 gene locus_tag LOCUS_02680 7459 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_02680 8329 9504 gene locus_tag LOCUS_02690 gene rnd 8329 9504 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE10 protein_id gnl|my_center|LOCUS_02690 10557 9889 gene locus_tag LOCUS_02700 10557 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 <12004 10770 gene locus_tag LOCUS_02710 <12004 10770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787651.1:carbon-nitrogen hydrolase >Feature sequence025 1551 898 gene locus_tag LOCUS_02720 1551 898 CDS product L-serine dehydratase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 protein_id gnl|my_center|LOCUS_02720 1771 2784 gene locus_tag LOCUS_02730 1771 2784 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_02730 2808 3566 gene locus_tag LOCUS_02740 2808 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4887 3598 gene locus_tag LOCUS_02750 4887 3598 CDS product MFS dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 protein_id gnl|my_center|LOCUS_02750 5534 5923 gene locus_tag LOCUS_02760 5534 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 5986 7554 gene locus_tag LOCUS_02770 5986 7554 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_02770 7838 9616 gene locus_tag LOCUS_02780 7838 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9900 11855 gene locus_tag LOCUS_02790 9900 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence026 1 543 gene locus_tag LOCUS_02800 1 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1232 1519 gene locus_tag LOCUS_02810 1232 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1516 2418 gene locus_tag LOCUS_02820 1516 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2423 3217 gene locus_tag LOCUS_02830 2423 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4056 3262 gene locus_tag LOCUS_02840 4056 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5432 4194 gene locus_tag LOCUS_02850 5432 4194 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_02850 6670 5702 gene locus_tag LOCUS_02860 6670 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6887 8080 gene locus_tag LOCUS_02870 gene corA 6887 8080 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_02870 8206 11715 gene locus_tag LOCUS_02880 8206 11715 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence027 441 1238 gene locus_tag LOCUS_02890 441 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1627 1364 gene locus_tag LOCUS_02900 1627 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 5216 1728 gene locus_tag LOCUS_02910 5216 1728 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02910 6665 5511 gene locus_tag LOCUS_02920 6665 5511 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_02920 8420 6732 gene locus_tag LOCUS_02930 8420 6732 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_02930 9072 8458 gene locus_tag LOCUS_02940 9072 8458 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_02940 9390 9869 gene locus_tag LOCUS_02950 gene ispF 9390 9869 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_02950 10049 11713 gene locus_tag LOCUS_02960 10049 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence028 <1 1132 gene locus_tag LOCUS_02970 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64VI7:chaperone protein DnaJ 1468 1268 gene locus_tag LOCUS_02980 1468 1268 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915104.1 protein_id gnl|my_center|LOCUS_02980 2140 1595 gene locus_tag LOCUS_02990 2140 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3051 2260 gene locus_tag LOCUS_03000 3051 2260 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_03000 4080 3061 gene locus_tag LOCUS_03010 4080 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5013 4168 gene locus_tag LOCUS_03020 5013 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_03020 5514 5068 gene locus_tag LOCUS_03030 5514 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_03030 5754 6458 gene locus_tag LOCUS_03040 5754 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 7349 6462 gene locus_tag LOCUS_03050 7349 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10699 8573 gene locus_tag LOCUS_03060 10699 8573 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_03060 <11594 10849 gene locus_tag LOCUS_03070 <11594 10849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786035.1:O-succinylbenzoic acid--CoA ligase >Feature sequence029 194 3 gene locus_tag LOCUS_03080 194 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5577 421 gene locus_tag LOCUS_03090 5577 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5978 7756 gene locus_tag LOCUS_03100 gene yidC 5978 7756 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_03100 7817 8365 gene locus_tag LOCUS_03110 7817 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10273 8570 gene locus_tag LOCUS_03120 10273 8570 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_03120 10466 11275 gene locus_tag LOCUS_03130 10466 11275 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_03130 11295 11567 gene locus_tag LOCUS_03140 11295 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence030 1041 319 gene locus_tag LOCUS_03150 1041 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 1601 1107 gene locus_tag LOCUS_03160 1601 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2230 1697 gene locus_tag LOCUS_03170 2230 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2838 2434 gene locus_tag LOCUS_03180 gene dgkA 2838 2434 CDS product undecaprenol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19638 protein_id gnl|my_center|LOCUS_03180 3430 2831 gene locus_tag LOCUS_03190 3430 2831 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_03190 4976 3603 gene locus_tag LOCUS_03200 gene fumC 4976 3603 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_03200 6934 5270 gene locus_tag LOCUS_03210 6934 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9974 7161 gene locus_tag LOCUS_03220 9974 7161 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_03220 10405 11289 gene locus_tag LOCUS_03230 10405 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence031 <1 897 gene locus_tag LOCUS_03240 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase 925 1617 gene locus_tag LOCUS_03250 925 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2339 1782 gene locus_tag LOCUS_03260 2339 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3233 2436 gene locus_tag LOCUS_03270 3233 2436 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_03270 3351 3584 gene locus_tag LOCUS_03280 3351 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3594 4208 gene locus_tag LOCUS_03290 3594 4208 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_03290 4391 6493 gene locus_tag LOCUS_03300 4391 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7561 6584 gene locus_tag LOCUS_03310 7561 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 7739 9964 gene locus_tag LOCUS_03320 7739 9964 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_03320 10044 10490 gene locus_tag LOCUS_03330 10044 10490 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence032 1027 8 gene locus_tag LOCUS_03340 1027 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2019 1024 gene locus_tag LOCUS_03350 2019 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2181 2269 gene locus_tag LOCUS_t00080 2181 2269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2344 2418 gene locus_tag LOCUS_t00090 2344 2418 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2581 2655 gene locus_tag LOCUS_t00100 2581 2655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3004 4482 gene locus_tag LOCUS_03360 3004 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4776 6770 gene locus_tag LOCUS_03370 gene gyrB 4776 6770 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_03370 7028 9346 gene locus_tag LOCUS_03380 7028 9346 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence033 283 1056 gene locus_tag LOCUS_03390 gene phnP 283 1056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_03390 1578 3188 gene locus_tag LOCUS_03400 1578 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3374 3292 gene locus_tag LOCUS_t00110 3374 3292 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4272 3613 gene locus_tag LOCUS_03410 4272 3613 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_03410 4460 5272 gene locus_tag LOCUS_03420 4460 5272 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_03420 5598 6437 gene locus_tag LOCUS_03430 5598 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7369 6524 gene locus_tag LOCUS_03440 7369 6524 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_03440 8171 7599 gene locus_tag LOCUS_03450 8171 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8720 8175 gene locus_tag LOCUS_03460 8720 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 9990 8929 gene locus_tag LOCUS_03470 9990 8929 CDS product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_03470 10249 10755 gene locus_tag LOCUS_03480 10249 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence034 1455 172 gene locus_tag LOCUS_03490 1455 172 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_03490 1583 4492 gene locus_tag LOCUS_03500 gene gcvP 1583 4492 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_03500 4724 5335 gene locus_tag LOCUS_03510 4724 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 5462 6115 gene locus_tag LOCUS_03520 5462 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 9468 6529 gene locus_tag LOCUS_03530 9468 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9710 10612 gene locus_tag LOCUS_03540 9710 10612 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence035 2568 991 gene locus_tag LOCUS_03550 gene gldM 2568 991 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_03550 3426 2617 gene locus_tag LOCUS_03560 3426 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4372 3491 gene locus_tag LOCUS_03570 4372 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5743 4778 gene locus_tag LOCUS_03580 gene porP 5743 4778 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_03580 6748 5951 gene locus_tag LOCUS_03590 6748 5951 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_03590 7995 6814 gene locus_tag LOCUS_03600 7995 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9109 8036 gene locus_tag LOCUS_03610 9109 8036 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_03610 9621 9205 gene locus_tag LOCUS_03620 9621 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_03620 10440 9679 gene locus_tag LOCUS_03630 gene lipB 10440 9679 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_03630 10679 10437 gene locus_tag LOCUS_03640 10679 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence036 3193 209 gene locus_tag LOCUS_03650 3193 209 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037079.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence037 <1 948 gene locus_tag LOCUS_03660 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119250.1:gluconolactonase 1084 1611 gene locus_tag LOCUS_03670 1084 1611 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090374.1 protein_id gnl|my_center|LOCUS_03670 2946 1633 gene locus_tag LOCUS_03680 gene nhaA 2946 1633 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_03680 4347 3211 gene locus_tag LOCUS_03690 4347 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6124 4457 gene locus_tag LOCUS_03700 6124 4457 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_03700 6436 7752 gene locus_tag LOCUS_03710 6436 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7881 8102 gene locus_tag LOCUS_03720 7881 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_03720 8262 8942 gene locus_tag LOCUS_03730 8262 8942 CDS product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157197.1 protein_id gnl|my_center|LOCUS_03730 9246 9025 gene locus_tag LOCUS_03740 9246 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence038 2086 341 gene locus_tag LOCUS_03750 2086 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2519 3478 gene locus_tag LOCUS_03760 2519 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3657 4418 gene locus_tag LOCUS_03770 3657 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4451 5149 gene locus_tag LOCUS_03780 4451 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5400 5185 gene locus_tag LOCUS_03790 5400 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6578 5400 gene locus_tag LOCUS_03800 gene ndh 6578 5400 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_03800 7418 6729 gene locus_tag LOCUS_03810 7418 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9391 7754 gene locus_tag LOCUS_03820 9391 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10319 9384 gene locus_tag LOCUS_03830 10319 9384 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029794.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence039 786 1142 gene locus_tag LOCUS_03840 786 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1154 1864 gene locus_tag LOCUS_03850 1154 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2956 1895 gene locus_tag LOCUS_03860 2956 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3388 2984 gene locus_tag LOCUS_03870 gene yuxK 3388 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_03870 3772 4098 gene locus_tag LOCUS_03880 3772 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5198 4224 gene locus_tag LOCUS_03890 5198 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5801 5214 gene locus_tag LOCUS_03900 5801 5214 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_03900 7170 6049 gene locus_tag LOCUS_03910 7170 6049 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_03910 7841 7167 gene locus_tag LOCUS_03920 7841 7167 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_03920 8758 8117 gene locus_tag LOCUS_03930 8758 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9049 10155 gene locus_tag LOCUS_03940 9049 10155 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705611.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence040 1895 927 gene locus_tag LOCUS_03950 1895 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_03950 2832 2074 gene locus_tag LOCUS_03960 2832 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2952 3869 gene locus_tag LOCUS_03970 2952 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3989 4753 gene locus_tag LOCUS_03980 3989 4753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933727.1 protein_id gnl|my_center|LOCUS_03980 5344 4757 gene locus_tag LOCUS_03990 5344 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 5770 5351 gene locus_tag LOCUS_04000 5770 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7638 6640 gene locus_tag LOCUS_04010 gene ltd 7638 6640 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_04010 7913 8977 gene locus_tag LOCUS_04020 7913 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9198 10394 gene locus_tag LOCUS_04030 gene kbl 9198 10394 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_04030 >Feature sequence041 296 1840 gene locus_tag LOCUS_04040 296 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2002 4833 gene locus_tag LOCUS_04050 2002 4833 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_04050 7403 5340 gene locus_tag LOCUS_04060 7403 5340 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_04060 7726 9051 gene locus_tag LOCUS_04070 gene xseA 7726 9051 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_04070 9180 9467 gene locus_tag LOCUS_04080 9180 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9557 9916 gene locus_tag LOCUS_04090 9557 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence042 516 1049 gene locus_tag LOCUS_04100 gene msrA 516 1049 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_04100 2015 1476 gene locus_tag LOCUS_04110 2015 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2879 2046 gene locus_tag LOCUS_04120 gene dapD 2879 2046 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04120 3026 4159 gene locus_tag LOCUS_04130 3026 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4225 5241 gene locus_tag LOCUS_04140 gene fabH2 4225 5241 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_04140 5348 6016 gene locus_tag LOCUS_04150 gene sirR 5348 6016 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_04150 6016 7461 gene locus_tag LOCUS_04160 gene mnmE 6016 7461 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_04160 7613 8905 gene locus_tag LOCUS_04170 gene gltA 7613 8905 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_04170 9411 9034 gene locus_tag LOCUS_04180 9411 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence043 373 669 gene locus_tag LOCUS_04190 373 669 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_04190 882 2342 gene locus_tag LOCUS_04200 882 2342 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_04200 2579 3124 gene locus_tag LOCUS_04210 2579 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3172 4818 gene locus_tag LOCUS_04220 3172 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4815 5186 gene locus_tag LOCUS_04230 4815 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5206 5427 gene locus_tag LOCUS_04240 5206 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5518 5811 gene locus_tag LOCUS_04250 5518 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6062 6454 gene locus_tag LOCUS_04260 6062 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6502 6987 gene locus_tag LOCUS_04270 6502 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 7054 9510 gene locus_tag LOCUS_04280 gene mrcA 7054 9510 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence044 <1 2654 gene locus_tag LOCUS_04290 <1 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 2921 3280 gene locus_tag LOCUS_04300 2921 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3323 3484 gene locus_tag LOCUS_04310 3323 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4468 3569 gene locus_tag LOCUS_04320 gene sdhA 4468 3569 CDS product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_04320 4416 4580 gene locus_tag LOCUS_04330 4416 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5038 4577 gene locus_tag LOCUS_04340 gene msrB 5038 4577 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_04340 5156 5464 gene locus_tag LOCUS_04350 5156 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5576 6253 gene locus_tag LOCUS_04360 5576 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6344 8206 gene locus_tag LOCUS_04370 6344 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8264 9895 gene locus_tag LOCUS_04380 8264 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence045 963 592 gene locus_tag LOCUS_04390 963 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1373 1684 gene locus_tag LOCUS_04400 1373 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1795 4743 gene locus_tag LOCUS_04410 1795 4743 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_04410 4836 6845 gene locus_tag LOCUS_04420 4836 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6976 8106 gene locus_tag LOCUS_04430 6976 8106 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_04430 8580 8119 gene locus_tag LOCUS_04440 8580 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence046 433 1080 gene locus_tag LOCUS_04450 433 1080 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_04450 1287 2105 gene locus_tag LOCUS_04460 gene lpxH 1287 2105 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04460 2107 3021 gene locus_tag LOCUS_04470 2107 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3216 4358 gene locus_tag LOCUS_04480 3216 4358 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272517.1 protein_id gnl|my_center|LOCUS_04480 5533 4451 gene locus_tag LOCUS_04490 gene fbaA 5533 4451 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_04490 7618 5666 gene locus_tag LOCUS_04500 7618 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 8319 7891 gene locus_tag LOCUS_04510 8319 7891 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_04510 9300 8455 gene locus_tag LOCUS_04520 gene tatC 9300 8455 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_04520 <10134 9428 gene locus_tag LOCUS_04530 <10134 9428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase >Feature sequence047 1157 531 gene locus_tag LOCUS_04540 1157 531 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_04540 3889 1199 gene locus_tag LOCUS_04550 3889 1199 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_04550 4741 3929 gene locus_tag LOCUS_04560 4741 3929 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_04560 4921 5553 gene locus_tag LOCUS_04570 4921 5553 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXA8 protein_id gnl|my_center|LOCUS_04570 5606 6079 gene locus_tag LOCUS_04580 gene coaD 5606 6079 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039M3 protein_id gnl|my_center|LOCUS_04580 6892 6203 gene locus_tag LOCUS_04590 6892 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7048 7554 gene locus_tag LOCUS_04600 7048 7554 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_04600 7648 8727 gene locus_tag LOCUS_04610 7648 8727 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338163.1 protein_id gnl|my_center|LOCUS_04610 9351 8875 gene locus_tag LOCUS_04620 9351 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence048 214 588 gene locus_tag LOCUS_04630 214 588 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_04630 692 1795 gene locus_tag LOCUS_04640 692 1795 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_04640 2429 1917 gene locus_tag LOCUS_04650 2429 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_04650 3292 2573 gene locus_tag LOCUS_04660 3292 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3832 3377 gene locus_tag LOCUS_04670 3832 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4956 3976 gene locus_tag LOCUS_04680 4956 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_04680 5982 5017 gene locus_tag LOCUS_04690 5982 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_04690 6628 6110 gene locus_tag LOCUS_04700 6628 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_04700 7596 6676 gene locus_tag LOCUS_04710 7596 6676 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_04710 8787 7711 gene locus_tag LOCUS_04720 8787 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 9638 8868 gene locus_tag LOCUS_04730 9638 8868 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704031.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence049 340 1506 gene locus_tag LOCUS_04740 340 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1602 1913 gene locus_tag LOCUS_04750 1602 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1974 2996 gene locus_tag LOCUS_04760 1974 2996 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404422.1 protein_id gnl|my_center|LOCUS_04760 3047 3571 gene locus_tag LOCUS_04770 3047 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_04770 3723 4049 gene locus_tag LOCUS_04780 3723 4049 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_04780 4051 4797 gene locus_tag LOCUS_04790 4051 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4844 5452 gene locus_tag LOCUS_04800 gene coaE 4844 5452 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_04800 5841 5572 gene locus_tag LOCUS_04810 5841 5572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 protein_id gnl|my_center|LOCUS_04810 6211 7443 gene locus_tag LOCUS_04820 6211 7443 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_04820 7581 8483 gene locus_tag LOCUS_04830 7581 8483 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_04830 8628 9821 gene locus_tag LOCUS_04840 8628 9821 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence050 <1 1832 gene locus_tag LOCUS_04850 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein 2993 2058 gene locus_tag LOCUS_04860 gene ada 2993 2058 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_04860 3086 3796 gene locus_tag LOCUS_04870 3086 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4095 3814 gene locus_tag LOCUS_04880 4095 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_04880 4340 5446 gene locus_tag LOCUS_04890 4340 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_04890 5478 7106 gene locus_tag LOCUS_04900 5478 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7313 8842 gene locus_tag LOCUS_04910 7313 8842 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence051 893 1696 gene locus_tag LOCUS_04920 gene tpiA 893 1696 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_04920 2012 1752 gene locus_tag LOCUS_04930 2012 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1900 2277 gene locus_tag LOCUS_04940 1900 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2359 3189 gene locus_tag LOCUS_04950 gene prmA 2359 3189 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_04950 3217 3405 gene locus_tag LOCUS_04960 3217 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3408 8864 gene locus_tag LOCUS_04970 3408 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 9038 9589 gene locus_tag LOCUS_04980 9038 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence052 1090 176 gene locus_tag LOCUS_04990 1090 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1585 1154 gene locus_tag LOCUS_05000 1585 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2244 1864 gene locus_tag LOCUS_05010 2244 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2814 3425 gene locus_tag LOCUS_05020 2814 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3692 4321 gene locus_tag LOCUS_05030 3692 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_05030 5064 4375 gene locus_tag LOCUS_05040 5064 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5194 5826 gene locus_tag LOCUS_05050 5194 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5988 8558 gene locus_tag LOCUS_05060 5988 8558 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence053 1132 3087 gene locus_tag LOCUS_05070 1132 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3217 5964 gene locus_tag LOCUS_05080 gene yeeA 3217 5964 CDS product putative DNA methyltransferase YeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31504 protein_id gnl|my_center|LOCUS_05080 6378 6926 gene locus_tag LOCUS_05090 6378 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7053 9026 gene locus_tag LOCUS_05100 7053 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence054 838 1428 gene locus_tag LOCUS_05110 838 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2555 2082 gene locus_tag LOCUS_05120 2555 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2848 2663 gene locus_tag LOCUS_05130 2848 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3158 3412 gene locus_tag LOCUS_05140 3158 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3469 4215 gene locus_tag LOCUS_05150 3469 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4253 4921 gene locus_tag LOCUS_05160 4253 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5067 8054 gene locus_tag LOCUS_05170 gene sucA 5067 8054 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_05170 8142 8465 gene locus_tag LOCUS_05180 8142 8465 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545631.1 protein_id gnl|my_center|LOCUS_05180 8452 8859 gene locus_tag LOCUS_05190 8452 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence055 985 599 gene locus_tag LOCUS_05200 985 599 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_05200 2508 1048 gene locus_tag LOCUS_05210 2508 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2728 3510 gene locus_tag LOCUS_05220 gene rsmA 2728 3510 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 protein_id gnl|my_center|LOCUS_05220 3811 4779 gene locus_tag LOCUS_05230 3811 4779 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_05230 4892 5368 gene locus_tag LOCUS_05240 gene greA 4892 5368 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_05240 5475 6443 gene locus_tag LOCUS_05250 5475 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence056 3026 1326 gene locus_tag LOCUS_05260 3026 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_05260 5417 3411 gene locus_tag LOCUS_05270 5417 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5604 6770 gene locus_tag LOCUS_05280 5604 6770 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_05280 6845 7165 gene locus_tag LOCUS_05290 6845 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7086 7274 gene locus_tag LOCUS_05300 7086 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 7524 8528 gene locus_tag LOCUS_05310 7524 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence057 <1 1446 gene locus_tag LOCUS_05320 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203679.1:glycosyl hydrolase 1666 1592 gene locus_tag LOCUS_t00120 1666 1592 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2211 1783 gene locus_tag LOCUS_05330 2211 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3330 2353 gene locus_tag LOCUS_05340 gene ftsY 3330 2353 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_05340 3639 3478 gene locus_tag LOCUS_05350 3639 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3830 3648 gene locus_tag LOCUS_05360 gene rpmG 3830 3648 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_05360 5741 4077 gene locus_tag LOCUS_05370 5741 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6360 6121 gene locus_tag LOCUS_05380 gene rpmB 6360 6121 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_05380 6672 6445 gene locus_tag LOCUS_05390 6672 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6681 7205 gene locus_tag LOCUS_05400 6681 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7304 8545 gene locus_tag LOCUS_05410 gene rocD 7304 8545 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_05410 9087 9215 gene locus_tag LOCUS_05420 9087 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence058 <1 1537 gene locus_tag LOCUS_05430 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962595.1:cadmium/zinc/cobalt-transporting ATPase 1674 2162 gene locus_tag LOCUS_05440 1674 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2655 2239 gene locus_tag LOCUS_05450 2655 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3725 2748 gene locus_tag LOCUS_05460 3725 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3940 4818 gene locus_tag LOCUS_05470 gene sucD 3940 4818 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_05470 5036 6118 gene locus_tag LOCUS_05480 5036 6118 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_05480 6288 7169 gene locus_tag LOCUS_05490 gene ispH 6288 7169 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_05490 7215 7901 gene locus_tag LOCUS_05500 7215 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8451 7909 gene locus_tag LOCUS_05510 gene ymdB 8451 7909 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67342 protein_id gnl|my_center|LOCUS_05510 8602 8889 gene locus_tag LOCUS_05520 8602 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence059 1227 550 gene locus_tag LOCUS_05530 gene wlbB 1227 550 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 protein_id gnl|my_center|LOCUS_05530 1319 1915 gene locus_tag LOCUS_05540 1319 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_05540 2062 2529 gene locus_tag LOCUS_05550 2062 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228758.1 protein_id gnl|my_center|LOCUS_05550 3991 2549 gene locus_tag LOCUS_05560 3991 2549 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_05560 4106 6205 gene locus_tag LOCUS_05570 4106 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6318 7337 gene locus_tag LOCUS_05580 6318 7337 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_05580 7789 7448 gene locus_tag LOCUS_05590 7789 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8099 7905 gene locus_tag LOCUS_05600 8099 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9030 8227 gene locus_tag LOCUS_05610 9030 8227 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403307.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence060 272 1615 gene locus_tag LOCUS_05620 272 1615 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_05620 1735 2229 gene locus_tag LOCUS_05630 1735 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2945 2280 gene locus_tag LOCUS_05640 2945 2280 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_05640 3192 3839 gene locus_tag LOCUS_05650 3192 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3919 5016 gene locus_tag LOCUS_05660 3919 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6701 5277 gene locus_tag LOCUS_05670 6701 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6846 7865 gene locus_tag LOCUS_05680 6846 7865 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_05680 9164 8073 gene locus_tag LOCUS_05690 9164 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence061 3490 2546 gene locus_tag LOCUS_05700 3490 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3626 5923 gene locus_tag LOCUS_05710 3626 5923 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_05710 7543 6182 gene locus_tag LOCUS_05720 7543 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 8883 7822 gene locus_tag LOCUS_05730 8883 7822 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence062 1665 442 gene locus_tag LOCUS_05740 1665 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_05740 3100 1751 gene locus_tag LOCUS_05750 3100 1751 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_05750 3706 3173 gene locus_tag LOCUS_05760 3706 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_05760 4490 3798 gene locus_tag LOCUS_05770 4490 3798 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_05770 5324 4731 gene locus_tag LOCUS_05780 5324 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7090 5393 gene locus_tag LOCUS_05790 7090 5393 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_05790 7556 7116 gene locus_tag LOCUS_05800 7556 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 7777 7619 gene locus_tag LOCUS_05810 gene rpmH 7777 7619 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_05810 >Feature sequence063 <1 827 gene locus_tag LOCUS_05820 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389934.1:ATPase-like ATP-binding protein 856 1164 gene locus_tag LOCUS_05830 856 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2332 1253 gene locus_tag LOCUS_05840 gene aroC 2332 1253 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_05840 3992 2469 gene locus_tag LOCUS_05850 3992 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4243 4965 gene locus_tag LOCUS_05860 4243 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5004 5828 gene locus_tag LOCUS_05870 5004 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5997 6746 gene locus_tag LOCUS_05880 5997 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6846 7844 gene locus_tag LOCUS_05890 6846 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7964 8638 gene locus_tag LOCUS_05900 7964 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence064 168 851 gene locus_tag LOCUS_05910 gene rplB 168 851 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_05910 855 1133 gene locus_tag LOCUS_05920 gene rpsS 855 1133 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_05920 1135 1563 gene locus_tag LOCUS_05930 gene rplV 1135 1563 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL3 protein_id gnl|my_center|LOCUS_05930 1569 2495 gene locus_tag LOCUS_05940 1569 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2540 2941 gene locus_tag LOCUS_05950 gene rplP 2540 2941 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL5 protein_id gnl|my_center|LOCUS_05950 2957 3178 gene locus_tag LOCUS_05960 gene rpmC 2957 3178 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_05960 3181 3486 gene locus_tag LOCUS_05970 gene rpsQ 3181 3486 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL7 protein_id gnl|my_center|LOCUS_05970 3496 3864 gene locus_tag LOCUS_05980 gene rplN 3496 3864 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFE5 protein_id gnl|my_center|LOCUS_05980 3868 4164 gene locus_tag LOCUS_05990 gene rplX 3868 4164 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_05990 4180 4734 gene locus_tag LOCUS_06000 gene rplE 4180 4734 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP6 protein_id gnl|my_center|LOCUS_06000 4739 5008 gene locus_tag LOCUS_06010 gene rpsN 4739 5008 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_06010 5328 5726 gene locus_tag LOCUS_06020 gene rpsH 5328 5726 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_06020 5760 6314 gene locus_tag LOCUS_06030 gene rplF 5760 6314 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_06030 6324 6674 gene locus_tag LOCUS_06040 gene rplR 6324 6674 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYX3 protein_id gnl|my_center|LOCUS_06040 6681 7271 gene locus_tag LOCUS_06050 gene rpsE 6681 7271 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_06050 7279 7458 gene locus_tag LOCUS_06060 gene rpmD 7279 7458 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 protein_id gnl|my_center|LOCUS_06060 7571 8020 gene locus_tag LOCUS_06070 gene rplO 7571 8020 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_06070 >Feature sequence065 639 160 gene locus_tag LOCUS_06080 639 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 882 3980 gene locus_tag LOCUS_06090 882 3980 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_06090 4013 4282 gene locus_tag LOCUS_06100 4013 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5243 4602 gene locus_tag LOCUS_06110 5243 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5906 5319 gene locus_tag LOCUS_06120 5906 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6632 5991 gene locus_tag LOCUS_06130 6632 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6793 7656 gene locus_tag LOCUS_06140 6793 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7938 8420 gene locus_tag LOCUS_06150 7938 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence066 622 1662 gene locus_tag LOCUS_06160 622 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1668 6770 gene locus_tag LOCUS_06170 1668 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6945 6787 gene locus_tag LOCUS_06180 6945 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7029 7298 gene locus_tag LOCUS_06190 7029 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7570 8283 gene locus_tag LOCUS_06200 7570 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence067 1164 577 gene locus_tag LOCUS_06210 1164 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4450 1217 gene locus_tag LOCUS_06220 4450 1217 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAA8 protein_id gnl|my_center|LOCUS_06220 5308 5084 gene locus_tag LOCUS_06230 5308 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5668 5378 gene locus_tag LOCUS_06240 5668 5378 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_06240 6012 5734 gene locus_tag LOCUS_06250 6012 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7179 6082 gene locus_tag LOCUS_06260 gene carA 7179 6082 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ3 protein_id gnl|my_center|LOCUS_06260 7421 7188 gene locus_tag LOCUS_06270 7421 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 <8903 7739 gene locus_tag LOCUS_06280 <8903 7739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63WU0:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence068 <1 629 gene locus_tag LOCUS_06290 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785334.1:serine--tRNA ligase 1501 1142 gene locus_tag LOCUS_06300 1501 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1831 1550 gene locus_tag LOCUS_06310 1831 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_06310 2014 1838 gene locus_tag LOCUS_06320 2014 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2084 3079 gene locus_tag LOCUS_06330 2084 3079 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_06330 4088 3093 gene locus_tag LOCUS_06340 4088 3093 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_06340 6053 4296 gene locus_tag LOCUS_06350 6053 4296 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_06350 6242 6637 gene locus_tag LOCUS_06360 6242 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6797 7207 gene locus_tag LOCUS_06370 6797 7207 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538032.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence069 <1 1182 gene locus_tag LOCUS_06380 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203287.1:sulfatase 3338 1188 gene locus_tag LOCUS_06390 3338 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5564 3414 gene locus_tag LOCUS_06400 5564 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5692 7026 gene locus_tag LOCUS_06410 5692 7026 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_06410 7976 7221 gene locus_tag LOCUS_06420 7976 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence070 1008 1520 gene locus_tag LOCUS_06430 1008 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1749 4016 gene locus_tag LOCUS_06440 gene dpp11 1749 4016 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_06440 4862 4104 gene locus_tag LOCUS_06450 4862 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4970 5269 gene locus_tag LOCUS_06460 4970 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5571 5383 gene locus_tag LOCUS_06470 5571 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5483 6295 gene locus_tag LOCUS_06480 5483 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7359 6487 gene locus_tag LOCUS_06490 gene ykuF 7359 6487 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_06490 7636 8523 gene locus_tag LOCUS_06500 7636 8523 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887478.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence071 1035 712 gene locus_tag LOCUS_06510 1035 712 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_06510 1096 1710 gene locus_tag LOCUS_06520 1096 1710 CDS product putative nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703921.1 protein_id gnl|my_center|LOCUS_06520 1761 2303 gene locus_tag LOCUS_06530 1761 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2990 2340 gene locus_tag LOCUS_06540 2990 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3832 3149 gene locus_tag LOCUS_06550 3832 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 6096 3868 gene locus_tag LOCUS_06560 6096 3868 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_06560 7164 6163 gene locus_tag LOCUS_06570 7164 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence072 2277 886 gene locus_tag LOCUS_06580 2277 886 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_06580 2404 3264 gene locus_tag LOCUS_06590 2404 3264 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_06590 3507 4382 gene locus_tag LOCUS_06600 3507 4382 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_06600 4626 5204 gene locus_tag LOCUS_06610 gene exbD1 4626 5204 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_06610 5315 5776 gene locus_tag LOCUS_06620 gene exbD2 5315 5776 CDS product biopolymer transport ExbD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_06620 5773 6618 gene locus_tag LOCUS_06630 5773 6618 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_06630 6904 7164 gene locus_tag LOCUS_06640 6904 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 7157 8143 gene locus_tag LOCUS_06650 7157 8143 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence073 409 164 gene locus_tag LOCUS_06660 409 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2021 516 gene locus_tag LOCUS_06670 gene atpD 2021 516 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_06670 2313 2387 gene locus_tag LOCUS_t00130 2313 2387 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2813 3196 gene locus_tag LOCUS_06680 2813 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4693 3701 gene locus_tag LOCUS_06690 4693 3701 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X50 protein_id gnl|my_center|LOCUS_06690 5205 4747 gene locus_tag LOCUS_06700 5205 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5827 5381 gene locus_tag LOCUS_06710 5827 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7752 6277 gene locus_tag LOCUS_06720 gene proS 7752 6277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_06720 >Feature sequence074 <1 591 gene locus_tag LOCUS_06730 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958274.1:short-chain dehydrogenase 1321 665 gene locus_tag LOCUS_06740 1321 665 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_06740 1811 1314 gene locus_tag LOCUS_06750 1811 1314 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_06750 2038 3408 gene locus_tag LOCUS_06760 2038 3408 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_06760 7657 3644 gene locus_tag LOCUS_06770 7657 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8521 7796 gene locus_tag LOCUS_06780 8521 7796 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 protein_id gnl|my_center|LOCUS_06780 >Feature sequence075 454 158 gene locus_tag LOCUS_06790 454 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 478 1038 gene locus_tag LOCUS_06800 478 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2727 1102 gene locus_tag LOCUS_06810 gene pckA2 2727 1102 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_06810 2953 4686 gene locus_tag LOCUS_06820 2953 4686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964427.1 protein_id gnl|my_center|LOCUS_06820 5608 6774 gene locus_tag LOCUS_06830 5608 6774 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_06830 7184 6885 gene locus_tag LOCUS_06840 7184 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7533 7312 gene locus_tag LOCUS_06850 7533 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7977 7696 gene locus_tag LOCUS_06860 7977 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence076 1779 352 gene locus_tag LOCUS_06870 1779 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1919 2488 gene locus_tag LOCUS_06880 1919 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2943 2533 gene locus_tag LOCUS_06890 2943 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3784 3023 gene locus_tag LOCUS_06900 3784 3023 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202426.1 protein_id gnl|my_center|LOCUS_06900 4119 4451 gene locus_tag LOCUS_06910 4119 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6037 4667 gene locus_tag LOCUS_06920 gene ffh 6037 4667 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_06920 6255 7613 gene locus_tag LOCUS_06930 6255 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403758.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence077 1058 1978 gene locus_tag LOCUS_06940 gene hemF 1058 1978 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_06940 1971 2555 gene locus_tag LOCUS_06950 1971 2555 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_06950 2838 2635 gene locus_tag LOCUS_06960 2838 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3780 3037 gene locus_tag LOCUS_06970 3780 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4383 3787 gene locus_tag LOCUS_06980 gene ribE 4383 3787 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_06980 4935 4603 gene locus_tag LOCUS_06990 4935 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6706 5048 gene locus_tag LOCUS_07000 6706 5048 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_07000 7509 6766 gene locus_tag LOCUS_07010 7509 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <8404 7616 gene locus_tag LOCUS_07020 <8404 7616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZN9:tRNA-specific 2-thiouridylase MnmA >Feature sequence078 2167 1469 gene locus_tag LOCUS_07030 gene pssA 2167 1469 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_07030 2842 2195 gene locus_tag LOCUS_07040 2842 2195 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_07040 3578 2916 gene locus_tag LOCUS_07050 gene psd 3578 2916 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_07050 5170 3878 gene locus_tag LOCUS_07060 gene gdhA 5170 3878 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_07060 6367 5396 gene locus_tag LOCUS_07070 gene cdsA 6367 5396 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP76 protein_id gnl|my_center|LOCUS_07070 7450 6467 gene locus_tag LOCUS_07080 7450 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence079 6406 4199 gene locus_tag LOCUS_07090 6406 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8193 7117 gene locus_tag LOCUS_07100 8193 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence080 419 673 gene locus_tag LOCUS_07110 419 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 705 1121 gene locus_tag LOCUS_07120 705 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2119 1205 gene locus_tag LOCUS_07130 2119 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3448 2819 gene locus_tag LOCUS_07140 3448 2819 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_07140 3518 3911 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agccgcgtagcggcgccacgtctatag 4644 4165 gene locus_tag LOCUS_07150 4644 4165 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_07150 5678 4770 gene locus_tag LOCUS_07160 5678 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_07160 5866 6297 gene locus_tag LOCUS_07170 5866 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7121 6354 gene locus_tag LOCUS_07180 7121 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7486 7127 gene locus_tag LOCUS_07190 7486 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7981 7550 gene locus_tag LOCUS_07200 7981 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence081 657 1490 gene locus_tag LOCUS_07210 657 1490 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 protein_id gnl|my_center|LOCUS_07210 2837 1668 gene locus_tag LOCUS_07220 2837 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4016 2949 gene locus_tag LOCUS_07230 4016 2949 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_07230 4572 4078 gene locus_tag LOCUS_07240 4572 4078 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_07240 5482 4691 gene locus_tag LOCUS_07250 5482 4691 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_07250 6119 5619 gene locus_tag LOCUS_07260 gene smpB 6119 5619 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_07260 7560 6085 gene locus_tag LOCUS_07270 7560 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 <8208 7646 gene locus_tag LOCUS_07280 <8208 7646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H010:tRNA N6-adenosine threonylcarbamoyltransferase >Feature sequence082 1035 2363 gene locus_tag LOCUS_07290 1035 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2441 3073 gene locus_tag LOCUS_07300 2441 3073 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_07300 3116 4057 gene locus_tag LOCUS_07310 3116 4057 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XXF0 protein_id gnl|my_center|LOCUS_07310 4090 5001 gene locus_tag LOCUS_07320 gene udp 4090 5001 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_07320 5473 5168 gene locus_tag LOCUS_07330 5473 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6745 5723 gene locus_tag LOCUS_07340 6745 5723 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_07340 6952 7305 gene locus_tag LOCUS_07350 gene fdx1 6952 7305 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence083 927 550 gene locus_tag LOCUS_07360 927 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3741 1099 gene locus_tag LOCUS_07370 gene clpC 3741 1099 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_07370 4501 3836 gene locus_tag LOCUS_07380 4501 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_07380 4637 5524 gene locus_tag LOCUS_07390 4637 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5517 6437 gene locus_tag LOCUS_07400 5517 6437 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_07400 7167 6535 gene locus_tag LOCUS_07410 7167 6535 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence084 1523 3124 gene locus_tag LOCUS_07420 1523 3124 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_07420 4334 3375 gene locus_tag LOCUS_07430 4334 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4410 6638 gene locus_tag LOCUS_07440 gene pepX1 4410 6638 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_07440 6964 6734 gene locus_tag LOCUS_07450 6964 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 7497 7006 gene locus_tag LOCUS_07460 7497 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence085 566 784 gene locus_tag LOCUS_07470 566 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 2143 851 gene locus_tag LOCUS_07480 2143 851 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_07480 2254 2643 gene locus_tag LOCUS_07490 2254 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2921 3556 gene locus_tag LOCUS_07500 2921 3556 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_07500 3495 3725 gene locus_tag LOCUS_07510 3495 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3860 4522 gene locus_tag LOCUS_07520 gene nth 3860 4522 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A754 protein_id gnl|my_center|LOCUS_07520 5796 4594 gene locus_tag LOCUS_07530 5796 4594 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_07530 7056 6046 gene locus_tag LOCUS_07540 7056 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7151 7837 gene locus_tag LOCUS_07550 7151 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence086 2315 75 gene locus_tag LOCUS_07560 2315 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2647 4434 gene locus_tag LOCUS_07570 2647 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5083 4448 gene locus_tag LOCUS_07580 5083 4448 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_07580 5237 5965 gene locus_tag LOCUS_07590 gene rpe 5237 5965 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_07590 >Feature sequence087 188 1666 gene locus_tag LOCUS_07600 188 1666 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_07600 1757 2137 gene locus_tag LOCUS_07610 1757 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_07610 3147 2314 gene locus_tag LOCUS_07620 3147 2314 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_07620 3390 5171 gene locus_tag LOCUS_07630 3390 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5275 5949 gene locus_tag LOCUS_07640 5275 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6070 6681 gene locus_tag LOCUS_07650 6070 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6781 7404 gene locus_tag LOCUS_07660 6781 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence088 16 576 gene locus_tag LOCUS_07670 gene atpH 16 576 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_07670 691 2268 gene locus_tag LOCUS_07680 gene atpA 691 2268 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_07680 2363 3247 gene locus_tag LOCUS_07690 gene atpG 2363 3247 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_07690 3730 3323 gene locus_tag LOCUS_07700 3730 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4034 3837 gene locus_tag LOCUS_07710 4034 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4539 4117 gene locus_tag LOCUS_07720 4539 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4683 6326 gene locus_tag LOCUS_07730 4683 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6478 6984 gene locus_tag LOCUS_07740 6478 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence089 1022 2098 gene locus_tag LOCUS_07750 1022 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_07750 2876 2469 gene locus_tag LOCUS_07760 2876 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3056 3340 gene locus_tag LOCUS_07770 3056 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4737 3511 gene locus_tag LOCUS_07780 4737 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5113 5505 gene locus_tag LOCUS_07790 5113 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5607 6437 gene locus_tag LOCUS_07800 5607 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6708 7928 gene locus_tag LOCUS_07810 6708 7928 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence090 334 891 gene locus_tag LOCUS_07820 334 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1609 977 gene locus_tag LOCUS_07830 1609 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_07830 1724 2410 gene locus_tag LOCUS_07840 1724 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2407 2859 gene locus_tag LOCUS_07850 2407 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3090 3755 gene locus_tag LOCUS_07860 3090 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3804 5234 gene locus_tag LOCUS_07870 gene rtcB 3804 5234 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEC5 protein_id gnl|my_center|LOCUS_07870 5234 5500 gene locus_tag LOCUS_07880 5234 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5488 5781 gene locus_tag LOCUS_07890 5488 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5750 5893 gene locus_tag LOCUS_07900 5750 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6050 6955 gene locus_tag LOCUS_07910 6050 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7666 6965 gene locus_tag LOCUS_07920 7666 6965 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_07920 7693 7854 gene locus_tag LOCUS_07930 7693 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence091 1308 895 gene locus_tag LOCUS_07940 1308 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1976 1311 gene locus_tag LOCUS_07950 1976 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2456 2013 gene locus_tag LOCUS_07960 2456 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2552 3082 gene locus_tag LOCUS_07970 2552 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4557 3106 gene locus_tag LOCUS_07980 4557 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040390.1 protein_id gnl|my_center|LOCUS_07980 4631 5062 gene locus_tag LOCUS_07990 4631 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6372 5059 gene locus_tag LOCUS_08000 6372 5059 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918524.1 protein_id gnl|my_center|LOCUS_08000 6442 7632 gene locus_tag LOCUS_08010 6442 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence092 2867 1434 gene locus_tag LOCUS_08020 2867 1434 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_08020 3609 3034 gene locus_tag LOCUS_08030 3609 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4085 3618 gene locus_tag LOCUS_08040 4085 3618 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889457.1 protein_id gnl|my_center|LOCUS_08040 4148 4654 gene locus_tag LOCUS_08050 4148 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6989 4845 gene locus_tag LOCUS_08060 6989 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 7620 7123 gene locus_tag LOCUS_08070 7620 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015686.1 protein_id gnl|my_center|LOCUS_08070 7917 7684 gene locus_tag LOCUS_08080 7917 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence093 136 1569 gene locus_tag LOCUS_08090 136 1569 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_08090 2231 1611 gene locus_tag LOCUS_08100 2231 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3463 2228 gene locus_tag LOCUS_08110 3463 2228 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884000.1 protein_id gnl|my_center|LOCUS_08110 4075 3629 gene locus_tag LOCUS_08120 4075 3629 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188466.1 protein_id gnl|my_center|LOCUS_08120 6415 4088 gene locus_tag LOCUS_08130 6415 4088 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_08130 6990 6412 gene locus_tag LOCUS_08140 6990 6412 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_296358.1 protein_id gnl|my_center|LOCUS_08140 7186 7452 gene locus_tag LOCUS_08150 7186 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence094 2713 1187 gene locus_tag LOCUS_08160 2713 1187 CDS product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_08160 4055 2850 gene locus_tag LOCUS_08170 gene paaJ 4055 2850 CDS product 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7L2 protein_id gnl|my_center|LOCUS_08170 4495 4052 gene locus_tag LOCUS_08180 gene paaI 4495 4052 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_08180 5906 4743 gene locus_tag LOCUS_08190 5906 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6688 5903 gene locus_tag LOCUS_08200 gene paaG 6688 5903 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_08200 7338 6829 gene locus_tag LOCUS_08210 gene paaD 7338 6829 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976333.1 protein_id gnl|my_center|LOCUS_08210 <7876 7332 gene locus_tag LOCUS_08220 <7876 7332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969776.1:phenylacetic acid degradation protein >Feature sequence095 29 397 gene locus_tag LOCUS_08230 29 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 394 960 gene locus_tag LOCUS_08240 394 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1244 1011 gene locus_tag LOCUS_08250 1244 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1797 1222 gene locus_tag LOCUS_08260 1797 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2987 1794 gene locus_tag LOCUS_08270 2987 1794 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_08270 4204 3065 gene locus_tag LOCUS_08280 4204 3065 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_08280 4819 4274 gene locus_tag LOCUS_08290 4819 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5381 4863 gene locus_tag LOCUS_08300 5381 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6305 5493 gene locus_tag LOCUS_08310 6305 5493 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_08310 6480 7589 gene locus_tag LOCUS_08320 6480 7589 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence096 1299 2483 gene locus_tag LOCUS_08330 1299 2483 CDS product phage head-tail adapter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_08330 4650 2671 gene locus_tag LOCUS_08340 4650 2671 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_08340 4984 5967 gene locus_tag LOCUS_08350 4984 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6438 6064 gene locus_tag LOCUS_08360 6438 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6600 7592 gene locus_tag LOCUS_08370 6600 7592 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence097 2127 1228 gene locus_tag LOCUS_08380 2127 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3827 2193 gene locus_tag LOCUS_08390 3827 2193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08390 7182 3988 gene locus_tag LOCUS_08400 7182 3988 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_08400 7644 7252 gene locus_tag LOCUS_08410 7644 7252 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence098 <1 857 gene locus_tag LOCUS_08420 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92NG2:Fe(3+) ions import ATP-binding protein FbpC 924 1733 gene locus_tag LOCUS_08430 gene dltE 924 1733 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_08430 1860 3233 gene locus_tag LOCUS_08440 1860 3233 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_08440 3432 4541 gene locus_tag LOCUS_08450 gene acrA 3432 4541 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263944.1 protein_id gnl|my_center|LOCUS_08450 4632 4985 gene locus_tag LOCUS_08460 4632 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence099 1427 603 gene locus_tag LOCUS_08470 gene deoD 1427 603 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_08470 1486 2658 gene locus_tag LOCUS_08480 1486 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4478 2700 gene locus_tag LOCUS_08490 4478 2700 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_08490 6047 4692 gene locus_tag LOCUS_08500 6047 4692 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_08500 6138 7061 gene locus_tag LOCUS_08510 6138 7061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_08510 <7754 7198 gene locus_tag LOCUS_08520 <7754 7198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase >Feature sequence100 2747 1317 gene locus_tag LOCUS_08530 gene nuoM 2747 1317 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_08530 3658 2930 gene locus_tag LOCUS_08540 3658 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4464 3679 gene locus_tag LOCUS_08550 4464 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4977 4468 gene locus_tag LOCUS_08560 4977 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6415 5087 gene locus_tag LOCUS_08570 6415 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6581 7465 gene locus_tag LOCUS_08580 gene gluQ 6581 7465 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY0 protein_id gnl|my_center|LOCUS_08580 >Feature sequence101 2757 292 gene locus_tag LOCUS_08590 2757 292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_08590 3369 3070 gene locus_tag LOCUS_08600 3369 3070 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_08600 4398 3520 gene locus_tag LOCUS_08610 gene xerC 4398 3520 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_08610 4830 4636 gene locus_tag LOCUS_08620 gene rpsU 4830 4636 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_08620 6229 5078 gene locus_tag LOCUS_08630 6229 5078 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_08630 6632 7441 gene locus_tag LOCUS_08640 6632 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence102 2120 1107 gene locus_tag LOCUS_08650 2120 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2259 2927 gene locus_tag LOCUS_08660 2259 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3054 3494 gene locus_tag LOCUS_08670 3054 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3556 4320 gene locus_tag LOCUS_08680 3556 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5413 4367 gene locus_tag LOCUS_08690 gene hemH 5413 4367 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_08690 5530 6552 gene locus_tag LOCUS_08700 5530 6552 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_08700 7432 6758 gene locus_tag LOCUS_08710 7432 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence103 1966 542 gene locus_tag LOCUS_08720 1966 542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_08720 4918 2147 gene locus_tag LOCUS_08730 4918 2147 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405034.1 protein_id gnl|my_center|LOCUS_08730 <7676 5061 gene locus_tag LOCUS_08740 <7676 5061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962806.1:TonB-dependent receptor >Feature sequence104 1681 203 gene locus_tag LOCUS_08750 1681 203 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_08750 2234 1887 gene locus_tag LOCUS_08760 2234 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2362 2940 gene locus_tag LOCUS_08770 2362 2940 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_08770 3048 3371 gene locus_tag LOCUS_08780 3048 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3392 3967 gene locus_tag LOCUS_08790 3392 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4562 4224 gene locus_tag LOCUS_08800 4562 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4776 6140 gene locus_tag LOCUS_08810 4776 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence105 873 529 gene locus_tag LOCUS_08820 873 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1548 1144 gene locus_tag LOCUS_08830 1548 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1998 1633 gene locus_tag LOCUS_08840 1998 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3315 2059 gene locus_tag LOCUS_08850 3315 2059 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_08850 3419 4252 gene locus_tag LOCUS_08860 3419 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_08860 4812 4453 gene locus_tag LOCUS_08870 4812 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5606 4974 gene locus_tag LOCUS_08880 5606 4974 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_08880 6516 5713 gene locus_tag LOCUS_08890 gene lpxA 6516 5713 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_08890 <7666 6630 gene locus_tag LOCUS_08900 <7666 6630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY98:3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ >Feature sequence106 3048 1615 gene locus_tag LOCUS_08910 gene gatA 3048 1615 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_08910 3559 3185 gene locus_tag LOCUS_08920 3559 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3859 3593 gene locus_tag LOCUS_08930 3859 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4176 5111 gene locus_tag LOCUS_08940 4176 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6829 5411 gene locus_tag LOCUS_08950 6829 5411 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_08950 7652 6975 gene locus_tag LOCUS_08960 7652 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence107 3838 2819 gene locus_tag LOCUS_08970 3838 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4637 4038 gene locus_tag LOCUS_08980 4637 4038 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764520.1 protein_id gnl|my_center|LOCUS_08980 5873 4887 gene locus_tag LOCUS_08990 5873 4887 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_08990 6078 7454 gene locus_tag LOCUS_09000 gene mntH 6078 7454 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y773 protein_id gnl|my_center|LOCUS_09000 >Feature sequence108 <1 2480 gene locus_tag LOCUS_09010 <1 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 2582 3031 gene locus_tag LOCUS_09020 2582 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3056 3898 gene locus_tag LOCUS_09030 3056 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4817 4023 gene locus_tag LOCUS_09040 gene terC 4817 4023 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_09040 5530 4892 gene locus_tag LOCUS_09050 5530 4892 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL1 protein_id gnl|my_center|LOCUS_09050 5540 5983 gene locus_tag LOCUS_09060 5540 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6011 6469 gene locus_tag LOCUS_09070 6011 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 <7526 6482 gene locus_tag LOCUS_09080 <7526 6482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW65:UvrABC system protein C >Feature sequence109 1013 501 gene locus_tag LOCUS_09090 1013 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4827 1210 gene locus_tag LOCUS_09100 gene fpp1 4827 1210 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_09100 6002 5079 gene locus_tag LOCUS_09110 6002 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence110 59 436 gene locus_tag LOCUS_09120 gene rpsM 59 436 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_09120 577 969 gene locus_tag LOCUS_09130 gene rpsK 577 969 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 protein_id gnl|my_center|LOCUS_09130 996 1601 gene locus_tag LOCUS_09140 gene rpsD 996 1601 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN4 protein_id gnl|my_center|LOCUS_09140 1789 2757 gene locus_tag LOCUS_09150 gene rpoA 1789 2757 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN5 protein_id gnl|my_center|LOCUS_09150 2932 3525 gene locus_tag LOCUS_09160 gene rplQ 2932 3525 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A3 protein_id gnl|my_center|LOCUS_09160 3984 3649 gene locus_tag LOCUS_09170 3984 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4225 3974 gene locus_tag LOCUS_09180 4225 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4407 5009 gene locus_tag LOCUS_09190 4407 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5068 6339 gene locus_tag LOCUS_09200 gene eno 5068 6339 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_09200 6507 6824 gene locus_tag LOCUS_09210 6507 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6824 7300 gene locus_tag LOCUS_09220 6824 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence111 771 187 gene locus_tag LOCUS_09230 771 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 892 1311 gene locus_tag LOCUS_09240 892 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3479 1437 gene locus_tag LOCUS_09250 3479 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5311 3602 gene locus_tag LOCUS_09260 5311 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5619 6284 gene locus_tag LOCUS_09270 5619 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6659 6297 gene locus_tag LOCUS_09280 6659 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403456.1 protein_id gnl|my_center|LOCUS_09280 <7453 6672 gene locus_tag LOCUS_09290 <7453 6672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence112 219 893 gene locus_tag LOCUS_09300 219 893 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 protein_id gnl|my_center|LOCUS_09300 2323 890 gene locus_tag LOCUS_09310 2323 890 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_09310 3709 2405 gene locus_tag LOCUS_09320 3709 2405 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_09320 5119 3902 gene locus_tag LOCUS_09330 gene porV 5119 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_09330 <7440 5212 gene locus_tag LOCUS_09340 <7440 5212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence113 3915 6314 gene locus_tag LOCUS_09350 3915 6314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_09350 6368 7141 gene locus_tag LOCUS_09360 6368 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence114 929 240 gene locus_tag LOCUS_09370 929 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1540 929 gene locus_tag LOCUS_09380 1540 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_09380 2221 1595 gene locus_tag LOCUS_09390 2221 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_09390 3745 2258 gene locus_tag LOCUS_09400 3745 2258 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2K1 protein_id gnl|my_center|LOCUS_09400 3951 5120 gene locus_tag LOCUS_09410 3951 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5822 5199 gene locus_tag LOCUS_09420 5822 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6975 6055 gene locus_tag LOCUS_09430 6975 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence115 1058 1447 gene locus_tag LOCUS_09440 1058 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2048 1539 gene locus_tag LOCUS_09450 2048 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4560 2407 gene locus_tag LOCUS_09460 4560 2407 CDS product hydroxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114921.1 protein_id gnl|my_center|LOCUS_09460 4718 5419 gene locus_tag LOCUS_09470 4718 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6042 5533 gene locus_tag LOCUS_09480 6042 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7200 6055 gene locus_tag LOCUS_09490 7200 6055 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence116 2470 3369 gene locus_tag LOCUS_09500 gene xerC 2470 3369 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_09500 3524 6415 gene locus_tag LOCUS_09510 3524 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6534 7178 gene locus_tag LOCUS_09520 6534 7178 CDS product cell envelope biogenesis protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404316.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence117 2106 616 gene locus_tag LOCUS_09530 gene hutH1 2106 616 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_09530 2856 2248 gene locus_tag LOCUS_09540 2856 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4244 2856 gene locus_tag LOCUS_09550 gene hisS 4244 2856 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_09550 6916 4379 gene locus_tag LOCUS_09560 6916 4379 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence118 3525 2692 gene locus_tag LOCUS_09570 3525 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3922 4845 gene locus_tag LOCUS_09580 3922 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_09580 5433 4855 gene locus_tag LOCUS_09590 5433 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5896 5594 gene locus_tag LOCUS_09600 5896 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_09600 6459 6019 gene locus_tag LOCUS_09610 6459 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6604 7020 gene locus_tag LOCUS_09620 6604 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence119 1724 63 gene locus_tag LOCUS_09630 1724 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2364 1714 gene locus_tag LOCUS_09640 2364 1714 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_09640 2753 5608 gene locus_tag LOCUS_09650 2753 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5826 6479 gene locus_tag LOCUS_09660 5826 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6803 6633 gene locus_tag LOCUS_09670 6803 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7175 7002 gene locus_tag LOCUS_09680 7175 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence120 2653 953 gene locus_tag LOCUS_09690 gene kdpA 2653 953 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H086 protein_id gnl|my_center|LOCUS_09690 4635 3280 gene locus_tag LOCUS_09700 4635 3280 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_09700 7110 5077 gene locus_tag LOCUS_09710 7110 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence121 805 386 gene locus_tag LOCUS_09720 805 386 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_09720 2959 851 gene locus_tag LOCUS_09730 2959 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3973 3161 gene locus_tag LOCUS_09740 3973 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4126 5292 gene locus_tag LOCUS_09750 4126 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_09750 5408 6217 gene locus_tag LOCUS_09760 5408 6217 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_09760 6313 6963 gene locus_tag LOCUS_09770 6313 6963 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence122 <1 1536 gene locus_tag LOCUS_09780 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0Z9:pseudouridine synthase 1593 2333 gene locus_tag LOCUS_09790 gene coaX 1593 2333 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_09790 2338 3660 gene locus_tag LOCUS_09800 2338 3660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_09800 3671 4255 gene locus_tag LOCUS_09810 3671 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4274 4582 gene locus_tag LOCUS_09820 4274 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4818 6878 gene locus_tag LOCUS_09830 4818 6878 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_09830 >Feature sequence123 1032 2699 gene locus_tag LOCUS_09840 1032 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2745 3386 gene locus_tag LOCUS_09850 2745 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4129 3656 gene locus_tag LOCUS_09860 4129 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5102 4428 gene locus_tag LOCUS_09870 5102 4428 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09870 5677 6129 gene locus_tag LOCUS_09880 5677 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7175 6180 gene locus_tag LOCUS_09890 7175 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence124 3 404 gene locus_tag LOCUS_09900 3 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 448 1056 gene locus_tag LOCUS_09910 448 1056 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_09910 2445 1144 gene locus_tag LOCUS_09920 2445 1144 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_09920 2796 3056 gene locus_tag LOCUS_09930 2796 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3194 4270 gene locus_tag LOCUS_09940 gene menC 3194 4270 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_09940 4358 5602 gene locus_tag LOCUS_09950 4358 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5680 6057 gene locus_tag LOCUS_09960 gene ygdD 5680 6057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_09960 6643 6128 gene locus_tag LOCUS_09970 6643 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence125 3127 926 gene locus_tag LOCUS_09980 3127 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3613 4233 gene locus_tag LOCUS_09990 gene engB 3613 4233 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_09990 4358 4774 gene locus_tag LOCUS_10000 4358 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4915 5547 gene locus_tag LOCUS_10010 4915 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 6647 5619 gene locus_tag LOCUS_10020 gene fbp 6647 5619 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_10020 >Feature sequence126 593 1531 gene locus_tag LOCUS_10030 593 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2139 1549 gene locus_tag LOCUS_10040 2139 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3928 2315 gene locus_tag LOCUS_10050 3928 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4127 4324 gene locus_tag LOCUS_10060 gene cspA 4127 4324 CDS product cold shock-like protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KN00 protein_id gnl|my_center|LOCUS_10060 4937 4449 gene locus_tag LOCUS_10070 4937 4449 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_10070 6827 5139 gene locus_tag LOCUS_10080 6827 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence127 1820 1620 gene locus_tag LOCUS_10090 1820 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2055 3323 gene locus_tag LOCUS_10100 2055 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4211 3495 gene locus_tag LOCUS_10110 gene msrA 4211 3495 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTB6 protein_id gnl|my_center|LOCUS_10110 4485 5411 gene locus_tag LOCUS_10120 4485 5411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_10120 5942 5463 gene locus_tag LOCUS_10130 gene maoC 5942 5463 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_10130 6069 6920 gene locus_tag LOCUS_10140 6069 6920 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence128 387 1178 gene locus_tag LOCUS_10150 387 1178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_10150 1255 2700 gene locus_tag LOCUS_10160 1255 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3297 2713 gene locus_tag LOCUS_10170 3297 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_10170 4101 3334 gene locus_tag LOCUS_10180 4101 3334 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_10180 5301 4189 gene locus_tag LOCUS_10190 5301 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5997 5305 gene locus_tag LOCUS_10200 5997 5305 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_10200 6578 5994 gene locus_tag LOCUS_10210 6578 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence129 581 171 gene locus_tag LOCUS_10220 581 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 667 1023 gene locus_tag LOCUS_10230 667 1023 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144188.1 protein_id gnl|my_center|LOCUS_10230 1090 1836 gene locus_tag LOCUS_10240 1090 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1933 2352 gene locus_tag LOCUS_10250 1933 2352 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887824.1 protein_id gnl|my_center|LOCUS_10250 2445 2651 gene locus_tag LOCUS_10260 2445 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2885 3514 gene locus_tag LOCUS_10270 2885 3514 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_10270 3595 4320 gene locus_tag LOCUS_10280 3595 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4444 6387 gene locus_tag LOCUS_10290 gene kup 4444 6387 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence130 373 83 gene locus_tag LOCUS_10300 373 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10300 2482 671 gene locus_tag LOCUS_10310 gene pepN 2482 671 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_10310 2767 4530 gene locus_tag LOCUS_10320 2767 4530 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_10320 4801 5535 gene locus_tag LOCUS_10330 4801 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6511 6687 gene locus_tag LOCUS_10340 6511 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence131 1178 240 gene locus_tag LOCUS_10350 1178 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2630 1329 gene locus_tag LOCUS_10360 gene hemL 2630 1329 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_10360 4486 2711 gene locus_tag LOCUS_10370 4486 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4775 5458 gene locus_tag LOCUS_10380 4775 5458 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_10380 6058 5522 gene locus_tag LOCUS_10390 6058 5522 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403562.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence132 1015 1281 gene locus_tag LOCUS_10400 1015 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1375 1602 gene locus_tag LOCUS_10410 1375 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1691 2110 gene locus_tag LOCUS_10420 1691 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2432 2196 gene locus_tag LOCUS_10430 2432 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2561 3469 gene locus_tag LOCUS_10440 2561 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3616 4626 gene locus_tag LOCUS_10450 3616 4626 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_10450 4812 5483 gene locus_tag LOCUS_10460 4812 5483 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_10460 5623 6765 gene locus_tag LOCUS_10470 5623 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence133 673 1263 gene locus_tag LOCUS_10480 gene miaE 673 1263 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_10480 2752 1358 gene locus_tag LOCUS_10490 2752 1358 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_10490 3204 3680 gene locus_tag LOCUS_10500 3204 3680 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_10500 3687 4580 gene locus_tag LOCUS_10510 3687 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4712 5260 gene locus_tag LOCUS_10520 4712 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5311 5649 gene locus_tag LOCUS_10530 5311 5649 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK3 protein_id gnl|my_center|LOCUS_10530 >Feature sequence134 4386 3118 gene locus_tag LOCUS_10540 4386 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4594 4509 gene locus_tag LOCUS_t00140 4594 4509 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4795 4708 gene locus_tag LOCUS_t00150 4795 4708 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5881 4901 gene locus_tag LOCUS_10550 gene yfkH 5881 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_10550 6461 5934 gene locus_tag LOCUS_10560 6461 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence135 4173 3817 gene locus_tag LOCUS_10570 4173 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257768.1 protein_id gnl|my_center|LOCUS_10570 4596 4177 gene locus_tag LOCUS_10580 4596 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5756 4665 gene locus_tag LOCUS_10590 5756 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 6271 5846 gene locus_tag LOCUS_10600 6271 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6677 6447 gene locus_tag LOCUS_10610 6677 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence136 319 107 gene locus_tag LOCUS_10620 319 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 230 1147 gene locus_tag LOCUS_10630 230 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_10630 1189 1710 gene locus_tag LOCUS_10640 1189 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1943 2752 gene locus_tag LOCUS_10650 1943 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679779.1 protein_id gnl|my_center|LOCUS_10650 2832 2963 gene locus_tag LOCUS_10660 2832 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2974 3207 gene locus_tag LOCUS_10670 2974 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3211 3417 gene locus_tag LOCUS_10680 3211 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3466 3936 gene locus_tag LOCUS_10690 3466 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4078 4527 gene locus_tag LOCUS_10700 4078 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5459 4698 gene locus_tag LOCUS_10710 5459 4698 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_10710 5957 5538 gene locus_tag LOCUS_10720 5957 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence137 54 1844 gene locus_tag LOCUS_10730 54 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10730 3354 1936 gene locus_tag LOCUS_10740 3354 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4215 3454 gene locus_tag LOCUS_10750 4215 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5001 4243 gene locus_tag LOCUS_10760 5001 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5958 5011 gene locus_tag LOCUS_10770 5958 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence138 200 916 gene locus_tag LOCUS_10780 200 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 928 1143 gene locus_tag LOCUS_10790 928 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1073 1537 gene locus_tag LOCUS_10800 1073 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1873 1616 gene locus_tag LOCUS_10810 1873 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2981 1989 gene locus_tag LOCUS_10820 2981 1989 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_10820 3161 4072 gene locus_tag LOCUS_10830 3161 4072 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_10830 5975 4146 gene locus_tag LOCUS_10840 gene htpG 5975 4146 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_10840 >Feature sequence139 1414 635 gene locus_tag LOCUS_10850 1414 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2787 1684 gene locus_tag LOCUS_10860 gene recA 2787 1684 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_10860 2993 4201 gene locus_tag LOCUS_10870 2993 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4755 4213 gene locus_tag LOCUS_10880 4755 4213 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_10880 5327 4908 gene locus_tag LOCUS_10890 5327 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6437 5481 gene locus_tag LOCUS_10900 6437 5481 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence140 587 3997 gene locus_tag LOCUS_10910 gene secA 587 3997 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_10910 4567 5205 gene locus_tag LOCUS_10920 4567 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5437 5928 gene locus_tag LOCUS_10930 5437 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence141 1318 2700 gene locus_tag LOCUS_10940 1318 2700 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 protein_id gnl|my_center|LOCUS_10940 2817 3752 gene locus_tag LOCUS_10950 2817 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3876 4571 gene locus_tag LOCUS_10960 3876 4571 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_10960 4620 5183 gene locus_tag LOCUS_10970 4620 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence142 82 897 gene locus_tag LOCUS_10980 gene fecB 82 897 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_10980 2187 904 gene locus_tag LOCUS_10990 gene aroA 2187 904 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_10990 3227 2187 gene locus_tag LOCUS_11000 gene aroB 3227 2187 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_11000 3343 3762 gene locus_tag LOCUS_11010 3343 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3793 4227 gene locus_tag LOCUS_11020 3793 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5322 4243 gene locus_tag LOCUS_11030 5322 4243 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence143 2973 1726 gene locus_tag LOCUS_11040 2973 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3229 3017 gene locus_tag LOCUS_11050 3229 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4923 3841 gene locus_tag LOCUS_11060 4923 3841 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_11060 6569 5118 gene locus_tag LOCUS_11070 6569 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence144 1503 202 gene locus_tag LOCUS_11080 gene chrA 1503 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794551.1 protein_id gnl|my_center|LOCUS_11080 2661 1615 gene locus_tag LOCUS_11090 2661 1615 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_11090 2728 3588 gene locus_tag LOCUS_11100 2728 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 protein_id gnl|my_center|LOCUS_11100 3672 4940 gene locus_tag LOCUS_11110 3672 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence145 512 108 gene locus_tag LOCUS_11120 512 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1292 918 gene locus_tag LOCUS_11130 1292 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2013 1444 gene locus_tag LOCUS_11140 2013 1444 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096557.1 protein_id gnl|my_center|LOCUS_11140 2203 3102 gene locus_tag LOCUS_11150 2203 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3301 3690 gene locus_tag LOCUS_11160 gene nuoK 3301 3690 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q3 protein_id gnl|my_center|LOCUS_11160 3784 5736 gene locus_tag LOCUS_11170 gene nuoL 3784 5736 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence146 250 2106 gene locus_tag LOCUS_11180 250 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636719.2 protein_id gnl|my_center|LOCUS_11180 4003 2243 gene locus_tag LOCUS_11190 4003 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4052 4417 gene locus_tag LOCUS_11200 4052 4417 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918812.1 protein_id gnl|my_center|LOCUS_11200 4435 4806 gene locus_tag LOCUS_11210 4435 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence147 1134 412 gene locus_tag LOCUS_11220 1134 412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706305.1 protein_id gnl|my_center|LOCUS_11220 1235 1966 gene locus_tag LOCUS_11230 1235 1966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_11230 2076 2888 gene locus_tag LOCUS_11240 2076 2888 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_11240 3578 3027 gene locus_tag LOCUS_11250 gene yfiT 3578 3027 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_11250 4455 3829 gene locus_tag LOCUS_11260 4455 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_11260 5653 4676 gene locus_tag LOCUS_11270 gene etfA 5653 4676 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_11270 6526 5786 gene locus_tag LOCUS_11280 gene etfB 6526 5786 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence148 <1 1055 gene locus_tag LOCUS_11290 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010538536.1:serine protease 1349 2593 gene locus_tag LOCUS_11300 1349 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2711 3109 gene locus_tag LOCUS_11310 2711 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3247 4851 gene locus_tag LOCUS_11320 gene pcd 3247 4851 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_11320 5470 4940 gene locus_tag LOCUS_11330 5470 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5700 6194 gene locus_tag LOCUS_11340 5700 6194 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence149 186 1646 gene locus_tag LOCUS_11350 186 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1888 2439 gene locus_tag LOCUS_11360 1888 2439 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_11360 2494 5568 gene locus_tag LOCUS_11370 2494 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence150 <1 824 gene locus_tag LOCUS_11380 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964315.1:NADH dehydrogenase subunit G 903 1997 gene locus_tag LOCUS_11390 gene nuoH 903 1997 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q6 protein_id gnl|my_center|LOCUS_11390 2015 2272 gene locus_tag LOCUS_11400 2015 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2293 2859 gene locus_tag LOCUS_11410 gene nuoI 2293 2859 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_11410 2983 3492 gene locus_tag LOCUS_11420 gene nuoJ 2983 3492 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_11420 3669 4913 gene locus_tag LOCUS_11430 3669 4913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_11430 5063 6460 gene locus_tag LOCUS_11440 5063 6460 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence151 115 1617 gene locus_tag LOCUS_11450 gene mqo 115 1617 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_11450 1873 3156 gene locus_tag LOCUS_11460 1873 3156 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_11460 3199 4332 gene locus_tag LOCUS_11470 3199 4332 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_11470 5972 4422 gene locus_tag LOCUS_11480 5972 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence152 1513 329 gene locus_tag LOCUS_11490 gene uxuA 1513 329 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_11490 2328 1513 gene locus_tag LOCUS_11500 2328 1513 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_11500 3571 2369 gene locus_tag LOCUS_11510 3571 2369 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_11510 4842 3637 gene locus_tag LOCUS_11520 4842 3637 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227813.1 protein_id gnl|my_center|LOCUS_11520 5172 6389 gene locus_tag LOCUS_11530 5172 6389 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence153 1993 167 gene locus_tag LOCUS_11540 1993 167 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_11540 2132 2788 gene locus_tag LOCUS_11550 2132 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4856 3513 gene locus_tag LOCUS_11560 4856 3513 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_11560 5629 4943 gene locus_tag LOCUS_11570 5629 4943 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_11570 6123 5785 gene locus_tag LOCUS_11580 6123 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence154 478 642 gene locus_tag LOCUS_11590 478 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 823 2595 gene locus_tag LOCUS_11600 823 2595 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933296.1 protein_id gnl|my_center|LOCUS_11600 2607 3668 gene locus_tag LOCUS_11610 2607 3668 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705201.1 protein_id gnl|my_center|LOCUS_11610 3665 4633 gene locus_tag LOCUS_11620 3665 4633 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_11620 4786 4712 gene locus_tag LOCUS_t00160 4786 4712 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5644 4937 gene locus_tag LOCUS_11630 5644 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence155 3219 862 gene locus_tag LOCUS_11640 3219 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6083 3855 gene locus_tag LOCUS_11650 6083 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6444 6241 gene locus_tag LOCUS_11660 6444 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence156 96 21 gene locus_tag LOCUS_t00170 96 21 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2995 233 gene locus_tag LOCUS_11670 gene mutS 2995 233 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A334 protein_id gnl|my_center|LOCUS_11670 3357 3875 gene locus_tag LOCUS_11680 3357 3875 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_11680 4103 5548 gene locus_tag LOCUS_11690 4103 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence157 1716 652 gene locus_tag LOCUS_11700 1716 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5334 3613 gene locus_tag LOCUS_11710 5334 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 6009 5458 gene locus_tag LOCUS_11720 6009 5458 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence158 5 2056 gene locus_tag LOCUS_11730 5 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3438 2146 gene locus_tag LOCUS_11740 gene argH 3438 2146 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_11740 4513 3407 gene locus_tag LOCUS_11750 4513 3407 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_11750 5274 4501 gene locus_tag LOCUS_11760 gene argB 5274 4501 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_11760 5772 6359 gene locus_tag LOCUS_11770 5772 6359 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence159 758 4360 gene locus_tag LOCUS_11780 758 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5291 4650 gene locus_tag LOCUS_11790 5291 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence160 499 134 gene locus_tag LOCUS_11800 499 134 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_11800 1037 528 gene locus_tag LOCUS_11810 gene atpF 1037 528 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_11810 1487 1218 gene locus_tag LOCUS_11820 gene atpE 1487 1218 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9V0 protein_id gnl|my_center|LOCUS_11820 2712 1624 gene locus_tag LOCUS_11830 gene atpB 2712 1624 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_11830 3156 2749 gene locus_tag LOCUS_11840 3156 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3414 3184 gene locus_tag LOCUS_11850 3414 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence161 526 2571 gene locus_tag LOCUS_11860 526 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_11860 2675 3175 gene locus_tag LOCUS_11870 2675 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3206 3742 gene locus_tag LOCUS_11880 3206 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3735 4712 gene locus_tag LOCUS_11890 3735 4712 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_11890 4831 6189 gene locus_tag LOCUS_11900 4831 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence162 <1 946 gene locus_tag LOCUS_11910 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963249.1:cyanophycinase 1993 1055 gene locus_tag LOCUS_11920 1993 1055 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930911.1 protein_id gnl|my_center|LOCUS_11920 2142 2570 gene locus_tag LOCUS_11930 2142 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2688 3320 gene locus_tag LOCUS_11940 2688 3320 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_11940 5493 3784 gene locus_tag LOCUS_11950 5493 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5665 6315 gene locus_tag LOCUS_11960 5665 6315 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence163 <1 702 gene locus_tag LOCUS_11970 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107396.1:cation transporter 765 1847 gene locus_tag LOCUS_11980 765 1847 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107397.1 protein_id gnl|my_center|LOCUS_11980 1975 5133 gene locus_tag LOCUS_11990 1975 5133 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_11990 5202 5663 gene locus_tag LOCUS_12000 5202 5663 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence164 <1 2763 gene locus_tag LOCUS_12010 <1 2763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390685.1:hybrid sensor histidine kinase/response regulator 2787 3206 gene locus_tag LOCUS_12020 2787 3206 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_12020 4783 3233 gene locus_tag LOCUS_12030 gene dnaA 4783 3233 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6M2 protein_id gnl|my_center|LOCUS_12030 6000 5062 gene locus_tag LOCUS_12040 6000 5062 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence165 564 974 gene locus_tag LOCUS_12050 564 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1068 1415 gene locus_tag LOCUS_12060 1068 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2904 1615 gene locus_tag LOCUS_12070 2904 1615 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_12070 3167 3940 gene locus_tag LOCUS_12080 3167 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 <6202 4045 gene locus_tag LOCUS_12090 <6202 4045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence166 431 2077 gene locus_tag LOCUS_12100 431 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3154 2174 gene locus_tag LOCUS_12110 3154 2174 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_12110 4890 3244 gene locus_tag LOCUS_12120 4890 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5938 5018 gene locus_tag LOCUS_12130 5938 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence167 <1 3090 gene locus_tag LOCUS_12140 <1 3090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798907.1:SusC/RagA family TonB-linked outer membrane protein 3121 4626 gene locus_tag LOCUS_12150 3121 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence168 1348 593 gene locus_tag LOCUS_12160 1348 593 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_12160 3624 1495 gene locus_tag LOCUS_12170 3624 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3746 4312 gene locus_tag LOCUS_12180 3746 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888534.1 protein_id gnl|my_center|LOCUS_12180 4414 5415 gene locus_tag LOCUS_12190 gene gapA 4414 5415 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_12190 >Feature sequence169 3 518 gene locus_tag LOCUS_12200 3 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1159 569 gene locus_tag LOCUS_12210 1159 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2019 1159 gene locus_tag LOCUS_12220 2019 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2994 2194 gene locus_tag LOCUS_12230 gene proC 2994 2194 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 protein_id gnl|my_center|LOCUS_12230 4245 3124 gene locus_tag LOCUS_12240 4245 3124 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_12240 6045 4279 gene locus_tag LOCUS_12250 gene yngK 6045 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence170 603 977 gene locus_tag LOCUS_12260 603 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1145 2056 gene locus_tag LOCUS_12270 gene rnz 1145 2056 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 protein_id gnl|my_center|LOCUS_12270 2330 3085 gene locus_tag LOCUS_12280 2330 3085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_12280 3268 3618 gene locus_tag LOCUS_12290 3268 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703755.1 protein_id gnl|my_center|LOCUS_12290 3742 4521 gene locus_tag LOCUS_12300 3742 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4828 4604 gene locus_tag LOCUS_12310 4828 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5382 4861 gene locus_tag LOCUS_12320 5382 4861 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_12320 5496 5951 gene locus_tag LOCUS_12330 5496 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence171 1607 4117 gene locus_tag LOCUS_12340 gene topA 1607 4117 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X7 protein_id gnl|my_center|LOCUS_12340 4157 4801 gene locus_tag LOCUS_12350 4157 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence172 892 2058 gene locus_tag LOCUS_12360 892 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2986 2225 gene locus_tag LOCUS_12370 2986 2225 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_12370 2977 5793 gene locus_tag LOCUS_12380 2977 5793 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence173 615 301 gene locus_tag LOCUS_12390 615 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1694 960 gene locus_tag LOCUS_12400 1694 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2610 1786 gene locus_tag LOCUS_12410 gene menB 2610 1786 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HC28 protein_id gnl|my_center|LOCUS_12410 4518 2728 gene locus_tag LOCUS_12420 gene menD 4518 2728 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_12420 >Feature sequence174 <1 510 gene locus_tag LOCUS_12430 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964564.1:epimerase 577 993 gene locus_tag LOCUS_12440 577 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_12440 1137 1919 gene locus_tag LOCUS_12450 1137 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1983 3038 gene locus_tag LOCUS_12460 1983 3038 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_12460 3089 4069 gene locus_tag LOCUS_12470 3089 4069 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_12470 4066 6060 gene locus_tag LOCUS_12480 4066 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence175 2416 1823 gene locus_tag LOCUS_12490 2416 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2720 3148 gene locus_tag LOCUS_12500 2720 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3388 3807 gene locus_tag LOCUS_12510 3388 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4763 5878 gene locus_tag LOCUS_12520 4763 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence176 1558 539 gene locus_tag LOCUS_12530 1558 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4379 1923 gene locus_tag LOCUS_12540 4379 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4566 5228 gene locus_tag LOCUS_12550 4566 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5364 5693 gene locus_tag LOCUS_12560 5364 5693 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence177 450 1142 gene locus_tag LOCUS_12570 450 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_12570 1590 1168 gene locus_tag LOCUS_12580 gene moaE 1590 1168 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_12580 1976 1734 gene locus_tag LOCUS_12590 gene moaD 1976 1734 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDC0 protein_id gnl|my_center|LOCUS_12590 2122 3162 gene locus_tag LOCUS_12600 gene moaA 2122 3162 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EJ8 protein_id gnl|my_center|LOCUS_12600 >Feature sequence178 <1 836 gene locus_tag LOCUS_12610 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZS98:histidine kinase 909 1637 gene locus_tag LOCUS_12620 909 1637 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_12620 1671 2276 gene locus_tag LOCUS_12630 1671 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2347 3207 gene locus_tag LOCUS_12640 2347 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence179 273 707 gene locus_tag LOCUS_12650 273 707 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_12650 729 3788 gene locus_tag LOCUS_12660 729 3788 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_12660 4004 5362 gene locus_tag LOCUS_12670 4004 5362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_12670 5421 5651 gene locus_tag LOCUS_12680 5421 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence180 <1 679 gene locus_tag LOCUS_12690 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor 810 1793 gene locus_tag LOCUS_12700 810 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2569 1949 gene locus_tag LOCUS_12710 2569 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2823 3107 gene locus_tag LOCUS_12720 2823 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3219 3854 gene locus_tag LOCUS_12730 gene plsY2 3219 3854 CDS product glycerol-3-phosphate acyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFJ3 protein_id gnl|my_center|LOCUS_12730 3952 5322 gene locus_tag LOCUS_12740 3952 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence181 1651 263 gene locus_tag LOCUS_12750 1651 263 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_12750 4283 1965 gene locus_tag LOCUS_12760 4283 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4990 4574 gene locus_tag LOCUS_12770 4990 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5438 5109 gene locus_tag LOCUS_12780 5438 5109 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6I1 protein_id gnl|my_center|LOCUS_12780 <6019 5454 gene locus_tag LOCUS_12790 <6019 5454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258470.1:stage II sporulation protein E >Feature sequence182 <1 1743 gene locus_tag LOCUS_12800 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964508.1:penicillin-binding protein 2 1844 2668 gene locus_tag LOCUS_12810 gene dapF 1844 2668 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_12810 2773 3279 gene locus_tag LOCUS_12820 2773 3279 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_12820 3458 4759 gene locus_tag LOCUS_12830 3458 4759 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_12830 4833 6011 gene locus_tag LOCUS_12840 4833 6011 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889626.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence183 4136 1950 gene locus_tag LOCUS_12850 gene srfJ 4136 1950 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230106.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence184 2631 3812 gene locus_tag LOCUS_12860 2631 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3933 5702 gene locus_tag LOCUS_12870 3933 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence185 1775 867 gene locus_tag LOCUS_12880 1775 867 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_12880 4154 1860 gene locus_tag LOCUS_12890 4154 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4277 4558 gene locus_tag LOCUS_12900 4277 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4582 5763 gene locus_tag LOCUS_12910 4582 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005746663.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence186 79 1419 gene locus_tag LOCUS_12920 79 1419 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_12920 1453 2985 gene locus_tag LOCUS_12930 1453 2985 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_12930 3241 4713 gene locus_tag LOCUS_12940 3241 4713 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_12940 5099 4716 gene locus_tag LOCUS_12950 5099 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5576 5211 gene locus_tag LOCUS_12960 5576 5211 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887809.1 protein_id gnl|my_center|LOCUS_12960 5989 5570 gene locus_tag LOCUS_12970 5989 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence187 <1 1559 gene locus_tag LOCUS_12980 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000875702.1:thermolysin 3976 2033 gene locus_tag LOCUS_12990 3976 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4364 5305 gene locus_tag LOCUS_13000 4364 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence188 49 783 gene locus_tag LOCUS_13010 49 783 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040319.1 protein_id gnl|my_center|LOCUS_13010 1800 931 gene locus_tag LOCUS_13020 1800 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_13020 2282 2067 gene locus_tag LOCUS_13030 2282 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4165 2321 gene locus_tag LOCUS_13040 4165 2321 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_13040 4650 4204 gene locus_tag LOCUS_13050 4650 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <5946 4780 gene locus_tag LOCUS_13060 <5946 4780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963433.1:sodium:solute symporter >Feature sequence189 834 1238 gene locus_tag LOCUS_13070 834 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1865 1479 gene locus_tag LOCUS_13080 gene rplS 1865 1479 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CH65 protein_id gnl|my_center|LOCUS_13080 4136 2082 gene locus_tag LOCUS_13090 4136 2082 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_13090 4416 4736 gene locus_tag LOCUS_13100 4416 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence190 133 318 gene locus_tag LOCUS_13110 133 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 535 1563 gene locus_tag LOCUS_13120 535 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1556 2929 gene locus_tag LOCUS_13130 1556 2929 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_13130 3017 4477 gene locus_tag LOCUS_13140 3017 4477 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_13140 5326 4859 gene locus_tag LOCUS_13150 5326 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence191 >Feature sequence192 2324 1215 gene locus_tag LOCUS_13160 gene irpA 2324 1215 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_13160 3666 2500 gene locus_tag LOCUS_13170 3666 2500 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_13170 4884 3841 gene locus_tag LOCUS_13180 4884 3841 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266539.1 protein_id gnl|my_center|LOCUS_13180 5670 4912 gene locus_tag LOCUS_13190 5670 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5897 5676 gene locus_tag LOCUS_13200 5897 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence193 <1 1090 gene locus_tag LOCUS_13210 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein 2076 1246 gene locus_tag LOCUS_13220 2076 1246 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_13220 3682 2276 gene locus_tag LOCUS_13230 3682 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_13230 4865 3861 gene locus_tag LOCUS_13240 4865 3861 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_13240 5681 4905 gene locus_tag LOCUS_13250 5681 4905 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence194 725 3013 gene locus_tag LOCUS_13260 gene acn 725 3013 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_13260 3637 3098 gene locus_tag LOCUS_13270 3637 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4016 4270 gene locus_tag LOCUS_13280 gene sdpR 4016 4270 CDS product transcriptional repressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32242 protein_id gnl|my_center|LOCUS_13280 4291 4944 gene locus_tag LOCUS_13290 4291 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_13290 5554 5126 gene locus_tag LOCUS_13300 5554 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence195 49 636 gene locus_tag LOCUS_13310 49 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_13310 784 3159 gene locus_tag LOCUS_13320 gene pepN 784 3159 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_13320 4829 3435 gene locus_tag LOCUS_13330 4829 3435 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_13330 5337 4975 gene locus_tag LOCUS_13340 5337 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5809 5390 gene locus_tag LOCUS_13350 5809 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence196 1376 2548 gene locus_tag LOCUS_13360 1376 2548 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_13360 2545 3435 gene locus_tag LOCUS_13370 2545 3435 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869424.1 protein_id gnl|my_center|LOCUS_13370 3471 4256 gene locus_tag LOCUS_13380 3471 4256 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_13380 4307 5008 gene locus_tag LOCUS_13390 4307 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence197 1345 110 gene locus_tag LOCUS_13400 1345 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1838 1353 gene locus_tag LOCUS_13410 gene moaC 1838 1353 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_13410 2051 3268 gene locus_tag LOCUS_13420 gene moeA 2051 3268 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence198 8 1111 gene locus_tag LOCUS_13430 gene rtcB 8 1111 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SR8 protein_id gnl|my_center|LOCUS_13430 1683 1297 gene locus_tag LOCUS_13440 1683 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4739 1935 gene locus_tag LOCUS_13450 4739 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence199 34 777 gene locus_tag LOCUS_13460 34 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 913 2229 gene locus_tag LOCUS_13470 gene ahcY 913 2229 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_13470 2989 2321 gene locus_tag LOCUS_13480 2989 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3376 3134 gene locus_tag LOCUS_13490 3376 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4942 3899 gene locus_tag LOCUS_13500 4942 3899 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence200 436 1809 gene locus_tag LOCUS_13510 436 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1999 3471 gene locus_tag LOCUS_13520 1999 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4086 3577 gene locus_tag LOCUS_13530 4086 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_13530 <5744 4326 gene locus_tag LOCUS_13540 <5744 4326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803940.1:PDK repeat-containing protein >Feature sequence201 2955 2404 gene locus_tag LOCUS_13550 gene tdk 2955 2404 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_13550 3400 3080 gene locus_tag LOCUS_13560 3400 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3435 4649 gene locus_tag LOCUS_13570 3435 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence202 208 1284 gene locus_tag LOCUS_13580 gene ctaC 208 1284 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_13580 1362 3242 gene locus_tag LOCUS_13590 gene ctaD 1362 3242 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_13590 3567 4694 gene locus_tag LOCUS_13600 3567 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4737 5588 gene locus_tag LOCUS_13610 gene ctaB 4737 5588 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_13610 >Feature sequence203 1193 168 gene locus_tag LOCUS_13620 gene mreB 1193 168 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_13620 3112 1571 gene locus_tag LOCUS_13630 gene purH 3112 1571 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_13630 3287 4501 gene locus_tag LOCUS_13640 3287 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143041.1 protein_id gnl|my_center|LOCUS_13640 4510 5256 gene locus_tag LOCUS_13650 4510 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence204 3062 147 gene locus_tag LOCUS_13660 3062 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3114 4235 gene locus_tag LOCUS_13670 3114 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4333 4683 gene locus_tag LOCUS_13680 4333 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4824 5207 gene locus_tag LOCUS_13690 4824 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence205 783 2018 gene locus_tag LOCUS_13700 gene gcdH 783 2018 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_13700 2024 2530 gene locus_tag LOCUS_13710 2024 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002073755.1 protein_id gnl|my_center|LOCUS_13710 2878 3450 gene locus_tag LOCUS_13720 2878 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3866 3504 gene locus_tag LOCUS_13730 3866 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 <5653 3969 gene locus_tag LOCUS_13740 <5653 3969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence206 2581 836 gene locus_tag LOCUS_13750 2581 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2776 4185 gene locus_tag LOCUS_13760 2776 4185 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_13760 5500 4226 gene locus_tag LOCUS_13770 5500 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence207 5200 2693 gene locus_tag LOCUS_13780 5200 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence208 1708 2550 gene locus_tag LOCUS_13790 1708 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2547 2951 gene locus_tag LOCUS_13800 2547 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074110.1 protein_id gnl|my_center|LOCUS_13800 3093 3500 gene locus_tag LOCUS_13810 3093 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5387 3873 gene locus_tag LOCUS_13820 5387 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence209 3079 3321 gene locus_tag LOCUS_13830 3079 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3407 4399 gene locus_tag LOCUS_13840 gene ppx 3407 4399 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13840 5380 4430 gene locus_tag LOCUS_13850 5380 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence210 325 933 gene locus_tag LOCUS_13860 325 933 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_13860 1048 1602 gene locus_tag LOCUS_13870 1048 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2048 1764 gene locus_tag LOCUS_13880 2048 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2489 2145 gene locus_tag LOCUS_13890 2489 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3316 2573 gene locus_tag LOCUS_13900 3316 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3961 3500 gene locus_tag LOCUS_13910 3961 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4165 4434 gene locus_tag LOCUS_13920 gene rpmE2 4165 4434 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_13920 >Feature sequence211 1609 1259 gene locus_tag LOCUS_13930 1609 1259 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_13930 3237 1810 gene locus_tag LOCUS_13940 gene dbpA 3237 1810 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_13940 3818 3267 gene locus_tag LOCUS_13950 3818 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4958 4017 gene locus_tag LOCUS_13960 4958 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5001 5567 gene locus_tag LOCUS_13970 5001 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence212 341 2128 gene locus_tag LOCUS_13980 gene lepA 341 2128 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_13980 2190 3092 gene locus_tag LOCUS_13990 gene folD 2190 3092 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_13990 3237 3887 gene locus_tag LOCUS_14000 gene queE 3237 3887 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_14000 >Feature sequence213 846 1580 gene locus_tag LOCUS_14010 846 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1749 2471 gene locus_tag LOCUS_14020 1749 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2527 3183 gene locus_tag LOCUS_14030 2527 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4169 3390 gene locus_tag LOCUS_14040 gene dltE 4169 3390 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_14040 5105 4290 gene locus_tag LOCUS_14050 5105 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence214 1353 730 gene locus_tag LOCUS_14060 1353 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3481 1436 gene locus_tag LOCUS_14070 3481 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence215 452 1246 gene locus_tag LOCUS_14080 452 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3149 1275 gene locus_tag LOCUS_14090 3149 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3276 3725 gene locus_tag LOCUS_14100 3276 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4471 3722 gene locus_tag LOCUS_14110 gene kdsB 4471 3722 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_14110 >Feature sequence216 1360 2490 gene locus_tag LOCUS_14120 gene tgt 1360 2490 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_14120 2680 3759 gene locus_tag LOCUS_14130 2680 3759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_14130 3919 4857 gene locus_tag LOCUS_14140 3919 4857 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_14140 <5486 4917 gene locus_tag LOCUS_14150 <5486 4917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA41:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase >Feature sequence217 1286 249 gene locus_tag LOCUS_14160 1286 249 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_14160 1605 1465 gene locus_tag LOCUS_14170 1605 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2198 1992 gene locus_tag LOCUS_14180 2198 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2395 3777 gene locus_tag LOCUS_14190 gene kmo 2395 3777 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_14190 3965 4690 gene locus_tag LOCUS_14200 3965 4690 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence218 <1 859 gene locus_tag LOCUS_14210 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198300.1:zinc-binding dehydrogenase 3395 1104 gene locus_tag LOCUS_14220 3395 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5048 3519 gene locus_tag LOCUS_14230 5048 3519 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence219 325 582 gene locus_tag LOCUS_14240 325 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 624 1499 gene locus_tag LOCUS_14250 624 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1557 2234 gene locus_tag LOCUS_14260 1557 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_14260 2284 3000 gene locus_tag LOCUS_14270 2284 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3215 3841 gene locus_tag LOCUS_14280 3215 3841 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_14280 3917 4852 gene locus_tag LOCUS_14290 3917 4852 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence220 316 3870 gene locus_tag LOCUS_14300 316 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence221 3185 1134 gene locus_tag LOCUS_14310 3185 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3274 5076 gene locus_tag LOCUS_14320 3274 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence222 <1 651 gene locus_tag LOCUS_14330 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392797.1:6-phosphogluconate dehydrogenase 794 1495 gene locus_tag LOCUS_14340 gene yqjF 794 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_14340 1663 1590 gene locus_tag LOCUS_t00180 1663 1590 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1817 2518 gene locus_tag LOCUS_14350 1817 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2782 2555 gene locus_tag LOCUS_14360 2782 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence223 <1 595 gene locus_tag LOCUS_14370 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404226.1:enoyl-CoA hydratase 749 1234 gene locus_tag LOCUS_14380 gene crtZ 749 1234 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_14380 1365 2288 gene locus_tag LOCUS_14390 1365 2288 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_14390 2569 3120 gene locus_tag LOCUS_14400 2569 3120 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_14400 3625 3206 gene locus_tag LOCUS_14410 3625 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4366 3722 gene locus_tag LOCUS_14420 4366 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence224 4323 1090 gene locus_tag LOCUS_14430 4323 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_14430 5140 4307 gene locus_tag LOCUS_14440 5140 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence225 1247 864 gene locus_tag LOCUS_14450 1247 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1756 1406 gene locus_tag LOCUS_14460 1756 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2313 3197 gene locus_tag LOCUS_14470 2313 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3293 3973 gene locus_tag LOCUS_14480 3293 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4901 5089 gene locus_tag LOCUS_14490 4901 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence226 644 378 gene locus_tag LOCUS_14500 644 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1396 662 gene locus_tag LOCUS_14510 1396 662 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRQ0 protein_id gnl|my_center|LOCUS_14510 2427 1444 gene locus_tag LOCUS_14520 2427 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2831 2463 gene locus_tag LOCUS_14530 2831 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4573 3083 gene locus_tag LOCUS_14540 4573 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence227 1101 175 gene locus_tag LOCUS_14550 1101 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2433 1270 gene locus_tag LOCUS_14560 2433 1270 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_14560 2691 3290 gene locus_tag LOCUS_14570 2691 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3436 4842 gene locus_tag LOCUS_14580 3436 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4921 5292 gene locus_tag LOCUS_14590 4921 5292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence228 716 1201 gene locus_tag LOCUS_14600 716 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1637 1563 gene locus_tag LOCUS_t00190 1637 1563 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2467 1745 gene locus_tag LOCUS_14610 2467 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3514 2603 gene locus_tag LOCUS_14620 3514 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3647 4786 gene locus_tag LOCUS_14630 3647 4786 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence229 584 1282 gene locus_tag LOCUS_14640 584 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4012 1466 gene locus_tag LOCUS_14650 gene priA 4012 1466 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A451 protein_id gnl|my_center|LOCUS_14650 >Feature sequence230 1257 1583 gene locus_tag LOCUS_14660 1257 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1807 3603 gene locus_tag LOCUS_14670 1807 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3757 3617 gene locus_tag LOCUS_14680 3757 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence231 742 2544 gene locus_tag LOCUS_14690 742 2544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_14690 2622 3146 gene locus_tag LOCUS_14700 2622 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4687 3167 gene locus_tag LOCUS_14710 4687 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence232 1881 1387 gene locus_tag LOCUS_14720 1881 1387 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228810.1 protein_id gnl|my_center|LOCUS_14720 2944 2117 gene locus_tag LOCUS_14730 2944 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4243 3026 gene locus_tag LOCUS_14740 4243 3026 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_14740 5099 4500 gene locus_tag LOCUS_14750 5099 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence233 242 481 gene locus_tag LOCUS_14760 242 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 488 835 gene locus_tag LOCUS_14770 488 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2569 923 gene locus_tag LOCUS_14780 gene groL 2569 923 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_14780 2993 2703 gene locus_tag LOCUS_14790 gene groS 2993 2703 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF03 protein_id gnl|my_center|LOCUS_14790 4020 3172 gene locus_tag LOCUS_14800 4020 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5033 4026 gene locus_tag LOCUS_14810 5033 4026 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence234 643 978 gene locus_tag LOCUS_14820 643 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1302 1796 gene locus_tag LOCUS_14830 1302 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1889 3391 gene locus_tag LOCUS_14840 1889 3391 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_14840 3926 3519 gene locus_tag LOCUS_14850 3926 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 4924 4499 gene locus_tag LOCUS_14860 4924 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence235 922 2181 gene locus_tag LOCUS_14870 922 2181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_14870 2352 3461 gene locus_tag LOCUS_14880 2352 3461 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_14880 4450 3584 gene locus_tag LOCUS_14890 4450 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4724 4799 gene locus_tag LOCUS_t00200 4724 4799 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4907 4982 gene locus_tag LOCUS_t00210 4907 4982 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 291 1616 gene locus_tag LOCUS_14900 gene phrB1 291 1616 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_14900 1789 2478 gene locus_tag LOCUS_14910 1789 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2522 3889 gene locus_tag LOCUS_14920 2522 3889 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_14920 3924 4469 gene locus_tag LOCUS_14930 3924 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence237 399 1409 gene locus_tag LOCUS_14940 399 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2143 1469 gene locus_tag LOCUS_14950 gene hisI 2143 1469 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N8 protein_id gnl|my_center|LOCUS_14950 2931 2176 gene locus_tag LOCUS_14960 gene hisF 2931 2176 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDC1 protein_id gnl|my_center|LOCUS_14960 3716 3000 gene locus_tag LOCUS_14970 gene hisA 3716 3000 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_14970 4346 3744 gene locus_tag LOCUS_14980 gene hisH 4346 3744 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_14980 <5172 4410 gene locus_tag LOCUS_14990 <5172 4410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RE9:histidine biosynthesis bifunctional protein HisB >Feature sequence238 282 1373 gene locus_tag LOCUS_15000 282 1373 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_15000 1537 1625 gene locus_tag LOCUS_t00220 1537 1625 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2228 3304 gene locus_tag LOCUS_15010 2228 3304 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence239 1477 332 gene locus_tag LOCUS_15020 1477 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1649 2026 gene locus_tag LOCUS_15030 1649 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2039 3118 gene locus_tag LOCUS_15040 2039 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3078 3869 gene locus_tag LOCUS_15050 gene pcrB 3078 3869 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_15050 4054 3980 gene locus_tag LOCUS_t00230 4054 3980 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4235 4161 gene locus_tag LOCUS_t00240 4235 4161 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4405 4842 gene locus_tag LOCUS_15060 4405 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence240 358 1005 gene locus_tag LOCUS_15070 358 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1528 1202 gene locus_tag LOCUS_15080 1528 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1748 1530 gene locus_tag LOCUS_15090 1748 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2766 1810 gene locus_tag LOCUS_15100 gene tktC 2766 1810 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_15100 3354 2785 gene locus_tag LOCUS_15110 3354 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4764 3361 gene locus_tag LOCUS_15120 4764 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5150 4980 gene locus_tag LOCUS_15130 5150 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence241 1115 15 gene locus_tag LOCUS_15140 gene mutY 1115 15 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_15140 1302 1607 gene locus_tag LOCUS_15150 1302 1607 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_15150 1775 2641 gene locus_tag LOCUS_15160 1775 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3225 4832 gene locus_tag LOCUS_15170 3225 4832 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence242 2924 2850 gene locus_tag LOCUS_t00250 2924 2850 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3117 3779 gene locus_tag LOCUS_15180 3117 3779 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_15180 3739 5001 gene locus_tag LOCUS_15190 3739 5001 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence243 349 855 gene locus_tag LOCUS_15200 349 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1116 1619 gene locus_tag LOCUS_15210 1116 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3940 1751 gene locus_tag LOCUS_15220 gene glnA 3940 1751 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence244 1586 1218 gene locus_tag LOCUS_15230 1586 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2539 1601 gene locus_tag LOCUS_15240 2539 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2780 3214 gene locus_tag LOCUS_15250 2780 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3381 3740 gene locus_tag LOCUS_15260 3381 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4201 5079 gene locus_tag LOCUS_15270 4201 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence245 73 1029 gene locus_tag LOCUS_15280 gene pdxA 73 1029 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_15280 1176 1709 gene locus_tag LOCUS_15290 1176 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1783 2013 gene locus_tag LOCUS_15300 gene rpmF 1783 2013 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_15300 2134 3075 gene locus_tag LOCUS_15310 gene plsX 2134 3075 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I5 protein_id gnl|my_center|LOCUS_15310 3167 4174 gene locus_tag LOCUS_15320 gene fabH3 3167 4174 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_15320 4302 4865 gene locus_tag LOCUS_15330 gene efp 4302 4865 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWR4 protein_id gnl|my_center|LOCUS_15330 >Feature sequence246 1915 536 gene locus_tag LOCUS_15340 gene ftsA 1915 536 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_15340 2758 2000 gene locus_tag LOCUS_15350 2758 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4398 2995 gene locus_tag LOCUS_15360 4398 2995 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM2 protein_id gnl|my_center|LOCUS_15360 <5082 4572 gene locus_tag LOCUS_15370 <5082 4572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H195:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase >Feature sequence247 2 556 gene locus_tag LOCUS_15380 2 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 549 1988 gene locus_tag LOCUS_15390 549 1988 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence248 1526 858 gene locus_tag LOCUS_15400 1526 858 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 protein_id gnl|my_center|LOCUS_15400 1714 1632 gene locus_tag LOCUS_t00260 1714 1632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1904 2602 gene locus_tag LOCUS_15410 1904 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2954 4816 gene locus_tag LOCUS_15420 2954 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence249 939 421 gene locus_tag LOCUS_15430 gene greB 939 421 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_15430 1135 932 gene locus_tag LOCUS_15440 1135 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1044 2243 gene locus_tag LOCUS_15450 1044 2243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193486.1 protein_id gnl|my_center|LOCUS_15450 2922 2398 gene locus_tag LOCUS_15460 2922 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3361 2888 gene locus_tag LOCUS_15470 3361 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3969 3421 gene locus_tag LOCUS_15480 3969 3421 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_15480 4197 4526 gene locus_tag LOCUS_15490 4197 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence250 374 1717 gene locus_tag LOCUS_15500 gene sbcD 374 1717 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_15500 1768 2379 gene locus_tag LOCUS_15510 1768 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence251 481 5 gene locus_tag LOCUS_15520 481 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1094 639 gene locus_tag LOCUS_15530 1094 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1734 2096 gene locus_tag LOCUS_15540 1734 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2202 2642 gene locus_tag LOCUS_15550 2202 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4677 2920 gene locus_tag LOCUS_15560 4677 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5005 4808 gene locus_tag LOCUS_15570 5005 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence252 789 2930 gene locus_tag LOCUS_15580 789 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3173 4501 gene locus_tag LOCUS_15590 3173 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence253 <1 741 gene locus_tag LOCUS_15600 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186839.1:PDZ domain-containing protein 1030 1593 gene locus_tag LOCUS_15610 1030 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1957 1655 gene locus_tag LOCUS_15620 1957 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3011 2073 gene locus_tag LOCUS_15630 3011 2073 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_15630 3188 3114 gene locus_tag LOCUS_t00270 3188 3114 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4603 3380 gene locus_tag LOCUS_15640 4603 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence254 <1 754 gene locus_tag LOCUS_15650 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1A7:N-acetyl-gamma-glutamyl-phosphate reductase 870 1352 gene locus_tag LOCUS_15660 870 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1428 2561 gene locus_tag LOCUS_15670 gene argD 1428 2561 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_15670 3195 4175 gene locus_tag LOCUS_15680 gene pyrB 3195 4175 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK43 protein_id gnl|my_center|LOCUS_15680 >Feature sequence255 2398 3168 gene locus_tag LOCUS_15690 2398 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3271 3774 gene locus_tag LOCUS_15700 3271 3774 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence256 <1 2358 gene locus_tag LOCUS_15710 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q728I7:histidine kinase 2791 2444 gene locus_tag LOCUS_15720 2791 2444 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_15720 2937 3773 gene locus_tag LOCUS_15730 2937 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3899 4822 gene locus_tag LOCUS_15740 gene cysK 3899 4822 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_15740 >Feature sequence257 685 761 gene locus_tag LOCUS_t00280 685 761 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence258 565 161 gene locus_tag LOCUS_15750 565 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1106 681 gene locus_tag LOCUS_15760 1106 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1823 1290 gene locus_tag LOCUS_15770 1823 1290 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_15770 3484 2054 gene locus_tag LOCUS_15780 3484 2054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence259 742 182 gene locus_tag LOCUS_15790 742 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2201 858 gene locus_tag LOCUS_15800 2201 858 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_15800 3289 2330 gene locus_tag LOCUS_15810 gene egtD 3289 2330 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5M8 protein_id gnl|my_center|LOCUS_15810 4034 3495 gene locus_tag LOCUS_15820 4034 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4146 4811 gene locus_tag LOCUS_15830 4146 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence260 1 1875 gene locus_tag LOCUS_15840 1 1875 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403313.1 protein_id gnl|my_center|LOCUS_15840 1996 2745 gene locus_tag LOCUS_15850 1996 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3446 2895 gene locus_tag LOCUS_15860 3446 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence261 2002 1676 gene locus_tag LOCUS_15870 gene sufA 2002 1676 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15870 2503 2102 gene locus_tag LOCUS_15880 2503 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3002 2592 gene locus_tag LOCUS_15890 gene iscU 3002 2592 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_15890 4325 3111 gene locus_tag LOCUS_15900 gene iscS 4325 3111 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_15900 >Feature sequence262 1035 547 gene locus_tag LOCUS_15910 1035 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1328 1672 gene locus_tag LOCUS_15920 1328 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1687 2346 gene locus_tag LOCUS_15930 1687 2346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_15930 2581 3747 gene locus_tag LOCUS_15940 2581 3747 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405054.1 protein_id gnl|my_center|LOCUS_15940 3807 4682 gene locus_tag LOCUS_15950 3807 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence263 <1 2305 gene locus_tag LOCUS_15960 <1 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III 2396 3259 gene locus_tag LOCUS_15970 2396 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3366 4589 gene locus_tag LOCUS_15980 3366 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence264 8 1033 gene locus_tag LOCUS_15990 gene actA 8 1033 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_15990 1191 4226 gene locus_tag LOCUS_16000 gene actB 1191 4226 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence265 1144 908 gene locus_tag LOCUS_16010 1144 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1388 1981 gene locus_tag LOCUS_16020 1388 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2026 3129 gene locus_tag LOCUS_16030 2026 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3191 3469 gene locus_tag LOCUS_16040 gene acyP 3191 3469 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVU3 protein_id gnl|my_center|LOCUS_16040 4514 3999 gene locus_tag LOCUS_16050 4514 3999 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974988.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence266 1884 2222 gene locus_tag LOCUS_16060 1884 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2229 3266 gene locus_tag LOCUS_16070 2229 3266 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_16070 3587 3369 gene locus_tag LOCUS_16080 3587 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence267 <1 1226 gene locus_tag LOCUS_16090 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962387.1:glycosyl transferase 1946 1326 gene locus_tag LOCUS_16100 1946 1326 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 protein_id gnl|my_center|LOCUS_16100 2354 2058 gene locus_tag LOCUS_16110 2354 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2530 2285 gene locus_tag LOCUS_16120 2530 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3610 2639 gene locus_tag LOCUS_16130 3610 2639 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_16130 4267 3728 gene locus_tag LOCUS_16140 gene hslV 4267 3728 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 protein_id gnl|my_center|LOCUS_16140 >Feature sequence268 1126 377 gene locus_tag LOCUS_16150 1126 377 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_16150 1231 2472 gene locus_tag LOCUS_16160 1231 2472 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_16160 3486 2575 gene locus_tag LOCUS_16170 3486 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence269 <1 1918 gene locus_tag LOCUS_16180 <1 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035380.1:pectate lyase 1939 3474 gene locus_tag LOCUS_16190 gene uxaB 1939 3474 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34354 protein_id gnl|my_center|LOCUS_16190 >Feature sequence270 440 1876 gene locus_tag LOCUS_16200 gene miaB 440 1876 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_16200 1936 2313 gene locus_tag LOCUS_16210 1936 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_16210 2363 3652 gene locus_tag LOCUS_16220 2363 3652 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_16220 3672 4190 gene locus_tag LOCUS_16230 3672 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence271 1219 320 gene locus_tag LOCUS_16240 1219 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2335 1439 gene locus_tag LOCUS_16250 2335 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2633 4069 gene locus_tag LOCUS_16260 2633 4069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_16260 <4750 4193 gene locus_tag LOCUS_16270 <4750 4193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198629.1:carboxymethylenebutenolidase >Feature sequence272 799 1431 gene locus_tag LOCUS_16280 799 1431 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_16280 4518 1570 gene locus_tag LOCUS_16290 4518 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence273 1003 500 gene locus_tag LOCUS_16300 1003 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895679.1 protein_id gnl|my_center|LOCUS_16300 2383 1211 gene locus_tag LOCUS_16310 2383 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2513 3196 gene locus_tag LOCUS_16320 2513 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3329 4495 gene locus_tag LOCUS_16330 gene dxr 3329 4495 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_16330 >Feature sequence274 1782 280 gene locus_tag LOCUS_16340 1782 280 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_16340 3042 2110 gene locus_tag LOCUS_16350 gene hemB 3042 2110 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_16350 4613 4341 gene locus_tag LOCUS_16360 4613 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence275 573 2297 gene locus_tag LOCUS_16370 573 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2578 2979 gene locus_tag LOCUS_16380 2578 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4085 3330 gene locus_tag LOCUS_16390 4085 3330 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence276 1327 143 gene locus_tag LOCUS_16400 1327 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2130 1411 gene locus_tag LOCUS_16410 gene dapB 2130 1411 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_16410 2875 2189 gene locus_tag LOCUS_16420 2875 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3924 2953 gene locus_tag LOCUS_16430 gene parB 3924 2953 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_16430 4589 4359 gene locus_tag LOCUS_16440 4589 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence277 2041 2481 gene locus_tag LOCUS_16450 2041 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2904 3353 gene locus_tag LOCUS_16460 2904 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3733 3350 gene locus_tag LOCUS_16470 gene vapc5 3733 3350 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P4M9 protein_id gnl|my_center|LOCUS_16470 3957 3727 gene locus_tag LOCUS_16480 3957 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4681 4013 gene locus_tag LOCUS_16490 4681 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence278 <1 628 gene locus_tag LOCUS_16500 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001288614.1:histidine kinase 704 1876 gene locus_tag LOCUS_16510 704 1876 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 protein_id gnl|my_center|LOCUS_16510 1961 2794 gene locus_tag LOCUS_16520 1961 2794 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence279 1961 459 gene locus_tag LOCUS_16530 1961 459 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_16530 3288 2074 gene locus_tag LOCUS_16540 3288 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence280 912 82 gene locus_tag LOCUS_16550 912 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2389 1085 gene locus_tag LOCUS_16560 gene murA 2389 1085 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_16560 3157 2453 gene locus_tag LOCUS_16570 3157 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_16570 <4667 3370 gene locus_tag LOCUS_16580 <4667 3370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ5:DNA helicase >Feature sequence281 3039 28 gene locus_tag LOCUS_16590 3039 28 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_16590 3628 4314 gene locus_tag LOCUS_16600 3628 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4323 4550 gene locus_tag LOCUS_16610 4323 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence282 917 585 gene locus_tag LOCUS_16620 917 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1828 962 gene locus_tag LOCUS_16630 1828 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1837 2658 gene locus_tag LOCUS_16640 1837 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3031 3963 gene locus_tag LOCUS_16650 3031 3963 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027678.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence283 921 124 gene locus_tag LOCUS_16660 gene murQ 921 124 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_16660 1265 1011 gene locus_tag LOCUS_16670 1265 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2540 1386 gene locus_tag LOCUS_16680 gene fjo29 2540 1386 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_16680 2826 4589 gene locus_tag LOCUS_16690 gene fadD 2826 4589 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence284 293 1000 gene locus_tag LOCUS_16700 293 1000 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_16700 1009 1782 gene locus_tag LOCUS_16710 1009 1782 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_16710 2681 2016 gene locus_tag LOCUS_16720 2681 2016 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74F05 protein_id gnl|my_center|LOCUS_16720 3824 2823 gene locus_tag LOCUS_16730 3824 2823 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_16730 4024 4602 gene locus_tag LOCUS_16740 4024 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence285 352 2073 gene locus_tag LOCUS_16750 352 2073 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_16750 2561 2791 gene locus_tag LOCUS_16760 2561 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3933 3028 gene locus_tag LOCUS_16770 3933 3028 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_16770 4636 4028 gene locus_tag LOCUS_16780 4636 4028 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence286 <1 1311 gene locus_tag LOCUS_16790 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256824.1:alkyl hydroperoxide reductase 1486 2361 gene locus_tag LOCUS_16800 gene uspA 1486 2361 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_16800 3945 2533 gene locus_tag LOCUS_16810 3945 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4100 4411 gene locus_tag LOCUS_16820 4100 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence287 305 835 gene locus_tag LOCUS_16830 305 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1880 996 gene locus_tag LOCUS_16840 1880 996 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16840 3593 2046 gene locus_tag LOCUS_16850 3593 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence288 659 66 gene locus_tag LOCUS_16860 gene gmhA 659 66 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIK9 protein_id gnl|my_center|LOCUS_16860 1119 715 gene locus_tag LOCUS_16870 1119 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3028 1184 gene locus_tag LOCUS_16880 3028 1184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_16880 3458 3045 gene locus_tag LOCUS_16890 3458 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence289 319 1848 gene locus_tag LOCUS_16900 gene treA 319 1848 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MI6 protein_id gnl|my_center|LOCUS_16900 2554 1886 gene locus_tag LOCUS_16910 2554 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4011 2680 gene locus_tag LOCUS_16920 gene fucP 4011 2680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence290 1468 1881 gene locus_tag LOCUS_16930 1468 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3115 2657 gene locus_tag LOCUS_16940 3115 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3335 3108 gene locus_tag LOCUS_16950 3335 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence291 <1 2895 gene locus_tag LOCUS_16960 <1 2895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070785.1:diguanylate cyclase 3648 3013 gene locus_tag LOCUS_16970 3648 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence292 1547 3109 gene locus_tag LOCUS_16980 1547 3109 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_16980 3254 3994 gene locus_tag LOCUS_16990 3254 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 <4609 4094 gene locus_tag LOCUS_17000 <4609 4094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258372.1:homogentisate 1,2-dioxygenase >Feature sequence293 >Feature sequence294 <1 2251 gene locus_tag LOCUS_17010 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024193.1:cell surface protein 2375 4537 gene locus_tag LOCUS_17020 2375 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence295 1736 1074 gene locus_tag LOCUS_17030 1736 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3264 1939 gene locus_tag LOCUS_17040 3264 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3991 4356 gene locus_tag LOCUS_17050 gene ogt2 3991 4356 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence296 <1 1356 gene locus_tag LOCUS_17060 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD 1779 2243 gene locus_tag LOCUS_17070 1779 2243 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_17070 2253 3281 gene locus_tag LOCUS_17080 gene rfaF 2253 3281 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence297 <1 681 gene locus_tag LOCUS_17090 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYK6:DNA polymerase III subunit beta 935 1273 gene locus_tag LOCUS_17100 gene gldC 935 1273 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_17100 2598 1381 gene locus_tag LOCUS_17110 2598 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2880 3734 gene locus_tag LOCUS_17120 2880 3734 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_17120 <4575 3977 gene locus_tag LOCUS_17130 <4575 3977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein >Feature sequence298 2485 581 gene locus_tag LOCUS_17140 gene asnB 2485 581 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_17140 2607 3038 gene locus_tag LOCUS_17150 2607 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 <4568 3206 gene locus_tag LOCUS_17160 <4568 3206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962735.1:dehydrogenase >Feature sequence299 2670 313 gene locus_tag LOCUS_17170 2670 313 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744482.1 protein_id gnl|my_center|LOCUS_17170 3251 2919 gene locus_tag LOCUS_17180 3251 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3542 4432 gene locus_tag LOCUS_17190 3542 4432 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence300 1483 122 gene locus_tag LOCUS_17200 1483 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1776 1543 gene locus_tag LOCUS_17210 1776 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3261 1912 gene locus_tag LOCUS_17220 3261 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3461 4489 gene locus_tag LOCUS_17230 3461 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence301 857 1807 gene locus_tag LOCUS_17240 gene natA 857 1807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_17240 1814 3199 gene locus_tag LOCUS_17250 gene natB 1814 3199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_17250 3354 4223 gene locus_tag LOCUS_17260 3354 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence302 645 1526 gene locus_tag LOCUS_17270 645 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1559 3901 gene locus_tag LOCUS_17280 gene ftsI 1559 3901 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence303 1582 455 gene locus_tag LOCUS_17290 gene capI 1582 455 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence304 <1 946 gene locus_tag LOCUS_17300 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108315.1:transporter 1035 2417 gene locus_tag LOCUS_17310 1035 2417 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_17310 2633 3622 gene locus_tag LOCUS_17320 2633 3622 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5W3 protein_id gnl|my_center|LOCUS_17320 >Feature sequence305 856 2103 gene locus_tag LOCUS_17330 856 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17330 2521 4371 gene locus_tag LOCUS_17340 2521 4371 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence306 1482 3551 gene locus_tag LOCUS_17350 1482 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence307 637 1581 gene locus_tag LOCUS_17360 637 1581 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_17360 1675 2427 gene locus_tag LOCUS_17370 1675 2427 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_17370 3263 2640 gene locus_tag LOCUS_17380 3263 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_17380 <4489 3482 gene locus_tag LOCUS_17390 <4489 3482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974245.1:oxidoreductase >Feature sequence308 1383 517 gene locus_tag LOCUS_17400 gene dapA 1383 517 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_17400 1417 2388 gene locus_tag LOCUS_17410 1417 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3030 2587 gene locus_tag LOCUS_17420 3030 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3616 3200 gene locus_tag LOCUS_17430 3616 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4115 3660 gene locus_tag LOCUS_17440 4115 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence309 2069 1245 gene locus_tag LOCUS_17450 2069 1245 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_17450 2215 3594 gene locus_tag LOCUS_17460 gene mgtE 2215 3594 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBD4 protein_id gnl|my_center|LOCUS_17460 4216 3812 gene locus_tag LOCUS_17470 4216 3812 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence310 134 2353 gene locus_tag LOCUS_17480 134 2353 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_17480 3778 4455 gene locus_tag LOCUS_17490 3778 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence311 89 982 gene locus_tag LOCUS_17500 89 982 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_17500 1218 1709 gene locus_tag LOCUS_17510 1218 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_17510 1808 3730 gene locus_tag LOCUS_17520 1808 3730 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence312 <1 1725 gene locus_tag LOCUS_17530 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6J9:replicative DNA helicase 2165 2953 gene locus_tag LOCUS_17540 2165 2953 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 protein_id gnl|my_center|LOCUS_17540 4262 3051 gene locus_tag LOCUS_17550 4262 3051 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence313 1115 354 gene locus_tag LOCUS_17560 1115 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1689 1171 gene locus_tag LOCUS_17570 1689 1171 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_17570 4051 1829 gene locus_tag LOCUS_17580 4051 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence314 725 96 gene locus_tag LOCUS_17590 725 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1690 812 gene locus_tag LOCUS_17600 1690 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2608 1793 gene locus_tag LOCUS_17610 2608 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3033 2635 gene locus_tag LOCUS_17620 3033 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence315 199 1395 gene locus_tag LOCUS_17630 gene argD 199 1395 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_17630 1928 1482 gene locus_tag LOCUS_17640 1928 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2253 3179 gene locus_tag LOCUS_17650 gene pfkA 2253 3179 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_17650 3273 3893 gene locus_tag LOCUS_17660 3273 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence316 2934 601 gene locus_tag LOCUS_17670 2934 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3085 3384 gene locus_tag LOCUS_17680 3085 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <4411 3388 gene locus_tag LOCUS_17690 <4411 3388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:ATP-dependent DNA helicase RecQ >Feature sequence317 338 1498 gene locus_tag LOCUS_17700 338 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1754 2941 gene locus_tag LOCUS_17710 1754 2941 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_17710 3122 3568 gene locus_tag LOCUS_17720 3122 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3695 4150 gene locus_tag LOCUS_17730 3695 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence318 >Feature sequence319 <1 1394 gene locus_tag LOCUS_17740 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977659.1:amidase 1599 2018 gene locus_tag LOCUS_17750 1599 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_17750 2109 3389 gene locus_tag LOCUS_17760 gene nhaP 2109 3389 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_17760 >Feature sequence320 1949 1248 gene locus_tag LOCUS_17770 1949 1248 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_17770 2739 2140 gene locus_tag LOCUS_17780 gene epsL 2739 2140 CDS product putative sugar transferase EpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71062 protein_id gnl|my_center|LOCUS_17780 3777 2992 gene locus_tag LOCUS_17790 3777 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence321 1411 893 gene locus_tag LOCUS_17800 1411 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2053 1427 gene locus_tag LOCUS_17810 2053 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3199 2207 gene locus_tag LOCUS_17820 3199 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4310 3258 gene locus_tag LOCUS_17830 gene fjo19 4310 3258 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence322 1424 585 gene locus_tag LOCUS_17840 1424 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2772 1669 gene locus_tag LOCUS_17850 2772 1669 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_17850 4098 2980 gene locus_tag LOCUS_17860 4098 2980 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence323 1217 291 gene locus_tag LOCUS_17870 gene yfbL 1217 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_17870 1621 2541 gene locus_tag LOCUS_17880 1621 2541 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_17880 2746 3792 gene locus_tag LOCUS_17890 2746 3792 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_17890 4269 3814 gene locus_tag LOCUS_17900 4269 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence324 2406 892 gene locus_tag LOCUS_17910 2406 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence325 267 1265 gene locus_tag LOCUS_17920 267 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1883 1290 gene locus_tag LOCUS_17930 1883 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3883 1994 gene locus_tag LOCUS_17940 gene msbA 3883 1994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence326 2647 791 gene locus_tag LOCUS_17950 gene hscA 2647 791 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44669 protein_id gnl|my_center|LOCUS_17950 3083 3937 gene locus_tag LOCUS_17960 3083 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence327 645 1178 gene locus_tag LOCUS_17970 645 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_17970 1272 2435 gene locus_tag LOCUS_17980 1272 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_17980 2670 3728 gene locus_tag LOCUS_17990 gene dppB 2670 3728 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence328 1439 327 gene locus_tag LOCUS_18000 1439 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2925 1507 gene locus_tag LOCUS_18010 2925 1507 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_18010 <4330 3030 gene locus_tag LOCUS_18020 <4330 3030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225587.1:glucose/galactose MFS transporter >Feature sequence329 1169 408 gene locus_tag LOCUS_18030 gene mtgA 1169 408 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3G0 protein_id gnl|my_center|LOCUS_18030 1431 2066 gene locus_tag LOCUS_18040 1431 2066 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_18040 2515 2366 gene locus_tag LOCUS_18050 2515 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3546 2734 gene locus_tag LOCUS_18060 3546 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3764 4177 gene locus_tag LOCUS_18070 3764 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence330 671 141 gene locus_tag LOCUS_18080 671 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1231 881 gene locus_tag LOCUS_18090 1231 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_18090 2163 1324 gene locus_tag LOCUS_18100 2163 1324 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_18100 4000 2246 gene locus_tag LOCUS_18110 4000 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence331 1071 484 gene locus_tag LOCUS_18120 1071 484 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_18120 1536 1802 gene locus_tag LOCUS_18130 1536 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1932 2525 gene locus_tag LOCUS_18140 gene rnhB 1932 2525 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_18140 2993 2547 gene locus_tag LOCUS_18150 2993 2547 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887053.1 protein_id gnl|my_center|LOCUS_18150 4317 3052 gene locus_tag LOCUS_18160 4317 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence332 1825 281 gene locus_tag LOCUS_18170 1825 281 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_18170 2427 4034 gene locus_tag LOCUS_18180 2427 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence333 1866 259 gene locus_tag LOCUS_18190 1866 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2308 1886 gene locus_tag LOCUS_18200 2308 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3213 2308 gene locus_tag LOCUS_18210 3213 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_18210 3621 3304 gene locus_tag LOCUS_18220 3621 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 <4306 3677 gene locus_tag LOCUS_18230 <4306 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVK0:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence334 766 1863 gene locus_tag LOCUS_18240 766 1863 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_18240 2553 1873 gene locus_tag LOCUS_18250 2553 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3244 2591 gene locus_tag LOCUS_18260 3244 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4058 3393 gene locus_tag LOCUS_18270 4058 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence335 502 1554 gene locus_tag LOCUS_18280 502 1554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_18280 1646 2026 gene locus_tag LOCUS_18290 1646 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3138 2035 gene locus_tag LOCUS_18300 3138 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3698 3318 gene locus_tag LOCUS_18310 3698 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence336 1308 385 gene locus_tag LOCUS_18320 1308 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1939 1490 gene locus_tag LOCUS_18330 1939 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2051 3283 gene locus_tag LOCUS_18340 2051 3283 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence337 317 54 gene locus_tag LOCUS_18350 317 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 678 1313 gene locus_tag LOCUS_18360 678 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1611 1853 gene locus_tag LOCUS_18370 1611 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2983 1919 gene locus_tag LOCUS_18380 2983 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence338 511 437 gene locus_tag LOCUS_t00290 511 437 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 832 1779 gene locus_tag LOCUS_18390 gene accA 832 1779 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_18390 1886 2731 gene locus_tag LOCUS_18400 1886 2731 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_18400 2734 3558 gene locus_tag LOCUS_18410 2734 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence339 <1 516 gene locus_tag LOCUS_18420 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962525.1:cystathionine beta-lyase 596 2782 gene locus_tag LOCUS_18430 596 2782 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_18430 4248 2848 gene locus_tag LOCUS_18440 4248 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence340 1367 825 gene locus_tag LOCUS_18450 1367 825 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_18450 1523 2329 gene locus_tag LOCUS_18460 1523 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3453 2371 gene locus_tag LOCUS_18470 3453 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3877 3521 gene locus_tag LOCUS_18480 3877 3521 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence341 <1 2236 gene locus_tag LOCUS_18490 <1 2236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S13:histidine kinase 2303 2848 gene locus_tag LOCUS_18500 gene cheW 2303 2848 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210885.1 protein_id gnl|my_center|LOCUS_18500 2908 3291 gene locus_tag LOCUS_18510 2908 3291 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence342 2234 1590 gene locus_tag LOCUS_18520 gene ctaE 2234 1590 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_18520 2663 2325 gene locus_tag LOCUS_18530 2663 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2889 2656 gene locus_tag LOCUS_18540 2889 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 <4204 3038 gene locus_tag LOCUS_18550 <4204 3038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207998.1:peptidase M23 >Feature sequence343 950 75 gene locus_tag LOCUS_18560 gene fjo11 950 75 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_18560 1377 2654 gene locus_tag LOCUS_18570 gene hemA 1377 2654 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_18570 <4199 2721 gene locus_tag LOCUS_18580 <4199 2721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964122.1:pectate lyase >Feature sequence344 564 1778 gene locus_tag LOCUS_18590 gene pgk 564 1778 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_18590 2969 2013 gene locus_tag LOCUS_18600 2969 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3994 3359 gene locus_tag LOCUS_18610 3994 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence345 2018 2839 gene locus_tag LOCUS_18620 2018 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_18620 2904 3233 gene locus_tag LOCUS_18630 2904 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3403 3639 gene locus_tag LOCUS_18640 3403 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3738 3932 gene locus_tag LOCUS_18650 3738 3932 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence346 551 192 gene locus_tag LOCUS_18660 551 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 919 527 gene locus_tag LOCUS_18670 919 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2043 1033 gene locus_tag LOCUS_18680 2043 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2866 2030 gene locus_tag LOCUS_18690 2866 2030 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_18690 3440 3967 gene locus_tag LOCUS_18700 3440 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence347 1611 3179 gene locus_tag LOCUS_18710 gene rpoN 1611 3179 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence348 796 461 gene locus_tag LOCUS_18720 796 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1133 849 gene locus_tag LOCUS_18730 1133 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1655 1206 gene locus_tag LOCUS_18740 1655 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1798 1871 gene locus_tag LOCUS_t00300 1798 1871 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2021 2272 gene locus_tag LOCUS_18750 2021 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2362 2634 gene locus_tag LOCUS_18760 2362 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3446 2739 gene locus_tag LOCUS_18770 3446 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3932 3618 gene locus_tag LOCUS_18780 3932 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence349 2059 155 gene locus_tag LOCUS_18790 2059 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3533 2178 gene locus_tag LOCUS_18800 3533 2178 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence350 681 1283 gene locus_tag LOCUS_18810 681 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2090 1818 gene locus_tag LOCUS_18820 2090 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2856 2191 gene locus_tag LOCUS_18830 2856 2191 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_18830 4067 3093 gene locus_tag LOCUS_18840 4067 3093 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence351 <1 1564 gene locus_tag LOCUS_18850 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CN9:phosphoribosylformylglycinamidine synthase subunit PurL 1663 3084 gene locus_tag LOCUS_18860 1663 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence352 1527 1144 gene locus_tag LOCUS_18870 1527 1144 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_18870 2195 1731 gene locus_tag LOCUS_18880 gene ribH 2195 1731 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_18880 3214 2453 gene locus_tag LOCUS_18890 3214 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 <4147 3357 gene locus_tag LOCUS_18900 <4147 3357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE5:pyruvate dehydrogenase E1 component subunit alpha >Feature sequence353 <1 1328 gene locus_tag LOCUS_18910 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase 1566 1811 gene locus_tag LOCUS_18920 1566 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1846 3033 gene locus_tag LOCUS_18930 1846 3033 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_18930 3659 3976 gene locus_tag LOCUS_18940 3659 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091271.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence354 2745 250 gene locus_tag LOCUS_18950 gene rnr 2745 250 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_18950 3798 3025 gene locus_tag LOCUS_18960 3798 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence355 1381 677 gene locus_tag LOCUS_18970 1381 677 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_18970 1513 3375 gene locus_tag LOCUS_18980 gene yfbK 1513 3375 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_18980 3683 4120 gene locus_tag LOCUS_18990 3683 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence356 644 1246 gene locus_tag LOCUS_19000 644 1246 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19000 1243 2028 gene locus_tag LOCUS_19010 1243 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3331 2435 gene locus_tag LOCUS_19020 3331 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3517 4029 gene locus_tag LOCUS_19030 3517 4029 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence357 880 83 gene locus_tag LOCUS_19040 880 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1026 3314 gene locus_tag LOCUS_19050 1026 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence358 1838 474 gene locus_tag LOCUS_19060 1838 474 CDS product xanthosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705313.1 protein_id gnl|my_center|LOCUS_19060 3105 1975 gene locus_tag LOCUS_19070 gene morB 3105 1975 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_19070 3902 3264 gene locus_tag LOCUS_19080 3902 3264 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence359 >Feature sequence360 1033 77 gene locus_tag LOCUS_19090 1033 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1226 2374 gene locus_tag LOCUS_19100 gene porR 1226 2374 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_19100 2757 3782 gene locus_tag LOCUS_19110 gene wlbA 2757 3782 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence361 1587 196 gene locus_tag LOCUS_19120 1587 196 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence362 2157 166 gene locus_tag LOCUS_19130 2157 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1654 1739 gene locus_tag LOCUS_t00310 1654 1739 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <4085 2384 gene locus_tag LOCUS_19140 <4085 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109116.1:glycoside hydrolase >Feature sequence363 2444 3487 gene locus_tag LOCUS_19150 2444 3487 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence364 2590 2249 gene locus_tag LOCUS_19160 2590 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2821 2997 gene locus_tag LOCUS_19170 2821 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3780 3100 gene locus_tag LOCUS_19180 3780 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4070 3810 gene locus_tag LOCUS_19190 4070 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence365 1235 852 gene locus_tag LOCUS_19200 1235 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3280 1430 gene locus_tag LOCUS_19210 3280 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence366 <1 1240 gene locus_tag LOCUS_19220 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962545.1:molybdopterin oxidoreductase 1233 1757 gene locus_tag LOCUS_19230 gene actD 1233 1757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_19230 1757 2506 gene locus_tag LOCUS_19240 1757 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2513 3847 gene locus_tag LOCUS_19250 2513 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence367 <1 1089 gene locus_tag LOCUS_19260 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWA9:S-adenosylmethionine synthase 1559 1158 gene locus_tag LOCUS_19270 gene vapC 1559 1158 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73Q45 protein_id gnl|my_center|LOCUS_19270 2998 1949 gene locus_tag LOCUS_19280 gene ruvB 2998 1949 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_19280 >Feature sequence368 48 419 gene locus_tag LOCUS_19290 48 419 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_19290 1905 424 gene locus_tag LOCUS_19300 1905 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3545 2079 gene locus_tag LOCUS_19310 3545 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence369 1421 225 gene locus_tag LOCUS_19320 gene sucC 1421 225 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_19320 2782 1679 gene locus_tag LOCUS_19330 2782 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_19330 2951 3607 gene locus_tag LOCUS_19340 gene lolD 2951 3607 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_19340 >Feature sequence370 2808 592 gene locus_tag LOCUS_19350 gene feoB 2808 592 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_19350 3137 2817 gene locus_tag LOCUS_19360 3137 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence371 85 1995 gene locus_tag LOCUS_19370 85 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence372 >Feature sequence373 1359 310 gene locus_tag LOCUS_19380 gene ywcH 1359 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_19380 3880 1427 gene locus_tag LOCUS_19390 gene fecA 3880 1427 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence374 2850 2776 gene locus_tag LOCUS_t00320 2850 2776 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3400 3023 gene locus_tag LOCUS_19400 3400 3023 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_19400 <3996 3460 gene locus_tag LOCUS_19410 <3996 3460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958271.1:copper-translocating P-type ATPase >Feature sequence375 289 2223 gene locus_tag LOCUS_19420 gene thrS 289 2223 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_19420 2438 3169 gene locus_tag LOCUS_19430 2438 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3294 3488 gene locus_tag LOCUS_19440 gene rpmI 3294 3488 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_19440 >Feature sequence376 652 428 gene locus_tag LOCUS_19450 652 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1119 877 gene locus_tag LOCUS_19460 1119 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2566 1244 gene locus_tag LOCUS_19470 gene der 2566 1244 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_19470 3638 2742 gene locus_tag LOCUS_19480 gene era 3638 2742 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_19480 >Feature sequence377 1946 2398 gene locus_tag LOCUS_19490 1946 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence378 2794 1814 gene locus_tag LOCUS_19500 2794 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_19500 3565 2948 gene locus_tag LOCUS_19510 3565 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence379 1102 680 gene locus_tag LOCUS_19520 gene yqiW 1102 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_19520 1524 1817 gene locus_tag LOCUS_19530 1524 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3292 1847 gene locus_tag LOCUS_19540 gene srfJ 3292 1847 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_19540 >Feature sequence380 2877 1660 gene locus_tag LOCUS_19550 2877 1660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107808.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence381 678 202 gene locus_tag LOCUS_19560 gene guaD 678 202 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_19560 1746 802 gene locus_tag LOCUS_19570 1746 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3526 1961 gene locus_tag LOCUS_19580 3526 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence382 1857 1381 gene locus_tag LOCUS_19590 1857 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19590 2451 1882 gene locus_tag LOCUS_19600 2451 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19600 3738 2545 gene locus_tag LOCUS_19610 3738 2545 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889462.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence383 413 2461 gene locus_tag LOCUS_19620 413 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence384 1868 870 gene locus_tag LOCUS_19630 1868 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2733 1948 gene locus_tag LOCUS_19640 2733 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3255 2875 gene locus_tag LOCUS_19650 3255 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <3924 3381 gene locus_tag LOCUS_19660 <3924 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205773.1:NADPH-dependent oxidoreductase >Feature sequence385 1908 232 gene locus_tag LOCUS_19670 1908 232 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_19670 1988 3412 gene locus_tag LOCUS_19680 1988 3412 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_19680 3495 3713 gene locus_tag LOCUS_19690 3495 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence386 2503 269 gene locus_tag LOCUS_19700 2503 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence387 1648 1286 gene locus_tag LOCUS_19710 1648 1286 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence388 1682 1894 gene locus_tag LOCUS_19720 1682 1894 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S7 protein_id gnl|my_center|LOCUS_19720 1982 2866 gene locus_tag LOCUS_19730 1982 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 <3879 3098 gene locus_tag LOCUS_19740 <3879 3098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX82:prolipoprotein diacylglyceryl transferase >Feature sequence389 <1 1567 gene locus_tag LOCUS_19750 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120385.1:pectate lyase 3076 2039 gene locus_tag LOCUS_19760 3076 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence390 <1 510 gene locus_tag LOCUS_19770 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H289:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1748 588 gene locus_tag LOCUS_19780 1748 588 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_19780 3725 1953 gene locus_tag LOCUS_19790 3725 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence391 <1 537 gene locus_tag LOCUS_19800 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97N13:dCTP deaminase 636 1229 gene locus_tag LOCUS_19810 636 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2149 1325 gene locus_tag LOCUS_19820 2149 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 <3859 2255 gene locus_tag LOCUS_19830 <3859 2255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789572.1:membrane protein >Feature sequence392 2985 943 gene locus_tag LOCUS_19840 2985 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence393 2988 1306 gene locus_tag LOCUS_19850 2988 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence394 90 2009 gene locus_tag LOCUS_19860 90 2009 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107506.1 protein_id gnl|my_center|LOCUS_19860 2545 2075 gene locus_tag LOCUS_19870 2545 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_19870 2672 3442 gene locus_tag LOCUS_19880 2672 3442 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence395 3174 1120 gene locus_tag LOCUS_19890 3174 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence396 467 228 gene locus_tag LOCUS_19900 467 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 >Feature sequence397 1444 128 gene locus_tag LOCUS_19910 1444 128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_19910 1645 2397 gene locus_tag LOCUS_19920 gene lptB 1645 2397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence398 <1 793 gene locus_tag LOCUS_19930 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY81:ATP phosphoribosyltransferase 913 3345 gene locus_tag LOCUS_19940 913 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence399 138 725 gene locus_tag LOCUS_19950 138 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 746 1516 gene locus_tag LOCUS_19960 gene coxP 746 1516 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_19960 1683 2030 gene locus_tag LOCUS_19970 1683 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2034 2708 gene locus_tag LOCUS_19980 2034 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2692 3267 gene locus_tag LOCUS_19990 gene yozB 2692 3267 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_19990 3418 3669 gene locus_tag LOCUS_20000 3418 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence400 2506 221 gene locus_tag LOCUS_20010 2506 221 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_20010 3087 2692 gene locus_tag LOCUS_20020 3087 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 <3778 3193 gene locus_tag LOCUS_20030 <3778 3193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706561.1:membrane protein >Feature sequence401 1041 1664 gene locus_tag LOCUS_20040 1041 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_20040 3231 1756 gene locus_tag LOCUS_20050 3231 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence402 852 3044 gene locus_tag LOCUS_20060 852 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3686 3204 gene locus_tag LOCUS_20070 3686 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence403 1060 104 gene locus_tag LOCUS_20080 1060 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2005 1370 gene locus_tag LOCUS_20090 2005 1370 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_20090 2118 2873 gene locus_tag LOCUS_20100 2118 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence404 1021 386 gene locus_tag LOCUS_20110 1021 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1957 1199 gene locus_tag LOCUS_20120 1957 1199 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_20120 2047 2430 gene locus_tag LOCUS_20130 gene rsfS 2047 2430 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_20130 >Feature sequence405 <1 556 gene locus_tag LOCUS_20140 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257831.1:methyltransferase type 11 602 1996 gene locus_tag LOCUS_20150 602 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2752 2066 gene locus_tag LOCUS_20160 2752 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence406 1655 438 gene locus_tag LOCUS_20170 1655 438 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_20170 <3749 1815 gene locus_tag LOCUS_20180 <3749 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962750.1:glycosyl transferase family 2 >Feature sequence407 <1 766 gene locus_tag LOCUS_20190 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P2Z7:aminotransferase 2442 877 gene locus_tag LOCUS_20200 gene porX 2442 877 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_20200 2714 3148 gene locus_tag LOCUS_20210 2714 3148 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence408 686 177 gene locus_tag LOCUS_20220 686 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1458 1826 gene locus_tag LOCUS_20230 1458 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1954 2736 gene locus_tag LOCUS_20240 1954 2736 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_20240 2978 2766 gene locus_tag LOCUS_20250 2978 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence409 >Feature sequence410 964 266 gene locus_tag LOCUS_20260 964 266 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_20260 1085 1588 gene locus_tag LOCUS_20270 1085 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2297 1599 gene locus_tag LOCUS_20280 2297 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_20280 2544 2317 gene locus_tag LOCUS_20290 2544 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 <3715 2610 gene locus_tag LOCUS_20300 <3715 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TQ1:aspartate--tRNA ligase >Feature sequence411 1278 109 gene locus_tag LOCUS_20310 1278 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1580 3115 gene locus_tag LOCUS_20320 1580 3115 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_20320 3134 3445 gene locus_tag LOCUS_20330 3134 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence412 397 1644 gene locus_tag LOCUS_20340 397 1644 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_20340 1897 2151 gene locus_tag LOCUS_20350 1897 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 <3694 2401 gene locus_tag LOCUS_20360 <3694 2401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW04:tyrosine--tRNA ligase >Feature sequence413 <1 1018 gene locus_tag LOCUS_20370 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189844.1:hydrolase 1221 1805 gene locus_tag LOCUS_20380 1221 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2015 3691 gene locus_tag LOCUS_20390 2015 3691 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence414 2899 3504 gene locus_tag LOCUS_20400 2899 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence415 2744 1176 gene locus_tag LOCUS_20410 gene pccB 2744 1176 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_20410 3389 2850 gene locus_tag LOCUS_20420 3389 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence416 <1 1316 gene locus_tag LOCUS_20430 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H191:cell division protein FtsZ 1484 2395 gene locus_tag LOCUS_20440 1484 2395 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_20440 2632 3570 gene locus_tag LOCUS_20450 2632 3570 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YX1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence417 558 1331 gene locus_tag LOCUS_20460 558 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1495 3393 gene locus_tag LOCUS_20470 1495 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence418 1503 1102 gene locus_tag LOCUS_20480 1503 1102 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897869.1 protein_id gnl|my_center|LOCUS_20480 <3647 1698 gene locus_tag LOCUS_20490 <3647 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein >Feature sequence419 1171 521 gene locus_tag LOCUS_20500 1171 521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_20500 1735 1253 gene locus_tag LOCUS_20510 1735 1253 CDS product cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_20510 <3639 1899 gene locus_tag LOCUS_20520 <3639 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein >Feature sequence420 475 1809 gene locus_tag LOCUS_20530 475 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_20530 2997 1810 gene locus_tag LOCUS_20540 2997 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 <3624 3001 gene locus_tag LOCUS_20550 <3624 3001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035402.1:xylanase >Feature sequence421 2058 301 gene locus_tag LOCUS_20560 2058 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_20560 2601 2179 gene locus_tag LOCUS_20570 2601 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403204.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence422 <1 1729 gene locus_tag LOCUS_20580 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203449.1:methylmalonyl-CoA mutase small subunit >Feature sequence423 1556 2701 gene locus_tag LOCUS_20590 1556 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2755 3315 gene locus_tag LOCUS_20600 2755 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence424 1231 1833 gene locus_tag LOCUS_20610 1231 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807752.1 protein_id gnl|my_center|LOCUS_20610 3579 1843 gene locus_tag LOCUS_20620 3579 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence425 1751 156 gene locus_tag LOCUS_20630 1751 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1930 3516 gene locus_tag LOCUS_20640 1930 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence426 >Feature sequence427 2021 765 gene locus_tag LOCUS_20650 2021 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3337 2090 gene locus_tag LOCUS_20660 3337 2090 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence428 158 2608 gene locus_tag LOCUS_20670 158 2608 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence429 >Feature sequence430 261 548 gene locus_tag LOCUS_20680 261 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 597 1715 gene locus_tag LOCUS_20690 597 1715 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_20690 1952 2428 gene locus_tag LOCUS_20700 1952 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768489.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence431 2293 59 gene locus_tag LOCUS_20710 2293 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2521 3405 gene locus_tag LOCUS_20720 2521 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence432 1024 470 gene locus_tag LOCUS_20730 1024 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 <3527 1132 gene locus_tag LOCUS_20740 <3527 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence433 >Feature sequence434 1235 3319 gene locus_tag LOCUS_20750 1235 3319 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence435 1093 563 gene locus_tag LOCUS_20760 gene nbaC 1093 563 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_20760 1959 1222 gene locus_tag LOCUS_20770 1959 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2756 2043 gene locus_tag LOCUS_20780 2756 2043 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_20780 3518 2919 gene locus_tag LOCUS_20790 3518 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence436 553 1266 gene locus_tag LOCUS_20800 553 1266 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_20800 1348 1896 gene locus_tag LOCUS_20810 1348 1896 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_20810 2104 3168 gene locus_tag LOCUS_20820 2104 3168 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_20820 >Feature sequence437 <1 702 gene locus_tag LOCUS_20830 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY12:3-methyl-2-oxobutanoate hydroxymethyltransferase 863 1582 gene locus_tag LOCUS_20840 863 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1844 2566 gene locus_tag LOCUS_20850 1844 2566 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence438 1 1815 gene locus_tag LOCUS_20860 1 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2199 1903 gene locus_tag LOCUS_20870 2199 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 <3493 2657 gene locus_tag LOCUS_20880 <3493 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259114.1:methionine gamma-lyase >Feature sequence439 <1 1404 gene locus_tag LOCUS_20890 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084144.1:aspartate ammonia-lyase 3396 1480 gene locus_tag LOCUS_20900 gene acsA 3396 1480 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence440 781 2178 gene locus_tag LOCUS_20910 781 2178 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_20910 2247 3245 gene locus_tag LOCUS_20920 2247 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence441 719 1945 gene locus_tag LOCUS_20930 719 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1955 2176 gene locus_tag LOCUS_20940 1955 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence442 902 2692 gene locus_tag LOCUS_20950 902 2692 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence443 2226 292 gene locus_tag LOCUS_20960 gene dnaK 2226 292 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence444 <1 674 gene locus_tag LOCUS_20970 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957692.1:acyltransferase 1446 715 gene locus_tag LOCUS_20980 1446 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_20980 1611 2009 gene locus_tag LOCUS_20990 1611 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_20990 <3424 2074 gene locus_tag LOCUS_21000 <3424 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021764.1:surface antigen gene >Feature sequence445 1725 364 gene locus_tag LOCUS_21010 1725 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1990 2709 gene locus_tag LOCUS_21020 1990 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_21020 <3414 2726 gene locus_tag LOCUS_21030 <3414 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor >Feature sequence446 835 1338 gene locus_tag LOCUS_21040 835 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1512 2408 gene locus_tag LOCUS_21050 1512 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3277 2441 gene locus_tag LOCUS_21060 gene mutM 3277 2441 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence447 3256 1754 gene locus_tag LOCUS_21070 3256 1754 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence448 1324 2076 gene locus_tag LOCUS_21080 1324 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2134 2733 gene locus_tag LOCUS_21090 2134 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2806 3024 gene locus_tag LOCUS_21100 2806 3024 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708724.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence449 1823 3118 gene locus_tag LOCUS_21110 gene murF 1823 3118 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 protein_id gnl|my_center|LOCUS_21110 >Feature sequence450 481 726 gene locus_tag LOCUS_21120 481 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence451 260 892 gene locus_tag LOCUS_21130 260 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2460 1024 gene locus_tag LOCUS_21140 2460 1024 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W75 protein_id gnl|my_center|LOCUS_21140 <3356 2668 gene locus_tag LOCUS_21150 <3356 2668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704825.1:glycosyl transferase >Feature sequence452 1878 1114 gene locus_tag LOCUS_21160 1878 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_21160 2989 1868 gene locus_tag LOCUS_21170 2989 1868 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence453 107 757 gene locus_tag LOCUS_21180 107 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 757 1677 gene locus_tag LOCUS_21190 757 1677 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence454 <1 624 gene locus_tag LOCUS_21200 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107709.1:DNA-binding response regulator 1114 2025 gene locus_tag LOCUS_21210 1114 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 <3343 2043 gene locus_tag LOCUS_21220 <3343 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784143.1:TonB-dependent receptor >Feature sequence455 235 1470 gene locus_tag LOCUS_21230 235 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_21230 1519 3036 gene locus_tag LOCUS_21240 gene cysS 1519 3036 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F4 protein_id gnl|my_center|LOCUS_21240 >Feature sequence456 805 999 gene locus_tag LOCUS_21250 805 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1980 1030 gene locus_tag LOCUS_21260 gene queG 1980 1030 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_21260 2907 2140 gene locus_tag LOCUS_21270 2907 2140 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence457 213 1226 gene locus_tag LOCUS_21280 213 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1238 2305 gene locus_tag LOCUS_21290 1238 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence458 1183 1608 gene locus_tag LOCUS_21300 1183 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_21300 2244 1624 gene locus_tag LOCUS_21310 2244 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3286 2486 gene locus_tag LOCUS_21320 3286 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence459 2 934 gene locus_tag LOCUS_21330 2 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1277 2821 gene locus_tag LOCUS_21340 1277 2821 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256483.1 protein_id gnl|my_center|LOCUS_21340 3203 2910 gene locus_tag LOCUS_21350 3203 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence460 727 2127 gene locus_tag LOCUS_21360 727 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2160 2525 gene locus_tag LOCUS_21370 2160 2525 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_21370 2551 2955 gene locus_tag LOCUS_21380 2551 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence461 401 871 gene locus_tag LOCUS_21390 401 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 963 2450 gene locus_tag LOCUS_21400 gene nusA 963 2450 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_21400 >Feature sequence462 <1 584 gene locus_tag LOCUS_21410 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272501.1:chemotaxis protein CheA 638 1273 gene locus_tag LOCUS_21420 638 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1462 2556 gene locus_tag LOCUS_21430 gene speB 1462 2556 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_21430 2608 2952 gene locus_tag LOCUS_21440 2608 2952 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence463 2085 355 gene locus_tag LOCUS_21450 2085 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence464 2559 1726 gene locus_tag LOCUS_21460 2559 1726 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_21460 <3288 2701 gene locus_tag LOCUS_21470 <3288 2701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZH8:dihydropteroate synthase >Feature sequence465 163 1839 gene locus_tag LOCUS_21480 163 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142002.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence466 703 1113 gene locus_tag LOCUS_21490 703 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1157 1519 gene locus_tag LOCUS_21500 1157 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1935 1558 gene locus_tag LOCUS_21510 1935 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2146 2739 gene locus_tag LOCUS_21520 gene azoR 2146 2739 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL54 protein_id gnl|my_center|LOCUS_21520 2840 3211 gene locus_tag LOCUS_21530 2840 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence467 >Feature sequence468 >Feature sequence469 974 357 gene locus_tag LOCUS_21540 gene pncA 974 357 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 protein_id gnl|my_center|LOCUS_21540 1092 2027 gene locus_tag LOCUS_21550 1092 2027 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence470 673 455 gene locus_tag LOCUS_21560 673 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1839 832 gene locus_tag LOCUS_21570 1839 832 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_21570 3000 2131 gene locus_tag LOCUS_21580 3000 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence471 483 193 gene locus_tag LOCUS_21590 gene yisB 483 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 protein_id gnl|my_center|LOCUS_21590 688 1134 gene locus_tag LOCUS_21600 688 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1270 1578 gene locus_tag LOCUS_21610 1270 1578 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence472 >Feature sequence473 2430 1987 gene locus_tag LOCUS_21620 gene rplI 2430 1987 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_21620 2845 2570 gene locus_tag LOCUS_21630 gene rpsR 2845 2570 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_21630 >Feature sequence474 54 1010 gene locus_tag LOCUS_21640 54 1010 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_21640 1102 3219 gene locus_tag LOCUS_21650 1102 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence475 <1 857 gene locus_tag LOCUS_21660 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119887.1:quinone oxidoreductase 1061 1477 gene locus_tag LOCUS_21670 1061 1477 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_21670 2228 1575 gene locus_tag LOCUS_21680 2228 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence476 574 954 gene locus_tag LOCUS_21690 574 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_21690 1046 1504 gene locus_tag LOCUS_21700 1046 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1603 2283 gene locus_tag LOCUS_21710 1603 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2557 2937 gene locus_tag LOCUS_21720 2557 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225039.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence477 1907 888 gene locus_tag LOCUS_21730 gene porQ 1907 888 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_21730 <3231 2069 gene locus_tag LOCUS_21740 <3231 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TX8:Lon protease >Feature sequence478 2731 413 gene locus_tag LOCUS_21750 gene fhuA 2731 413 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence479 181 1821 gene locus_tag LOCUS_21760 181 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1907 2353 gene locus_tag LOCUS_21770 1907 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2753 2445 gene locus_tag LOCUS_21780 2753 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3223 2900 gene locus_tag LOCUS_21790 3223 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence480 728 1372 gene locus_tag LOCUS_21800 728 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2433 1501 gene locus_tag LOCUS_21810 gene mdh 2433 1501 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_21810 <3214 2695 gene locus_tag LOCUS_21820 <3214 2695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C65:tRNA(Ile)-lysidine synthase >Feature sequence481 <1 1767 gene locus_tag LOCUS_21830 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962749.1:ABC transporter 2981 1953 gene locus_tag LOCUS_21840 2981 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence482 482 1579 gene locus_tag LOCUS_21850 gene moeB 482 1579 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_21850 1672 2829 gene locus_tag LOCUS_21860 1672 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence483 75 1067 gene locus_tag LOCUS_21870 gene asd 75 1067 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_21870 >Feature sequence484 2817 2131 gene locus_tag LOCUS_21880 2817 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence485 <1 2371 gene locus_tag LOCUS_21890 <1 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:protein of unknown function precursor; adhesin 2386 2994 gene locus_tag LOCUS_21900 2386 2994 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBD5 protein_id gnl|my_center|LOCUS_21900 >Feature sequence486 261 674 gene locus_tag LOCUS_21910 261 674 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085844.1 protein_id gnl|my_center|LOCUS_21910 2307 772 gene locus_tag LOCUS_21920 gene guaA 2307 772 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_21920 >Feature sequence487 1716 1015 gene locus_tag LOCUS_21930 1716 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_21930 1910 2332 gene locus_tag LOCUS_21940 1910 2332 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence488 1795 248 gene locus_tag LOCUS_21950 1795 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2227 1976 gene locus_tag LOCUS_21960 gene rpsT 2227 1976 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_21960 >Feature sequence489 3 719 gene locus_tag LOCUS_21970 3 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 785 1696 gene locus_tag LOCUS_21980 785 1696 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_21980 1752 3074 gene locus_tag LOCUS_21990 gene dctA 1752 3074 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925728.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence490 129 416 gene locus_tag LOCUS_22000 gene gatC 129 416 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_22000 >Feature sequence491 <1 820 gene locus_tag LOCUS_22010 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein 1827 913 gene locus_tag LOCUS_22020 1827 913 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_22020 2290 1994 gene locus_tag LOCUS_22030 2290 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 <3151 2424 gene locus_tag LOCUS_22040 <3151 2424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764634.1:putative DNA modification/repair radical SAM protein >Feature sequence492 2321 1398 gene locus_tag LOCUS_22050 2321 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence493 309 722 gene locus_tag LOCUS_22060 309 722 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_22060 697 2025 gene locus_tag LOCUS_22070 697 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence494 2652 2158 gene locus_tag LOCUS_22080 2652 2158 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence495 2764 953 gene locus_tag LOCUS_22090 2764 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence496 >Feature sequence497 >Feature sequence498 3 407 gene locus_tag LOCUS_22100 3 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1631 546 gene locus_tag LOCUS_22110 gene rlmN 1631 546 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_22110 1743 2576 gene locus_tag LOCUS_22120 gene yxxB 1743 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39139 protein_id gnl|my_center|LOCUS_22120 >Feature sequence499 1136 675 gene locus_tag LOCUS_22130 1136 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_22130 1517 1167 gene locus_tag LOCUS_22140 1517 1167 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_22140 <3104 1634 gene locus_tag LOCUS_22150 <3104 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388138.1:gamma-glutamyltransferase >Feature sequence500 <1 777 gene locus_tag LOCUS_22160 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144156.1:cation transporter 1711 980 gene locus_tag LOCUS_22170 1711 980 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887996.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence501 1741 224 gene locus_tag LOCUS_22180 gene gpmI 1741 224 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_22180 1995 2435 gene locus_tag LOCUS_22190 1995 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence502 1912 503 gene locus_tag LOCUS_22200 1912 503 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_22200 <3090 1963 gene locus_tag LOCUS_22210 <3090 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765636.1:alpha-amylase >Feature sequence503 <1 1469 gene locus_tag LOCUS_22220 <1 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808616.1:nicotinate phosphoribosyltransferase 1618 2196 gene locus_tag LOCUS_22230 1618 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2425 2925 gene locus_tag LOCUS_22240 2425 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence504 1509 2411 gene locus_tag LOCUS_22250 1509 2411 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence505 1028 1945 gene locus_tag LOCUS_22260 1028 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence506 456 538 gene locus_tag LOCUS_t00330 456 538 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 638 1960 gene locus_tag LOCUS_22270 638 1960 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_22270 2125 2841 gene locus_tag LOCUS_22280 gene clpP 2125 2841 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_22280 >Feature sequence507 1492 209 gene locus_tag LOCUS_22290 1492 209 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_22290 2749 1499 gene locus_tag LOCUS_22300 2749 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence508 >Feature sequence509 >Feature sequence510 408 1418 gene locus_tag LOCUS_22310 408 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1563 1979 gene locus_tag LOCUS_22320 1563 1979 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_22320 >Feature sequence511 1208 873 gene locus_tag LOCUS_22330 1208 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22330 1409 1212 gene locus_tag LOCUS_22340 1409 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1653 1580 gene locus_tag LOCUS_t00340 1653 1580 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1750 2013 gene locus_tag LOCUS_22350 1750 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2057 2611 gene locus_tag LOCUS_22360 gene paiA 2057 2611 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_22360 >Feature sequence512 <1 852 gene locus_tag LOCUS_22370 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme 1908 1018 gene locus_tag LOCUS_22380 1908 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2484 1927 gene locus_tag LOCUS_22390 gene ppa 2484 1927 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_22390 3036 2683 gene locus_tag LOCUS_22400 3036 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence513 639 712 gene locus_tag LOCUS_t00350 639 712 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2679 820 gene locus_tag LOCUS_22410 2679 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence514 330 608 gene locus_tag LOCUS_22420 330 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1697 612 gene locus_tag LOCUS_22430 1697 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence515 1689 2780 gene locus_tag LOCUS_22440 gene vdh 1689 2780 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence516 610 1248 gene locus_tag LOCUS_22450 610 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1796 1299 gene locus_tag LOCUS_22460 gene recX 1796 1299 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_22460 1899 2765 gene locus_tag LOCUS_22470 1899 2765 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973497.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence517 966 2060 gene locus_tag LOCUS_22480 966 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2339 2698 gene locus_tag LOCUS_22490 gene folB 2339 2698 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence518 >Feature sequence519 2483 1869 gene locus_tag LOCUS_22500 2483 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence520 1670 2971 gene locus_tag LOCUS_22510 gene gluP 1670 2971 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence521 1659 1051 gene locus_tag LOCUS_22520 1659 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1795 2004 gene locus_tag LOCUS_22530 1795 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence522 <1 2533 gene locus_tag LOCUS_22540 <1 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107841.1:collagen-binding protein >Feature sequence523 712 134 gene locus_tag LOCUS_22550 712 134 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_22550 <2975 957 gene locus_tag LOCUS_22560 <2975 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence524 797 1144 gene locus_tag LOCUS_22570 797 1144 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence525 3 899 gene locus_tag LOCUS_22580 3 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1526 1203 gene locus_tag LOCUS_22590 1526 1203 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_22590 2678 1662 gene locus_tag LOCUS_22600 2678 1662 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_22600 >Feature sequence526 990 2057 gene locus_tag LOCUS_22610 990 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2388 2227 gene locus_tag LOCUS_22620 2388 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence527 2 73 gene locus_tag LOCUS_t00360 2 73 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 246 2873 gene locus_tag LOCUS_22630 gene cphA 246 2873 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence528 <1 1778 gene locus_tag LOCUS_22640 <1 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064497.1:TonB-dependent receptor 2226 1960 gene locus_tag LOCUS_22650 2226 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2663 2280 gene locus_tag LOCUS_22660 2663 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence529 281 1483 gene locus_tag LOCUS_22670 281 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_22670 1578 2309 gene locus_tag LOCUS_22680 1578 2309 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267661.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence530 >Feature sequence531 2034 796 gene locus_tag LOCUS_22690 2034 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2400 2131 gene locus_tag LOCUS_22700 2400 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 <2912 2411 gene locus_tag LOCUS_22710 <2912 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404122.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence532 >Feature sequence533 >Feature sequence534 1844 1137 gene locus_tag LOCUS_22720 1844 1137 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_22720 <2907 1967 gene locus_tag LOCUS_22730 <2907 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403922.1:amidohydrolase >Feature sequence535 1043 27 gene locus_tag LOCUS_22740 1043 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1113 1721 gene locus_tag LOCUS_22750 gene tpm 1113 1721 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_22750 1836 2693 gene locus_tag LOCUS_22760 1836 2693 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_22760 >Feature sequence536 >Feature sequence537 403 1011 gene locus_tag LOCUS_22770 403 1011 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_22770 2116 1139 gene locus_tag LOCUS_22780 2116 1139 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_22780 <2885 2202 gene locus_tag LOCUS_22790 <2885 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118006.1:hybrid sensor histidine kinase/response regulator >Feature sequence538 1880 519 gene locus_tag LOCUS_22800 1880 519 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942633.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence539 1077 430 gene locus_tag LOCUS_22810 1077 430 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_22810 1847 1077 gene locus_tag LOCUS_22820 1847 1077 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_22820 1983 2819 gene locus_tag LOCUS_22830 1983 2819 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence540 1915 1388 gene locus_tag LOCUS_22840 gene mreD 1915 1388 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_22840 2856 1912 gene locus_tag LOCUS_22850 2856 1912 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence541 1104 703 gene locus_tag LOCUS_22860 1104 703 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence542 1635 454 gene locus_tag LOCUS_22870 1635 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889394.1 protein_id gnl|my_center|LOCUS_22870 2643 1711 gene locus_tag LOCUS_22880 2643 1711 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence543 <1 528 gene locus_tag LOCUS_22890 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31716:putative ABC transporter ATP-binding protein YkpA 697 1461 gene locus_tag LOCUS_22900 697 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1700 1542 gene locus_tag LOCUS_22910 1700 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1915 2802 gene locus_tag LOCUS_22920 1915 2802 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence544 863 1108 gene locus_tag LOCUS_22930 863 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1196 2746 gene locus_tag LOCUS_22940 1196 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702019.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence545 882 1526 gene locus_tag LOCUS_22950 882 1526 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence546 3 659 gene locus_tag LOCUS_22960 3 659 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_22960 670 2019 gene locus_tag LOCUS_22970 gene exuT 670 2019 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_22970 2176 2637 gene locus_tag LOCUS_22980 2176 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence547 1258 212 gene locus_tag LOCUS_22990 1258 212 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_22990 1918 2688 gene locus_tag LOCUS_23000 gene kduD 1918 2688 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence548 1390 134 gene locus_tag LOCUS_23010 1390 134 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_23010 2003 1428 gene locus_tag LOCUS_23020 2003 1428 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_23020 <2818 2088 gene locus_tag LOCUS_23030 <2818 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWE2:aspartokinase >Feature sequence549 850 155 gene locus_tag LOCUS_23040 850 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1140 1823 gene locus_tag LOCUS_23050 1140 1823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence550 559 290 gene locus_tag LOCUS_23060 559 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 597 1430 gene locus_tag LOCUS_23070 gene murI 597 1430 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFN8 protein_id gnl|my_center|LOCUS_23070 >Feature sequence551 <1 2139 gene locus_tag LOCUS_23080 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PE60:pectinesterase >Feature sequence552 <1 640 gene locus_tag LOCUS_23090 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NQQ7:UvrABC system protein B 671 898 gene locus_tag LOCUS_23100 671 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_23100 899 1234 gene locus_tag LOCUS_23110 899 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1552 1869 gene locus_tag LOCUS_23120 1552 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2028 2615 gene locus_tag LOCUS_23130 2028 2615 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG2 protein_id gnl|my_center|LOCUS_23130 >Feature sequence553 >Feature sequence554 2142 1174 gene locus_tag LOCUS_23140 gene hldD 2142 1174 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_23140 >Feature sequence555 521 1081 gene locus_tag LOCUS_23150 gene pfpI 521 1081 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_23150 1665 1150 gene locus_tag LOCUS_23160 1665 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2404 1724 gene locus_tag LOCUS_23170 2404 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2581 2657 gene locus_tag LOCUS_t00370 2581 2657 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence556 >Feature sequence557 755 561 gene locus_tag LOCUS_23180 755 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2484 976 gene locus_tag LOCUS_23190 2484 976 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence558 2206 467 gene locus_tag LOCUS_23200 2206 467 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence559 1279 938 gene locus_tag LOCUS_23210 1279 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1830 1369 gene locus_tag LOCUS_23220 1830 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2469 1843 gene locus_tag LOCUS_23230 gene udk 2469 1843 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_23230 >Feature sequence560 327 1571 gene locus_tag LOCUS_23240 327 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence561 >Feature sequence562 1584 2579 gene locus_tag LOCUS_23250 1584 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence563 974 2338 gene locus_tag LOCUS_23260 gene dgt 974 2338 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence564 >Feature sequence565 2725 1262 gene locus_tag LOCUS_23270 2725 1262 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence566 >Feature sequence567 130 891 gene locus_tag LOCUS_23280 130 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1445 1098 gene locus_tag LOCUS_23290 1445 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 <2756 1598 gene locus_tag LOCUS_23300 <2756 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787236.1:TonB-dependent receptor >Feature sequence568 910 236 gene locus_tag LOCUS_23310 gene pcm 910 236 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_23310 1058 2479 gene locus_tag LOCUS_23320 gene wcaJ 1058 2479 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence569 578 1030 gene locus_tag LOCUS_23330 gene rplM 578 1030 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_23330 1109 1495 gene locus_tag LOCUS_23340 gene rpsI 1109 1495 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_23340 1514 2281 gene locus_tag LOCUS_23350 gene rpsB 1514 2281 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z4 protein_id gnl|my_center|LOCUS_23350 >Feature sequence570 277 828 gene locus_tag LOCUS_23360 277 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2227 938 gene locus_tag LOCUS_23370 gene pepP 2227 938 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence571 880 1059 gene locus_tag LOCUS_23380 880 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1047 1340 gene locus_tag LOCUS_23390 1047 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 <2742 1362 gene locus_tag LOCUS_23400 <2742 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG >Feature sequence572 2131 86 gene locus_tag LOCUS_23410 2131 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence573 1133 357 gene locus_tag LOCUS_23420 1133 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545134.1 protein_id gnl|my_center|LOCUS_23420 1379 2479 gene locus_tag LOCUS_23430 1379 2479 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence574 <1 938 gene locus_tag LOCUS_23440 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759882.1:phosphohydrolase 1037 2077 gene locus_tag LOCUS_23450 gene lpxD 1037 2077 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_23450 >Feature sequence575 395 1237 gene locus_tag LOCUS_23460 gene crtB 395 1237 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_23460 1434 1910 gene locus_tag LOCUS_23470 1434 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence576 2 892 gene locus_tag LOCUS_23480 2 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1729 992 gene locus_tag LOCUS_23490 1729 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2016 1944 gene locus_tag LOCUS_t00380 2016 1944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2158 2637 gene locus_tag LOCUS_23500 2158 2637 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence577 2 214 gene locus_tag LOCUS_23510 2 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 246 1322 gene locus_tag LOCUS_23520 246 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 <2717 1355 gene locus_tag LOCUS_23530 <2717 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JNU7:nuclease SbcCD subunit C >Feature sequence578 <2714 891 gene locus_tag LOCUS_23540 <2714 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023149.1:zinc metalloprotease >Feature sequence579 391 1014 gene locus_tag LOCUS_23550 gene gpm 391 1014 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence580 1488 2435 gene locus_tag LOCUS_23560 1488 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence581 2691 1237 gene locus_tag LOCUS_23570 gene gatB 2691 1237 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_23570 >Feature sequence582 <1 574 gene locus_tag LOCUS_23580 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW63:5-formyltetrahydrofolate cyclo-ligase 748 1182 gene locus_tag LOCUS_23590 gene exbD2 748 1182 CDS product biopolymer transport ExbD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_23590 1179 2036 gene locus_tag LOCUS_23600 1179 2036 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_23600 2685 2137 gene locus_tag LOCUS_23610 2685 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence583 35 1444 gene locus_tag LOCUS_23620 35 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence584 1241 231 gene locus_tag LOCUS_23630 1241 231 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_23630 <2705 1632 gene locus_tag LOCUS_23640 <2705 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405031.1:alpha-amylase >Feature sequence585 480 1067 gene locus_tag LOCUS_23650 480 1067 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_23650 1134 2552 gene locus_tag LOCUS_23660 1134 2552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence586 621 1676 gene locus_tag LOCUS_23670 gene lpxK 621 1676 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence587 1040 672 gene locus_tag LOCUS_23680 1040 672 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_23680 1308 1042 gene locus_tag LOCUS_23690 1308 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2075 1377 gene locus_tag LOCUS_23700 2075 1377 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_23700 >Feature sequence588 >Feature sequence589 337 771 gene locus_tag LOCUS_23710 337 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 842 2497 gene locus_tag LOCUS_23720 842 2497 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence590 1322 429 gene locus_tag LOCUS_23730 1322 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1520 2530 gene locus_tag LOCUS_23740 1520 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence591 257 613 gene locus_tag LOCUS_23750 257 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1167 781 gene locus_tag LOCUS_23760 1167 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_23760 1972 1145 gene locus_tag LOCUS_23770 1972 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_23770 2479 2096 gene locus_tag LOCUS_23780 2479 2096 CDS product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence592 >Feature sequence593 1380 781 gene locus_tag LOCUS_23790 1380 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2558 1650 gene locus_tag LOCUS_23800 gene menA 2558 1650 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44739 protein_id gnl|my_center|LOCUS_23800 >Feature sequence594 >Feature sequence595 379 2442 gene locus_tag LOCUS_23810 379 2442 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence596 <1 1285 gene locus_tag LOCUS_23820 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786230.1:phosphoglucomutase <2662 1373 gene locus_tag LOCUS_23830 <2662 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PM9:lysine--tRNA ligase >Feature sequence597 1017 1835 gene locus_tag LOCUS_23840 1017 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence598 >Feature sequence599 575 1291 gene locus_tag LOCUS_23850 575 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1323 2456 gene locus_tag LOCUS_23860 1323 2456 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence600 347 2131 gene locus_tag LOCUS_23870 347 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2264 2638 gene locus_tag LOCUS_23880 gene rpsF 2264 2638 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_23880 >Feature sequence601 104 640 gene locus_tag LOCUS_23890 104 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1292 630 gene locus_tag LOCUS_23900 gene ung2 1292 630 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_23900 1425 1811 gene locus_tag LOCUS_23910 gene apaG 1425 1811 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_23910 >Feature sequence602 1714 218 gene locus_tag LOCUS_23920 gene purF 1714 218 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_23920 2481 1840 gene locus_tag LOCUS_23930 gene purN 2481 1840 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKZ6 protein_id gnl|my_center|LOCUS_23930 >Feature sequence603 <1 1822 gene locus_tag LOCUS_23940 <1 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889387.1:GMC oxidoreductase 2015 2449 gene locus_tag LOCUS_23950 2015 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence604 1 324 gene locus_tag LOCUS_23960 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 431 1108 gene locus_tag LOCUS_23970 431 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1271 2266 gene locus_tag LOCUS_23980 gene uvsE 1271 2266 CDS product UV damage endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961155.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence605 >Feature sequence606 258 2390 gene locus_tag LOCUS_23990 258 2390 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931802.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence607 <1 1436 gene locus_tag LOCUS_24000 <1 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZZR9:catalase 1592 2107 gene locus_tag LOCUS_24010 1592 2107 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PR9 protein_id gnl|my_center|LOCUS_24010 >Feature sequence608 1085 552 gene locus_tag LOCUS_24020 1085 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1758 1294 gene locus_tag LOCUS_24030 1758 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2329 1889 gene locus_tag LOCUS_24040 2329 1889 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_24040 2621 2382 gene locus_tag LOCUS_24050 2621 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence609 1839 691 gene locus_tag LOCUS_24060 1839 691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_24060 <2621 2030 gene locus_tag LOCUS_24070 <2621 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIR3:pseudouridine synthase >Feature sequence610 1792 1325 gene locus_tag LOCUS_24080 gene aroQ 1792 1325 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_24080 >Feature sequence611 1523 1095 gene locus_tag LOCUS_24090 1523 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1696 1932 gene locus_tag LOCUS_24100 gene acpP 1696 1932 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_24100 >Feature sequence612 313 1050 gene locus_tag LOCUS_24110 313 1050 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence613 >Feature sequence614 336 1676 gene locus_tag LOCUS_24120 336 1676 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence615 >Feature sequence616 >Feature sequence617 >Feature sequence618 296 1009 gene locus_tag LOCUS_24130 gene ispD 296 1009 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_24130 1200 2213 gene locus_tag LOCUS_24140 1200 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence619 >Feature sequence620 452 81 gene locus_tag LOCUS_24150 452 81 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_24150 1507 491 gene locus_tag LOCUS_24160 1507 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2241 1606 gene locus_tag LOCUS_24170 gene def 2241 1606 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_24170 >Feature sequence621 1151 1591 gene locus_tag LOCUS_24180 1151 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_24180 1741 2379 gene locus_tag LOCUS_24190 1741 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence622 1 831 gene locus_tag LOCUS_24200 1 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 951 1655 gene locus_tag LOCUS_24210 951 1655 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence623 1058 285 gene locus_tag LOCUS_24220 1058 285 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_24220 1538 1104 gene locus_tag LOCUS_24230 1538 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 <2542 1659 gene locus_tag LOCUS_24240 <2542 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763952.1:coproporphyrinogen III oxidase >Feature sequence624 479 204 gene locus_tag LOCUS_24250 479 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24250 1001 678 gene locus_tag LOCUS_24260 1001 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1391 1119 gene locus_tag LOCUS_24270 1391 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1694 1422 gene locus_tag LOCUS_24280 1694 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence625 >Feature sequence626 365 1399 gene locus_tag LOCUS_24290 gene murB 365 1399 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_24290 >Feature sequence627 485 1192 gene locus_tag LOCUS_24300 485 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1411 1644 gene locus_tag LOCUS_24310 1411 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1726 2493 gene locus_tag LOCUS_24320 1726 2493 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRQ0 protein_id gnl|my_center|LOCUS_24320 >Feature sequence628 <1 939 gene locus_tag LOCUS_24330 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142597.1:sorbosone dehydrogenase 2429 966 gene locus_tag LOCUS_24340 2429 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence629 429 2168 gene locus_tag LOCUS_24350 429 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence630 >Feature sequence631 604 1011 gene locus_tag LOCUS_24360 gene ygcM 604 1011 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_24360 1004 1663 gene locus_tag LOCUS_24370 gene folE2 1004 1663 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_24370 >Feature sequence632 922 134 gene locus_tag LOCUS_24380 922 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence633 774 52 gene locus_tag LOCUS_24390 774 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_24390 1754 936 gene locus_tag LOCUS_24400 1754 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2497 1985 gene locus_tag LOCUS_24410 2497 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence634 <1 512 gene locus_tag LOCUS_24420 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119920.1:mechanosensitive ion channel protein MscS 630 1190 gene locus_tag LOCUS_24430 630 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence635 1559 834 gene locus_tag LOCUS_24440 gene gldF 1559 834 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_24440 <2490 1662 gene locus_tag LOCUS_24450 <2490 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962427.1:gliding motility-associated ABC transporter ATP-binding subunit GldA >Feature sequence636 2055 637 gene locus_tag LOCUS_24460 2055 637 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence637 <1 1077 gene locus_tag LOCUS_24470 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964054.1:ABC transporter ATP-binding protein 1247 1648 gene locus_tag LOCUS_24480 1247 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence638 586 1080 gene locus_tag LOCUS_24490 586 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1383 2090 gene locus_tag LOCUS_24500 1383 2090 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence639 1494 1009 gene locus_tag LOCUS_24510 gene folA 1494 1009 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB2 protein_id gnl|my_center|LOCUS_24510 <2470 1585 gene locus_tag LOCUS_24520 <2470 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PD6:methionyl-tRNA formyltransferase >Feature sequence640 514 143 gene locus_tag LOCUS_24530 514 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 630 2198 gene locus_tag LOCUS_24540 630 2198 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141665.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence641 484 230 gene locus_tag LOCUS_24550 484 230 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_24550 1180 587 gene locus_tag LOCUS_24560 1180 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence642 1302 865 gene locus_tag LOCUS_24570 1302 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 <2465 1348 gene locus_tag LOCUS_24580 <2465 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108504.1:endonuclease >Feature sequence643 1534 917 gene locus_tag LOCUS_24590 1534 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_24590 2088 1582 gene locus_tag LOCUS_24600 2088 1582 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence644 1352 462 gene locus_tag LOCUS_24610 1352 462 CDS product putative NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701739.1 protein_id gnl|my_center|LOCUS_24610 2388 1462 gene locus_tag LOCUS_24620 2388 1462 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence645 498 1595 gene locus_tag LOCUS_24630 498 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence646 454 630 gene locus_tag LOCUS_24640 454 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 996 2441 gene locus_tag LOCUS_24650 996 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence647 290 1507 gene locus_tag LOCUS_24660 290 1507 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186419.1 protein_id gnl|my_center|LOCUS_24660 1559 2101 gene locus_tag LOCUS_24670 1559 2101 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence648 2109 1678 gene locus_tag LOCUS_24680 2109 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence649 678 1574 gene locus_tag LOCUS_24690 gene lipA 678 1574 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_24690 <2434 1626 gene locus_tag LOCUS_24700 <2434 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201890.1:helicase >Feature sequence650 >Feature sequence651 <2422 308 gene locus_tag LOCUS_24710 <2422 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530879.1:membrane protein >Feature sequence652 164 715 gene locus_tag LOCUS_24720 164 715 CDS product ribosomal-protein-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426600.1 protein_id gnl|my_center|LOCUS_24720 763 1473 gene locus_tag LOCUS_24730 763 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2277 1525 gene locus_tag LOCUS_24740 2277 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence653 669 1514 gene locus_tag LOCUS_24750 669 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1540 1998 gene locus_tag LOCUS_24760 1540 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence654 325 2076 gene locus_tag LOCUS_24770 325 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence655 >Feature sequence656 <2416 471 gene locus_tag LOCUS_24780 <2416 471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor >Feature sequence657 <1 1470 gene locus_tag LOCUS_24790 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708919.1:RNA helicase 1794 1474 gene locus_tag LOCUS_24800 1794 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_24800 2035 1787 gene locus_tag LOCUS_24810 2035 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence658 855 235 gene locus_tag LOCUS_24820 855 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence659 187 741 gene locus_tag LOCUS_24830 187 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 843 1631 gene locus_tag LOCUS_24840 843 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_24840 1714 2103 gene locus_tag LOCUS_24850 1714 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence660 495 848 gene locus_tag LOCUS_24860 495 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence661 897 580 gene locus_tag LOCUS_24870 897 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1111 2244 gene locus_tag LOCUS_24880 1111 2244 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence662 >Feature sequence663 629 2398 gene locus_tag LOCUS_24890 gene glgB 629 2398 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYJ7 protein_id gnl|my_center|LOCUS_24890 >Feature sequence664 >Feature sequence665 478 20 gene locus_tag LOCUS_24900 478 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 647 1270 gene locus_tag LOCUS_24910 647 1270 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_24910 1821 1285 gene locus_tag LOCUS_24920 1821 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2219 1884 gene locus_tag LOCUS_24930 2219 1884 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence666 >Feature sequence667 2 799 gene locus_tag LOCUS_24940 2 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 932 1168 gene locus_tag LOCUS_24950 932 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence668 426 1226 gene locus_tag LOCUS_24960 426 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 <2372 1505 gene locus_tag LOCUS_24970 <2372 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III >Feature sequence669 1735 845 gene locus_tag LOCUS_24980 1735 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24980 1773 2189 gene locus_tag LOCUS_24990 1773 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence670 >Feature sequence671 1044 223 gene locus_tag LOCUS_25000 1044 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2063 1293 gene locus_tag LOCUS_25010 2063 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence672 >Feature sequence673 956 495 gene locus_tag LOCUS_25020 gene purE 956 495 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJG5 protein_id gnl|my_center|LOCUS_25020 2351 1551 gene locus_tag LOCUS_25030 2351 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence674 >Feature sequence675 7 906 gene locus_tag LOCUS_25040 7 906 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_25040 994 1935 gene locus_tag LOCUS_25050 gene hemC 994 1935 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 protein_id gnl|my_center|LOCUS_25050 >Feature sequence676 953 552 gene locus_tag LOCUS_25060 953 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1085 1486 gene locus_tag LOCUS_25070 1085 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence677 127 837 gene locus_tag LOCUS_25080 127 837 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_25080 933 1352 gene locus_tag LOCUS_25090 933 1352 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence678 364 1041 gene locus_tag LOCUS_25100 364 1041 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_25100 2199 1489 gene locus_tag LOCUS_25110 2199 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence679 1086 394 gene locus_tag LOCUS_25120 gene cmk 1086 394 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_25120 1536 1126 gene locus_tag LOCUS_25130 1536 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence680 >Feature sequence681 205 2220 gene locus_tag LOCUS_25140 205 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence682 762 106 gene locus_tag LOCUS_25150 762 106 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889488.1 protein_id gnl|my_center|LOCUS_25150 1509 940 gene locus_tag LOCUS_25160 1509 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889489.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence683 422 1639 gene locus_tag LOCUS_25170 422 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence684 <1 1503 gene locus_tag LOCUS_25180 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYM2:UvrABC system protein A 1536 1739 gene locus_tag LOCUS_25190 1536 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence685 1459 446 gene locus_tag LOCUS_25200 gene pdhB 1459 446 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_25200 2270 1536 gene locus_tag LOCUS_25210 2270 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence686 453 1859 gene locus_tag LOCUS_25220 453 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence687 244 678 gene locus_tag LOCUS_25230 gene dut 244 678 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_25230 886 1899 gene locus_tag LOCUS_25240 886 1899 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence688 58 681 gene locus_tag LOCUS_25250 gene sigW 58 681 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_25250 855 1472 gene locus_tag LOCUS_25260 gene rsmG 855 1472 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_25260 <2287 1634 gene locus_tag LOCUS_25270 <2287 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939508.1:alpha/beta hydrolase >Feature sequence689 525 1298 gene locus_tag LOCUS_25280 525 1298 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_25280 1302 1913 gene locus_tag LOCUS_25290 gene pyrE 1302 1913 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E176 protein_id gnl|my_center|LOCUS_25290 >Feature sequence690 >Feature sequence691 838 239 gene locus_tag LOCUS_25300 838 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence692 250 705 gene locus_tag LOCUS_25310 250 705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence693 521 141 gene locus_tag LOCUS_25320 521 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1315 647 gene locus_tag LOCUS_25330 1315 647 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence694 1 906 gene locus_tag LOCUS_25340 1 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2123 1068 gene locus_tag LOCUS_25350 2123 1068 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence695 1770 982 gene locus_tag LOCUS_25360 1770 982 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence696 1131 1820 gene locus_tag LOCUS_25370 1131 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence697 498 1418 gene locus_tag LOCUS_25380 498 1418 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_25380 <2246 1457 gene locus_tag LOCUS_25390 <2246 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L5:dihydroorotate dehydrogenase (quinone) >Feature sequence698 >Feature sequence699 <1 923 gene locus_tag LOCUS_25400 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259345.1:CHAT domain-containing protein >Feature sequence700 227 982 gene locus_tag LOCUS_25410 gene truA 227 982 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZY4 protein_id gnl|my_center|LOCUS_25410 1091 2179 gene locus_tag LOCUS_25420 1091 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence701 1924 311 gene locus_tag LOCUS_25430 1924 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence702 550 155 gene locus_tag LOCUS_25440 550 155 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_25440 783 553 gene locus_tag LOCUS_25450 783 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1791 853 gene locus_tag LOCUS_25460 1791 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence703 <2228 244 gene locus_tag LOCUS_25470 <2228 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence704 2058 931 gene locus_tag LOCUS_25480 2058 931 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546360.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence705 20 673 gene locus_tag LOCUS_25490 20 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 780 1658 gene locus_tag LOCUS_25500 780 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence706 <1 786 gene locus_tag LOCUS_25510 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123067.1:sulfate transporter 878 1606 gene locus_tag LOCUS_25520 878 1606 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_25520 >Feature sequence707 975 271 gene locus_tag LOCUS_25530 975 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1621 1109 gene locus_tag LOCUS_25540 1621 1109 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence708 <2180 1008 gene locus_tag LOCUS_25550 <2180 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYG2:phenylalanine--tRNA ligase beta subunit >Feature sequence709 1838 69 gene locus_tag LOCUS_25560 1838 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence710 1170 493 gene locus_tag LOCUS_25570 1170 493 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_25570 1736 1209 gene locus_tag LOCUS_25580 1736 1209 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence711 548 1639 gene locus_tag LOCUS_25590 548 1639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence712 245 922 gene locus_tag LOCUS_25600 245 922 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107823.1 protein_id gnl|my_center|LOCUS_25600 1055 1654 gene locus_tag LOCUS_25610 1055 1654 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence713 915 1463 gene locus_tag LOCUS_25620 915 1463 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence714 1422 1901 gene locus_tag LOCUS_25630 1422 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence715 296 9 gene locus_tag LOCUS_25640 gene paaB 296 9 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_25640 1371 421 gene locus_tag LOCUS_25650 gene paaA 1371 421 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_25650 <2155 1600 gene locus_tag LOCUS_25660 <2155 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551026.1:phenylacetic acid degradation NADH oxidoreductase PaaE >Feature sequence716 <1 663 gene locus_tag LOCUS_25670 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEC9:NADH-quinone oxidoreductase subunit N 782 958 gene locus_tag LOCUS_25680 782 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 942 1097 gene locus_tag LOCUS_25690 942 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1098 1316 gene locus_tag LOCUS_25700 1098 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1330 1884 gene locus_tag LOCUS_25710 1330 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence717 654 1289 gene locus_tag LOCUS_25720 654 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1930 1307 gene locus_tag LOCUS_25730 1930 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence718 >Feature sequence719 <2132 1257 gene locus_tag LOCUS_25740 <2132 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140324.1:AraC family transcriptional regulator >Feature sequence720 1483 527 gene locus_tag LOCUS_25750 1483 527 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_25750 >Feature sequence721 698 979 gene locus_tag LOCUS_25760 698 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1073 1687 gene locus_tag LOCUS_25770 gene recR 1073 1687 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_25770 >Feature sequence722 353 1036 gene locus_tag LOCUS_25780 gene npdA 353 1036 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_25780 1080 1634 gene locus_tag LOCUS_25790 1080 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence723 >Feature sequence724 163 1671 gene locus_tag LOCUS_25800 163 1671 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence725 956 129 gene locus_tag LOCUS_25810 956 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1999 1199 gene locus_tag LOCUS_25820 1999 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence726 <1 1107 gene locus_tag LOCUS_25830 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793275.1:glycosyl transferase >Feature sequence727 63 341 gene locus_tag LOCUS_25840 63 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1629 361 gene locus_tag LOCUS_25850 gene purA 1629 361 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QR7 protein_id gnl|my_center|LOCUS_25850 2047 1697 gene locus_tag LOCUS_25860 2047 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence728 320 1402 gene locus_tag LOCUS_25870 320 1402 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_25870 <2085 1564 gene locus_tag LOCUS_25880 <2085 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788741.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB >Feature sequence729 >Feature sequence730 <2076 159 gene locus_tag LOCUS_25890 <2076 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor >Feature sequence731 530 1267 gene locus_tag LOCUS_25900 530 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence732 >Feature sequence733 331 1647 gene locus_tag LOCUS_25910 331 1647 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GN5 protein_id gnl|my_center|LOCUS_25910 >Feature sequence734 365 1105 gene locus_tag LOCUS_25920 365 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence735 1165 209 gene locus_tag LOCUS_25930 1165 209 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_25930 1287 1670 gene locus_tag LOCUS_25940 1287 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence736 >Feature sequence737 190 717 gene locus_tag LOCUS_25950 190 717 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_25950 923 1537 gene locus_tag LOCUS_25960 923 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence738 839 297 gene locus_tag LOCUS_25970 839 297 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_25970 1011 1403 gene locus_tag LOCUS_25980 1011 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence739 1938 187 gene locus_tag LOCUS_25990 1938 187 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence740 <1 720 gene locus_tag LOCUS_26000 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788733.1:folylpolyglutamate synthase 847 1554 gene locus_tag LOCUS_26010 gene trmB 847 1554 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_26010 >Feature sequence741 >Feature sequence742 997 728 gene locus_tag LOCUS_26020 997 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence743 953 75 gene locus_tag LOCUS_26030 953 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 <2014 1021 gene locus_tag LOCUS_26040 <2014 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor >Feature sequence744 1379 348 gene locus_tag LOCUS_26050 1379 348 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence745 125 997 gene locus_tag LOCUS_26060 125 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence746 <1 1424 gene locus_tag LOCUS_26070 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AE8:pyruvate carboxylase >Feature sequence747 <1 876 gene locus_tag LOCUS_26080 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NW5:inosine-5'-monophosphate dehydrogenase 1777 1055 gene locus_tag LOCUS_26090 1777 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence748 587 1048 gene locus_tag LOCUS_26100 gene mraZ 587 1048 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK88 protein_id gnl|my_center|LOCUS_26100 >Feature sequence749 94 435 gene locus_tag LOCUS_26110 94 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 428 688 gene locus_tag LOCUS_26120 428 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 681 959 gene locus_tag LOCUS_26130 681 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence750 197 589 gene locus_tag LOCUS_26140 197 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1973 606 gene locus_tag LOCUS_26150 gene tetV 1973 606 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence751 404 1942 gene locus_tag LOCUS_26160 404 1942 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence752 <1957 852 gene locus_tag LOCUS_26170 <1957 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884009.1:nuclease >Feature sequence753 423 1034 gene locus_tag LOCUS_26180 423 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence754 >Feature sequence755 393 1334 gene locus_tag LOCUS_26190 393 1334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142003.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence756 3 1082 gene locus_tag LOCUS_26200 gene bfmBB 3 1082 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_26200 1198 1395 gene locus_tag LOCUS_26210 1198 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1860 1399 gene locus_tag LOCUS_26220 1860 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence757 1074 1925 gene locus_tag LOCUS_26230 gene ispH 1074 1925 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence758 >Feature sequence759 668 282 gene locus_tag LOCUS_26240 668 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 <1928 734 gene locus_tag LOCUS_26250 <1928 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:hybrid sensor histidine kinase/response regulator >Feature sequence760 1450 218 gene locus_tag LOCUS_26260 gene icd 1450 218 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_26260 >Feature sequence761 >Feature sequence762 1077 391 gene locus_tag LOCUS_26270 1077 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence763 774 1463 gene locus_tag LOCUS_26280 gene upp 774 1463 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence764 >Feature sequence765 879 247 gene locus_tag LOCUS_26290 879 247 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_26290 1029 1880 gene locus_tag LOCUS_26300 1029 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence766 142 327 gene locus_tag LOCUS_26310 142 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 410 757 gene locus_tag LOCUS_26320 410 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26320 >Feature sequence767 1391 531 gene locus_tag LOCUS_26330 1391 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1539 1811 gene locus_tag LOCUS_26340 1539 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence768 489 55 gene locus_tag LOCUS_26350 489 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 798 1856 gene locus_tag LOCUS_26360 798 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence769 788 1546 gene locus_tag LOCUS_26370 788 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence770 <1887 304 gene locus_tag LOCUS_26380 <1887 304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF >Feature sequence771 1579 440 gene locus_tag LOCUS_26390 1579 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1812 1663 gene locus_tag LOCUS_26400 1812 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence772 >Feature sequence773 246 983 gene locus_tag LOCUS_26410 246 983 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_26410 1051 1224 gene locus_tag LOCUS_26420 1051 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1236 1598 gene locus_tag LOCUS_26430 1236 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_26430 1611 1856 gene locus_tag LOCUS_26440 1611 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence774 <1 1182 gene locus_tag LOCUS_26450 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107966.1:ribonucleoprotein >Feature sequence775 295 1305 gene locus_tag LOCUS_26460 295 1305 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence776 855 169 gene locus_tag LOCUS_26470 855 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1778 1188 gene locus_tag LOCUS_26480 1778 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence777 311 745 gene locus_tag LOCUS_26490 311 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1598 837 gene locus_tag LOCUS_26500 1598 837 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence778 240 1622 gene locus_tag LOCUS_26510 240 1622 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688412.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence779 926 114 gene locus_tag LOCUS_26520 926 114 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_26520 1281 1718 gene locus_tag LOCUS_26530 1281 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence780 335 760 gene locus_tag LOCUS_26540 335 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence781 <1826 447 gene locus_tag LOCUS_26550 <1826 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence782 868 455 gene locus_tag LOCUS_26560 868 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence783 <1823 1304 gene locus_tag LOCUS_26570 <1823 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YL7:ribosomal RNA small subunit methyltransferase I >Feature sequence784 >Feature sequence785 <1 1184 gene locus_tag LOCUS_26580 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NX1:DNA mismatch repair protein MutL >Feature sequence786 >Feature sequence787 >Feature sequence788 116 529 gene locus_tag LOCUS_26590 116 529 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_26590 558 1319 gene locus_tag LOCUS_26600 558 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence789 474 1505 gene locus_tag LOCUS_26610 474 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence790 <1 1368 gene locus_tag LOCUS_26620 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Y60:porin >Feature sequence791 1289 876 gene locus_tag LOCUS_26630 1289 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence792 1229 66 gene locus_tag LOCUS_26640 1229 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1357 1644 gene locus_tag LOCUS_26650 1357 1644 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence793 1620 913 gene locus_tag LOCUS_26660 1620 913 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence794 653 1528 gene locus_tag LOCUS_26670 gene dcyD 653 1528 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence795 >Feature sequence796 >Feature sequence797 1319 360 gene locus_tag LOCUS_26680 1319 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence798 <1 646 gene locus_tag LOCUS_26690 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968297.1:altronate hydrolase >Feature sequence799 >Feature sequence800 <1 1113 gene locus_tag LOCUS_26700 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:TonB-dependent receptor >Feature sequence801 844 662 gene locus_tag LOCUS_26710 844 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 <1764 854 gene locus_tag LOCUS_26720 <1764 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797236.1:membrane protein note possible pseudo, internal stop codon >Feature sequence802 >Feature sequence803 1425 193 gene locus_tag LOCUS_26730 gene yjhB 1425 193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence804 221 790 gene locus_tag LOCUS_26740 221 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence805 >Feature sequence806 186 1532 gene locus_tag LOCUS_26750 186 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868954.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence807 >Feature sequence808 >Feature sequence809 1042 650 gene locus_tag LOCUS_26760 1042 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence810 >Feature sequence811 888 190 gene locus_tag LOCUS_26770 888 190 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097308.1 protein_id gnl|my_center|LOCUS_26770 <1707 923 gene locus_tag LOCUS_26780 <1707 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962476.1:alpha-amylase >Feature sequence812 1440 508 gene locus_tag LOCUS_26790 gene fabH 1440 508 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS6 protein_id gnl|my_center|LOCUS_26790 >Feature sequence813 >Feature sequence814 >Feature sequence815 >Feature sequence816 1225 164 gene locus_tag LOCUS_26800 1225 164 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence817 >Feature sequence818 1073 165 gene locus_tag LOCUS_26810 1073 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142485.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence819 401 1660 gene locus_tag LOCUS_26820 401 1660 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence820 81 899 gene locus_tag LOCUS_26830 gene kduI2 81 899 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V09 protein_id gnl|my_center|LOCUS_26830 <1678 1020 gene locus_tag LOCUS_26840 <1678 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141618.1:histone deacetylase >Feature sequence821 >Feature sequence822 >Feature sequence823 >Feature sequence824 581 132 gene locus_tag LOCUS_26850 581 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 <1671 700 gene locus_tag LOCUS_26860 <1671 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence825 <1 1566 gene locus_tag LOCUS_26870 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202942.1:peptidase S9 >Feature sequence826 1650 397 gene locus_tag LOCUS_26880 1650 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence827 <1 665 gene locus_tag LOCUS_26890 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89W32:DNA polymerase IV <1668 878 gene locus_tag LOCUS_26900 <1668 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1E9:N-acetylornithine carbamoyltransferase >Feature sequence828 772 1557 gene locus_tag LOCUS_26910 772 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence829 156 932 gene locus_tag LOCUS_26920 156 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence830 >Feature sequence831 <1656 39 gene locus_tag LOCUS_26930 <1656 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403352.1:tungsten formylmethanofuran dehydrogenase subunit E >Feature sequence832 >Feature sequence833 1380 85 gene locus_tag LOCUS_26940 1380 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence834 398 1447 gene locus_tag LOCUS_26950 gene fbp 398 1447 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_26950 >Feature sequence835 1082 42 gene locus_tag LOCUS_26960 1082 42 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_26960 1514 1092 gene locus_tag LOCUS_26970 1514 1092 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence836 518 171 gene locus_tag LOCUS_26980 518 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 625 1563 gene locus_tag LOCUS_26990 gene irk 625 1563 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence837 >Feature sequence838 157 1242 gene locus_tag LOCUS_27000 gene apbE 157 1242 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_27000 1245 1490 gene locus_tag LOCUS_27010 1245 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence839 <1 973 gene locus_tag LOCUS_27020 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H092:valine--tRNA ligase 1141 1569 gene locus_tag LOCUS_27030 1141 1569 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380356.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence840 >Feature sequence841 >Feature sequence842 >Feature sequence843 250 1011 gene locus_tag LOCUS_27040 250 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence844 1326 694 gene locus_tag LOCUS_27050 1326 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1498 1424 gene locus_tag LOCUS_t00390 1498 1424 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence845 >Feature sequence846 <1 1032 gene locus_tag LOCUS_27060 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962867.1:cysteine desulfurase >Feature sequence847 <1 1021 gene locus_tag LOCUS_27070 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962929.1:acetyl-CoA acetyltransferase >Feature sequence848 <1614 184 gene locus_tag LOCUS_27080 <1614 184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963567.1:phytoene dehydrogenase >Feature sequence849 <1614 525 gene locus_tag LOCUS_27090 <1614 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957530.1:glucose sorbosone dehydrogenase >Feature sequence850 77 772 gene locus_tag LOCUS_27100 77 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence851 <1609 667 gene locus_tag LOCUS_27110 <1609 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142623.1:ATP-dependent DNA helicase RecQ >Feature sequence852 943 233 gene locus_tag LOCUS_27120 943 233 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038030.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence853 1420 140 gene locus_tag LOCUS_27130 1420 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence854 9 1274 gene locus_tag LOCUS_27140 gene purD 9 1274 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGV8 protein_id gnl|my_center|LOCUS_27140 >Feature sequence855 >Feature sequence856 <1587 344 gene locus_tag LOCUS_27150 <1587 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZL7:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence857 678 178 gene locus_tag LOCUS_27160 678 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 <1587 841 gene locus_tag LOCUS_27170 <1587 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932712.1:DEAD/DEAH box family ATP-dependent RNA helicase >Feature sequence858 182 1342 gene locus_tag LOCUS_27180 182 1342 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence859 >Feature sequence860 784 320 gene locus_tag LOCUS_27190 gene rnhA 784 320 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_27190 1444 884 gene locus_tag LOCUS_27200 1444 884 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_27200 >Feature sequence861 >Feature sequence862 >Feature sequence863 771 145 gene locus_tag LOCUS_27210 771 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 941 1399 gene locus_tag LOCUS_27220 gene ppiB 941 1399 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC00 protein_id gnl|my_center|LOCUS_27220 >Feature sequence864 >Feature sequence865 808 1374 gene locus_tag LOCUS_27230 808 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence866 620 1435 gene locus_tag LOCUS_27240 gene mvaB 620 1435 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence867 <1 1320 gene locus_tag LOCUS_27250 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin >Feature sequence868 315 812 gene locus_tag LOCUS_27260 gene folK 315 812 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence869 <1 1030 gene locus_tag LOCUS_27270 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202310.1:alpha-glucosidase >Feature sequence870 570 67 gene locus_tag LOCUS_27280 570 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 662 1120 gene locus_tag LOCUS_27290 662 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence871 817 1326 gene locus_tag LOCUS_27300 817 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence872 826 158 gene locus_tag LOCUS_27310 826 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1179 886 gene locus_tag LOCUS_27320 1179 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1533 1207 gene locus_tag LOCUS_27330 1533 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence873 1533 1012 gene locus_tag LOCUS_27340 1533 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence874 >Feature sequence875 1529 285 gene locus_tag LOCUS_27350 1529 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence876 317 997 gene locus_tag LOCUS_27360 317 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence877 >Feature sequence878 >Feature sequence879 >Feature sequence880 >Feature sequence881 >Feature sequence882 <1 811 gene locus_tag LOCUS_27370 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532875.1:multidrug efflux RND transporter permease subunit 1462 986 gene locus_tag LOCUS_27380 1462 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380