>Feature sequence001 <1 1056 gene locus_tag LOCUS_00010 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNT0:glycerol-3-phosphate dehydrogenase [NAD(P)+] 1053 1715 gene locus_tag LOCUS_00020 1053 1715 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_00020 1975 1727 gene locus_tag LOCUS_00030 1975 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3874 2117 gene locus_tag LOCUS_00040 3874 2117 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_00040 4895 4083 gene locus_tag LOCUS_00050 gene rsmA 4895 4083 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_00050 5881 4892 gene locus_tag LOCUS_00060 gene pdxA 5881 4892 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_00060 7203 5878 gene locus_tag LOCUS_00070 gene surA 7203 5878 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_00070 9446 7200 gene locus_tag LOCUS_00080 gene lptD 9446 7200 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_00080 9480 10520 gene locus_tag LOCUS_00090 9480 10520 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_00090 10513 10884 gene locus_tag LOCUS_00100 10513 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11738 10908 gene locus_tag LOCUS_00110 11738 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_00110 >Feature sequence002 510 1118 gene locus_tag LOCUS_00120 510 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 1220 3616 gene locus_tag LOCUS_00130 1220 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 4735 3767 gene locus_tag LOCUS_00140 4735 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 5912 4719 gene locus_tag LOCUS_00150 5912 4719 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_00150 8170 5909 gene locus_tag LOCUS_00160 8170 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_00160 9271 8180 gene locus_tag LOCUS_00170 9271 8180 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_00170 10809 9268 gene locus_tag LOCUS_00180 10809 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_00180 12125 10812 gene locus_tag LOCUS_00190 12125 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_00190 >Feature sequence003 308 12 gene locus_tag LOCUS_00200 308 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 2045 609 gene locus_tag LOCUS_00210 gene gatB 2045 609 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_00210 3563 2109 gene locus_tag LOCUS_00220 gene gatA 3563 2109 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_00220 3988 3701 gene locus_tag LOCUS_00230 gene gatC 3988 3701 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_00230 4340 5386 gene locus_tag LOCUS_00240 4340 5386 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_00240 5567 6379 gene locus_tag LOCUS_00250 5567 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 6383 6874 gene locus_tag LOCUS_00260 gene mreD 6383 6874 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_00260 6906 8768 gene locus_tag LOCUS_00270 6906 8768 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_00270 8749 9888 gene locus_tag LOCUS_00280 8749 9888 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_00280 9902 10867 gene locus_tag LOCUS_00290 gene sltB1 9902 10867 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_00290 10885 11697 gene locus_tag LOCUS_00300 10885 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_00300 >Feature sequence004 2597 2091 gene locus_tag LOCUS_00310 gene recX 2597 2091 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_00310 3695 2601 gene locus_tag LOCUS_00320 gene recA 3695 2601 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_00320 4592 4068 gene locus_tag LOCUS_00330 4592 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5116 4601 gene locus_tag LOCUS_00340 gene ygaD 5116 4601 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_00340 5324 6250 gene locus_tag LOCUS_00350 gene psd 5324 6250 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYM4 protein_id gnl|my_center|LOCUS_00350 6247 6825 gene locus_tag LOCUS_00360 6247 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_00360 7202 6864 gene locus_tag LOCUS_00370 7202 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 7922 7587 gene locus_tag LOCUS_00380 gene ydhD 7922 7587 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBA7 protein_id gnl|my_center|LOCUS_00380 9569 8016 gene locus_tag LOCUS_00390 gene hyuB 9569 8016 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_00390 9783 10364 gene locus_tag LOCUS_00400 gene sodB 9783 10364 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_00400 >Feature sequence005 3175 122 gene locus_tag LOCUS_00410 gene sbcC 3175 122 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 protein_id gnl|my_center|LOCUS_00410 4317 3175 gene locus_tag LOCUS_00420 gene sbcD 4317 3175 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HE2 protein_id gnl|my_center|LOCUS_00420 5994 4648 gene locus_tag LOCUS_00430 gene mqo 5994 4648 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56954 protein_id gnl|my_center|LOCUS_00430 6208 7929 gene locus_tag LOCUS_00440 6208 7929 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_00440 9887 7926 gene locus_tag LOCUS_00450 9887 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence006 642 1331 gene locus_tag LOCUS_00460 642 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1482 2234 gene locus_tag LOCUS_00470 1482 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2781 4766 gene locus_tag LOCUS_00480 2781 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5148 4828 gene locus_tag LOCUS_00490 5148 4828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_00490 6115 5255 gene locus_tag LOCUS_00500 6115 5255 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_00500 7404 6142 gene locus_tag LOCUS_00510 7404 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8225 7416 gene locus_tag LOCUS_00520 8225 7416 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479170.1 protein_id gnl|my_center|LOCUS_00520 8274 9770 gene locus_tag LOCUS_00530 8274 9770 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142005.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence007 <1 658 gene locus_tag LOCUS_00540 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003163304.1:motility protein FimV 795 1484 gene locus_tag LOCUS_00550 795 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 1844 3112 gene locus_tag LOCUS_00560 gene glgC 1844 3112 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_00560 3102 4802 gene locus_tag LOCUS_00570 3102 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4802 6292 gene locus_tag LOCUS_00580 4802 6292 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_00580 8903 6348 gene locus_tag LOCUS_00590 8903 6348 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 protein_id gnl|my_center|LOCUS_00590 9250 9164 gene locus_tag LOCUS_t00010 9250 9164 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 581 1012 gene locus_tag LOCUS_00600 gene ndk 581 1012 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C71 protein_id gnl|my_center|LOCUS_00600 994 2121 gene locus_tag LOCUS_00610 gene rlmN 994 2121 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_00610 2126 2869 gene locus_tag LOCUS_00620 gene pilF 2126 2869 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_00620 2866 3840 gene locus_tag LOCUS_00630 gene rodZ 2866 3840 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P3 protein_id gnl|my_center|LOCUS_00630 3855 5000 gene locus_tag LOCUS_00640 gene ispG 3855 5000 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_00640 5041 6360 gene locus_tag LOCUS_00650 gene hisS 5041 6360 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_00650 6360 6998 gene locus_tag LOCUS_00660 6360 6998 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_00660 6995 8146 gene locus_tag LOCUS_00670 gene bamB 6995 8146 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN97 protein_id gnl|my_center|LOCUS_00670 8151 9542 gene locus_tag LOCUS_00680 gene der 8151 9542 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW7 protein_id gnl|my_center|LOCUS_00680 >Feature sequence009 360 839 gene locus_tag LOCUS_00690 360 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1168 845 gene locus_tag LOCUS_00700 1168 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 1250 1534 gene locus_tag LOCUS_00710 1250 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_00710 2709 1537 gene locus_tag LOCUS_00720 gene rnd 2709 1537 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZV4 protein_id gnl|my_center|LOCUS_00720 3572 2706 gene locus_tag LOCUS_00730 3572 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3771 3565 gene locus_tag LOCUS_00740 3771 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_00740 4621 3881 gene locus_tag LOCUS_00750 4621 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 5781 4789 gene locus_tag LOCUS_00760 gene srkA 5781 4789 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_00760 6190 6627 gene locus_tag LOCUS_00770 6190 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 7580 6603 gene locus_tag LOCUS_00780 gene gluQ 7580 6603 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_00780 7666 7953 gene locus_tag LOCUS_00790 7666 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8046 8840 gene locus_tag LOCUS_00800 8046 8840 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_00800 <10165 8869 gene locus_tag LOCUS_00810 <10165 8869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105198.1:diguanylate cyclase response regulator >Feature sequence010 1736 846 gene locus_tag LOCUS_00820 gene argB 1736 846 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY1 protein_id gnl|my_center|LOCUS_00820 2210 1755 gene locus_tag LOCUS_00830 gene dut 2210 1755 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU09 protein_id gnl|my_center|LOCUS_00830 3417 2191 gene locus_tag LOCUS_00840 gene coaBC 3417 2191 CDS product coenzyme A biosynthesis bifunctional protein CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVD1 protein_id gnl|my_center|LOCUS_00840 3497 4171 gene locus_tag LOCUS_00850 3497 4171 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_00850 4182 4487 gene locus_tag LOCUS_00860 gene rpmB 4182 4487 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEM3 protein_id gnl|my_center|LOCUS_00860 4503 4658 gene locus_tag LOCUS_00870 gene rpmG 4503 4658 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66226 protein_id gnl|my_center|LOCUS_00870 4950 4711 gene locus_tag LOCUS_00880 4950 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6139 4964 gene locus_tag LOCUS_00890 6139 4964 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_00890 7462 6242 gene locus_tag LOCUS_00900 gene argJ 7462 6242 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_00900 7666 8394 gene locus_tag LOCUS_00910 7666 8394 CDS product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_00910 8970 8500 gene locus_tag LOCUS_00920 8970 8500 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_00920 9252 8971 gene locus_tag LOCUS_00930 9252 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence011 1539 28 gene locus_tag LOCUS_00940 gene purF 1539 28 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_00940 2051 1554 gene locus_tag LOCUS_00950 2051 1554 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770588.1 protein_id gnl|my_center|LOCUS_00950 2792 2097 gene locus_tag LOCUS_00960 2792 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4067 2796 gene locus_tag LOCUS_00970 gene folC 4067 2796 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_00970 5051 4116 gene locus_tag LOCUS_00980 gene accD 5051 4116 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E456 protein_id gnl|my_center|LOCUS_00980 5881 5048 gene locus_tag LOCUS_00990 gene trpA 5881 5048 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVY3 protein_id gnl|my_center|LOCUS_00990 7092 5878 gene locus_tag LOCUS_01000 gene trpB 7092 5878 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_01000 7705 7076 gene locus_tag LOCUS_01010 gene trpF 7705 7076 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_01010 8609 7803 gene locus_tag LOCUS_01020 gene truA 8609 7803 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJP6 protein_id gnl|my_center|LOCUS_01020 >Feature sequence012 1377 664 gene locus_tag LOCUS_01030 1377 664 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_01030 1513 2214 gene locus_tag LOCUS_01040 gene bioD 1513 2214 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 protein_id gnl|my_center|LOCUS_01040 2219 2653 gene locus_tag LOCUS_01050 2219 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2650 3888 gene locus_tag LOCUS_01060 gene roxS 2650 3888 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_01060 3894 4445 gene locus_tag LOCUS_01070 gene roxR 3894 4445 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_01070 5121 4558 gene locus_tag LOCUS_01080 5121 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5220 5717 gene locus_tag LOCUS_01090 5220 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5717 6538 gene locus_tag LOCUS_01100 gene rrmA 5717 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_01100 6607 8340 gene locus_tag LOCUS_01110 gene argS 6607 8340 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQC6 protein_id gnl|my_center|LOCUS_01110 8657 8397 gene locus_tag LOCUS_01120 8657 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence013 1203 1964 gene locus_tag LOCUS_01130 1203 1964 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_01130 2049 2642 gene locus_tag LOCUS_01140 2049 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2635 3159 gene locus_tag LOCUS_01150 2635 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3152 3676 gene locus_tag LOCUS_01160 3152 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3724 4224 gene locus_tag LOCUS_01170 3724 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4513 4310 gene locus_tag LOCUS_01180 4513 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4842 5132 gene locus_tag LOCUS_01190 4842 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5305 6714 gene locus_tag LOCUS_01200 gene ccoN 5305 6714 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_01200 6817 7773 gene locus_tag LOCUS_01210 6817 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 7790 8437 gene locus_tag LOCUS_01220 7790 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8453 8602 gene locus_tag LOCUS_01230 8453 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 8731 9057 gene locus_tag LOCUS_01240 8731 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9068 9337 gene locus_tag LOCUS_01250 9068 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence014 538 1035 gene locus_tag LOCUS_01260 538 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 1487 2794 gene locus_tag LOCUS_01270 gene aspB 1487 2794 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53001 protein_id gnl|my_center|LOCUS_01270 2819 4003 gene locus_tag LOCUS_01280 gene ackA 2819 4003 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S6 protein_id gnl|my_center|LOCUS_01280 4068 5555 gene locus_tag LOCUS_01290 4068 5555 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_01290 5683 8067 gene locus_tag LOCUS_01300 5683 8067 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 protein_id gnl|my_center|LOCUS_01300 >Feature sequence015 <1 1159 gene locus_tag LOCUS_01310 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024256.1:histidine kinase 1149 2042 gene locus_tag LOCUS_01320 1149 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2410 2066 gene locus_tag LOCUS_01330 2410 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 protein_id gnl|my_center|LOCUS_01330 3200 2622 gene locus_tag LOCUS_01340 3200 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3842 3279 gene locus_tag LOCUS_01350 3842 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_01350 4713 3889 gene locus_tag LOCUS_01360 4713 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4801 5109 gene locus_tag LOCUS_01370 4801 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5270 5698 gene locus_tag LOCUS_01380 5270 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6227 5682 gene locus_tag LOCUS_01390 6227 5682 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_01390 6595 6332 gene locus_tag LOCUS_01400 6595 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7660 6596 gene locus_tag LOCUS_01410 gene comA 7660 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143263.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence016 3031 1142 gene locus_tag LOCUS_01420 3031 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3545 3174 gene locus_tag LOCUS_01430 3545 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3677 4564 gene locus_tag LOCUS_01440 3677 4564 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090560.1 protein_id gnl|my_center|LOCUS_01440 5965 4745 gene locus_tag LOCUS_01450 5965 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6436 6645 gene locus_tag LOCUS_01460 6436 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8349 6847 gene locus_tag LOCUS_01470 8349 6847 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816663.1 protein_id gnl|my_center|LOCUS_01470 8466 9107 gene locus_tag LOCUS_01480 gene azoR1 8466 9107 CDS product FMN-dependent NADH-azoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PW2 protein_id gnl|my_center|LOCUS_01480 >Feature sequence017 3651 1621 gene locus_tag LOCUS_01490 gene yfcX 3651 1621 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_01490 4971 3658 gene locus_tag LOCUS_01500 4971 3658 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_01500 7412 4971 gene locus_tag LOCUS_01510 7412 4971 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_01510 7843 8196 gene locus_tag LOCUS_01520 7843 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence018 639 1259 gene locus_tag LOCUS_01530 639 1259 CDS product class III cytochrome C domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_01530 1336 3534 gene locus_tag LOCUS_01540 1336 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3536 4396 gene locus_tag LOCUS_01550 3536 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4452 5870 gene locus_tag LOCUS_01560 4452 5870 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_01560 5898 6425 gene locus_tag LOCUS_01570 5898 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6422 6985 gene locus_tag LOCUS_01580 6422 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7026 8072 gene locus_tag LOCUS_01590 7026 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_01590 9021 8128 gene locus_tag LOCUS_01600 9021 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence019 <1 714 gene locus_tag LOCUS_01610 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262833.1:type II secretion system protein GspD 704 2236 gene locus_tag LOCUS_01620 gene xcpR 704 2236 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_01620 2243 3466 gene locus_tag LOCUS_01630 2243 3466 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_01630 3495 3935 gene locus_tag LOCUS_01640 gene gspG 3495 3935 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_01640 3964 4488 gene locus_tag LOCUS_01650 gene xcpU 3964 4488 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_01650 4493 4885 gene locus_tag LOCUS_01660 gene gspI 4493 4885 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_01660 4882 5676 gene locus_tag LOCUS_01670 gene xcpW 4882 5676 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_01670 5673 6623 gene locus_tag LOCUS_01680 gene xcpX 5673 6623 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_01680 6625 7836 gene locus_tag LOCUS_01690 6625 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7836 8333 gene locus_tag LOCUS_01700 7836 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence020 465 19 gene locus_tag LOCUS_01710 gene rplI 465 19 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q328J6 protein_id gnl|my_center|LOCUS_01710 1481 525 gene locus_tag LOCUS_01720 1481 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_01720 1749 1525 gene locus_tag LOCUS_01730 gene rpsR 1749 1525 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_01730 2181 1867 gene locus_tag LOCUS_01740 2181 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2618 2196 gene locus_tag LOCUS_01750 gene rpsF 2618 2196 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFV4 protein_id gnl|my_center|LOCUS_01750 3607 2960 gene locus_tag LOCUS_01760 gene cheD1 3607 2960 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_01760 3748 4554 gene locus_tag LOCUS_01770 gene rsmJ 3748 4554 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44901 protein_id gnl|my_center|LOCUS_01770 5576 4596 gene locus_tag LOCUS_01780 5576 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 <8972 5598 gene locus_tag LOCUS_01790 <8972 5598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVF8:chromosome partition protein Smc >Feature sequence021 768 13 gene locus_tag LOCUS_01800 768 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1498 1031 gene locus_tag LOCUS_01810 1498 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2397 1495 gene locus_tag LOCUS_01820 2397 1495 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_01820 3349 2399 gene locus_tag LOCUS_01830 3349 2399 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_01830 3445 4272 gene locus_tag LOCUS_01840 3445 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4403 5056 gene locus_tag LOCUS_01850 gene ccmA 4403 5056 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 protein_id gnl|my_center|LOCUS_01850 5059 5784 gene locus_tag LOCUS_01860 gene ccmB 5059 5784 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3S8 protein_id gnl|my_center|LOCUS_01860 5843 6592 gene locus_tag LOCUS_01870 gene ccmC 5843 6592 CDS product heme export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_01870 6589 6762 gene locus_tag LOCUS_01880 6589 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6752 7210 gene locus_tag LOCUS_01890 gene ccmE 6752 7210 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45401 protein_id gnl|my_center|LOCUS_01890 >Feature sequence022 1444 785 gene locus_tag LOCUS_01900 1444 785 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_01900 1700 2290 gene locus_tag LOCUS_01910 1700 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3546 2287 gene locus_tag LOCUS_01920 3546 2287 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704461.1 protein_id gnl|my_center|LOCUS_01920 3802 7248 gene locus_tag LOCUS_01930 3802 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 <8795 7420 gene locus_tag LOCUS_01940 <8795 7420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I742:protein ClpV1 >Feature sequence023 189 1739 gene locus_tag LOCUS_01950 gene ggt 189 1739 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_01950 3069 1750 gene locus_tag LOCUS_01960 gene rimO 3069 1750 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAI1 protein_id gnl|my_center|LOCUS_01960 3936 3106 gene locus_tag LOCUS_01970 3936 3106 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_01970 4794 3940 gene locus_tag LOCUS_01980 gene pstA 4794 3940 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I7 protein_id gnl|my_center|LOCUS_01980 5638 4784 gene locus_tag LOCUS_01990 gene pstC 5638 4784 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 protein_id gnl|my_center|LOCUS_01990 6476 5619 gene locus_tag LOCUS_02000 6476 5619 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061131.1 protein_id gnl|my_center|LOCUS_02000 6838 6467 gene locus_tag LOCUS_02010 6838 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8387 7050 gene locus_tag LOCUS_02020 8387 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence024 277 116 gene locus_tag LOCUS_02030 277 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2171 297 gene locus_tag LOCUS_02040 2171 297 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_02040 3633 2413 gene locus_tag LOCUS_02050 3633 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4677 3730 gene locus_tag LOCUS_02060 gene znuA 4677 3730 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_02060 6101 4833 gene locus_tag LOCUS_02070 6101 4833 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_02070 6401 6105 gene locus_tag LOCUS_02080 6401 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7522 6608 gene locus_tag LOCUS_02090 7522 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7824 7519 gene locus_tag LOCUS_02100 7824 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence025 <1 1874 gene locus_tag LOCUS_02110 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038389.1:membrane protein 2024 3859 gene locus_tag LOCUS_02120 2024 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4231 4156 gene locus_tag LOCUS_t00020 4231 4156 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5060 4362 gene locus_tag LOCUS_02130 gene queC 5060 4362 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y44 protein_id gnl|my_center|LOCUS_02130 5759 5061 gene locus_tag LOCUS_02140 gene queE 5759 5061 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F56 protein_id gnl|my_center|LOCUS_02140 6728 5787 gene locus_tag LOCUS_02150 6728 5787 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_02150 7365 6754 gene locus_tag LOCUS_02160 7365 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8665 7385 gene locus_tag LOCUS_02170 gene tolB 8665 7385 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_02170 >Feature sequence026 580 759 gene locus_tag LOCUS_02180 580 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 737 2614 gene locus_tag LOCUS_02190 gene speA 737 2614 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_02190 3603 2674 gene locus_tag LOCUS_02200 3603 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_02200 4382 3627 gene locus_tag LOCUS_02210 4382 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_02210 4546 4791 gene locus_tag LOCUS_02220 4546 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5023 6492 gene locus_tag LOCUS_02230 5023 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6805 6614 gene locus_tag LOCUS_02240 6805 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7486 6869 gene locus_tag LOCUS_02250 7486 6869 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_02250 8048 7560 gene locus_tag LOCUS_02260 8048 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8605 8045 gene locus_tag LOCUS_02270 8605 8045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence027 1958 219 gene locus_tag LOCUS_02280 1958 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_02280 3780 1942 gene locus_tag LOCUS_02290 gene batB 3780 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_02290 4766 3777 gene locus_tag LOCUS_02300 4766 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_02300 5229 4759 gene locus_tag LOCUS_02310 5229 4759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021659.1 protein_id gnl|my_center|LOCUS_02310 6136 5231 gene locus_tag LOCUS_02320 6136 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_02320 7116 6139 gene locus_tag LOCUS_02330 7116 6139 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_02330 7735 7229 gene locus_tag LOCUS_02340 7735 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945783.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence028 1178 339 gene locus_tag LOCUS_02350 1178 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1760 1254 gene locus_tag LOCUS_02360 1760 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967527.1 protein_id gnl|my_center|LOCUS_02360 2269 1808 gene locus_tag LOCUS_02370 2269 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2773 2297 gene locus_tag LOCUS_02380 2773 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3743 2949 gene locus_tag LOCUS_02390 3743 2949 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_02390 4351 3740 gene locus_tag LOCUS_02400 4351 3740 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_02400 6007 4409 gene locus_tag LOCUS_02410 6007 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460289.1 protein_id gnl|my_center|LOCUS_02410 6400 7365 gene locus_tag LOCUS_02420 6400 7365 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_02420 7437 8474 gene locus_tag LOCUS_02430 gene aguA 7437 8474 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence029 2690 138 gene locus_tag LOCUS_02440 2690 138 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707612.1 protein_id gnl|my_center|LOCUS_02440 3467 2772 gene locus_tag LOCUS_02450 gene nfi 3467 2772 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIJ2 protein_id gnl|my_center|LOCUS_02450 3970 3488 gene locus_tag LOCUS_02460 3970 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4496 3951 gene locus_tag LOCUS_02470 4496 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 protein_id gnl|my_center|LOCUS_02470 4673 5020 gene locus_tag LOCUS_02480 4673 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5067 5945 gene locus_tag LOCUS_02490 5067 5945 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090846.1 protein_id gnl|my_center|LOCUS_02490 5958 6329 gene locus_tag LOCUS_02500 5958 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6762 6370 gene locus_tag LOCUS_02510 6762 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 <8648 7044 gene locus_tag LOCUS_02520 <8648 7044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704308.1:transcription accessory protein >Feature sequence030 2556 3086 gene locus_tag LOCUS_02530 2556 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3090 3590 gene locus_tag LOCUS_02540 gene def-2 3090 3590 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R2 protein_id gnl|my_center|LOCUS_02540 3686 6313 gene locus_tag LOCUS_02550 3686 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6505 7356 gene locus_tag LOCUS_02560 6505 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7406 8488 gene locus_tag LOCUS_02570 gene telA 7406 8488 CDS product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence031 325 768 gene locus_tag LOCUS_02580 gene hspA 325 768 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_02580 914 1093 gene locus_tag LOCUS_02590 914 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1935 1444 gene locus_tag LOCUS_02600 1935 1444 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_02600 2556 2044 gene locus_tag LOCUS_02610 2556 2044 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815290.1 protein_id gnl|my_center|LOCUS_02610 3029 2598 gene locus_tag LOCUS_02620 3029 2598 CDS product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261976.1 protein_id gnl|my_center|LOCUS_02620 3898 3095 gene locus_tag LOCUS_02630 3898 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02630 4758 3895 gene locus_tag LOCUS_02640 4758 3895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727086.1 protein_id gnl|my_center|LOCUS_02640 5651 4755 gene locus_tag LOCUS_02650 5651 4755 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_02650 6606 5638 gene locus_tag LOCUS_02660 gene appB 6606 5638 CDS product oligopeptide transport system permease protein AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42062 protein_id gnl|my_center|LOCUS_02660 8207 6606 gene locus_tag LOCUS_02670 8207 6606 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948959.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence032 96 761 gene locus_tag LOCUS_02680 96 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 834 1850 gene locus_tag LOCUS_02690 834 1850 CDS product sugar dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_02690 1879 2364 gene locus_tag LOCUS_02700 1879 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2399 3865 gene locus_tag LOCUS_02710 gene mucD 2399 3865 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_02710 3957 5753 gene locus_tag LOCUS_02720 gene lepA 3957 5753 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43729 protein_id gnl|my_center|LOCUS_02720 5750 6583 gene locus_tag LOCUS_02730 gene lep 5750 6583 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA30 protein_id gnl|my_center|LOCUS_02730 6604 7035 gene locus_tag LOCUS_02740 6604 7035 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 protein_id gnl|my_center|LOCUS_02740 7041 7736 gene locus_tag LOCUS_02750 gene rnc 7041 7736 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CV4 protein_id gnl|my_center|LOCUS_02750 8280 7918 gene locus_tag LOCUS_02760 gene pilH 8280 7918 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_02760 >Feature sequence033 1897 1667 gene locus_tag LOCUS_02770 1897 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 5941 2057 gene locus_tag LOCUS_02780 gene purL 5941 2057 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ51 protein_id gnl|my_center|LOCUS_02780 6683 5967 gene locus_tag LOCUS_02790 gene purC 6683 5967 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_02790 7736 6726 gene locus_tag LOCUS_02800 7736 6726 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039334.1 protein_id gnl|my_center|LOCUS_02800 8392 7733 gene locus_tag LOCUS_02810 8392 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence034 <1 1881 gene locus_tag LOCUS_02820 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946906.1:HcpA family protein 1966 2238 gene locus_tag LOCUS_02830 1966 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2740 2285 gene locus_tag LOCUS_02840 2740 2285 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_02840 3659 2826 gene locus_tag LOCUS_02850 3659 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4562 3666 gene locus_tag LOCUS_02860 4562 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5335 4718 gene locus_tag LOCUS_02870 5335 4718 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_02870 5966 5358 gene locus_tag LOCUS_02880 5966 5358 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_02880 6595 5990 gene locus_tag LOCUS_02890 6595 5990 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_02890 7596 6673 gene locus_tag LOCUS_02900 7596 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 7686 7853 gene locus_tag LOCUS_02910 7686 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence035 701 279 gene locus_tag LOCUS_02920 701 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 902 3199 gene locus_tag LOCUS_02930 gene comA 902 3199 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_02930 3276 3956 gene locus_tag LOCUS_02940 3276 3956 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_02940 3958 4386 gene locus_tag LOCUS_02950 3958 4386 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_02950 4554 5831 gene locus_tag LOCUS_02960 4554 5831 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_02960 5818 6882 gene locus_tag LOCUS_02970 gene lpxK 5818 6882 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W5 protein_id gnl|my_center|LOCUS_02970 6875 7057 gene locus_tag LOCUS_02980 6875 7057 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK8 protein_id gnl|my_center|LOCUS_02980 7054 7812 gene locus_tag LOCUS_02990 gene kdsB 7054 7812 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32E38 protein_id gnl|my_center|LOCUS_02990 8163 7834 gene locus_tag LOCUS_03000 8163 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence036 2300 1371 gene locus_tag LOCUS_03010 2300 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_03010 3871 2960 gene locus_tag LOCUS_03020 gene lpxC 3871 2960 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_03020 5163 3997 gene locus_tag LOCUS_03030 gene ftsZ 5163 3997 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q1 protein_id gnl|my_center|LOCUS_03030 6544 5306 gene locus_tag LOCUS_03040 gene ftsA 6544 5306 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_03040 7281 6562 gene locus_tag LOCUS_03050 7281 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8222 7278 gene locus_tag LOCUS_03060 gene ddlB 8222 7278 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_03060 >Feature sequence037 <1 673 gene locus_tag LOCUS_03070 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939406.1:hybrid sensor histidine kinase/response regulator 736 2688 gene locus_tag LOCUS_03080 736 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5839 2762 gene locus_tag LOCUS_03090 gene dnaE2 5839 2762 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_03090 7267 5849 gene locus_tag LOCUS_03100 7267 5849 CDS product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104196.1 protein_id gnl|my_center|LOCUS_03100 8017 7403 gene locus_tag LOCUS_03110 8017 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence038 2237 801 gene locus_tag LOCUS_03120 gene creC 2237 801 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_03120 2922 2227 gene locus_tag LOCUS_03130 gene creB 2922 2227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_03130 3298 2930 gene locus_tag LOCUS_03140 3298 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3860 3528 gene locus_tag LOCUS_03150 3860 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4447 5670 gene locus_tag LOCUS_03160 gene traB 4447 5670 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037346.1 protein_id gnl|my_center|LOCUS_03160 5765 6871 gene locus_tag LOCUS_03170 5765 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7629 6889 gene locus_tag LOCUS_03180 7629 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 <8246 7714 gene locus_tag LOCUS_03190 <8246 7714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812407.1:phosphatase >Feature sequence039 6 1295 gene locus_tag LOCUS_03200 6 1295 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459708.1 protein_id gnl|my_center|LOCUS_03200 1865 1314 gene locus_tag LOCUS_03210 1865 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3718 1943 gene locus_tag LOCUS_03220 3718 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3877 5571 gene locus_tag LOCUS_03230 3877 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6229 5588 gene locus_tag LOCUS_03240 gene agmR 6229 5588 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence040 1206 1619 gene locus_tag LOCUS_03250 gene rimP 1206 1619 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_03250 1663 3183 gene locus_tag LOCUS_03260 gene nusA 1663 3183 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_03260 3202 5877 gene locus_tag LOCUS_03270 gene infB 3202 5877 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M02 protein_id gnl|my_center|LOCUS_03270 5902 6282 gene locus_tag LOCUS_03280 gene rbfA 5902 6282 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_03280 6282 7199 gene locus_tag LOCUS_03290 gene truB 6282 7199 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX7 protein_id gnl|my_center|LOCUS_03290 7378 7647 gene locus_tag LOCUS_03300 gene rpsO 7378 7647 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECB7 protein_id gnl|my_center|LOCUS_03300 >Feature sequence041 1795 503 gene locus_tag LOCUS_03310 1795 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2238 2786 gene locus_tag LOCUS_03320 gene ampD 2238 2786 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_03320 2787 3209 gene locus_tag LOCUS_03330 2787 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4020 3253 gene locus_tag LOCUS_03340 4020 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4244 4855 gene locus_tag LOCUS_03350 4244 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_03350 5046 5528 gene locus_tag LOCUS_03360 5046 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6496 5600 gene locus_tag LOCUS_03370 6496 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 <8179 6515 gene locus_tag LOCUS_03380 <8179 6515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FYI1:lipid A export ATP-binding/permease protein MsbA >Feature sequence042 1788 3338 gene locus_tag LOCUS_03390 1788 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3879 3388 gene locus_tag LOCUS_03400 3879 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4637 4452 gene locus_tag LOCUS_03410 4637 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4963 5568 gene locus_tag LOCUS_03420 4963 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6091 5579 gene locus_tag LOCUS_03430 6091 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6313 7071 gene locus_tag LOCUS_03440 gene ntcA 6313 7071 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_03440 7248 7499 gene locus_tag LOCUS_03450 7248 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence043 1179 1562 gene locus_tag LOCUS_03460 1179 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1874 2437 gene locus_tag LOCUS_03470 gene rpoE 1874 2437 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_03470 2424 2837 gene locus_tag LOCUS_03480 2424 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 2842 3036 gene locus_tag LOCUS_03490 2842 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3029 3496 gene locus_tag LOCUS_03500 3029 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3668 4531 gene locus_tag LOCUS_03510 3668 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4559 6748 gene locus_tag LOCUS_03520 4559 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_03520 6750 7232 gene locus_tag LOCUS_03530 6750 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339340.1 protein_id gnl|my_center|LOCUS_03530 7258 7716 gene locus_tag LOCUS_03540 7258 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence044 1053 325 gene locus_tag LOCUS_03550 1053 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1571 1209 gene locus_tag LOCUS_03560 1571 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2293 1688 gene locus_tag LOCUS_03570 2293 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2878 2363 gene locus_tag LOCUS_03580 2878 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3646 2891 gene locus_tag LOCUS_03590 gene dsbC 3646 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_03590 4732 3824 gene locus_tag LOCUS_03600 gene xerD 4732 3824 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_03600 5189 4842 gene locus_tag LOCUS_03610 gene rplS 5189 4842 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_03610 6008 5301 gene locus_tag LOCUS_03620 gene trmD 6008 5301 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY7 protein_id gnl|my_center|LOCUS_03620 6553 6026 gene locus_tag LOCUS_03630 gene rimM 6553 6026 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44568 protein_id gnl|my_center|LOCUS_03630 6804 6550 gene locus_tag LOCUS_03640 gene rpsP 6804 6550 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_03640 8055 6991 gene locus_tag LOCUS_03650 8055 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence045 <1 1478 gene locus_tag LOCUS_03660 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112350.1:TonB-dependent receptor 1494 2111 gene locus_tag LOCUS_03670 1494 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2098 2700 gene locus_tag LOCUS_03680 gene cobO 2098 2700 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_03680 3272 6994 gene locus_tag LOCUS_03690 3272 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence046 1173 217 gene locus_tag LOCUS_03700 gene thiL 1173 217 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_03700 1625 1179 gene locus_tag LOCUS_03710 gene nusB 1625 1179 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY4 protein_id gnl|my_center|LOCUS_03710 2127 1642 gene locus_tag LOCUS_03720 gene ribH 2127 1642 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_03720 3252 2149 gene locus_tag LOCUS_03730 gene ribB 3252 2149 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG9 protein_id gnl|my_center|LOCUS_03730 3921 3265 gene locus_tag LOCUS_03740 3921 3265 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_03740 5031 3934 gene locus_tag LOCUS_03750 gene ribD 5031 3934 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN1 protein_id gnl|my_center|LOCUS_03750 5678 5145 gene locus_tag LOCUS_03760 gene nrdR 5678 5145 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT4 protein_id gnl|my_center|LOCUS_03760 6958 5705 gene locus_tag LOCUS_03770 gene glyA 6958 5705 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_03770 7142 7393 gene locus_tag LOCUS_03780 7142 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence047 2457 280 gene locus_tag LOCUS_03790 2457 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2582 3556 gene locus_tag LOCUS_03800 gene rnz 2582 3556 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_03800 4653 3601 gene locus_tag LOCUS_03810 gene ispB 4653 3601 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_03810 4841 5152 gene locus_tag LOCUS_03820 gene rplU 4841 5152 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUT0 protein_id gnl|my_center|LOCUS_03820 5187 5444 gene locus_tag LOCUS_03830 gene rpmA 5187 5444 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_03830 5557 6570 gene locus_tag LOCUS_03840 gene obg 5557 6570 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK1 protein_id gnl|my_center|LOCUS_03840 6576 7700 gene locus_tag LOCUS_03850 gene proB 6576 7700 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_03850 >Feature sequence048 372 1355 gene locus_tag LOCUS_03860 gene holB 372 1355 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770613.1 protein_id gnl|my_center|LOCUS_03860 1407 1766 gene locus_tag LOCUS_03870 gene pilZ 1407 1766 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_03870 3279 1897 gene locus_tag LOCUS_03880 3279 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_03880 5100 3292 gene locus_tag LOCUS_03890 5100 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_03890 7196 5130 gene locus_tag LOCUS_03900 7196 5130 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_03900 <7943 7431 gene locus_tag LOCUS_03910 <7943 7431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112813.1:transcriptional regulator >Feature sequence049 90 659 gene locus_tag LOCUS_03920 90 659 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_03920 1688 666 gene locus_tag LOCUS_03930 1688 666 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_03930 2536 1748 gene locus_tag LOCUS_03940 2536 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208237.1 protein_id gnl|my_center|LOCUS_03940 3750 2575 gene locus_tag LOCUS_03950 3750 2575 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974637.1 protein_id gnl|my_center|LOCUS_03950 3933 4790 gene locus_tag LOCUS_03960 3933 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5003 6256 gene locus_tag LOCUS_03970 5003 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807794.1 protein_id gnl|my_center|LOCUS_03970 6435 7850 gene locus_tag LOCUS_03980 6435 7850 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706579.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence050 135 1136 gene locus_tag LOCUS_03990 135 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2352 1162 gene locus_tag LOCUS_04000 2352 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3558 2842 gene locus_tag LOCUS_04010 3558 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4570 3569 gene locus_tag LOCUS_04020 4570 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5456 4563 gene locus_tag LOCUS_04030 5456 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6349 5456 gene locus_tag LOCUS_04040 6349 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence051 699 199 gene locus_tag LOCUS_04050 gene dctQ 699 199 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_04050 1717 692 gene locus_tag LOCUS_04060 1717 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2583 1735 gene locus_tag LOCUS_04070 2583 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3405 2815 gene locus_tag LOCUS_04080 3405 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4197 3412 gene locus_tag LOCUS_04090 4197 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04090 4282 5370 gene locus_tag LOCUS_04100 4282 5370 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_04100 5814 5359 gene locus_tag LOCUS_04110 gene soxR 5814 5359 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896846.1 protein_id gnl|my_center|LOCUS_04110 5887 6648 gene locus_tag LOCUS_04120 5887 6648 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030538.1 protein_id gnl|my_center|LOCUS_04120 6645 7181 gene locus_tag LOCUS_04130 6645 7181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence052 292 891 gene locus_tag LOCUS_04140 292 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1965 1063 gene locus_tag LOCUS_04150 gene pagO 1965 1063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_04150 4203 2203 gene locus_tag LOCUS_04160 4203 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_04160 4497 4261 gene locus_tag LOCUS_04170 4497 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5207 4638 gene locus_tag LOCUS_04180 5207 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_04180 5998 5207 gene locus_tag LOCUS_04190 gene proC 5998 5207 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_04190 6808 6107 gene locus_tag LOCUS_04200 6808 6107 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence053 1306 842 gene locus_tag LOCUS_04210 gene lspA 1306 842 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH46 protein_id gnl|my_center|LOCUS_04210 2419 1400 gene locus_tag LOCUS_04220 gene fbp 2419 1400 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LZ0 protein_id gnl|my_center|LOCUS_04220 2772 3575 gene locus_tag LOCUS_04230 gene lgt 2772 3575 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_04230 3600 4394 gene locus_tag LOCUS_04240 gene thyA 3600 4394 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR98 protein_id gnl|my_center|LOCUS_04240 4412 4903 gene locus_tag LOCUS_04250 gene folA 4412 4903 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_04250 4906 5652 gene locus_tag LOCUS_04260 gene pgl 4906 5652 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122137.1 protein_id gnl|my_center|LOCUS_04260 5655 6623 gene locus_tag LOCUS_04270 gene glk 5655 6623 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_04270 7181 6648 gene locus_tag LOCUS_04280 7181 6648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence054 2610 490 gene locus_tag LOCUS_04290 2610 490 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 protein_id gnl|my_center|LOCUS_04290 3290 2721 gene locus_tag LOCUS_04300 gene pilP 3290 2721 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_04300 3984 3361 gene locus_tag LOCUS_04310 gene pilO 3984 3361 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_04310 4571 3984 gene locus_tag LOCUS_04320 4571 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5635 4568 gene locus_tag LOCUS_04330 gene pilM 5635 4568 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence055 2879 1089 gene locus_tag LOCUS_04340 gene dnaG 2879 1089 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLI2 protein_id gnl|my_center|LOCUS_04340 3526 3110 gene locus_tag LOCUS_04350 3526 3110 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772128.1 protein_id gnl|my_center|LOCUS_04350 3822 3607 gene locus_tag LOCUS_04360 gene rpsU 3822 3607 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 protein_id gnl|my_center|LOCUS_04360 4687 3902 gene locus_tag LOCUS_04370 gene thiF 4687 3902 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_04370 5650 4700 gene locus_tag LOCUS_04380 5650 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5859 6704 gene locus_tag LOCUS_04390 5859 6704 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_04390 6710 7357 gene locus_tag LOCUS_04400 gene thiE 6710 7357 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VY6 protein_id gnl|my_center|LOCUS_04400 >Feature sequence056 1151 2275 gene locus_tag LOCUS_04410 1151 2275 CDS product multidrug resistance efflux pump-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868921.1 protein_id gnl|my_center|LOCUS_04410 2625 4241 gene locus_tag LOCUS_04420 2625 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4924 4238 gene locus_tag LOCUS_04430 4924 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04430 5911 4934 gene locus_tag LOCUS_04440 5911 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6069 7133 gene locus_tag LOCUS_04450 6069 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence057 <1 808 gene locus_tag LOCUS_04460 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118589.1:alkaline phosphatase 1302 862 gene locus_tag LOCUS_04470 1302 862 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_04470 1560 1928 gene locus_tag LOCUS_04480 1560 1928 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 protein_id gnl|my_center|LOCUS_04480 1934 2902 gene locus_tag LOCUS_04490 1934 2902 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_04490 3742 3023 gene locus_tag LOCUS_04500 gene lpxH 3742 3023 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCB8 protein_id gnl|my_center|LOCUS_04500 4351 3749 gene locus_tag LOCUS_04510 gene ppiB 4351 3749 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SS5 protein_id gnl|my_center|LOCUS_04510 4524 5912 gene locus_tag LOCUS_04520 gene cysS 4524 5912 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YQ2 protein_id gnl|my_center|LOCUS_04520 6811 5951 gene locus_tag LOCUS_04530 gene folD 6811 5951 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_04530 >Feature sequence058 442 1401 gene locus_tag LOCUS_04540 442 1401 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_04540 1516 2670 gene locus_tag LOCUS_04550 gene cca 1516 2670 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820V9 protein_id gnl|my_center|LOCUS_04550 3104 2718 gene locus_tag LOCUS_04560 3104 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3272 3925 gene locus_tag LOCUS_04570 3272 3925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_04570 5350 3929 gene locus_tag LOCUS_04580 5350 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_04580 5570 6733 gene locus_tag LOCUS_04590 5570 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_04590 <7400 6768 gene locus_tag LOCUS_04600 <7400 6768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000167314.1:ornithine--oxo-acid transaminase >Feature sequence059 <1 1383 gene locus_tag LOCUS_04610 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83F27:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1439 2521 gene locus_tag LOCUS_04620 gene mraY 1439 2521 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_04620 2526 3899 gene locus_tag LOCUS_04630 gene murD 2526 3899 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY8 protein_id gnl|my_center|LOCUS_04630 3905 5098 gene locus_tag LOCUS_04640 gene ftsW 3905 5098 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_04640 5098 6237 gene locus_tag LOCUS_04650 gene murG 5098 6237 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ7 protein_id gnl|my_center|LOCUS_04650 >Feature sequence060 5205 4018 gene locus_tag LOCUS_04660 5205 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_04660 5656 5216 gene locus_tag LOCUS_04670 5656 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971067.1 protein_id gnl|my_center|LOCUS_04670 <7371 5649 gene locus_tag LOCUS_04680 <7371 5649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119822.1:3-isopropylmalate dehydrogenase >Feature sequence061 1760 1530 gene locus_tag LOCUS_04690 1760 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2468 1938 gene locus_tag LOCUS_04700 2468 1938 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_04700 2665 3447 gene locus_tag LOCUS_04710 2665 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3478 3648 gene locus_tag LOCUS_04720 gene rubA2 3478 3648 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_04720 3664 4815 gene locus_tag LOCUS_04730 3664 4815 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_04730 5043 5387 gene locus_tag LOCUS_04740 5043 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5421 5708 gene locus_tag LOCUS_04750 5421 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 <7368 5768 gene locus_tag LOCUS_04760 <7368 5768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase >Feature sequence062 1974 670 gene locus_tag LOCUS_04770 1974 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2468 2187 gene locus_tag LOCUS_04780 2468 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4172 2703 gene locus_tag LOCUS_04790 gene crnA 4172 2703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_04790 5964 4594 gene locus_tag LOCUS_04800 5964 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6339 6608 gene locus_tag LOCUS_04810 6339 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 <7329 6619 gene locus_tag LOCUS_04820 <7329 6619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUM8:23S rRNA (guanosine-2'-O-)-methyltransferase RlmB >Feature sequence063 559 368 gene locus_tag LOCUS_04830 559 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 503 1999 gene locus_tag LOCUS_04840 503 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2010 2696 gene locus_tag LOCUS_04850 2010 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2689 5985 gene locus_tag LOCUS_04860 2689 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5957 7117 gene locus_tag LOCUS_04870 5957 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence064 271 1788 gene locus_tag LOCUS_04880 271 1788 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_04880 4158 1810 gene locus_tag LOCUS_04890 4158 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4476 6374 gene locus_tag LOCUS_04900 4476 6374 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence065 912 3863 gene locus_tag LOCUS_04910 gene glnE 912 3863 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_04910 3916 4839 gene locus_tag LOCUS_04920 gene ilvE 3916 4839 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_04920 4861 5064 gene locus_tag LOCUS_04930 4861 5064 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_04930 5795 5145 gene locus_tag LOCUS_04940 5795 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975434.1 protein_id gnl|my_center|LOCUS_04940 6964 5855 gene locus_tag LOCUS_04950 6964 5855 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence066 385 1266 gene locus_tag LOCUS_04960 gene tsf 385 1266 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_04960 1268 1996 gene locus_tag LOCUS_04970 gene pyrH 1268 1996 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_04970 2020 2577 gene locus_tag LOCUS_04980 gene frr 2020 2577 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_04980 2751 3500 gene locus_tag LOCUS_04990 gene uppS 2751 3500 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T16 protein_id gnl|my_center|LOCUS_04990 3493 4311 gene locus_tag LOCUS_05000 gene cdsA 3493 4311 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_05000 4308 5501 gene locus_tag LOCUS_05010 gene dxr 4308 5501 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_05010 5498 6847 gene locus_tag LOCUS_05020 5498 6847 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME4 protein_id gnl|my_center|LOCUS_05020 >Feature sequence067 261 10 gene locus_tag LOCUS_05030 261 10 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087106.1 protein_id gnl|my_center|LOCUS_05030 507 2096 gene locus_tag LOCUS_05040 507 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4381 2156 gene locus_tag LOCUS_05050 4381 2156 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_05050 4514 5422 gene locus_tag LOCUS_05060 4514 5422 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_05060 6633 5419 gene locus_tag LOCUS_05070 6633 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 <7219 6645 gene locus_tag LOCUS_05080 <7219 6645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035312.1:helicase >Feature sequence068 1531 1106 gene locus_tag LOCUS_05090 1531 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 1800 2396 gene locus_tag LOCUS_05100 1800 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2749 2510 gene locus_tag LOCUS_05110 2749 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3402 3046 gene locus_tag LOCUS_05120 3402 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4324 3872 gene locus_tag LOCUS_05130 4324 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4790 5209 gene locus_tag LOCUS_05140 4790 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5206 5757 gene locus_tag LOCUS_05150 5206 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_05150 6057 5770 gene locus_tag LOCUS_05160 6057 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence069 1634 4510 gene locus_tag LOCUS_05170 gene rapA 1634 4510 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT6 protein_id gnl|my_center|LOCUS_05170 4547 5365 gene locus_tag LOCUS_05180 4547 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5628 6140 gene locus_tag LOCUS_05190 5628 6140 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966791.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence070 2649 1873 gene locus_tag LOCUS_05200 2649 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5286 2833 gene locus_tag LOCUS_05210 5286 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5588 6433 gene locus_tag LOCUS_05220 5588 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence071 919 110 gene locus_tag LOCUS_05230 gene dapB 919 110 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_05230 2055 931 gene locus_tag LOCUS_05240 gene dnaJ 2055 931 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_05240 4163 2190 gene locus_tag LOCUS_05250 gene dnaK 4163 2190 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_05250 4927 4259 gene locus_tag LOCUS_05260 gene grpE 4927 4259 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN9 protein_id gnl|my_center|LOCUS_05260 6040 4997 gene locus_tag LOCUS_05270 gene hrcA 6040 4997 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_05270 6195 7067 gene locus_tag LOCUS_05280 gene nadK 6195 7067 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_05280 >Feature sequence072 <1 2004 gene locus_tag LOCUS_05290 <1 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein 2209 3012 gene locus_tag LOCUS_05300 2209 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4686 3280 gene locus_tag LOCUS_05310 4686 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_05310 4878 5087 gene locus_tag LOCUS_05320 4878 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5691 5098 gene locus_tag LOCUS_05330 5691 5098 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_05330 6308 5691 gene locus_tag LOCUS_05340 6308 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 <7076 6425 gene locus_tag LOCUS_05350 <7076 6425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113266.1:cell envelope integrity protein CreD >Feature sequence073 380 1444 gene locus_tag LOCUS_05360 gene fba 380 1444 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_05360 2530 1523 gene locus_tag LOCUS_05370 gene uge 2530 1523 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_05370 3829 2549 gene locus_tag LOCUS_05380 gene wbpO 3829 2549 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 protein_id gnl|my_center|LOCUS_05380 5219 3885 gene locus_tag LOCUS_05390 5219 3885 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence074 472 1461 gene locus_tag LOCUS_05400 gene accA 472 1461 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_05400 1608 2822 gene locus_tag LOCUS_05410 gene tilS 1608 2822 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_05410 2870 4501 gene locus_tag LOCUS_05420 gene pyrG 2870 4501 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_05420 4508 5329 gene locus_tag LOCUS_05430 gene kdsA 4508 5329 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 protein_id gnl|my_center|LOCUS_05430 5680 6963 gene locus_tag LOCUS_05440 gene eno 5680 6963 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SQ0 protein_id gnl|my_center|LOCUS_05440 >Feature sequence075 129 635 gene locus_tag LOCUS_05450 129 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1600 650 gene locus_tag LOCUS_05460 gene ispH 1600 650 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG42 protein_id gnl|my_center|LOCUS_05460 2078 1593 gene locus_tag LOCUS_05470 gene lspA 2078 1593 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_05470 4992 2122 gene locus_tag LOCUS_05480 gene ileS 4992 2122 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_05480 5985 5035 gene locus_tag LOCUS_05490 gene ribF 5985 5035 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_05490 <6935 5985 gene locus_tag LOCUS_05500 <6935 5985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87S92:putative lipid II flippase MurJ >Feature sequence076 1502 576 gene locus_tag LOCUS_05510 1502 576 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_05510 1579 1908 gene locus_tag LOCUS_05520 1579 1908 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_05520 2864 1905 gene locus_tag LOCUS_05530 2864 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3830 2877 gene locus_tag LOCUS_05540 3830 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4132 4575 gene locus_tag LOCUS_05550 4132 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_05550 4838 5407 gene locus_tag LOCUS_05560 4838 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence077 3098 2163 gene locus_tag LOCUS_05570 3098 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3535 3182 gene locus_tag LOCUS_05580 3535 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4089 3532 gene locus_tag LOCUS_05590 4089 3532 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_05590 4558 5445 gene locus_tag LOCUS_05600 4558 5445 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_05600 5539 5937 gene locus_tag LOCUS_05610 5539 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5909 6571 gene locus_tag LOCUS_05620 5909 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence078 3507 1615 gene locus_tag LOCUS_05630 3507 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_05630 4229 3531 gene locus_tag LOCUS_05640 4229 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_05640 6686 5061 gene locus_tag LOCUS_05650 6686 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence079 467 1273 gene locus_tag LOCUS_05660 467 1273 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_05660 1276 2175 gene locus_tag LOCUS_05670 gene mvaB 1276 2175 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_05670 2215 2988 gene locus_tag LOCUS_05680 2215 2988 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_05680 3021 3905 gene locus_tag LOCUS_05690 gene prpB 3021 3905 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSC2 protein_id gnl|my_center|LOCUS_05690 3902 5035 gene locus_tag LOCUS_05700 3902 5035 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUP3 protein_id gnl|my_center|LOCUS_05700 5058 6491 gene locus_tag LOCUS_05710 gene prpD 5058 6491 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence080 <6486 2762 gene locus_tag LOCUS_05720 <6486 2762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51561:DNA-directed RNA polymerase subunit beta >Feature sequence081 315 3041 gene locus_tag LOCUS_05730 315 3041 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_05730 3049 3849 gene locus_tag LOCUS_05740 3049 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887626.1 protein_id gnl|my_center|LOCUS_05740 3846 5717 gene locus_tag LOCUS_05750 3846 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973596.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence082 1256 39 gene locus_tag LOCUS_05760 gene glgC2 1256 39 CDS product glucose-1-phosphate adenylyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLP4 protein_id gnl|my_center|LOCUS_05760 2171 1455 gene locus_tag LOCUS_05770 2171 1455 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_05770 3166 2168 gene locus_tag LOCUS_05780 3166 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3984 3163 gene locus_tag LOCUS_05790 3984 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4811 3981 gene locus_tag LOCUS_05800 4811 3981 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_05800 <6413 4960 gene locus_tag LOCUS_05810 <6413 4960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112650.1:aerotaxis transducer Aer2 >Feature sequence083 <1 2075 gene locus_tag LOCUS_05820 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000759730.1:cholesterol oxidase 2106 3215 gene locus_tag LOCUS_05830 2106 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3163 4065 gene locus_tag LOCUS_05840 3163 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4046 4423 gene locus_tag LOCUS_05850 4046 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4420 5955 gene locus_tag LOCUS_05860 4420 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence084 1303 1722 gene locus_tag LOCUS_05870 1303 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 4119 1795 gene locus_tag LOCUS_05880 4119 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence085 1116 316 gene locus_tag LOCUS_05890 gene yrbF 1116 316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261187.1 protein_id gnl|my_center|LOCUS_05890 1954 1121 gene locus_tag LOCUS_05900 1954 1121 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_05900 6121 2183 gene locus_tag LOCUS_05910 6121 2183 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_05910 6371 6141 gene locus_tag LOCUS_05920 6371 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence086 456 1685 gene locus_tag LOCUS_05930 gene hflK 456 1685 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_05930 1686 2681 gene locus_tag LOCUS_05940 1686 2681 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_05940 2745 2933 gene locus_tag LOCUS_05950 2745 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2993 4207 gene locus_tag LOCUS_05960 gene hisZ 2993 4207 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_05960 4304 5596 gene locus_tag LOCUS_05970 gene purA 4304 5596 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_05970 >Feature sequence087 613 116 gene locus_tag LOCUS_05980 613 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1684 638 gene locus_tag LOCUS_05990 gene cpx 1684 638 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_05990 2241 1861 gene locus_tag LOCUS_06000 2241 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2296 2454 gene locus_tag LOCUS_06010 2296 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3848 2727 gene locus_tag LOCUS_06020 3848 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4032 4370 gene locus_tag LOCUS_06030 4032 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4497 5498 gene locus_tag LOCUS_06040 gene gapA 4497 5498 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_06040 >Feature sequence088 430 2481 gene locus_tag LOCUS_06050 430 2481 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_06050 2647 4008 gene locus_tag LOCUS_06060 2647 4008 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence089 409 1656 gene locus_tag LOCUS_06070 409 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1637 4891 gene locus_tag LOCUS_06080 1637 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5315 5019 gene locus_tag LOCUS_06090 5315 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5682 5419 gene locus_tag LOCUS_06100 5682 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence090 1084 611 gene locus_tag LOCUS_06110 gene rimI 1084 611 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q327M4 protein_id gnl|my_center|LOCUS_06110 1807 1094 gene locus_tag LOCUS_06120 1807 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3354 1816 gene locus_tag LOCUS_06130 gene leuA 3354 1816 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_06130 4383 3592 gene locus_tag LOCUS_06140 gene pssA 4383 3592 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_06140 5558 4542 gene locus_tag LOCUS_06150 gene ilvC 5558 4542 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 protein_id gnl|my_center|LOCUS_06150 6122 5628 gene locus_tag LOCUS_06160 gene ilvH 6122 5628 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence091 <1 686 gene locus_tag LOCUS_06170 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263730.1:LysR family transcriptional regulator 718 1572 gene locus_tag LOCUS_06180 718 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1656 1904 gene locus_tag LOCUS_06190 1656 1904 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_06190 1894 2181 gene locus_tag LOCUS_06200 1894 2181 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_06200 2353 2278 gene locus_tag LOCUS_t00030 2353 2278 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2521 3060 gene locus_tag LOCUS_06210 2521 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence092 2141 1503 gene locus_tag LOCUS_06220 2141 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4402 2141 gene locus_tag LOCUS_06230 4402 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence093 823 1026 gene locus_tag LOCUS_06240 823 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4679 1356 gene locus_tag LOCUS_06250 4679 1356 CDS product helicase/SNF2 family domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071804.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence094 1288 2226 gene locus_tag LOCUS_06260 1288 2226 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_06260 2241 5294 gene locus_tag LOCUS_06270 2241 5294 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_06270 5454 5753 gene locus_tag LOCUS_06280 5454 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence095 219 31 gene locus_tag LOCUS_06290 219 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 551 2578 gene locus_tag LOCUS_06300 551 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2696 3136 gene locus_tag LOCUS_06310 gene flaG 2696 3136 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_06310 3179 4927 gene locus_tag LOCUS_06320 3179 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4999 5454 gene locus_tag LOCUS_06330 gene fliS 4999 5454 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_06330 5469 5795 gene locus_tag LOCUS_06340 5469 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5904 6092 gene locus_tag LOCUS_06350 5904 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence096 441 1124 gene locus_tag LOCUS_06360 441 1124 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_06360 1276 1785 gene locus_tag LOCUS_06370 1276 1785 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232896.2 protein_id gnl|my_center|LOCUS_06370 1927 2274 gene locus_tag LOCUS_06380 1927 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2472 2912 gene locus_tag LOCUS_06390 2472 2912 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence097 247 387 gene locus_tag LOCUS_06400 247 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence098 1048 494 gene locus_tag LOCUS_06410 1048 494 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085258.1 protein_id gnl|my_center|LOCUS_06410 2159 1353 gene locus_tag LOCUS_06420 2159 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_06420 2743 2285 gene locus_tag LOCUS_06430 2743 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3360 2773 gene locus_tag LOCUS_06440 3360 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3541 3410 gene locus_tag LOCUS_06450 3541 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3796 6054 gene locus_tag LOCUS_06460 gene gidA 3796 6054 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence099 747 1085 gene locus_tag LOCUS_06470 747 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2387 1137 gene locus_tag LOCUS_06480 2387 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2655 3254 gene locus_tag LOCUS_06490 2655 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3401 4816 gene locus_tag LOCUS_06500 gene hemN 3401 4816 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884U3 protein_id gnl|my_center|LOCUS_06500 >Feature sequence100 1 411 gene locus_tag LOCUS_06510 1 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 580 1338 gene locus_tag LOCUS_06520 gene tpiA 580 1338 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_06520 1394 1837 gene locus_tag LOCUS_06530 gene secG 1394 1837 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481580.1 protein_id gnl|my_center|LOCUS_06530 1857 1941 gene locus_tag LOCUS_t00040 1857 1941 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2391 2747 gene locus_tag LOCUS_06540 gene nuoA 2391 2747 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_06540 2738 3214 gene locus_tag LOCUS_06550 gene nuoB1 2738 3214 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN6 protein_id gnl|my_center|LOCUS_06550 3262 3876 gene locus_tag LOCUS_06560 gene nuoC 3262 3876 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN7 protein_id gnl|my_center|LOCUS_06560 3869 5122 gene locus_tag LOCUS_06570 gene nuoD 3869 5122 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ8 protein_id gnl|my_center|LOCUS_06570 5122 5616 gene locus_tag LOCUS_06580 5122 5616 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence101 977 438 gene locus_tag LOCUS_06590 977 438 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_06590 1968 994 gene locus_tag LOCUS_06600 gene kdsD 1968 994 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_06600 2165 1965 gene locus_tag LOCUS_06610 2165 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3158 2178 gene locus_tag LOCUS_06620 3158 2178 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_06620 4069 3173 gene locus_tag LOCUS_06630 gene ubiA 4069 3173 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDF7 protein_id gnl|my_center|LOCUS_06630 <6033 4270 gene locus_tag LOCUS_06640 <6033 4270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEZ6:ATP-dependent DNA helicase RecG >Feature sequence102 2184 1273 gene locus_tag LOCUS_06650 gene prmA 2184 1273 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KU2 protein_id gnl|my_center|LOCUS_06650 3561 2200 gene locus_tag LOCUS_06660 3561 2200 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 protein_id gnl|my_center|LOCUS_06660 4063 3590 gene locus_tag LOCUS_06670 4063 3590 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_06670 4534 4067 gene locus_tag LOCUS_06680 gene aroQ1 4534 4067 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_06680 5268 4696 gene locus_tag LOCUS_06690 5268 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6031 5255 gene locus_tag LOCUS_06700 6031 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence103 1 1794 gene locus_tag LOCUS_06710 1 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2103 2477 gene locus_tag LOCUS_06720 gene rpsL 2103 2477 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63196 protein_id gnl|my_center|LOCUS_06720 2524 2994 gene locus_tag LOCUS_06730 gene rpsG 2524 2994 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD1 protein_id gnl|my_center|LOCUS_06730 3026 5125 gene locus_tag LOCUS_06740 gene fusA 3026 5125 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_06740 >Feature sequence104 4282 3413 gene locus_tag LOCUS_06750 gene pilK 4282 3413 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_06750 <6009 4308 gene locus_tag LOCUS_06760 <6009 4308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42257:protein PilJ >Feature sequence105 489 3158 gene locus_tag LOCUS_06770 489 3158 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947978.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence106 1578 907 gene locus_tag LOCUS_06780 gene mip 1578 907 CDS product peptidyl-prolyl cis-trans isomerase Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51752 protein_id gnl|my_center|LOCUS_06780 2764 1607 gene locus_tag LOCUS_06790 2764 1607 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_06790 3785 2772 gene locus_tag LOCUS_06800 3785 2772 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_06800 3901 4344 gene locus_tag LOCUS_06810 3901 4344 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW57 protein_id gnl|my_center|LOCUS_06810 4832 4365 gene locus_tag LOCUS_06820 4832 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence107 1033 539 gene locus_tag LOCUS_06830 1033 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3489 1033 gene locus_tag LOCUS_06840 gene leuS 3489 1033 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_06840 4522 3677 gene locus_tag LOCUS_06850 4522 3677 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_06850 <5996 4626 gene locus_tag LOCUS_06860 <5996 4626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6U6:apolipoprotein N-acyltransferase >Feature sequence108 777 1136 gene locus_tag LOCUS_06870 777 1136 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816344.1 protein_id gnl|my_center|LOCUS_06870 1150 1902 gene locus_tag LOCUS_06880 1150 1902 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_06880 1907 2605 gene locus_tag LOCUS_06890 1907 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2819 3106 gene locus_tag LOCUS_06900 2819 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_06900 4612 3116 gene locus_tag LOCUS_06910 gene putP 4612 3116 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_06910 4965 4615 gene locus_tag LOCUS_06920 4965 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5806 4997 gene locus_tag LOCUS_06930 5806 4997 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence109 794 507 gene locus_tag LOCUS_06940 794 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2240 873 gene locus_tag LOCUS_06950 gene flrC 2240 873 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 protein_id gnl|my_center|LOCUS_06950 3519 2287 gene locus_tag LOCUS_06960 gene fleS 3519 2287 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_06960 5080 3647 gene locus_tag LOCUS_06970 gene fleQ 5080 3647 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_06970 5886 5344 gene locus_tag LOCUS_06980 5886 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence110 342 1001 gene locus_tag LOCUS_06990 342 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 994 1335 gene locus_tag LOCUS_07000 994 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 protein_id gnl|my_center|LOCUS_07000 2053 1451 gene locus_tag LOCUS_07010 2053 1451 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262220.1 protein_id gnl|my_center|LOCUS_07010 2562 3977 gene locus_tag LOCUS_07020 2562 3977 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_07020 4004 5485 gene locus_tag LOCUS_07030 4004 5485 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence111 13 2856 gene locus_tag LOCUS_07040 gene sucA 13 2856 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_07040 2901 4118 gene locus_tag LOCUS_07050 gene sucB 2901 4118 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD8 protein_id gnl|my_center|LOCUS_07050 4152 5567 gene locus_tag LOCUS_07060 4152 5567 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRG6 protein_id gnl|my_center|LOCUS_07060 >Feature sequence112 <1 744 gene locus_tag LOCUS_07070 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106690.1:trichloroethylene chemotactic transducer CttP 761 1138 gene locus_tag LOCUS_07080 761 1138 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_07080 1344 2936 gene locus_tag LOCUS_07090 1344 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3495 2944 gene locus_tag LOCUS_07100 gene tsaC 3495 2944 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT5 protein_id gnl|my_center|LOCUS_07100 4811 3528 gene locus_tag LOCUS_07110 gene purD 4811 3528 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM2 protein_id gnl|my_center|LOCUS_07110 <5910 4855 gene locus_tag LOCUS_07120 <5910 4855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FPY5:bifunctional purine biosynthesis protein PurH >Feature sequence113 2641 389 gene locus_tag LOCUS_07130 gene parC 2641 389 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYZ8 protein_id gnl|my_center|LOCUS_07130 4558 2666 gene locus_tag LOCUS_07140 gene parE 4558 2666 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQT9 protein_id gnl|my_center|LOCUS_07140 5197 4562 gene locus_tag LOCUS_07150 gene rnt 5197 4562 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB8 protein_id gnl|my_center|LOCUS_07150 <5866 5204 gene locus_tag LOCUS_07160 <5866 5204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P72170:dihydroorotase >Feature sequence114 859 548 gene locus_tag LOCUS_07170 859 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1281 946 gene locus_tag LOCUS_07180 1281 946 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227701.1 protein_id gnl|my_center|LOCUS_07180 2443 1547 gene locus_tag LOCUS_07190 gene metR 2443 1547 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 protein_id gnl|my_center|LOCUS_07190 2551 4866 gene locus_tag LOCUS_07200 gene metE 2551 4866 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_07200 >Feature sequence115 1599 721 gene locus_tag LOCUS_07210 gene glyQ 1599 721 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_07210 1770 2543 gene locus_tag LOCUS_07220 1770 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_07220 3893 2547 gene locus_tag LOCUS_07230 3893 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4098 4982 gene locus_tag LOCUS_07240 4098 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence116 2530 1547 gene locus_tag LOCUS_07250 2530 1547 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_07250 3522 2530 gene locus_tag LOCUS_07260 gene pdhA 3522 2530 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AD3 protein_id gnl|my_center|LOCUS_07260 3648 5129 gene locus_tag LOCUS_07270 3648 5129 CDS product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706228.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence117 373 687 gene locus_tag LOCUS_07280 373 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 735 1331 gene locus_tag LOCUS_07290 735 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1553 3472 gene locus_tag LOCUS_07300 gene dsbD 1553 3472 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946423.1 protein_id gnl|my_center|LOCUS_07300 3586 4572 gene locus_tag LOCUS_07310 3586 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4590 5057 gene locus_tag LOCUS_07320 4590 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5154 5777 gene locus_tag LOCUS_07330 5154 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence118 1736 3001 gene locus_tag LOCUS_07340 gene hemA 1736 3001 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW8 protein_id gnl|my_center|LOCUS_07340 3018 4109 gene locus_tag LOCUS_07350 gene prfA 3018 4109 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_07350 4099 4965 gene locus_tag LOCUS_07360 gene prmC 4099 4965 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_07360 5095 5472 gene locus_tag LOCUS_07370 5095 5472 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence119 2490 1216 gene locus_tag LOCUS_07380 2490 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 4022 2559 gene locus_tag LOCUS_07390 4022 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403607.1 protein_id gnl|my_center|LOCUS_07390 4383 4811 gene locus_tag LOCUS_07400 4383 4811 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123239.1 protein_id gnl|my_center|LOCUS_07400 4804 5067 gene locus_tag LOCUS_07410 4804 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 <5775 5120 gene locus_tag LOCUS_07420 <5775 5120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000841995.1:integron integrase >Feature sequence120 <1 898 gene locus_tag LOCUS_07430 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator 911 2173 gene locus_tag LOCUS_07440 911 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2740 5193 gene locus_tag LOCUS_07450 2740 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 <5757 5210 gene locus_tag LOCUS_07460 <5757 5210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PP06:adenine phosphoribosyltransferase >Feature sequence121 865 203 gene locus_tag LOCUS_07470 865 203 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_07470 996 1145 gene locus_tag LOCUS_07480 996 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1149 2426 gene locus_tag LOCUS_07490 gene lysA 1149 2426 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_07490 2404 3063 gene locus_tag LOCUS_07500 gene smtA 2404 3063 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_07500 3261 4190 gene locus_tag LOCUS_07510 3261 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4647 4180 gene locus_tag LOCUS_07520 gene trmL 4647 4180 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ6 protein_id gnl|my_center|LOCUS_07520 >Feature sequence122 1983 886 gene locus_tag LOCUS_07530 1983 886 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947985.1 protein_id gnl|my_center|LOCUS_07530 2387 2902 gene locus_tag LOCUS_07540 2387 2902 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_07540 2915 4057 gene locus_tag LOCUS_07550 2915 4057 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_07550 4096 5289 gene locus_tag LOCUS_07560 gene atoB 4096 5289 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence123 131 2293 gene locus_tag LOCUS_07570 131 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2310 2855 gene locus_tag LOCUS_07580 gene orn 2310 2855 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_07580 3897 2845 gene locus_tag LOCUS_07590 gene queG 3897 2845 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_07590 4281 5453 gene locus_tag LOCUS_07600 4281 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence124 1073 36 gene locus_tag LOCUS_07610 1073 36 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383683.1 protein_id gnl|my_center|LOCUS_07610 1587 1162 gene locus_tag LOCUS_07620 1587 1162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_07620 1719 2603 gene locus_tag LOCUS_07630 1719 2603 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 protein_id gnl|my_center|LOCUS_07630 4196 2961 gene locus_tag LOCUS_07640 4196 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence125 465 1775 gene locus_tag LOCUS_07650 gene pepP 465 1775 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_07650 1793 3016 gene locus_tag LOCUS_07660 gene ubiH 1793 3016 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_07660 3036 4232 gene locus_tag LOCUS_07670 gene visC 3036 4232 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192227.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence126 <1 2506 gene locus_tag LOCUS_07680 <1 2506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein 4303 2519 gene locus_tag LOCUS_07690 gene deaD-1 4303 2519 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_07690 5623 4463 gene locus_tag LOCUS_07700 5623 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence127 1039 44 gene locus_tag LOCUS_07710 1039 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2877 1387 gene locus_tag LOCUS_07720 2877 1387 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_07720 3674 2874 gene locus_tag LOCUS_07730 gene ygdL 3674 2874 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 protein_id gnl|my_center|LOCUS_07730 4848 4063 gene locus_tag LOCUS_07740 4848 4063 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence128 3199 62 gene locus_tag LOCUS_07750 3199 62 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_07750 4289 3204 gene locus_tag LOCUS_07760 4289 3204 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_07760 4477 4839 gene locus_tag LOCUS_07770 4477 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence129 1801 116 gene locus_tag LOCUS_07780 gene rpsA 1801 116 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_07780 2726 2028 gene locus_tag LOCUS_07790 gene cmk 2726 2028 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_07790 3966 2737 gene locus_tag LOCUS_07800 3966 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5091 4204 gene locus_tag LOCUS_07810 5091 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 <5591 5088 gene locus_tag LOCUS_07820 <5591 5088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZ67:P-protein >Feature sequence130 222 1010 gene locus_tag LOCUS_07830 222 1010 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_07830 1007 2407 gene locus_tag LOCUS_07840 1007 2407 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_07840 2409 2942 gene locus_tag LOCUS_07850 2409 2942 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_07850 2939 3337 gene locus_tag LOCUS_07860 2939 3337 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_07860 3348 4013 gene locus_tag LOCUS_07870 gene tonB2 3348 4013 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_07870 4015 5214 gene locus_tag LOCUS_07880 4015 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence131 112 1023 gene locus_tag LOCUS_07890 gene argF 112 1023 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_07890 1164 4940 gene locus_tag LOCUS_07900 1164 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence132 <1 529 gene locus_tag LOCUS_07910 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455118.1:ABC transporter permease 545 1012 gene locus_tag LOCUS_07920 545 1012 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_07920 1012 2376 gene locus_tag LOCUS_07930 1012 2376 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_07930 2373 2972 gene locus_tag LOCUS_07940 2373 2972 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_07940 2992 3267 gene locus_tag LOCUS_07950 2992 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3359 3598 gene locus_tag LOCUS_07960 3359 3598 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_07960 3599 4858 gene locus_tag LOCUS_07970 gene murA 3599 4858 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_07970 >Feature sequence133 171 974 gene locus_tag LOCUS_07980 171 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1179 1793 gene locus_tag LOCUS_07990 1179 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1798 2067 gene locus_tag LOCUS_08000 1798 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3091 2105 gene locus_tag LOCUS_08010 3091 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3533 3108 gene locus_tag LOCUS_08020 3533 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3867 3526 gene locus_tag LOCUS_08030 3867 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4262 4840 gene locus_tag LOCUS_08040 4262 4840 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038039.1 protein_id gnl|my_center|LOCUS_08040 4833 5315 gene locus_tag LOCUS_08050 4833 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence134 844 323 gene locus_tag LOCUS_08060 844 323 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_08060 1641 856 gene locus_tag LOCUS_08070 1641 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2674 1616 gene locus_tag LOCUS_08080 2674 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3016 3975 gene locus_tag LOCUS_08090 gene rluD 3016 3975 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU17 protein_id gnl|my_center|LOCUS_08090 3972 4703 gene locus_tag LOCUS_08100 3972 4703 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EK85 protein_id gnl|my_center|LOCUS_08100 4719 5345 gene locus_tag LOCUS_08110 4719 5345 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence135 <1 991 gene locus_tag LOCUS_08120 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537977.1:type II/IV secretion system-related protein 988 1953 gene locus_tag LOCUS_08130 988 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_08130 1946 2926 gene locus_tag LOCUS_08140 1946 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_08140 2926 4038 gene locus_tag LOCUS_08150 2926 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4371 4865 gene locus_tag LOCUS_08160 4371 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719475.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence136 3159 2677 gene locus_tag LOCUS_08170 3159 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3432 3857 gene locus_tag LOCUS_08180 gene fkpA 3432 3857 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z0 protein_id gnl|my_center|LOCUS_08180 4129 3854 gene locus_tag LOCUS_08190 4129 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <5369 4310 gene locus_tag LOCUS_08200 <5369 4310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682335.1:TRAP transporter subunit DctM >Feature sequence137 1186 707 gene locus_tag LOCUS_08210 1186 707 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_08210 2670 1183 gene locus_tag LOCUS_08220 2670 1183 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_08220 3143 2673 gene locus_tag LOCUS_08230 3143 2673 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_08230 3202 3621 gene locus_tag LOCUS_08240 3202 3621 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_08240 3797 3618 gene locus_tag LOCUS_08250 3797 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3865 4377 gene locus_tag LOCUS_08260 3865 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4389 5261 gene locus_tag LOCUS_08270 4389 5261 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887886.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence138 748 50 gene locus_tag LOCUS_08280 748 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1012 1671 gene locus_tag LOCUS_08290 1012 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1742 1939 gene locus_tag LOCUS_08300 1742 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2306 2632 gene locus_tag LOCUS_08310 2306 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3315 2629 gene locus_tag LOCUS_08320 gene mtnC 3315 2629 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP11 protein_id gnl|my_center|LOCUS_08320 3872 3312 gene locus_tag LOCUS_08330 gene mtnD 3872 3312 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 protein_id gnl|my_center|LOCUS_08330 4495 3875 gene locus_tag LOCUS_08340 gene mtnB 4495 3875 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 protein_id gnl|my_center|LOCUS_08340 4840 4499 gene locus_tag LOCUS_08350 4840 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence139 66 935 gene locus_tag LOCUS_08360 66 935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013300.1 protein_id gnl|my_center|LOCUS_08360 1008 1442 gene locus_tag LOCUS_08370 1008 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1704 3869 gene locus_tag LOCUS_08380 gene glgB 1704 3869 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 protein_id gnl|my_center|LOCUS_08380 5049 3928 gene locus_tag LOCUS_08390 5049 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence140 189 1052 gene locus_tag LOCUS_08400 189 1052 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764420.1 protein_id gnl|my_center|LOCUS_08400 3194 1113 gene locus_tag LOCUS_08410 gene fusA2 3194 1113 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_08410 1566 1479 gene locus_tag LOCUS_t00050 1566 1479 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3547 3744 gene locus_tag LOCUS_08420 3547 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3686 4681 gene locus_tag LOCUS_08430 3686 4681 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence141 <1 876 gene locus_tag LOCUS_08440 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056430.1:sucrose-phosphate synthase 886 1590 gene locus_tag LOCUS_08450 886 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08450 1597 3285 gene locus_tag LOCUS_08460 1597 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08460 >Feature sequence142 312 2291 gene locus_tag LOCUS_08470 312 2291 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_08470 2295 3215 gene locus_tag LOCUS_08480 2295 3215 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704360.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence143 4948 5121 gene locus_tag LOCUS_08490 4948 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence144 855 1994 gene locus_tag LOCUS_08500 855 1994 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947238.1 protein_id gnl|my_center|LOCUS_08500 1987 2856 gene locus_tag LOCUS_08510 1987 2856 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064726.1 protein_id gnl|my_center|LOCUS_08510 2902 3171 gene locus_tag LOCUS_08520 2902 3171 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHQ3 protein_id gnl|my_center|LOCUS_08520 3177 3818 gene locus_tag LOCUS_08530 gene lipB 3177 3818 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RR0 protein_id gnl|my_center|LOCUS_08530 4108 4770 gene locus_tag LOCUS_08540 4108 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08540 4853 5074 gene locus_tag LOCUS_08550 4853 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895203.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence145 <1 1278 gene locus_tag LOCUS_08560 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase 3130 1409 gene locus_tag LOCUS_08570 3130 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4213 3260 gene locus_tag LOCUS_08580 4213 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 <5223 4321 gene locus_tag LOCUS_08590 <5223 4321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814901.1:exported protein >Feature sequence146 1811 717 gene locus_tag LOCUS_08600 1811 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_08600 2741 1815 gene locus_tag LOCUS_08610 2741 1815 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_08610 3024 2722 gene locus_tag LOCUS_08620 3024 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3574 3065 gene locus_tag LOCUS_08630 3574 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence147 429 782 gene locus_tag LOCUS_08640 429 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1560 982 gene locus_tag LOCUS_08650 1560 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4480 1835 gene locus_tag LOCUS_08660 4480 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence148 <1 546 gene locus_tag LOCUS_08670 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194444.1:glutathione S-transferase 550 873 gene locus_tag LOCUS_08680 550 873 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227522.1 protein_id gnl|my_center|LOCUS_08680 975 1130 gene locus_tag LOCUS_08690 975 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1457 2167 gene locus_tag LOCUS_08700 1457 2167 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987012.1 protein_id gnl|my_center|LOCUS_08700 2565 2164 gene locus_tag LOCUS_08710 2565 2164 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_08710 2552 2722 gene locus_tag LOCUS_08720 2552 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2883 3524 gene locus_tag LOCUS_08730 2883 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3531 4184 gene locus_tag LOCUS_08740 3531 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 protein_id gnl|my_center|LOCUS_08740 4186 4686 gene locus_tag LOCUS_08750 4186 4686 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence149 424 1086 gene locus_tag LOCUS_08760 424 1086 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_08760 1334 2416 gene locus_tag LOCUS_08770 gene intD 1334 2416 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_08770 2559 2484 gene locus_tag LOCUS_t00060 2559 2484 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2745 3698 gene locus_tag LOCUS_08780 2745 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4067 3768 gene locus_tag LOCUS_08790 4067 3768 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU80 protein_id gnl|my_center|LOCUS_08790 <5124 4083 gene locus_tag LOCUS_08800 <5124 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098673.1:A/G-specific adenine glycosylase >Feature sequence150 603 1574 gene locus_tag LOCUS_08810 603 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544197.1 protein_id gnl|my_center|LOCUS_08810 1731 1546 gene locus_tag LOCUS_08820 1731 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2253 1843 gene locus_tag LOCUS_08830 2253 1843 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUF6 protein_id gnl|my_center|LOCUS_08830 3050 2250 gene locus_tag LOCUS_08840 3050 2250 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_08840 3831 3241 gene locus_tag LOCUS_08850 gene dsbA 3831 3241 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y08 protein_id gnl|my_center|LOCUS_08850 3830 3997 gene locus_tag LOCUS_08860 3830 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4175 4807 gene locus_tag LOCUS_08870 gene engB 4175 4807 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7K9 protein_id gnl|my_center|LOCUS_08870 >Feature sequence151 456 1643 gene locus_tag LOCUS_08880 gene aspC 456 1643 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_08880 1821 2339 gene locus_tag LOCUS_08890 1821 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3477 2626 gene locus_tag LOCUS_08900 3477 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5010 3667 gene locus_tag LOCUS_08910 5010 3667 CDS product RmuC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence152 202 3384 gene locus_tag LOCUS_08920 202 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3705 4283 gene locus_tag LOCUS_08930 3705 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_08930 4283 4588 gene locus_tag LOCUS_08940 4283 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence153 2 244 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaataccttcttcataaggcaaccactcaaac 1433 429 gene locus_tag LOCUS_08950 1433 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2304 1453 gene locus_tag LOCUS_08960 2304 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2695 2294 gene locus_tag LOCUS_08970 2695 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3693 2692 gene locus_tag LOCUS_08980 3693 2692 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_08980 4910 3690 gene locus_tag LOCUS_08990 4910 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5104 4910 gene locus_tag LOCUS_09000 5104 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence154 922 440 gene locus_tag LOCUS_09010 922 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1186 1842 gene locus_tag LOCUS_09020 1186 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1890 2546 gene locus_tag LOCUS_09030 1890 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2939 3721 gene locus_tag LOCUS_09040 2939 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence155 226 1089 gene locus_tag LOCUS_09050 226 1089 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_09050 1115 2695 gene locus_tag LOCUS_09060 1115 2695 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_09060 4126 2765 gene locus_tag LOCUS_09070 gene bioA 4126 2765 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ98 protein_id gnl|my_center|LOCUS_09070 >Feature sequence156 <1 1329 gene locus_tag LOCUS_09080 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449670.1:TonB-dependent receptor 1350 2165 gene locus_tag LOCUS_09090 1350 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2146 2967 gene locus_tag LOCUS_09100 2146 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3124 4788 gene locus_tag LOCUS_09110 3124 4788 CDS product 4-cresol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence157 229 137 gene locus_tag LOCUS_t00070 229 137 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 582 367 gene locus_tag LOCUS_09120 582 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2061 829 gene locus_tag LOCUS_09130 2061 829 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_09130 2609 2328 gene locus_tag LOCUS_09140 2609 2328 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245515.1 protein_id gnl|my_center|LOCUS_09140 4438 2624 gene locus_tag LOCUS_09150 gene recQ 4438 2624 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_09150 <5044 4458 gene locus_tag LOCUS_09160 <5044 4458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63TF9:alanine--tRNA ligase >Feature sequence158 437 1819 gene locus_tag LOCUS_09170 gene mltF 437 1819 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74SQ6 protein_id gnl|my_center|LOCUS_09170 3005 1893 gene locus_tag LOCUS_09180 gene cheB-1 3005 1893 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH22 protein_id gnl|my_center|LOCUS_09180 3870 3010 gene locus_tag LOCUS_09190 3870 3010 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD1 protein_id gnl|my_center|LOCUS_09190 4417 3857 gene locus_tag LOCUS_09200 gene cheW-1 4417 3857 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704963.1 protein_id gnl|my_center|LOCUS_09200 <5031 4457 gene locus_tag LOCUS_09210 <5031 4457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000488898.1:methyl-accepting chemotaxis protein >Feature sequence159 98 1711 gene locus_tag LOCUS_09220 98 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2346 1732 gene locus_tag LOCUS_09230 2346 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_09230 2530 2363 gene locus_tag LOCUS_09240 2530 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2968 3579 gene locus_tag LOCUS_09250 2968 3579 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_09250 3746 4489 gene locus_tag LOCUS_09260 3746 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 >Feature sequence160 681 73 gene locus_tag LOCUS_09270 681 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1039 671 gene locus_tag LOCUS_09280 1039 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52996 protein_id gnl|my_center|LOCUS_09280 1180 2460 gene locus_tag LOCUS_09290 1180 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2877 2677 gene locus_tag LOCUS_09300 2877 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_09300 3229 2891 gene locus_tag LOCUS_09310 gene fdx 3229 2891 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_09310 <4993 3239 gene locus_tag LOCUS_09320 <4993 3239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87S24:chaperone protein HscA >Feature sequence161 1220 660 gene locus_tag LOCUS_09330 1220 660 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_09330 2074 1550 gene locus_tag LOCUS_09340 2074 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2159 3154 gene locus_tag LOCUS_09350 2159 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3260 3628 gene locus_tag LOCUS_09360 3260 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3930 4757 gene locus_tag LOCUS_09370 3930 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence162 983 2581 gene locus_tag LOCUS_09380 983 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2796 3293 gene locus_tag LOCUS_09390 gene greB 2796 3293 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_09390 3483 4211 gene locus_tag LOCUS_09400 gene rstA 3483 4211 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence163 1061 261 gene locus_tag LOCUS_09410 gene hemD 1061 261 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_09410 2108 1179 gene locus_tag LOCUS_09420 gene hemC 2108 1179 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PH4 protein_id gnl|my_center|LOCUS_09420 2338 2682 gene locus_tag LOCUS_09430 gene nirM 2338 2682 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 protein_id gnl|my_center|LOCUS_09430 2786 3466 gene locus_tag LOCUS_09440 gene phoP 2786 3466 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_09440 3463 4821 gene locus_tag LOCUS_09450 gene phoQ 3463 4821 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence164 2194 215 gene locus_tag LOCUS_09460 2194 215 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_09460 2408 3205 gene locus_tag LOCUS_09470 gene cysE 2408 3205 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_09470 3269 3790 gene locus_tag LOCUS_09480 gene iscR 3269 3790 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIJ8 protein_id gnl|my_center|LOCUS_09480 3889 4212 gene locus_tag LOCUS_09490 gene iscA 3889 4212 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQB4 protein_id gnl|my_center|LOCUS_09490 4245 4772 gene locus_tag LOCUS_09500 gene hscB 4245 4772 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU6 protein_id gnl|my_center|LOCUS_09500 >Feature sequence165 978 259 gene locus_tag LOCUS_09510 978 259 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_09510 1671 1096 gene locus_tag LOCUS_09520 1671 1096 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_09520 2522 1695 gene locus_tag LOCUS_09530 2522 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2601 3509 gene locus_tag LOCUS_09540 2601 3509 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_09540 3936 3541 gene locus_tag LOCUS_09550 3936 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4422 4123 gene locus_tag LOCUS_09560 4422 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence166 544 269 gene locus_tag LOCUS_09570 544 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 856 1152 gene locus_tag LOCUS_09580 856 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1330 2565 gene locus_tag LOCUS_09590 1330 2565 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_09590 2578 3486 gene locus_tag LOCUS_09600 gene znuA 2578 3486 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_09600 3483 4262 gene locus_tag LOCUS_09610 gene znuB 3483 4262 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence167 1324 620 gene locus_tag LOCUS_09620 gene nrdJb 1324 620 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_09620 3521 1371 gene locus_tag LOCUS_09630 gene nrdJa 3521 1371 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence168 789 34 gene locus_tag LOCUS_09640 789 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_09640 1404 793 gene locus_tag LOCUS_09650 gene purN 1404 793 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLA1 protein_id gnl|my_center|LOCUS_09650 2488 1460 gene locus_tag LOCUS_09660 gene purM 2488 1460 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPY6 protein_id gnl|my_center|LOCUS_09660 2699 3799 gene locus_tag LOCUS_09670 2699 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3796 4359 gene locus_tag LOCUS_09680 3796 4359 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence169 <4842 1269 gene locus_tag LOCUS_09690 <4842 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103872.1:non-ribosomal peptide synthetase >Feature sequence170 <4835 144 gene locus_tag LOCUS_09700 <4835 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749I5:UvrABC system protein A >Feature sequence171 850 1953 gene locus_tag LOCUS_09710 850 1953 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948172.1 protein_id gnl|my_center|LOCUS_09710 1950 2774 gene locus_tag LOCUS_09720 gene hydG-2 1950 2774 CDS product Ni/Fe hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_09720 2777 3520 gene locus_tag LOCUS_09730 2777 3520 CDS product sulfhydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948170.1 protein_id gnl|my_center|LOCUS_09730 3513 4808 gene locus_tag LOCUS_09740 gene hydA 3513 4808 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948169.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence172 1771 1139 gene locus_tag LOCUS_09750 1771 1139 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227673.1 protein_id gnl|my_center|LOCUS_09750 2821 1790 gene locus_tag LOCUS_09760 2821 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3640 2852 gene locus_tag LOCUS_09770 gene cbiQ 3640 2852 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_09770 4299 3682 gene locus_tag LOCUS_09780 4299 3682 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence173 1349 129 gene locus_tag LOCUS_09790 gene glcF 1349 129 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPG0 protein_id gnl|my_center|LOCUS_09790 2440 1361 gene locus_tag LOCUS_09800 gene glcE 2440 1361 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_09800 3913 2444 gene locus_tag LOCUS_09810 3913 2444 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_09810 4087 4440 gene locus_tag LOCUS_09820 4087 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence174 <1 1557 gene locus_tag LOCUS_09830 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815768.1:NAD+ synthase 1692 2030 gene locus_tag LOCUS_09840 1692 2030 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106041.1 protein_id gnl|my_center|LOCUS_09840 2374 3450 gene locus_tag LOCUS_09850 2374 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4314 3643 gene locus_tag LOCUS_09860 4314 3643 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDE8 protein_id gnl|my_center|LOCUS_09860 4734 4342 gene locus_tag LOCUS_09870 4734 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence175 1667 582 gene locus_tag LOCUS_09880 1667 582 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_09880 1749 2321 gene locus_tag LOCUS_09890 gene efp 1749 2321 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_09890 2378 3337 gene locus_tag LOCUS_09900 gene epmA 2378 3337 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_09900 3348 4445 gene locus_tag LOCUS_09910 gene tgt 3348 4445 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D2 protein_id gnl|my_center|LOCUS_09910 >Feature sequence176 7 1536 gene locus_tag LOCUS_09920 7 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence177 564 1355 gene locus_tag LOCUS_09930 564 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1415 1984 gene locus_tag LOCUS_09940 1415 1984 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXA8 protein_id gnl|my_center|LOCUS_09940 1990 2268 gene locus_tag LOCUS_09950 1990 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2304 3266 gene locus_tag LOCUS_09960 2304 3266 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_09960 3300 4433 gene locus_tag LOCUS_09970 3300 4433 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence178 373 1485 gene locus_tag LOCUS_09980 gene hemH1 373 1485 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_09980 1517 2509 gene locus_tag LOCUS_09990 1517 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2539 3231 gene locus_tag LOCUS_10000 gene ftsE 2539 3231 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_10000 3194 4144 gene locus_tag LOCUS_10010 gene ftsX 3194 4144 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_10010 4373 4690 gene locus_tag LOCUS_10020 4373 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence179 1115 1882 gene locus_tag LOCUS_10030 gene map 1115 1882 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_10030 1879 4569 gene locus_tag LOCUS_10040 gene glnD 1879 4569 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_10040 >Feature sequence180 282 2858 gene locus_tag LOCUS_10050 282 2858 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_10050 2858 3877 gene locus_tag LOCUS_10060 2858 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3877 4734 gene locus_tag LOCUS_10070 3877 4734 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941366.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence181 1039 173 gene locus_tag LOCUS_10080 1039 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 protein_id gnl|my_center|LOCUS_10080 1217 1969 gene locus_tag LOCUS_10090 gene rph 1217 1969 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8P0 protein_id gnl|my_center|LOCUS_10090 1966 2568 gene locus_tag LOCUS_10100 1966 2568 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ9 protein_id gnl|my_center|LOCUS_10100 2835 3611 gene locus_tag LOCUS_10110 2835 3611 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362406.1 protein_id gnl|my_center|LOCUS_10110 3636 4691 gene locus_tag LOCUS_10120 gene motB 3636 4691 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence182 755 1609 gene locus_tag LOCUS_10130 gene aroE 755 1609 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B50 protein_id gnl|my_center|LOCUS_10130 1651 1818 gene locus_tag LOCUS_10140 1651 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1903 2553 gene locus_tag LOCUS_10150 1903 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2565 3056 gene locus_tag LOCUS_10160 2565 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483350.1 protein_id gnl|my_center|LOCUS_10160 3514 3203 gene locus_tag LOCUS_10170 3514 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4023 3526 gene locus_tag LOCUS_10180 4023 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence183 301 1284 gene locus_tag LOCUS_10190 301 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1535 1281 gene locus_tag LOCUS_10200 1535 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1787 1536 gene locus_tag LOCUS_10210 1787 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2173 1865 gene locus_tag LOCUS_10220 2173 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3066 2191 gene locus_tag LOCUS_10230 3066 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3152 4441 gene locus_tag LOCUS_10240 3152 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence184 244 594 gene locus_tag LOCUS_10250 244 594 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR89 protein_id gnl|my_center|LOCUS_10250 591 1973 gene locus_tag LOCUS_10260 gene dld 591 1973 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_10260 2394 1978 gene locus_tag LOCUS_10270 gene sspB 2394 1978 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_10270 3042 2407 gene locus_tag LOCUS_10280 gene sspA 3042 2407 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_10280 3965 3222 gene locus_tag LOCUS_10290 gene djlA 3965 3222 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_10290 4560 4213 gene locus_tag LOCUS_10300 4560 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence185 450 172 gene locus_tag LOCUS_10310 gene acyP 450 172 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I504 protein_id gnl|my_center|LOCUS_10310 566 1960 gene locus_tag LOCUS_10320 566 1960 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257327.1 protein_id gnl|my_center|LOCUS_10320 2547 1999 gene locus_tag LOCUS_10330 2547 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2814 3407 gene locus_tag LOCUS_10340 2814 3407 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_10340 4129 3401 gene locus_tag LOCUS_10350 4129 3401 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948489.1 protein_id gnl|my_center|LOCUS_10350 4705 4145 gene locus_tag LOCUS_10360 4705 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10360 >Feature sequence186 111 860 gene locus_tag LOCUS_10370 111 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1598 1188 gene locus_tag LOCUS_10380 gene fkpA 1598 1188 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z0 protein_id gnl|my_center|LOCUS_10380 2250 3485 gene locus_tag LOCUS_10390 2250 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence187 2029 623 gene locus_tag LOCUS_10400 gene gltD 2029 623 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 protein_id gnl|my_center|LOCUS_10400 <4676 2061 gene locus_tag LOCUS_10410 <4676 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence188 2676 421 gene locus_tag LOCUS_10420 2676 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2955 2818 gene locus_tag LOCUS_10430 2955 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3006 3656 gene locus_tag LOCUS_10440 3006 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <4670 3745 gene locus_tag LOCUS_10450 <4670 3745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100959.1:twitching motility protein PilU >Feature sequence189 725 309 gene locus_tag LOCUS_10460 725 309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888099.1 protein_id gnl|my_center|LOCUS_10460 811 1236 gene locus_tag LOCUS_10470 811 1236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_10470 1250 3475 gene locus_tag LOCUS_10480 gene priA 1250 3475 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V04 protein_id gnl|my_center|LOCUS_10480 3586 4035 gene locus_tag LOCUS_10490 3586 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence190 1 141 gene locus_tag LOCUS_10500 1 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 178 1083 gene locus_tag LOCUS_10510 gene cysM 178 1083 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_10510 1088 1861 gene locus_tag LOCUS_10520 1088 1861 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_10520 1935 3284 gene locus_tag LOCUS_10530 gene rlmD 1935 3284 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_10530 4518 3253 gene locus_tag LOCUS_10540 gene tet 4518 3253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242239.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence191 3826 2426 gene locus_tag LOCUS_10550 gene traH 3826 2426 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947793.1 protein_id gnl|my_center|LOCUS_10550 <4607 3828 gene locus_tag LOCUS_10560 <4607 3828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001310006.1:conjugal transfer protein TraF >Feature sequence192 420 1061 gene locus_tag LOCUS_10570 gene pyrE 420 1061 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L5 protein_id gnl|my_center|LOCUS_10570 3018 1123 gene locus_tag LOCUS_10580 3018 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence193 420 154 gene locus_tag LOCUS_10590 420 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 <4585 562 gene locus_tag LOCUS_10600 <4585 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262166.1:chitinase >Feature sequence194 366 1067 gene locus_tag LOCUS_10610 366 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1361 2974 gene locus_tag LOCUS_10620 1361 2974 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_10620 4566 2998 gene locus_tag LOCUS_10630 4566 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence195 2134 893 gene locus_tag LOCUS_10640 2134 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2999 2157 gene locus_tag LOCUS_10650 2999 2157 CDS product UMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 protein_id gnl|my_center|LOCUS_10650 <4571 3015 gene locus_tag LOCUS_10660 <4571 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938897.1:potassium transporter TrkA >Feature sequence196 1316 339 gene locus_tag LOCUS_10670 1316 339 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947988.1 protein_id gnl|my_center|LOCUS_10670 2440 1313 gene locus_tag LOCUS_10680 gene hmgA 2440 1313 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_10680 3492 2440 gene locus_tag LOCUS_10690 gene hppD 3492 2440 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_10690 <4560 3687 gene locus_tag LOCUS_10700 <4560 3687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037978.1:L-serine dehydratase >Feature sequence197 127 936 gene locus_tag LOCUS_10710 gene dapF 127 936 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ4 protein_id gnl|my_center|LOCUS_10710 933 1664 gene locus_tag LOCUS_10720 933 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_10720 1670 2572 gene locus_tag LOCUS_10730 gene xerC 1670 2572 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8D1K0 protein_id gnl|my_center|LOCUS_10730 >Feature sequence198 <1 1245 gene locus_tag LOCUS_10740 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405078.1:ATPase AAA 1657 2040 gene locus_tag LOCUS_10750 gene crcB 1657 2040 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_10750 2055 3329 gene locus_tag LOCUS_10760 gene serS 2055 3329 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_10760 >Feature sequence199 <1 694 gene locus_tag LOCUS_10770 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q45885:co-chaperone protein DjlA 1370 789 gene locus_tag LOCUS_10780 1370 789 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_10780 1717 3852 gene locus_tag LOCUS_10790 gene prc 1717 3852 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_10790 <4537 3932 gene locus_tag LOCUS_10800 <4537 3932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74B17:histidine kinase >Feature sequence200 4066 2201 gene locus_tag LOCUS_10810 gene mutL 4066 2201 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_10810 >Feature sequence201 1205 102 gene locus_tag LOCUS_10820 gene moaA 1205 102 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59038 protein_id gnl|my_center|LOCUS_10820 1812 1480 gene locus_tag LOCUS_10830 gene nirM 1812 1480 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 protein_id gnl|my_center|LOCUS_10830 2248 2574 gene locus_tag LOCUS_10840 gene trxA 2248 2574 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_10840 2797 4053 gene locus_tag LOCUS_10850 gene rho 2797 4053 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_10850 4139 4399 gene locus_tag LOCUS_10860 gene rpsT 4139 4399 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E8 protein_id gnl|my_center|LOCUS_10860 >Feature sequence202 946 215 gene locus_tag LOCUS_10870 946 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_10870 1189 1668 gene locus_tag LOCUS_10880 gene rppH 1189 1668 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLV2 protein_id gnl|my_center|LOCUS_10880 1701 3965 gene locus_tag LOCUS_10890 gene ptsP 1701 3965 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence203 2057 1581 gene locus_tag LOCUS_10900 2057 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10900 2642 2448 gene locus_tag LOCUS_10910 2642 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4143 3142 gene locus_tag LOCUS_10920 4143 3142 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533010.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence204 <1 537 gene locus_tag LOCUS_10930 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LK2:ribosomal RNA small subunit methyltransferase E 998 534 gene locus_tag LOCUS_10940 998 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2181 1015 gene locus_tag LOCUS_10950 gene chpB 2181 1015 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_10950 <4497 2174 gene locus_tag LOCUS_10960 <4497 2174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266435.1:sensor histidine kinase >Feature sequence205 1587 73 gene locus_tag LOCUS_10970 1587 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2526 1648 gene locus_tag LOCUS_10980 2526 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3085 2549 gene locus_tag LOCUS_10990 gene dsbB 3085 2549 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_10990 3270 3590 gene locus_tag LOCUS_11000 3270 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3814 3650 gene locus_tag LOCUS_11010 3814 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence206 >Feature sequence207 1912 1325 gene locus_tag LOCUS_11020 1912 1325 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_11020 2308 1916 gene locus_tag LOCUS_11030 gene rlmH 2308 1916 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_11030 2547 4319 gene locus_tag LOCUS_11040 2547 4319 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence208 <1 780 gene locus_tag LOCUS_11050 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYP6:flagella basal body P-ring formation protein FlgA 893 1216 gene locus_tag LOCUS_11060 893 1216 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907265.1 protein_id gnl|my_center|LOCUS_11060 1286 1774 gene locus_tag LOCUS_11070 1286 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2189 2935 gene locus_tag LOCUS_11080 2189 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3246 3848 gene locus_tag LOCUS_11090 3246 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4037 4113 gene locus_tag LOCUS_t00080 4037 4113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 3382 14 gene locus_tag LOCUS_11100 3382 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence210 343 546 gene locus_tag LOCUS_11110 343 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 659 2632 gene locus_tag LOCUS_11120 659 2632 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405431.1 protein_id gnl|my_center|LOCUS_11120 2860 4038 gene locus_tag LOCUS_11130 2860 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence211 209 1555 gene locus_tag LOCUS_11140 gene pcnB 209 1555 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T2 protein_id gnl|my_center|LOCUS_11140 1556 2056 gene locus_tag LOCUS_11150 gene folK 1556 2056 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV71 protein_id gnl|my_center|LOCUS_11150 2069 2875 gene locus_tag LOCUS_11160 gene panB 2069 2875 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T0 protein_id gnl|my_center|LOCUS_11160 2876 3724 gene locus_tag LOCUS_11170 gene panC 2876 3724 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_11170 >Feature sequence212 1058 27 gene locus_tag LOCUS_11180 gene adh1 1058 27 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_11180 1198 2103 gene locus_tag LOCUS_11190 1198 2103 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263873.1 protein_id gnl|my_center|LOCUS_11190 2836 2447 gene locus_tag LOCUS_11200 gene mraZ 2836 2447 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45056 protein_id gnl|my_center|LOCUS_11200 3763 2849 gene locus_tag LOCUS_11210 3763 2849 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_11210 <4420 3878 gene locus_tag LOCUS_11220 <4420 3878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118364.1:Na(+)/H(+) antiporter subunit D >Feature sequence213 793 996 gene locus_tag LOCUS_11230 793 996 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 protein_id gnl|my_center|LOCUS_11230 1096 1356 gene locus_tag LOCUS_11240 1096 1356 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_11240 3022 2429 gene locus_tag LOCUS_11250 3022 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3267 3130 gene locus_tag LOCUS_11260 3267 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3454 3260 gene locus_tag LOCUS_11270 3454 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3617 4114 gene locus_tag LOCUS_11280 3617 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346868.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence214 1330 485 gene locus_tag LOCUS_11290 1330 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1461 2174 gene locus_tag LOCUS_11300 1461 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2261 3439 gene locus_tag LOCUS_11310 gene agxT 2261 3439 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_11310 4180 3629 gene locus_tag LOCUS_11320 4180 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence215 1103 501 gene locus_tag LOCUS_11330 1103 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3300 1447 gene locus_tag LOCUS_11340 3300 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143577.1 protein_id gnl|my_center|LOCUS_11340 3834 3442 gene locus_tag LOCUS_11350 3834 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4005 4199 gene locus_tag LOCUS_11360 4005 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence216 >Feature sequence217 1318 248 gene locus_tag LOCUS_11370 gene nadA 1318 248 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_11370 2096 2542 gene locus_tag LOCUS_11380 gene iscR 2096 2542 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E785 protein_id gnl|my_center|LOCUS_11380 2600 3814 gene locus_tag LOCUS_11390 gene iscS 2600 3814 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNC4 protein_id gnl|my_center|LOCUS_11390 3853 4281 gene locus_tag LOCUS_11400 gene iscU 3853 4281 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFF4 protein_id gnl|my_center|LOCUS_11400 >Feature sequence218 1281 1991 gene locus_tag LOCUS_11410 1281 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2013 2279 gene locus_tag LOCUS_11420 2013 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3262 2294 gene locus_tag LOCUS_11430 3262 2294 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523788.1 protein_id gnl|my_center|LOCUS_11430 4172 3264 gene locus_tag LOCUS_11440 4172 3264 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence219 27 596 gene locus_tag LOCUS_11450 27 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 596 2023 gene locus_tag LOCUS_11460 596 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2024 2257 gene locus_tag LOCUS_11470 2024 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2342 3265 gene locus_tag LOCUS_11480 2342 3265 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_11480 3269 3721 gene locus_tag LOCUS_11490 3269 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3820 4209 gene locus_tag LOCUS_11500 3820 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence220 631 239 gene locus_tag LOCUS_11510 631 239 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_11510 969 1823 gene locus_tag LOCUS_11520 969 1823 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_11520 1908 2252 gene locus_tag LOCUS_11530 1908 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_11530 3667 2255 gene locus_tag LOCUS_11540 3667 2255 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_11540 3870 4058 gene locus_tag LOCUS_11550 3870 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence221 734 1960 gene locus_tag LOCUS_11560 734 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1988 3868 gene locus_tag LOCUS_11570 1988 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence222 <1 618 gene locus_tag LOCUS_11580 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973092.1:DNA alkylation repair protein 787 1191 gene locus_tag LOCUS_11590 787 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2030 1353 gene locus_tag LOCUS_11600 2030 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2232 2621 gene locus_tag LOCUS_11610 2232 2621 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence223 1443 82 gene locus_tag LOCUS_11620 1443 82 CDS product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence224 <1 905 gene locus_tag LOCUS_11630 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009938358.1:radical SAM protein 2066 1044 gene locus_tag LOCUS_11640 gene pyrD 2066 1044 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_11640 3279 2119 gene locus_tag LOCUS_11650 3279 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence225 745 401 gene locus_tag LOCUS_11660 745 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 987 1496 gene locus_tag LOCUS_11670 987 1496 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_11670 1886 2257 gene locus_tag LOCUS_11680 1886 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2461 3660 gene locus_tag LOCUS_11690 2461 3660 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_11690 4260 3718 gene locus_tag LOCUS_11700 gene def 4260 3718 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 protein_id gnl|my_center|LOCUS_11700 >Feature sequence226 1 873 gene locus_tag LOCUS_11710 1 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 898 2412 gene locus_tag LOCUS_11720 gene nuoM 898 2412 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_11720 2483 3931 gene locus_tag LOCUS_11730 gene nuoN 2483 3931 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR8 protein_id gnl|my_center|LOCUS_11730 >Feature sequence227 <1 594 gene locus_tag LOCUS_11740 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104153.1:chemotaxis protein CheR 1812 589 gene locus_tag LOCUS_11750 gene moeA1 1812 589 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_11750 3887 1917 gene locus_tag LOCUS_11760 3887 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence228 3053 1398 gene locus_tag LOCUS_11770 gene pbpB 3053 1398 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_11770 3433 3131 gene locus_tag LOCUS_11780 3433 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 <4282 3430 gene locus_tag LOCUS_11790 <4282 3430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KPF9:ribosomal RNA small subunit methyltransferase H >Feature sequence229 708 346 gene locus_tag LOCUS_11800 708 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 812 2428 gene locus_tag LOCUS_11810 812 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_11810 2425 3207 gene locus_tag LOCUS_11820 2425 3207 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_11820 3508 3999 gene locus_tag LOCUS_11830 3508 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence230 170 985 gene locus_tag LOCUS_11840 170 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1020 1610 gene locus_tag LOCUS_11850 1020 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1723 2280 gene locus_tag LOCUS_11860 1723 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2297 3094 gene locus_tag LOCUS_11870 2297 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence231 464 138 gene locus_tag LOCUS_11880 464 138 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_11880 1561 497 gene locus_tag LOCUS_11890 1561 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1945 1571 gene locus_tag LOCUS_11900 gene ydeP 1945 1571 CDS product putative HTH-type transcriptional regulator YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96673 protein_id gnl|my_center|LOCUS_11900 2073 3161 gene locus_tag LOCUS_11910 2073 3161 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_11910 <4261 3258 gene locus_tag LOCUS_11920 <4261 3258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783193.1:ATPase AAA >Feature sequence232 290 802 gene locus_tag LOCUS_11930 290 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 804 1691 gene locus_tag LOCUS_11940 gene tonB 804 1691 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_11940 1812 2375 gene locus_tag LOCUS_11950 1812 2375 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_11950 2368 2826 gene locus_tag LOCUS_11960 2368 2826 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_11960 2823 3329 gene locus_tag LOCUS_11970 gene pyrR 2823 3329 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_11970 >Feature sequence233 <1 635 gene locus_tag LOCUS_11980 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679762.1:membrane protein 632 1504 gene locus_tag LOCUS_11990 632 1504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_11990 1508 2794 gene locus_tag LOCUS_12000 1508 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence234 354 539 gene locus_tag LOCUS_12010 354 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1382 972 gene locus_tag LOCUS_12020 1382 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1568 2029 gene locus_tag LOCUS_12030 1568 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1992 2630 gene locus_tag LOCUS_12040 1992 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2637 3098 gene locus_tag LOCUS_12050 2637 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3111 3398 gene locus_tag LOCUS_12060 3111 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3449 3988 gene locus_tag LOCUS_12070 3449 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence235 1 834 gene locus_tag LOCUS_12080 1 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 839 1936 gene locus_tag LOCUS_12090 839 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968501.1 protein_id gnl|my_center|LOCUS_12090 2027 3841 gene locus_tag LOCUS_12100 2027 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_12100 3938 4014 gene locus_tag LOCUS_t00090 3938 4014 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 2082 421 gene locus_tag LOCUS_12110 2082 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2401 4140 gene locus_tag LOCUS_12120 2401 4140 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence237 2608 1481 gene locus_tag LOCUS_12130 gene carA 2608 1481 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M9 protein_id gnl|my_center|LOCUS_12130 >Feature sequence238 1430 228 gene locus_tag LOCUS_12140 gene tyrS 1430 228 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_12140 1721 3112 gene locus_tag LOCUS_12150 1721 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence239 829 77 gene locus_tag LOCUS_12160 829 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1596 2657 gene locus_tag LOCUS_12170 1596 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence240 1 1878 gene locus_tag LOCUS_12180 1 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2116 1985 gene locus_tag LOCUS_12190 2116 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2468 3781 gene locus_tag LOCUS_12200 2468 3781 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence241 <1 835 gene locus_tag LOCUS_12210 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator 2800 845 gene locus_tag LOCUS_12220 2800 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4088 2841 gene locus_tag LOCUS_12230 4088 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence242 2895 2668 gene locus_tag LOCUS_12240 2895 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 <4174 2901 gene locus_tag LOCUS_12250 <4174 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NFP1:exodeoxyribonuclease 7 large subunit >Feature sequence243 135 1631 gene locus_tag LOCUS_12260 135 1631 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_12260 3274 1652 gene locus_tag LOCUS_12270 3274 1652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_12270 <4174 3332 gene locus_tag LOCUS_12280 <4174 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989687.1:alpha/beta hydrolase >Feature sequence244 411 103 gene locus_tag LOCUS_12290 411 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 622 1296 gene locus_tag LOCUS_12300 622 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 protein_id gnl|my_center|LOCUS_12300 1881 1342 gene locus_tag LOCUS_12310 1881 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2015 2176 gene locus_tag LOCUS_12320 2015 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence245 1342 377 gene locus_tag LOCUS_12330 1342 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1460 3442 gene locus_tag LOCUS_12340 gene hyuA 1460 3442 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_12340 <4165 3586 gene locus_tag LOCUS_12350 <4165 3586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7W9:magnesium transporter MgtE >Feature sequence246 2170 95 gene locus_tag LOCUS_12360 gene metG 2170 95 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1Q0 protein_id gnl|my_center|LOCUS_12360 2353 3450 gene locus_tag LOCUS_12370 2353 3450 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W88 protein_id gnl|my_center|LOCUS_12370 3486 4019 gene locus_tag LOCUS_12380 gene dcd 3486 4019 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63904 protein_id gnl|my_center|LOCUS_12380 >Feature sequence247 <1 1250 gene locus_tag LOCUS_12390 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455451.1:outer membrane channel protein 2520 1228 gene locus_tag LOCUS_12400 gene kdtA 2520 1228 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_12400 3944 2517 gene locus_tag LOCUS_12410 gene hldE 3944 2517 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL4 protein_id gnl|my_center|LOCUS_12410 4156 3941 gene locus_tag LOCUS_12420 4156 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence248 888 88 gene locus_tag LOCUS_12430 888 88 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_12430 3181 821 gene locus_tag LOCUS_12440 3181 821 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_12440 3913 3314 gene locus_tag LOCUS_12450 3913 3314 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532915.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence249 437 853 gene locus_tag LOCUS_12460 437 853 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_12460 850 1416 gene locus_tag LOCUS_12470 850 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703123.1 protein_id gnl|my_center|LOCUS_12470 1419 2276 gene locus_tag LOCUS_12480 1419 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2838 2248 gene locus_tag LOCUS_12490 2838 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3105 3875 gene locus_tag LOCUS_12500 gene yfcA 3105 3875 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB6 protein_id gnl|my_center|LOCUS_12500 >Feature sequence250 225 1529 gene locus_tag LOCUS_12510 gene hisD 225 1529 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_12510 1560 2354 gene locus_tag LOCUS_12520 1560 2354 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_12520 2387 2980 gene locus_tag LOCUS_12530 gene hisB 2387 2980 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_12530 2977 3630 gene locus_tag LOCUS_12540 gene hisH 2977 3630 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLP9 protein_id gnl|my_center|LOCUS_12540 >Feature sequence251 <1 526 gene locus_tag LOCUS_12550 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932564.1:CHAD domain-containing protein 523 1254 gene locus_tag LOCUS_12560 523 1254 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_12560 2515 1340 gene locus_tag LOCUS_12570 2515 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3094 2516 gene locus_tag LOCUS_12580 3094 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3635 3114 gene locus_tag LOCUS_12590 3635 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence252 155 991 gene locus_tag LOCUS_12600 155 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence253 1695 337 gene locus_tag LOCUS_12610 1695 337 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_12610 3968 1716 gene locus_tag LOCUS_12620 3968 1716 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence254 750 112 gene locus_tag LOCUS_12630 gene rlmE 750 112 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_12630 1017 766 gene locus_tag LOCUS_12640 1017 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1106 1396 gene locus_tag LOCUS_12650 1106 1396 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_12650 1477 2286 gene locus_tag LOCUS_12660 1477 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence255 2 886 gene locus_tag LOCUS_12670 gene mtrA 2 886 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_12670 891 3086 gene locus_tag LOCUS_12680 891 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3091 3711 gene locus_tag LOCUS_12690 3091 3711 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545087.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence256 3140 1503 gene locus_tag LOCUS_12700 3140 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3862 3179 gene locus_tag LOCUS_12710 3862 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence257 1105 572 gene locus_tag LOCUS_12720 1105 572 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_12720 2237 1161 gene locus_tag LOCUS_12730 2237 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_12730 3937 2456 gene locus_tag LOCUS_12740 3937 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence258 791 90 gene locus_tag LOCUS_12750 gene ung 791 90 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_12750 1033 824 gene locus_tag LOCUS_12760 1033 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1333 1809 gene locus_tag LOCUS_12770 1333 1809 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_12770 1809 2105 gene locus_tag LOCUS_12780 1809 2105 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_12780 2102 2419 gene locus_tag LOCUS_12790 2102 2419 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_12790 2416 3006 gene locus_tag LOCUS_12800 2416 3006 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_12800 2996 3415 gene locus_tag LOCUS_12810 2996 3415 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_12810 3415 3771 gene locus_tag LOCUS_12820 3415 3771 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence259 714 974 gene locus_tag LOCUS_12830 714 974 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_12830 3843 1063 gene locus_tag LOCUS_12840 3843 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence260 585 10 gene locus_tag LOCUS_12850 gene rnhB 585 10 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF1 protein_id gnl|my_center|LOCUS_12850 1742 597 gene locus_tag LOCUS_12860 gene lpxB 1742 597 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ24 protein_id gnl|my_center|LOCUS_12860 2558 1788 gene locus_tag LOCUS_12870 gene lpxA 2558 1788 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY61 protein_id gnl|my_center|LOCUS_12870 3002 2568 gene locus_tag LOCUS_12880 gene fabZ 3002 2568 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_12880 <4077 3195 gene locus_tag LOCUS_12890 <4077 3195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXY6:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence261 477 971 gene locus_tag LOCUS_12900 gene thiJ 477 971 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_12900 2626 968 gene locus_tag LOCUS_12910 gene ubiB 2626 968 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_12910 3281 2640 gene locus_tag LOCUS_12920 3281 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948589.1 protein_id gnl|my_center|LOCUS_12920 4066 3308 gene locus_tag LOCUS_12930 gene ubiE 4066 3308 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVQ6 protein_id gnl|my_center|LOCUS_12930 >Feature sequence262 2912 1932 gene locus_tag LOCUS_12940 2912 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_12940 3287 2925 gene locus_tag LOCUS_12950 3287 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4070 3411 gene locus_tag LOCUS_12960 4070 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence263 1434 271 gene locus_tag LOCUS_12970 1434 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3010 1673 gene locus_tag LOCUS_12980 3010 1673 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_12980 3868 3407 gene locus_tag LOCUS_12990 3868 3407 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence264 39 1349 gene locus_tag LOCUS_13000 gene ahcY 39 1349 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_13000 1451 2296 gene locus_tag LOCUS_13010 gene metF 1451 2296 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT4 protein_id gnl|my_center|LOCUS_13010 >Feature sequence265 410 1183 gene locus_tag LOCUS_13020 410 1183 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_13020 1398 1811 gene locus_tag LOCUS_13030 1398 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1777 2061 gene locus_tag LOCUS_13040 1777 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2045 2371 gene locus_tag LOCUS_13050 2045 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2374 2673 gene locus_tag LOCUS_13060 2374 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2670 3269 gene locus_tag LOCUS_13070 2670 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3232 3966 gene locus_tag LOCUS_13080 3232 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence266 468 1253 gene locus_tag LOCUS_13090 gene flgG 468 1253 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1J4 protein_id gnl|my_center|LOCUS_13090 1264 1959 gene locus_tag LOCUS_13100 gene flgH 1264 1959 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_13100 2189 3328 gene locus_tag LOCUS_13110 2189 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_13110 3404 3991 gene locus_tag LOCUS_13120 3404 3991 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence267 <1 2256 gene locus_tag LOCUS_13130 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWG0:UvrABC system protein A 2288 3727 gene locus_tag LOCUS_13140 gene yfgC 2288 3727 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H9 protein_id gnl|my_center|LOCUS_13140 >Feature sequence268 <1 2008 gene locus_tag LOCUS_13150 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530942.1:nitrite reductase large subunit 2008 2322 gene locus_tag LOCUS_13160 gene nirD 2008 2322 CDS product assimilatory nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence269 >Feature sequence270 3055 1808 gene locus_tag LOCUS_13170 3055 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3212 3523 gene locus_tag LOCUS_13180 3212 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence271 2621 711 gene locus_tag LOCUS_13190 gene htpG 2621 711 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL53 protein_id gnl|my_center|LOCUS_13190 >Feature sequence272 1132 260 gene locus_tag LOCUS_13200 1132 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2075 1173 gene locus_tag LOCUS_13210 2075 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2222 2884 gene locus_tag LOCUS_13220 2222 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence273 579 184 gene locus_tag LOCUS_13230 579 184 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_13230 1742 576 gene locus_tag LOCUS_13240 gene hdc 1742 576 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRG7 protein_id gnl|my_center|LOCUS_13240 >Feature sequence274 228 2762 gene locus_tag LOCUS_13250 228 2762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_13250 2755 3912 gene locus_tag LOCUS_13260 2755 3912 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence275 941 3577 gene locus_tag LOCUS_13270 941 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence276 108 803 gene locus_tag LOCUS_13280 108 803 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_13280 1373 783 gene locus_tag LOCUS_13290 1373 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_13290 2705 1389 gene locus_tag LOCUS_13300 2705 1389 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_13300 3197 2778 gene locus_tag LOCUS_13310 3197 2778 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence277 3734 3450 gene locus_tag LOCUS_13320 3734 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948633.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence278 133 1893 gene locus_tag LOCUS_13330 133 1893 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706260.1 protein_id gnl|my_center|LOCUS_13330 1877 3637 gene locus_tag LOCUS_13340 1877 3637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136732.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence279 406 1194 gene locus_tag LOCUS_13350 406 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_13350 2483 1350 gene locus_tag LOCUS_13360 2483 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_13360 2604 3491 gene locus_tag LOCUS_13370 gene rmlA 2604 3491 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_13370 >Feature sequence280 242 21 gene locus_tag LOCUS_13380 242 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 549 274 gene locus_tag LOCUS_13390 549 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1889 897 gene locus_tag LOCUS_13400 1889 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence281 201 2966 gene locus_tag LOCUS_13410 201 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence282 56 613 gene locus_tag LOCUS_13420 56 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2215 1001 gene locus_tag LOCUS_13430 2215 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_13430 2955 2212 gene locus_tag LOCUS_13440 gene fabG 2955 2212 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPI3 protein_id gnl|my_center|LOCUS_13440 3926 2958 gene locus_tag LOCUS_13450 gene tklB 3926 2958 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence283 674 1177 gene locus_tag LOCUS_13460 674 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2422 1253 gene locus_tag LOCUS_13470 2422 1253 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_13470 2726 2568 gene locus_tag LOCUS_13480 2726 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3741 2929 gene locus_tag LOCUS_13490 3741 2929 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_13490 3944 3759 gene locus_tag LOCUS_13500 3944 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence284 <1 1143 gene locus_tag LOCUS_13510 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331475.1:conjugative transfer factor, TraB 1145 1585 gene locus_tag LOCUS_13520 1145 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence285 758 489 gene locus_tag LOCUS_13530 758 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232878.2 protein_id gnl|my_center|LOCUS_13530 1176 3863 gene locus_tag LOCUS_13540 1176 3863 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_13540 3763 3838 gene locus_tag LOCUS_t00100 3763 3838 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence286 2794 872 gene locus_tag LOCUS_13550 2794 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3784 2942 gene locus_tag LOCUS_13560 gene serB 3784 2942 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence287 388 2790 gene locus_tag LOCUS_13570 388 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2790 3104 gene locus_tag LOCUS_13580 2790 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3135 3788 gene locus_tag LOCUS_13590 3135 3788 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence288 939 1523 gene locus_tag LOCUS_13600 939 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1607 2086 gene locus_tag LOCUS_13610 1607 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2187 2564 gene locus_tag LOCUS_13620 2187 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3390 2575 gene locus_tag LOCUS_13630 gene folE2 3390 2575 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K023 protein_id gnl|my_center|LOCUS_13630 3783 3403 gene locus_tag LOCUS_13640 gene queD 3783 3403 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_13640 >Feature sequence289 1568 354 gene locus_tag LOCUS_13650 1568 354 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_13650 3764 1584 gene locus_tag LOCUS_13660 gene rlmL 3764 1584 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_13660 >Feature sequence290 1693 1103 gene locus_tag LOCUS_13670 1693 1103 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460829.1 protein_id gnl|my_center|LOCUS_13670 2021 2497 gene locus_tag LOCUS_13680 2021 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13680 3211 2642 gene locus_tag LOCUS_13690 3211 2642 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871100.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence291 <1 1477 gene locus_tag LOCUS_13700 <1 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317954.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1796 1578 gene locus_tag LOCUS_13710 gene infA 1796 1578 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW6 protein_id gnl|my_center|LOCUS_13710 2921 2175 gene locus_tag LOCUS_13720 gene ate 2921 2175 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK9 protein_id gnl|my_center|LOCUS_13720 <3848 2931 gene locus_tag LOCUS_13730 <3848 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104922.1:glutathione-disulfide reductase >Feature sequence292 128 1621 gene locus_tag LOCUS_13740 gene manB 128 1621 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_13740 1633 3711 gene locus_tag LOCUS_13750 gene ppk 1633 3711 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_13750 >Feature sequence293 <1 1312 gene locus_tag LOCUS_13760 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947961.1:glutamine synthetase 1335 2729 gene locus_tag LOCUS_13770 1335 2729 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence294 1735 1214 gene locus_tag LOCUS_13780 1735 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2249 2743 gene locus_tag LOCUS_13790 2249 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2740 3717 gene locus_tag LOCUS_13800 2740 3717 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence295 <1 830 gene locus_tag LOCUS_13810 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVP0:glutamine--tRNA ligase 1046 1945 gene locus_tag LOCUS_13820 1046 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2325 1981 gene locus_tag LOCUS_13830 gene dskA 2325 1981 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971243.1 protein_id gnl|my_center|LOCUS_13830 2590 3738 gene locus_tag LOCUS_13840 2590 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence296 <1 1128 gene locus_tag LOCUS_13850 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein 1521 1153 gene locus_tag LOCUS_13860 1521 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1984 1640 gene locus_tag LOCUS_13870 1984 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence297 70 990 gene locus_tag LOCUS_13880 70 990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261545.1 protein_id gnl|my_center|LOCUS_13880 1870 947 gene locus_tag LOCUS_13890 1870 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2346 1876 gene locus_tag LOCUS_13900 2346 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3696 2350 gene locus_tag LOCUS_13910 3696 2350 CDS product cell division cycle protein 48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887292.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence298 845 456 gene locus_tag LOCUS_13920 845 456 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_13920 3286 1049 gene locus_tag LOCUS_13930 gene spoT 3286 1049 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_13930 3594 3313 gene locus_tag LOCUS_13940 3594 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence299 2293 746 gene locus_tag LOCUS_13950 2293 746 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence300 >Feature sequence301 2787 2008 gene locus_tag LOCUS_13960 2787 2008 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_13960 3510 2800 gene locus_tag LOCUS_13970 3510 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531779.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence302 1716 3389 gene locus_tag LOCUS_13980 1716 3389 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence303 1718 531 gene locus_tag LOCUS_13990 gene rfaG 1718 531 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475730.1 protein_id gnl|my_center|LOCUS_13990 3586 1991 gene locus_tag LOCUS_14000 3586 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence304 2421 1240 gene locus_tag LOCUS_14010 gene pgk 2421 1240 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_14010 3567 2563 gene locus_tag LOCUS_14020 gene gap 3567 2563 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59199 protein_id gnl|my_center|LOCUS_14020 >Feature sequence305 1000 65 gene locus_tag LOCUS_14030 gene traU 1000 65 CDS product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 protein_id gnl|my_center|LOCUS_14030 1727 1095 gene locus_tag LOCUS_14040 1727 1095 CDS product conjugal transfer pilus assembly protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087208.1 protein_id gnl|my_center|LOCUS_14040 2221 1727 gene locus_tag LOCUS_14050 2221 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2540 2208 gene locus_tag LOCUS_14060 2540 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 <3801 2537 gene locus_tag LOCUS_14070 <3801 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947800.1:type-IV secretion system protein TraC >Feature sequence306 <1 1319 gene locus_tag LOCUS_14080 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976304.1:branched-chain amino acid ABC transporter permease 1322 2470 gene locus_tag LOCUS_14090 1322 2470 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_14090 2467 3309 gene locus_tag LOCUS_14100 2467 3309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence307 1183 29 gene locus_tag LOCUS_14110 1183 29 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCG7 protein_id gnl|my_center|LOCUS_14110 1738 1385 gene locus_tag LOCUS_14120 gene erpA 1738 1385 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW5 protein_id gnl|my_center|LOCUS_14120 2343 1843 gene locus_tag LOCUS_14130 2343 1843 CDS product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_14130 3066 2359 gene locus_tag LOCUS_14140 3066 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 <3790 3077 gene locus_tag LOCUS_14150 <3790 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZMM3:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence308 2951 2334 gene locus_tag LOCUS_14160 2951 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence309 1031 252 gene locus_tag LOCUS_14170 1031 252 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_14170 2178 1015 gene locus_tag LOCUS_14180 gene pstA 2178 1015 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAQ2 protein_id gnl|my_center|LOCUS_14180 3077 2175 gene locus_tag LOCUS_14190 3077 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence310 2798 1776 gene locus_tag LOCUS_14200 gene asd 2798 1776 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_14200 <3786 2863 gene locus_tag LOCUS_14210 <3786 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51375:3-isopropylmalate dehydrogenase >Feature sequence311 1117 1461 gene locus_tag LOCUS_14220 1117 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2397 1555 gene locus_tag LOCUS_14230 2397 1555 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_14230 3010 2399 gene locus_tag LOCUS_14240 gene azoR 3010 2399 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 protein_id gnl|my_center|LOCUS_14240 >Feature sequence312 1948 1493 gene locus_tag LOCUS_14250 1948 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence313 2527 1817 gene locus_tag LOCUS_14260 2527 1817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_14260 2602 3567 gene locus_tag LOCUS_14270 gene cbpA 2602 3567 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence314 2732 1713 gene locus_tag LOCUS_14280 2732 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence315 340 1572 gene locus_tag LOCUS_14290 340 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1775 1584 gene locus_tag LOCUS_14300 1775 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2617 1904 gene locus_tag LOCUS_14310 2617 1904 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_14310 3093 3575 gene locus_tag LOCUS_14320 3093 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence316 606 1067 gene locus_tag LOCUS_14330 gene yvbK 606 1067 CDS product putative N-acetyltransferase YvbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32248 protein_id gnl|my_center|LOCUS_14330 3543 1522 gene locus_tag LOCUS_14340 3543 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence317 1058 471 gene locus_tag LOCUS_14350 1058 471 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_14350 1422 1129 gene locus_tag LOCUS_14360 1422 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3148 1436 gene locus_tag LOCUS_14370 gene proS 3148 1436 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 protein_id gnl|my_center|LOCUS_14370 <3742 3149 gene locus_tag LOCUS_14380 <3742 3149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000665274.1:nicotinate-nucleotide diphosphorylase >Feature sequence318 445 176 gene locus_tag LOCUS_14390 445 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3011 822 gene locus_tag LOCUS_14400 gene uvrD 3011 822 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFB5 protein_id gnl|my_center|LOCUS_14400 >Feature sequence319 1121 75 gene locus_tag LOCUS_14410 1121 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1820 2584 gene locus_tag LOCUS_14420 1820 2584 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_14420 2780 3448 gene locus_tag LOCUS_14430 2780 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence320 <1 2290 gene locus_tag LOCUS_14440 <1 2290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AA5:DNA topoisomerase 1 3377 2418 gene locus_tag LOCUS_14450 gene cysB 3377 2418 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406770.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence321 2060 111 gene locus_tag LOCUS_14460 2060 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941908.1 protein_id gnl|my_center|LOCUS_14460 <3701 2060 gene locus_tag LOCUS_14470 <3701 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941907.1:multicopper oxidase >Feature sequence322 <1 950 gene locus_tag LOCUS_14480 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45684:RNA polymerase sigma factor RpoS 1442 1005 gene locus_tag LOCUS_14490 1442 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1599 2846 gene locus_tag LOCUS_14500 1599 2846 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785920.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence323 <3688 2976 gene locus_tag LOCUS_14510 <3688 2976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222804.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence324 <1 1817 gene locus_tag LOCUS_14520 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478619.1:DNA polymerase I 1817 2272 gene locus_tag LOCUS_14530 1817 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence325 1787 702 gene locus_tag LOCUS_14540 gene serC 1787 702 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T5 protein_id gnl|my_center|LOCUS_14540 <3655 1842 gene locus_tag LOCUS_14550 <3655 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVM3:DNA gyrase subunit A >Feature sequence326 752 1705 gene locus_tag LOCUS_14560 752 1705 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016024.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence327 328 3096 gene locus_tag LOCUS_14570 gene valS 328 3096 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_14570 3318 3160 gene locus_tag LOCUS_14580 3318 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence328 679 266 gene locus_tag LOCUS_14590 679 266 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_14590 1828 791 gene locus_tag LOCUS_14600 gene ruvB 1828 791 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_14600 2482 1865 gene locus_tag LOCUS_14610 gene ruvA 2482 1865 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL2 protein_id gnl|my_center|LOCUS_14610 3040 2489 gene locus_tag LOCUS_14620 gene ruvC 3040 2489 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence329 368 249 gene locus_tag LOCUS_14630 368 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 367 804 gene locus_tag LOCUS_14640 367 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1187 2020 gene locus_tag LOCUS_14650 1187 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2116 2514 gene locus_tag LOCUS_14660 2116 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2524 3138 gene locus_tag LOCUS_14670 2524 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence330 405 851 gene locus_tag LOCUS_14680 405 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 889 1950 gene locus_tag LOCUS_14690 889 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1965 2237 gene locus_tag LOCUS_14700 1965 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2275 2637 gene locus_tag LOCUS_14710 2275 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence331 1034 1618 gene locus_tag LOCUS_14720 gene tag 1034 1618 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_14720 1881 2999 gene locus_tag LOCUS_14730 1881 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence332 1765 122 gene locus_tag LOCUS_14740 1765 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2231 1749 gene locus_tag LOCUS_14750 2231 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence333 1639 1205 gene locus_tag LOCUS_14760 1639 1205 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020435.1 protein_id gnl|my_center|LOCUS_14760 2500 1772 gene locus_tag LOCUS_14770 gene trmJ 2500 1772 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_14770 2597 3376 gene locus_tag LOCUS_14780 gene suhB 2597 3376 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence334 314 1258 gene locus_tag LOCUS_14790 314 1258 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX6 protein_id gnl|my_center|LOCUS_14790 1242 1763 gene locus_tag LOCUS_14800 gene fabZ 1242 1763 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R690 protein_id gnl|my_center|LOCUS_14800 1776 2522 gene locus_tag LOCUS_14810 1776 2522 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346474.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence335 145 327 gene locus_tag LOCUS_14820 145 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1862 807 gene locus_tag LOCUS_14830 1862 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2606 2013 gene locus_tag LOCUS_14840 gene plsY 2606 2013 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM5 protein_id gnl|my_center|LOCUS_14840 2740 3105 gene locus_tag LOCUS_14850 gene folB 2740 3105 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_14850 >Feature sequence336 276 839 gene locus_tag LOCUS_14860 gene lolB 276 839 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 protein_id gnl|my_center|LOCUS_14860 827 1684 gene locus_tag LOCUS_14870 gene ipk 827 1684 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y038 protein_id gnl|my_center|LOCUS_14870 1836 1910 gene locus_tag LOCUS_t00110 1836 1910 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2019 2960 gene locus_tag LOCUS_14880 gene prs 2019 2960 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUH1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence337 169 2199 gene locus_tag LOCUS_14890 169 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence338 >Feature sequence339 1 144 gene locus_tag LOCUS_14900 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1239 340 gene locus_tag LOCUS_14910 1239 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1669 2463 gene locus_tag LOCUS_14920 1669 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2450 3406 gene locus_tag LOCUS_14930 2450 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence340 210 626 gene locus_tag LOCUS_14940 210 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 732 1130 gene locus_tag LOCUS_14950 732 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1774 2268 gene locus_tag LOCUS_14960 1774 2268 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263378.1 protein_id gnl|my_center|LOCUS_14960 2739 2311 gene locus_tag LOCUS_14970 2739 2311 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_14970 <3568 2780 gene locus_tag LOCUS_14980 <3568 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478994.1:MFS transporter >Feature sequence341 104 421 gene locus_tag LOCUS_14990 104 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 563 2149 gene locus_tag LOCUS_15000 gene hsdM 563 2149 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_15000 2366 3502 gene locus_tag LOCUS_15010 gene hsdS 2366 3502 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538174.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence342 1073 210 gene locus_tag LOCUS_15020 1073 210 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_15020 1180 2577 gene locus_tag LOCUS_15030 gene leuC 1180 2577 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_15030 2605 3243 gene locus_tag LOCUS_15040 gene leuD 2605 3243 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_15040 >Feature sequence343 1306 884 gene locus_tag LOCUS_15050 1306 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1998 1597 gene locus_tag LOCUS_15060 1998 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2736 2293 gene locus_tag LOCUS_15070 2736 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 <3561 2786 gene locus_tag LOCUS_15080 <3561 2786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EP48:DNA topoisomerase >Feature sequence344 1430 3 gene locus_tag LOCUS_15090 1430 3 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204943.1 protein_id gnl|my_center|LOCUS_15090 1557 2462 gene locus_tag LOCUS_15100 1557 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550739.1 protein_id gnl|my_center|LOCUS_15100 <3558 2643 gene locus_tag LOCUS_15110 <3558 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257348.1:transcriptional activator >Feature sequence345 597 1322 gene locus_tag LOCUS_15120 597 1322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_15120 1454 3022 gene locus_tag LOCUS_15130 gene rpoN 1454 3022 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_15130 3068 3385 gene locus_tag LOCUS_15140 gene yfiA-2 3068 3385 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence346 <1 1751 gene locus_tag LOCUS_15150 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228248.1:helix-turn-helix transcriptional regulator 1838 2491 gene locus_tag LOCUS_15160 1838 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2889 3350 gene locus_tag LOCUS_15170 2889 3350 CDS product aminoglycoside N(6')-acetyltransferase type 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2K0 protein_id gnl|my_center|LOCUS_15170 >Feature sequence347 713 294 gene locus_tag LOCUS_15180 713 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_15180 826 1464 gene locus_tag LOCUS_15190 gene vfr 826 1464 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_15190 2814 1507 gene locus_tag LOCUS_15200 2814 1507 CDS product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_15200 <3528 2923 gene locus_tag LOCUS_15210 <3528 2923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PAS8:indole-3-glycerol phosphate synthase >Feature sequence348 1807 308 gene locus_tag LOCUS_15220 gene pepA2 1807 308 CDS product putative cytosol aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH62 protein_id gnl|my_center|LOCUS_15220 2030 3088 gene locus_tag LOCUS_15230 2030 3088 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957819.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence349 396 277 gene locus_tag LOCUS_15240 396 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1994 777 gene locus_tag LOCUS_15250 gene sat 1994 777 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_15250 2183 2773 gene locus_tag LOCUS_15260 gene hslV 2183 2773 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence350 290 829 gene locus_tag LOCUS_15270 290 829 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_15270 829 2160 gene locus_tag LOCUS_15280 829 2160 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence351 <1 1202 gene locus_tag LOCUS_15290 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:two-component sensor histidine kinase 1299 2282 gene locus_tag LOCUS_15300 1299 2282 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_15300 2620 2297 gene locus_tag LOCUS_15310 2620 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence352 488 1612 gene locus_tag LOCUS_15320 488 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence353 <3491 2486 gene locus_tag LOCUS_15330 <3491 2486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706057.1:membrane protein >Feature sequence354 2316 1261 gene locus_tag LOCUS_15340 2316 1261 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_15340 3469 2420 gene locus_tag LOCUS_15350 3469 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence355 1793 1065 gene locus_tag LOCUS_15360 gene folP 1793 1065 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_15360 3449 1872 gene locus_tag LOCUS_15370 3449 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence356 881 1879 gene locus_tag LOCUS_15380 881 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence357 382 1500 gene locus_tag LOCUS_15390 382 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1572 2531 gene locus_tag LOCUS_15400 1572 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence358 750 25 gene locus_tag LOCUS_15410 gene phoU 750 25 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_15410 2365 998 gene locus_tag LOCUS_15420 gene phoR 2365 998 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_15420 3053 2367 gene locus_tag LOCUS_15430 3053 2367 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460184.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence359 352 1353 gene locus_tag LOCUS_15440 352 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1370 2281 gene locus_tag LOCUS_15450 gene scbA 1370 2281 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_15450 2284 2901 gene locus_tag LOCUS_15460 2284 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence360 2 1018 gene locus_tag LOCUS_15470 2 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1671 1024 gene locus_tag LOCUS_15480 gene agmR 1671 1024 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_15480 2227 2042 gene locus_tag LOCUS_15490 2227 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 <3419 2304 gene locus_tag LOCUS_15500 <3419 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFY5:glycerol kinase >Feature sequence361 1581 2300 gene locus_tag LOCUS_15510 gene ilvE 1581 2300 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_15510 <3413 2294 gene locus_tag LOCUS_15520 <3413 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:hybrid sensor histidine kinase/response regulator >Feature sequence362 1121 687 gene locus_tag LOCUS_15530 1121 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1413 3335 gene locus_tag LOCUS_15540 gene ftsH 1413 3335 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 protein_id gnl|my_center|LOCUS_15540 >Feature sequence363 193 651 gene locus_tag LOCUS_15550 193 651 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 protein_id gnl|my_center|LOCUS_15550 670 1185 gene locus_tag LOCUS_15560 670 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1385 2254 gene locus_tag LOCUS_15570 gene rapZ 1385 2254 CDS product RNase adapter protein RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ97 protein_id gnl|my_center|LOCUS_15570 2264 2533 gene locus_tag LOCUS_15580 gene ptsH 2264 2533 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65877 protein_id gnl|my_center|LOCUS_15580 >Feature sequence364 3284 2247 gene locus_tag LOCUS_15590 3284 2247 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence365 222 1085 gene locus_tag LOCUS_15600 gene rpoH 222 1085 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_15600 2011 1094 gene locus_tag LOCUS_15610 gene bioC 2011 1094 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT34 protein_id gnl|my_center|LOCUS_15610 2762 2022 gene locus_tag LOCUS_15620 gene bioH 2762 2022 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z221 protein_id gnl|my_center|LOCUS_15620 <3398 2776 gene locus_tag LOCUS_15630 <3398 2776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I617:8-amino-7-oxononanoate synthase >Feature sequence366 2675 1773 gene locus_tag LOCUS_15640 2675 1773 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence367 244 738 gene locus_tag LOCUS_15650 244 738 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_15650 1801 746 gene locus_tag LOCUS_15660 1801 746 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_15660 2720 2421 gene locus_tag LOCUS_15670 2720 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3200 2751 gene locus_tag LOCUS_15680 3200 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence368 51 1088 gene locus_tag LOCUS_15690 51 1088 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021005.1 protein_id gnl|my_center|LOCUS_15690 1097 2905 gene locus_tag LOCUS_15700 1097 2905 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence369 1669 89 gene locus_tag LOCUS_15710 1669 89 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_15710 2324 1695 gene locus_tag LOCUS_15720 2324 1695 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence370 374 1183 gene locus_tag LOCUS_15730 gene minD 374 1183 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E446 protein_id gnl|my_center|LOCUS_15730 1187 1477 gene locus_tag LOCUS_15740 gene minE 1187 1477 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ6 protein_id gnl|my_center|LOCUS_15740 2041 2727 gene locus_tag LOCUS_15750 2041 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence371 932 201 gene locus_tag LOCUS_15760 932 201 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_15760 2505 976 gene locus_tag LOCUS_15770 2505 976 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence372 194 1219 gene locus_tag LOCUS_15780 194 1219 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_15780 1328 2881 gene locus_tag LOCUS_15790 1328 2881 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence373 479 1315 gene locus_tag LOCUS_15800 479 1315 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence374 78 875 gene locus_tag LOCUS_15810 78 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 875 2842 gene locus_tag LOCUS_15820 gene traN 875 2842 CDS product type-F conjugative transfer system mating-pair stabilization protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947796.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence375 2070 1528 gene locus_tag LOCUS_15830 gene atpH 2070 1528 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR98 protein_id gnl|my_center|LOCUS_15830 2547 2077 gene locus_tag LOCUS_15840 gene atpF 2547 2077 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR97 protein_id gnl|my_center|LOCUS_15840 2867 2580 gene locus_tag LOCUS_15850 gene atpE 2867 2580 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR96 protein_id gnl|my_center|LOCUS_15850 3360 2965 gene locus_tag LOCUS_15860 3360 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence376 1138 1851 gene locus_tag LOCUS_15870 1138 1851 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_15870 2633 1896 gene locus_tag LOCUS_15880 2633 1896 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence377 1786 134 gene locus_tag LOCUS_15890 gene pgi 1786 134 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_15890 3318 1822 gene locus_tag LOCUS_15900 gene zwf 3318 1822 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_15900 >Feature sequence378 997 257 gene locus_tag LOCUS_15910 997 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1098 2351 gene locus_tag LOCUS_15920 1098 2351 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213032.1 protein_id gnl|my_center|LOCUS_15920 2320 3147 gene locus_tag LOCUS_15930 2320 3147 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence379 <1 600 gene locus_tag LOCUS_15940 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405133.1:O-methyltransferase 975 628 gene locus_tag LOCUS_15950 gene ybeB 975 628 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF37 protein_id gnl|my_center|LOCUS_15950 1632 991 gene locus_tag LOCUS_15960 gene nadD 1632 991 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_15960 2925 1669 gene locus_tag LOCUS_15970 gene proA 2925 1669 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_15970 >Feature sequence380 3072 1666 gene locus_tag LOCUS_15980 gene traH 3072 1666 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309243.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence381 646 2511 gene locus_tag LOCUS_15990 gene mnmG 646 2511 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDG1 protein_id gnl|my_center|LOCUS_15990 2519 3163 gene locus_tag LOCUS_16000 gene rsmG 2519 3163 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 protein_id gnl|my_center|LOCUS_16000 >Feature sequence382 >Feature sequence383 106 1569 gene locus_tag LOCUS_16010 106 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2290 1586 gene locus_tag LOCUS_16020 2290 1586 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887316.1 protein_id gnl|my_center|LOCUS_16020 2996 2295 gene locus_tag LOCUS_16030 2996 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence384 <1 957 gene locus_tag LOCUS_16040 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088479.1:transcriptional regulator 1600 2793 gene locus_tag LOCUS_16050 1600 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3313 2873 gene locus_tag LOCUS_16060 3313 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence385 510 1568 gene locus_tag LOCUS_16070 gene pbp 510 1568 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181794.1 protein_id gnl|my_center|LOCUS_16070 1858 2781 gene locus_tag LOCUS_16080 1858 2781 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence386 284 673 gene locus_tag LOCUS_16090 gene queF 284 673 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_16090 674 1984 gene locus_tag LOCUS_16100 674 1984 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529335.1 protein_id gnl|my_center|LOCUS_16100 1981 2709 gene locus_tag LOCUS_16110 gene cysZ 1981 2709 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_16110 >Feature sequence387 1420 1121 gene locus_tag LOCUS_16120 1420 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2245 1604 gene locus_tag LOCUS_16130 gene drga 2245 1604 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_16130 2413 3114 gene locus_tag LOCUS_16140 2413 3114 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence388 397 1245 gene locus_tag LOCUS_16150 397 1245 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXA8 protein_id gnl|my_center|LOCUS_16150 2089 1313 gene locus_tag LOCUS_16160 2089 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence389 <1 3021 gene locus_tag LOCUS_16170 <1 3021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q726T1:pyruvate synthase >Feature sequence390 28 216 gene locus_tag LOCUS_16180 28 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 740 213 gene locus_tag LOCUS_16190 740 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1393 737 gene locus_tag LOCUS_16200 1393 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602227.1 protein_id gnl|my_center|LOCUS_16200 2337 1408 gene locus_tag LOCUS_16210 2337 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2897 2439 gene locus_tag LOCUS_16220 2897 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence391 480 1814 gene locus_tag LOCUS_16230 gene fliI 480 1814 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_16230 1879 2328 gene locus_tag LOCUS_16240 gene fliJ 1879 2328 CDS product flagellar FliJ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTY0 protein_id gnl|my_center|LOCUS_16240 2547 2909 gene locus_tag LOCUS_16250 gene cheY 2547 2909 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence392 184 843 gene locus_tag LOCUS_16260 184 843 CDS product type-F conjugative transfer system protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947799.1 protein_id gnl|my_center|LOCUS_16260 843 1862 gene locus_tag LOCUS_16270 gene traU 843 1862 CDS product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 protein_id gnl|my_center|LOCUS_16270 1841 2572 gene locus_tag LOCUS_16280 gene trbC 1841 2572 CDS product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331483.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence393 1419 223 gene locus_tag LOCUS_16290 1419 223 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_16290 1697 2296 gene locus_tag LOCUS_16300 1697 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence394 453 1199 gene locus_tag LOCUS_16310 gene fabG 453 1199 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_16310 1351 1596 gene locus_tag LOCUS_16320 gene acpP 1351 1596 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E38 protein_id gnl|my_center|LOCUS_16320 1865 3082 gene locus_tag LOCUS_16330 gene fabF 1865 3082 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJC8 protein_id gnl|my_center|LOCUS_16330 >Feature sequence395 <1 1930 gene locus_tag LOCUS_16340 <1 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704651.1:pilus biosynthesis protein 1942 2271 gene locus_tag LOCUS_16350 1942 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2316 2717 gene locus_tag LOCUS_16360 gene pilE3 2316 2717 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence396 594 112 gene locus_tag LOCUS_16370 594 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 922 1974 gene locus_tag LOCUS_16380 922 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence397 <1 541 gene locus_tag LOCUS_16390 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q884J1:transcription-repair-coupling factor 898 1476 gene locus_tag LOCUS_16400 898 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence398 1240 644 gene locus_tag LOCUS_16410 gene gmhA2 1240 644 CDS product phosphoheptose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMN3 protein_id gnl|my_center|LOCUS_16410 2250 1228 gene locus_tag LOCUS_16420 gene hddA 2250 1228 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_16420 <3272 2316 gene locus_tag LOCUS_16430 <3272 2316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776768.1:glycosyltransferase WbuB >Feature sequence399 1259 1915 gene locus_tag LOCUS_16440 gene rpiA 1259 1915 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK7 protein_id gnl|my_center|LOCUS_16440 >Feature sequence400 408 2120 gene locus_tag LOCUS_16450 408 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2189 2740 gene locus_tag LOCUS_16460 2189 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2753 3103 gene locus_tag LOCUS_16470 2753 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence401 522 148 gene locus_tag LOCUS_16480 522 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16480 1068 685 gene locus_tag LOCUS_16490 gene rplQ 1068 685 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK46 protein_id gnl|my_center|LOCUS_16490 2095 1097 gene locus_tag LOCUS_16500 gene rpoA 2095 1097 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_16500 2563 2141 gene locus_tag LOCUS_16510 2563 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 3172 2783 gene locus_tag LOCUS_16520 gene rpsK 3172 2783 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF43 protein_id gnl|my_center|LOCUS_16520 >Feature sequence402 <1 765 gene locus_tag LOCUS_16530 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PA49:peptidylprolyl isomerase <3251 920 gene locus_tag LOCUS_16540 <3251 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257106.1:glucose dehydrogenase >Feature sequence403 1088 108 gene locus_tag LOCUS_16550 1088 108 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_16550 2562 1186 gene locus_tag LOCUS_16560 gene miaB 2562 1186 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8G5 protein_id gnl|my_center|LOCUS_16560 2746 3132 gene locus_tag LOCUS_16570 2746 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence404 171 533 gene locus_tag LOCUS_16580 171 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1057 599 gene locus_tag LOCUS_16590 1057 599 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_16590 2319 1069 gene locus_tag LOCUS_16600 2319 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2822 2559 gene locus_tag LOCUS_16610 2822 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2990 2871 gene locus_tag LOCUS_16620 2990 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence405 558 1784 gene locus_tag LOCUS_16630 558 1784 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_16630 1836 2636 gene locus_tag LOCUS_16640 gene uppP1 1836 2636 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_16640 >Feature sequence406 >Feature sequence407 721 368 gene locus_tag LOCUS_16650 721 368 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_16650 1546 722 gene locus_tag LOCUS_16660 gene dapD 1546 722 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB9 protein_id gnl|my_center|LOCUS_16660 2760 1564 gene locus_tag LOCUS_16670 2760 1564 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence408 191 1060 gene locus_tag LOCUS_16680 gene cas6_1 191 1060 CDS product CRISPR-associated protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_16680 1600 1854 gene locus_tag LOCUS_16690 1600 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence409 <1 1061 gene locus_tag LOCUS_16700 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948395.1:ADP-heptose--LPS heptosyltransferase 1067 2185 gene locus_tag LOCUS_16710 1067 2185 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_16710 2353 3021 gene locus_tag LOCUS_16720 2353 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence410 1045 905 gene locus_tag LOCUS_16730 1045 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1706 1128 gene locus_tag LOCUS_16740 1706 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence411 <1 1162 gene locus_tag LOCUS_16750 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNU6:S-(hydroxymethyl)glutathione dehydrogenase 1165 2013 gene locus_tag LOCUS_16760 1165 2013 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 protein_id gnl|my_center|LOCUS_16760 >Feature sequence412 1228 257 gene locus_tag LOCUS_16770 gene gspC 1228 257 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 protein_id gnl|my_center|LOCUS_16770 2279 1530 gene locus_tag LOCUS_16780 2279 1530 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCD0 protein_id gnl|my_center|LOCUS_16780 >Feature sequence413 813 3017 gene locus_tag LOCUS_16790 813 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence414 98 391 gene locus_tag LOCUS_16800 gene rplW 98 391 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I6 protein_id gnl|my_center|LOCUS_16800 420 1241 gene locus_tag LOCUS_16810 gene rplB 420 1241 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_16810 1277 1552 gene locus_tag LOCUS_16820 gene rpsS 1277 1552 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_16820 1562 1897 gene locus_tag LOCUS_16830 gene rplV 1562 1897 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW3 protein_id gnl|my_center|LOCUS_16830 1911 2579 gene locus_tag LOCUS_16840 gene rpsC 1911 2579 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_16840 2596 3009 gene locus_tag LOCUS_16850 gene rplP 2596 3009 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9L6 protein_id gnl|my_center|LOCUS_16850 >Feature sequence415 129 662 gene locus_tag LOCUS_16860 gene ppa 129 662 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSS7 protein_id gnl|my_center|LOCUS_16860 830 1402 gene locus_tag LOCUS_16870 830 1402 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_16870 <3183 1419 gene locus_tag LOCUS_16880 <3183 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein >Feature sequence416 >Feature sequence417 <1 1182 gene locus_tag LOCUS_16890 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P20580:anthranilate synthase component 1 1173 1754 gene locus_tag LOCUS_16900 1173 1754 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706958.1 protein_id gnl|my_center|LOCUS_16900 1780 2802 gene locus_tag LOCUS_16910 gene trpD 1780 2802 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_16910 >Feature sequence418 161 1303 gene locus_tag LOCUS_16920 161 1303 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705269.1 protein_id gnl|my_center|LOCUS_16920 1384 2577 gene locus_tag LOCUS_16930 gene purT 1384 2577 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY4 protein_id gnl|my_center|LOCUS_16930 2590 3105 gene locus_tag LOCUS_16940 gene sprT 2590 3105 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPT0 protein_id gnl|my_center|LOCUS_16940 >Feature sequence419 991 743 gene locus_tag LOCUS_16950 gene hfq 991 743 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_16950 2054 1113 gene locus_tag LOCUS_16960 gene miaA 2054 1113 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_16960 2279 2094 gene locus_tag LOCUS_16970 2279 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence420 <1 1741 gene locus_tag LOCUS_16980 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTY7:protein translocase subunit SecD 1758 2693 gene locus_tag LOCUS_16990 gene secF 1758 2693 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_16990 >Feature sequence421 226 1374 gene locus_tag LOCUS_17000 226 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2247 1420 gene locus_tag LOCUS_17010 2247 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 <3151 2248 gene locus_tag LOCUS_17020 <3151 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256604.1:glycosyl transferase family 1 >Feature sequence422 1178 564 gene locus_tag LOCUS_17030 1178 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2519 1260 gene locus_tag LOCUS_17040 2519 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence423 1907 2530 gene locus_tag LOCUS_17050 gene lexA 1907 2530 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0D1 protein_id gnl|my_center|LOCUS_17050 2897 2577 gene locus_tag LOCUS_17060 2897 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence424 2076 1132 gene locus_tag LOCUS_17070 gene scrK 2076 1132 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_17070 2800 2078 gene locus_tag LOCUS_17080 2800 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence425 <1 511 gene locus_tag LOCUS_17090 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104689.1:DNA polymerase III subunit epsilon 897 2780 gene locus_tag LOCUS_17100 897 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence426 22 423 gene locus_tag LOCUS_17110 22 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1790 642 gene locus_tag LOCUS_17120 1790 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2837 2487 gene locus_tag LOCUS_17130 2837 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence427 3059 252 gene locus_tag LOCUS_17140 3059 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence428 1483 359 gene locus_tag LOCUS_17150 1483 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence429 1311 1826 gene locus_tag LOCUS_17160 gene dhc 1311 1826 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_17160 2228 2830 gene locus_tag LOCUS_17170 2228 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence430 1 1395 gene locus_tag LOCUS_17180 1 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2018 1470 gene locus_tag LOCUS_17190 2018 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_17190 2978 2169 gene locus_tag LOCUS_17200 gene cysQ 2978 2169 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_17200 >Feature sequence431 491 1195 gene locus_tag LOCUS_17210 gene lolA 491 1195 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_17210 1212 2990 gene locus_tag LOCUS_17220 1212 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence432 1449 1373 gene locus_tag LOCUS_t00120 1449 1373 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1562 1487 gene locus_tag LOCUS_t00130 1562 1487 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3041 1638 gene locus_tag LOCUS_17230 gene gltX 3041 1638 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04805 protein_id gnl|my_center|LOCUS_17230 >Feature sequence433 <1 1251 gene locus_tag LOCUS_17240 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83CM5:bifunctional NAD(P)H-hydrate repair enzyme Nnr 1248 1724 gene locus_tag LOCUS_17250 1248 1724 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence434 1979 204 gene locus_tag LOCUS_17260 1979 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence435 636 983 gene locus_tag LOCUS_17270 636 983 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XAD1 protein_id gnl|my_center|LOCUS_17270 2098 1043 gene locus_tag LOCUS_17280 2098 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence436 2386 1037 gene locus_tag LOCUS_17290 2386 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence437 2403 1906 gene locus_tag LOCUS_17300 2403 1906 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_17300 2704 2390 gene locus_tag LOCUS_17310 2704 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence438 <1 1117 gene locus_tag LOCUS_17320 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103297.1:glycine oxidase ThiO 1743 1114 gene locus_tag LOCUS_17330 gene nth 1743 1114 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM8 protein_id gnl|my_center|LOCUS_17330 2414 1740 gene locus_tag LOCUS_17340 2414 1740 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_17340 <3047 2411 gene locus_tag LOCUS_17350 <3047 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYB6:electron transport complex subunit G >Feature sequence439 1888 449 gene locus_tag LOCUS_17360 1888 449 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_17360 <3045 2189 gene locus_tag LOCUS_17370 <3045 2189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLH9:iron deficiency-induced protein A >Feature sequence440 2836 926 gene locus_tag LOCUS_17380 2836 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence441 422 1450 gene locus_tag LOCUS_17390 422 1450 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198416.1 protein_id gnl|my_center|LOCUS_17390 1536 2435 gene locus_tag LOCUS_17400 1536 2435 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_17400 <3033 2421 gene locus_tag LOCUS_17410 <3033 2421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071232.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence442 <1 1158 gene locus_tag LOCUS_17420 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase/phosphodiesterase >Feature sequence443 407 532 gene locus_tag LOCUS_17430 407 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1233 616 gene locus_tag LOCUS_17440 gene folE 1233 616 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYB4 protein_id gnl|my_center|LOCUS_17440 1405 1821 gene locus_tag LOCUS_17450 1405 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1889 2203 gene locus_tag LOCUS_17460 1889 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2200 2553 gene locus_tag LOCUS_17470 2200 2553 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883347.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence444 178 103 gene locus_tag LOCUS_t00140 178 103 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1172 615 gene locus_tag LOCUS_17480 gene pgsA 1172 615 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104334.1 protein_id gnl|my_center|LOCUS_17480 <3024 1180 gene locus_tag LOCUS_17490 <3024 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0Q1:UvrABC system protein C >Feature sequence445 224 868 gene locus_tag LOCUS_17500 224 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 873 2045 gene locus_tag LOCUS_17510 873 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2061 2873 gene locus_tag LOCUS_17520 2061 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence446 2479 1127 gene locus_tag LOCUS_17530 2479 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence447 1151 687 gene locus_tag LOCUS_17540 1151 687 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_17540 1999 1421 gene locus_tag LOCUS_17550 1999 1421 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F82 protein_id gnl|my_center|LOCUS_17550 2958 2632 gene locus_tag LOCUS_17560 2958 2632 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WB4 protein_id gnl|my_center|LOCUS_17560 >Feature sequence448 >Feature sequence449 802 1845 gene locus_tag LOCUS_17570 802 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2047 2661 gene locus_tag LOCUS_17580 2047 2661 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence450 2048 1041 gene locus_tag LOCUS_17590 2048 1041 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_17590 2896 2066 gene locus_tag LOCUS_17600 gene omcP 2896 2066 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943544.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence451 <1 855 gene locus_tag LOCUS_17610 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948327.1:membrane protein 1255 2793 gene locus_tag LOCUS_17620 1255 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence452 1896 433 gene locus_tag LOCUS_17630 gene glgA 1896 433 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSI5 protein_id gnl|my_center|LOCUS_17630 >Feature sequence453 <1 1532 gene locus_tag LOCUS_17640 <1 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPW5:protein translocase subunit SecA 1779 2474 gene locus_tag LOCUS_17650 1779 2474 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196078.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence454 1368 1 gene locus_tag LOCUS_17660 gene purB 1368 1 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_17660 2044 1385 gene locus_tag LOCUS_17670 gene hflD 2044 1385 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QM0 protein_id gnl|my_center|LOCUS_17670 <2977 2064 gene locus_tag LOCUS_17680 <2977 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FRI2:tRNA-specific 2-thiouridylase MnmA >Feature sequence455 2379 1198 gene locus_tag LOCUS_17690 2379 1198 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence456 1113 412 gene locus_tag LOCUS_17700 1113 412 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_17700 1284 1114 gene locus_tag LOCUS_17710 1284 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1711 1322 gene locus_tag LOCUS_17720 1711 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2313 1855 gene locus_tag LOCUS_17730 2313 1855 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_17730 <2970 2370 gene locus_tag LOCUS_17740 <2970 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941642.1:tail protein >Feature sequence457 >Feature sequence458 <1 1942 gene locus_tag LOCUS_17750 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000166134.1:glycyl radical enzyme 1953 2609 gene locus_tag LOCUS_17760 1953 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence459 1142 1963 gene locus_tag LOCUS_17770 1142 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1968 2927 gene locus_tag LOCUS_17780 1968 2927 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707318.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence460 676 224 gene locus_tag LOCUS_17790 676 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1214 663 gene locus_tag LOCUS_17800 1214 663 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_17800 2245 1232 gene locus_tag LOCUS_17810 2245 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2961 2521 gene locus_tag LOCUS_17820 2961 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence461 1188 766 gene locus_tag LOCUS_17830 1188 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1709 1293 gene locus_tag LOCUS_17840 1709 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2307 2017 gene locus_tag LOCUS_17850 2307 2017 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_17850 2560 2300 gene locus_tag LOCUS_17860 2560 2300 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E847 protein_id gnl|my_center|LOCUS_17860 >Feature sequence462 626 294 gene locus_tag LOCUS_17870 626 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 777 2336 gene locus_tag LOCUS_17880 777 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence463 1161 331 gene locus_tag LOCUS_17890 gene ugpE 1161 331 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3H6 protein_id gnl|my_center|LOCUS_17890 2045 1158 gene locus_tag LOCUS_17900 2045 1158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887225.1 protein_id gnl|my_center|LOCUS_17900 2953 2042 gene locus_tag LOCUS_17910 2953 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence464 1763 1023 gene locus_tag LOCUS_17920 1763 1023 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 protein_id gnl|my_center|LOCUS_17920 2596 1859 gene locus_tag LOCUS_17930 2596 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence465 265 1086 gene locus_tag LOCUS_17940 265 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2328 1138 gene locus_tag LOCUS_17950 2328 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence466 707 282 gene locus_tag LOCUS_17960 707 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1564 2814 gene locus_tag LOCUS_17970 1564 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence467 1912 719 gene locus_tag LOCUS_17980 1912 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2012 1821 gene locus_tag LOCUS_17990 2012 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence468 <1 2394 gene locus_tag LOCUS_18000 <1 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HY08:DNA mismatch repair protein MutS 2487 2810 gene locus_tag LOCUS_18010 gene fdxA 2487 2810 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_18010 >Feature sequence469 51 788 gene locus_tag LOCUS_18020 51 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 810 1919 gene locus_tag LOCUS_18030 gene kynU 810 1919 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_18030 2353 2027 gene locus_tag LOCUS_18040 2353 2027 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947495.1 protein_id gnl|my_center|LOCUS_18040 2475 2897 gene locus_tag LOCUS_18050 2475 2897 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531063.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence470 169 762 gene locus_tag LOCUS_18060 169 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 775 1944 gene locus_tag LOCUS_18070 775 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2025 2345 gene locus_tag LOCUS_18080 2025 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2876 2403 gene locus_tag LOCUS_18090 2876 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence471 1377 265 gene locus_tag LOCUS_18100 1377 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2230 2796 gene locus_tag LOCUS_18110 2230 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence472 1083 442 gene locus_tag LOCUS_18120 1083 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2112 1195 gene locus_tag LOCUS_18130 2112 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 <2932 2187 gene locus_tag LOCUS_18140 <2932 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence473 101 1117 gene locus_tag LOCUS_18150 gene hemB 101 1117 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_18150 >Feature sequence474 1238 195 gene locus_tag LOCUS_18160 1238 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2091 1261 gene locus_tag LOCUS_18170 2091 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2890 2093 gene locus_tag LOCUS_18180 2890 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence475 <2925 1714 gene locus_tag LOCUS_18190 <2925 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence476 1308 2423 gene locus_tag LOCUS_18200 1308 2423 CDS product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence477 169 360 gene locus_tag LOCUS_18210 169 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 472 1704 gene locus_tag LOCUS_18220 472 1704 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039428.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence478 2038 1160 gene locus_tag LOCUS_18230 2038 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 <2906 2050 gene locus_tag LOCUS_18240 <2906 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147933.1:ATP-dependent DNA helicase >Feature sequence479 482 1795 gene locus_tag LOCUS_18250 482 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence480 1497 2336 gene locus_tag LOCUS_18260 1497 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence481 310 1581 gene locus_tag LOCUS_18270 310 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2037 1756 gene locus_tag LOCUS_18280 2037 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence482 <2893 204 gene locus_tag LOCUS_18290 <2893 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140960.1:urea carboxylase note possible pseudo, internal stop codon >Feature sequence483 <2889 399 gene locus_tag LOCUS_18300 <2889 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039500.1:inner membrane transport permease >Feature sequence484 207 2501 gene locus_tag LOCUS_18310 207 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence485 <1 549 gene locus_tag LOCUS_18320 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056097.1:glycosyl transferase 776 522 gene locus_tag LOCUS_18330 776 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1193 786 gene locus_tag LOCUS_18340 1193 786 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200966.1 protein_id gnl|my_center|LOCUS_18340 2078 1203 gene locus_tag LOCUS_18350 2078 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence486 887 264 gene locus_tag LOCUS_18360 887 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1424 897 gene locus_tag LOCUS_18370 1424 897 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_18370 1953 1435 gene locus_tag LOCUS_18380 1953 1435 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_18380 2496 1987 gene locus_tag LOCUS_18390 2496 1987 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence487 1055 159 gene locus_tag LOCUS_18400 1055 159 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_18400 2671 1052 gene locus_tag LOCUS_18410 2671 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence488 776 450 gene locus_tag LOCUS_18420 776 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_18420 <2879 773 gene locus_tag LOCUS_18430 <2879 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67026:UPF0753 protein >Feature sequence489 1289 2674 gene locus_tag LOCUS_18440 gene dbpA 1289 2674 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762956.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence490 972 310 gene locus_tag LOCUS_18450 972 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1602 1075 gene locus_tag LOCUS_18460 1602 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1924 2487 gene locus_tag LOCUS_18470 1924 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2866 2489 gene locus_tag LOCUS_18480 2866 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence491 2 736 gene locus_tag LOCUS_18490 2 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 720 1466 gene locus_tag LOCUS_18500 720 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1475 2767 gene locus_tag LOCUS_18510 1475 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263401.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence492 >Feature sequence493 1031 57 gene locus_tag LOCUS_18520 1031 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1756 1031 gene locus_tag LOCUS_18530 1756 1031 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_18530 2011 2340 gene locus_tag LOCUS_18540 2011 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence494 387 578 gene locus_tag LOCUS_18550 387 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence495 417 49 gene locus_tag LOCUS_18560 417 49 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_18560 1148 729 gene locus_tag LOCUS_18570 gene pilG 1148 729 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_18570 1281 2591 gene locus_tag LOCUS_18580 1281 2591 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958508.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence496 1138 815 gene locus_tag LOCUS_18590 gene clpS 1138 815 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_18590 1889 2122 gene locus_tag LOCUS_18600 1889 2122 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence497 <1 738 gene locus_tag LOCUS_18610 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528434.1:short-chain dehydrogenase/reductase >Feature sequence498 >Feature sequence499 808 2406 gene locus_tag LOCUS_18620 gene nadB 808 2406 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_18620 >Feature sequence500 >Feature sequence501 1106 276 gene locus_tag LOCUS_18630 1106 276 CDS product sigma E regulatory protein, MucB/RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_18630 2235 1081 gene locus_tag LOCUS_18640 2235 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2507 2737 gene locus_tag LOCUS_18650 2507 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence502 2481 523 gene locus_tag LOCUS_18660 2481 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55368 protein_id gnl|my_center|LOCUS_18660 >Feature sequence503 >Feature sequence504 <1 768 gene locus_tag LOCUS_18670 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088478.1:nitrate ABC transporter substrate-binding protein 768 1598 gene locus_tag LOCUS_18680 gene nrtB 768 1598 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 protein_id gnl|my_center|LOCUS_18680 1608 2525 gene locus_tag LOCUS_18690 gene nrtC 1608 2525 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence505 >Feature sequence506 1418 510 gene locus_tag LOCUS_18700 1418 510 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_18700 2600 1536 gene locus_tag LOCUS_18710 2600 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence507 <1 1142 gene locus_tag LOCUS_18720 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PD63:acetyl-coenzyme A synthetase 2377 1232 gene locus_tag LOCUS_18730 2377 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence508 1668 307 gene locus_tag LOCUS_18740 1668 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence509 1015 278 gene locus_tag LOCUS_18750 1015 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2076 1555 gene locus_tag LOCUS_18760 2076 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525332.1 protein_id gnl|my_center|LOCUS_18760 2432 2073 gene locus_tag LOCUS_18770 2432 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525337.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence510 1378 731 gene locus_tag LOCUS_18780 1378 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2649 1372 gene locus_tag LOCUS_18790 2649 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence511 <1 795 gene locus_tag LOCUS_18800 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96110:glutamate dehydrogenase >Feature sequence512 105 30 gene locus_tag LOCUS_t00150 105 30 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 915 160 gene locus_tag LOCUS_18810 915 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1658 912 gene locus_tag LOCUS_18820 gene coaX 1658 912 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XZ2 protein_id gnl|my_center|LOCUS_18820 2632 1661 gene locus_tag LOCUS_18830 gene birA 2632 1661 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_18830 >Feature sequence513 <1 1220 gene locus_tag LOCUS_18840 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X1S1:D-glycerate 2-kinase 2141 1233 gene locus_tag LOCUS_18850 2141 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence514 <1 524 gene locus_tag LOCUS_18860 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPD0:tRNA-dihydrouridine(20/20a) synthase >Feature sequence515 1066 1647 gene locus_tag LOCUS_18870 1066 1647 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_18870 1681 2163 gene locus_tag LOCUS_18880 1681 2163 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F37 protein_id gnl|my_center|LOCUS_18880 2191 2709 gene locus_tag LOCUS_18890 2191 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence516 267 1481 gene locus_tag LOCUS_18900 gene bchP 267 1481 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933906.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence517 >Feature sequence518 1248 484 gene locus_tag LOCUS_18910 1248 484 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_18910 2737 1457 gene locus_tag LOCUS_18920 gene hemY 2737 1457 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence519 >Feature sequence520 261 869 gene locus_tag LOCUS_18930 261 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1282 1163 gene locus_tag LOCUS_18940 1282 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1281 1958 gene locus_tag LOCUS_18950 1281 1958 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence521 1732 458 gene locus_tag LOCUS_18960 gene cycH 1732 458 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_18960 2208 1729 gene locus_tag LOCUS_18970 gene ccmH 2208 1729 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262346.1 protein_id gnl|my_center|LOCUS_18970 <2754 2205 gene locus_tag LOCUS_18980 <2754 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3N1:thiol:disulfide interchange protein DsbE >Feature sequence522 <1 1687 gene locus_tag LOCUS_18990 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2W9:phosphoenolpyruvate synthase 2184 1771 gene locus_tag LOCUS_19000 2184 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence523 130 792 gene locus_tag LOCUS_19010 130 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1545 754 gene locus_tag LOCUS_19020 1545 754 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_19020 1564 2562 gene locus_tag LOCUS_19030 1564 2562 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence524 2039 870 gene locus_tag LOCUS_19040 2039 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2743 2036 gene locus_tag LOCUS_19050 2743 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence525 1322 1666 gene locus_tag LOCUS_19060 1322 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence526 >Feature sequence527 861 145 gene locus_tag LOCUS_19070 861 145 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388129.1 protein_id gnl|my_center|LOCUS_19070 2587 836 gene locus_tag LOCUS_19080 gene yehU 2587 836 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence528 1796 399 gene locus_tag LOCUS_19090 1796 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 <2731 1852 gene locus_tag LOCUS_19100 <2731 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83D71:alanine racemase >Feature sequence529 1686 2300 gene locus_tag LOCUS_19110 1686 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence530 209 1069 gene locus_tag LOCUS_19120 209 1069 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_19120 1732 1301 gene locus_tag LOCUS_19130 1732 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2104 1841 gene locus_tag LOCUS_19140 2104 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence531 412 152 gene locus_tag LOCUS_19150 412 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 614 1450 gene locus_tag LOCUS_19160 gene hdtR 614 1450 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence532 430 1104 gene locus_tag LOCUS_19170 gene flgD 430 1104 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_19170 1127 2401 gene locus_tag LOCUS_19180 gene flgE 1127 2401 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW68 protein_id gnl|my_center|LOCUS_19180 >Feature sequence533 1317 472 gene locus_tag LOCUS_19190 1317 472 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_19190 1936 1490 gene locus_tag LOCUS_19200 1936 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence534 1191 1814 gene locus_tag LOCUS_19210 1191 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1862 2296 gene locus_tag LOCUS_19220 1862 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence535 <1 900 gene locus_tag LOCUS_19230 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNA2:RNA-splicing ligase RtcB 1024 1995 gene locus_tag LOCUS_19240 1024 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1996 2634 gene locus_tag LOCUS_19250 gene prfH 1996 2634 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 protein_id gnl|my_center|LOCUS_19250 2696 2620 gene locus_tag LOCUS_t00160 2696 2620 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence536 <1 931 gene locus_tag LOCUS_19260 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114121.1:GGDEF domain-containing protein >Feature sequence537 427 251 gene locus_tag LOCUS_19270 427 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 759 917 gene locus_tag LOCUS_19280 759 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 943 2625 gene locus_tag LOCUS_19290 943 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence538 838 254 gene locus_tag LOCUS_19300 838 254 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_19300 2359 950 gene locus_tag LOCUS_19310 2359 950 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_19310 >Feature sequence539 <2669 1172 gene locus_tag LOCUS_19320 <2669 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118575.1:nitrite reductase >Feature sequence540 154 552 gene locus_tag LOCUS_19330 154 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2153 570 gene locus_tag LOCUS_19340 2153 570 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence541 >Feature sequence542 512 57 gene locus_tag LOCUS_19350 512 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_19350 1404 523 gene locus_tag LOCUS_19360 1404 523 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_19360 1542 1763 gene locus_tag LOCUS_19370 1542 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1768 2064 gene locus_tag LOCUS_19380 1768 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence543 <1 2304 gene locus_tag LOCUS_19390 <1 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein >Feature sequence544 1014 343 gene locus_tag LOCUS_19400 gene macB 1014 343 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_19400 1537 1019 gene locus_tag LOCUS_19410 1537 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2224 1574 gene locus_tag LOCUS_19420 2224 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence545 146 445 gene locus_tag LOCUS_19430 146 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1425 439 gene locus_tag LOCUS_19440 gene bioB 1425 439 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MW9 protein_id gnl|my_center|LOCUS_19440 >Feature sequence546 87 1199 gene locus_tag LOCUS_19450 gene hypD2 87 1199 CDS product hydrogenase expression/formation protein hypD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31904 protein_id gnl|my_center|LOCUS_19450 1199 2221 gene locus_tag LOCUS_19460 gene hypE 1199 2221 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence547 1964 537 gene locus_tag LOCUS_19470 1964 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 <2626 2047 gene locus_tag LOCUS_19480 <2626 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334319.1:hybrid sensor histidine kinase/response regulator >Feature sequence548 >Feature sequence549 1595 228 gene locus_tag LOCUS_19490 gene glmU 1595 228 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KB0 protein_id gnl|my_center|LOCUS_19490 2262 1837 gene locus_tag LOCUS_19500 gene atpC 2262 1837 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRA2 protein_id gnl|my_center|LOCUS_19500 >Feature sequence550 306 989 gene locus_tag LOCUS_19510 306 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence551 2312 1557 gene locus_tag LOCUS_19520 2312 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence552 883 629 gene locus_tag LOCUS_19530 883 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19530 1267 896 gene locus_tag LOCUS_19540 1267 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19540 1997 1269 gene locus_tag LOCUS_19550 1997 1269 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_19550 <2612 2011 gene locus_tag LOCUS_19560 <2612 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268763.1:lauroyl acyltransferase >Feature sequence553 >Feature sequence554 <1 1080 gene locus_tag LOCUS_19570 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205688.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 1090 2151 gene locus_tag LOCUS_19580 gene rffG 1090 2151 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WAE8 protein_id gnl|my_center|LOCUS_19580 >Feature sequence555 <1 1181 gene locus_tag LOCUS_19590 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPU4:aconitate hydratase B 1724 2152 gene locus_tag LOCUS_19600 1724 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence556 689 468 gene locus_tag LOCUS_19610 689 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 <2599 1689 gene locus_tag LOCUS_19620 <2599 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099358.1:chemotaxis transducer >Feature sequence557 <1 723 gene locus_tag LOCUS_19630 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070889.1:response regulator 1916 735 gene locus_tag LOCUS_19640 1916 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence558 <1 771 gene locus_tag LOCUS_19650 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114710.1:glycerate dehydrogenase note possible pseudo, frameshifted 723 911 gene locus_tag LOCUS_19660 723 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 905 2365 gene locus_tag LOCUS_19670 gene glpK1 905 2365 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X049 protein_id gnl|my_center|LOCUS_19670 >Feature sequence559 1430 165 gene locus_tag LOCUS_19680 1430 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1726 2241 gene locus_tag LOCUS_19690 gene ymdB 1726 2241 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence560 1156 1968 gene locus_tag LOCUS_19700 1156 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence561 181 678 gene locus_tag LOCUS_19710 181 678 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709362.1 protein_id gnl|my_center|LOCUS_19710 1531 632 gene locus_tag LOCUS_19720 1531 632 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_19720 1965 1534 gene locus_tag LOCUS_19730 1965 1534 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_19730 2291 2049 gene locus_tag LOCUS_19740 2291 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence562 994 701 gene locus_tag LOCUS_19750 994 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1367 984 gene locus_tag LOCUS_19760 1367 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1569 1339 gene locus_tag LOCUS_19770 1569 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence563 <1 570 gene locus_tag LOCUS_19780 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5R7:S-adenosylmethionine decarboxylase proenzyme 1387 707 gene locus_tag LOCUS_19790 gene coq7 1387 707 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_19790 2565 1405 gene locus_tag LOCUS_19800 2565 1405 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC7 protein_id gnl|my_center|LOCUS_19800 >Feature sequence564 1268 1750 gene locus_tag LOCUS_19810 1268 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369713.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence565 348 1379 gene locus_tag LOCUS_19820 348 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence566 >Feature sequence567 >Feature sequence568 400 1707 gene locus_tag LOCUS_19830 400 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1777 2289 gene locus_tag LOCUS_19840 1777 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence569 458 36 gene locus_tag LOCUS_19850 458 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1145 744 gene locus_tag LOCUS_19860 1145 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1698 1429 gene locus_tag LOCUS_19870 1698 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2170 1727 gene locus_tag LOCUS_19880 2170 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence570 >Feature sequence571 <1 1766 gene locus_tag LOCUS_19890 <1 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KND9:polyribonucleotide nucleotidyltransferase 2530 1862 gene locus_tag LOCUS_19900 2530 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence572 1003 470 gene locus_tag LOCUS_19910 1003 470 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_19910 1140 1367 gene locus_tag LOCUS_19920 1140 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence573 <2529 1009 gene locus_tag LOCUS_19930 <2529 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYB8:electron transport complex subunit C >Feature sequence574 1463 1329 gene locus_tag LOCUS_19940 1463 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence575 >Feature sequence576 1979 1722 gene locus_tag LOCUS_19950 gene fdx1 1979 1722 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_19950 2492 2016 gene locus_tag LOCUS_19960 gene coaD 2492 2016 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence577 1400 1059 gene locus_tag LOCUS_19970 1400 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2426 1710 gene locus_tag LOCUS_19980 2426 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence578 >Feature sequence579 757 1506 gene locus_tag LOCUS_19990 gene omcE 757 1506 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence580 1786 359 gene locus_tag LOCUS_20000 1786 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence581 390 46 gene locus_tag LOCUS_20010 390 46 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708900.1 protein_id gnl|my_center|LOCUS_20010 988 521 gene locus_tag LOCUS_20020 988 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1677 1081 gene locus_tag LOCUS_20030 1677 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence582 260 568 gene locus_tag LOCUS_20040 260 568 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_20040 688 1116 gene locus_tag LOCUS_20050 gene rplM 688 1116 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQB9 protein_id gnl|my_center|LOCUS_20050 1137 1529 gene locus_tag LOCUS_20060 gene rpsI 1137 1529 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66644 protein_id gnl|my_center|LOCUS_20060 >Feature sequence583 221 988 gene locus_tag LOCUS_20070 gene znuC 221 988 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_20070 981 1772 gene locus_tag LOCUS_20080 gene znuB 981 1772 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_20080 1814 2044 gene locus_tag LOCUS_20090 1814 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence584 <1 523 gene locus_tag LOCUS_20100 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZRU4:NADH-quinone oxidoreductase 583 1629 gene locus_tag LOCUS_20110 gene nuoH 583 1629 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_20110 1641 2129 gene locus_tag LOCUS_20120 gene nuoI 1641 2129 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIM7 protein_id gnl|my_center|LOCUS_20120 >Feature sequence585 199 531 gene locus_tag LOCUS_20130 199 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1832 546 gene locus_tag LOCUS_20140 gene apeB 1832 546 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_20140 2307 1855 gene locus_tag LOCUS_20150 2307 1855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence586 <1 815 gene locus_tag LOCUS_20160 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941134.1:cytochrome c biogenesis protein CcsA 848 1387 gene locus_tag LOCUS_20170 848 1387 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 protein_id gnl|my_center|LOCUS_20170 1534 2283 gene locus_tag LOCUS_20180 1534 2283 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC3 protein_id gnl|my_center|LOCUS_20180 >Feature sequence587 1230 520 gene locus_tag LOCUS_20190 gene pyrF 1230 520 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX90 protein_id gnl|my_center|LOCUS_20190 2407 1253 gene locus_tag LOCUS_20200 gene lapB 2407 1253 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_20200 >Feature sequence588 763 308 gene locus_tag LOCUS_20210 763 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1512 775 gene locus_tag LOCUS_20220 1512 775 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence589 165 713 gene locus_tag LOCUS_20230 165 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 806 1306 gene locus_tag LOCUS_20240 806 1306 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710172.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20240 >Feature sequence590 1567 35 gene locus_tag LOCUS_20250 1567 35 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_20250 1963 1610 gene locus_tag LOCUS_20260 1963 1610 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883347.1 protein_id gnl|my_center|LOCUS_20260 2274 1960 gene locus_tag LOCUS_20270 2274 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence591 742 1425 gene locus_tag LOCUS_20280 742 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1761 1492 gene locus_tag LOCUS_20290 1761 1492 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213017.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence592 2065 1457 gene locus_tag LOCUS_20300 2065 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence593 1001 2467 gene locus_tag LOCUS_20310 gene htrA 1001 2467 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6T0 protein_id gnl|my_center|LOCUS_20310 >Feature sequence594 1206 109 gene locus_tag LOCUS_20320 1206 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 <2480 1222 gene locus_tag LOCUS_20330 <2480 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947081.1:aldehyde dehydrogenase >Feature sequence595 211 1035 gene locus_tag LOCUS_20340 211 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence596 1163 321 gene locus_tag LOCUS_20350 1163 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1251 1787 gene locus_tag LOCUS_20360 1251 1787 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_20360 <2476 1803 gene locus_tag LOCUS_20370 <2476 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104152.1:two-component system sensor histidine kinase/response regulator >Feature sequence597 605 1024 gene locus_tag LOCUS_20380 605 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence598 508 981 gene locus_tag LOCUS_20390 gene cheW 508 981 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_20390 1000 1176 gene locus_tag LOCUS_20400 1000 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1185 1565 gene locus_tag LOCUS_20410 1185 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 <2474 1562 gene locus_tag LOCUS_20420 <2474 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJM6:cyclic di-GMP phosphodiesterase PdeB >Feature sequence599 805 137 gene locus_tag LOCUS_20430 805 137 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_20430 1259 837 gene locus_tag LOCUS_20440 1259 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089945.1 protein_id gnl|my_center|LOCUS_20440 1678 2301 gene locus_tag LOCUS_20450 gene gst15 1678 2301 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974933.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence600 <2471 1269 gene locus_tag LOCUS_20460 <2471 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925685.1:histidine kinase >Feature sequence601 243 770 gene locus_tag LOCUS_20470 243 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence602 <1 844 gene locus_tag LOCUS_20480 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771912.1:2-oxoisovalerate dehydrogenase subunit beta 841 1992 gene locus_tag LOCUS_20490 841 1992 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DQ8 protein_id gnl|my_center|LOCUS_20490 2267 2049 gene locus_tag LOCUS_20500 2267 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence603 <1 624 gene locus_tag LOCUS_20510 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097243.1:chromosome partitioning protein Soj 666 1550 gene locus_tag LOCUS_20520 gene parB 666 1550 CDS product putative chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AH2 protein_id gnl|my_center|LOCUS_20520 1844 2047 gene locus_tag LOCUS_20530 1844 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2049 2441 gene locus_tag LOCUS_20540 2049 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence604 854 441 gene locus_tag LOCUS_20550 854 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_20550 1323 856 gene locus_tag LOCUS_20560 1323 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528643.1 protein_id gnl|my_center|LOCUS_20560 2228 1353 gene locus_tag LOCUS_20570 2228 1353 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R390 protein_id gnl|my_center|LOCUS_20570 >Feature sequence605 1826 429 gene locus_tag LOCUS_20580 1826 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence606 701 1756 gene locus_tag LOCUS_20590 gene mtnA 701 1756 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_20590 >Feature sequence607 498 803 gene locus_tag LOCUS_20600 gene ihfA 498 803 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG1 protein_id gnl|my_center|LOCUS_20600 778 1143 gene locus_tag LOCUS_20610 778 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_20610 1221 1297 gene locus_tag LOCUS_t00170 1221 1297 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence608 1858 8 gene locus_tag LOCUS_20620 gene alsS 1858 8 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966914.1 protein_id gnl|my_center|LOCUS_20620 2134 2009 gene locus_tag LOCUS_20630 2134 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence609 533 946 gene locus_tag LOCUS_20640 533 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 928 1425 gene locus_tag LOCUS_20650 928 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1448 1963 gene locus_tag LOCUS_20660 1448 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence610 <1 817 gene locus_tag LOCUS_20670 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83BH2:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 841 1980 gene locus_tag LOCUS_20680 gene yibP 841 1980 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence611 831 277 gene locus_tag LOCUS_20690 831 277 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D36 protein_id gnl|my_center|LOCUS_20690 930 1655 gene locus_tag LOCUS_20700 930 1655 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980794.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence612 212 1492 gene locus_tag LOCUS_20710 gene pyrC 212 1492 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ71 protein_id gnl|my_center|LOCUS_20710 >Feature sequence613 159 587 gene locus_tag LOCUS_20720 159 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1053 574 gene locus_tag LOCUS_20730 1053 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888249.1 protein_id gnl|my_center|LOCUS_20730 1893 1231 gene locus_tag LOCUS_20740 1893 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence614 499 281 gene locus_tag LOCUS_20750 499 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 protein_id gnl|my_center|LOCUS_20750 540 671 gene locus_tag LOCUS_20760 540 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1207 926 gene locus_tag LOCUS_20770 1207 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence615 250 1641 gene locus_tag LOCUS_20780 gene argH 250 1641 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_20780 <2441 1856 gene locus_tag LOCUS_20790 <2441 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814405.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence616 <1 676 gene locus_tag LOCUS_20800 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766740.1:N-ethylammeline chlorohydrolase 691 1413 gene locus_tag LOCUS_20810 gene ubiG 691 1413 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_20810 1425 2102 gene locus_tag LOCUS_20820 gene gph 1425 2102 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence617 2437 1406 gene locus_tag LOCUS_20830 2437 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence618 476 2068 gene locus_tag LOCUS_20840 476 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2252 2432 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaaacgatgaccggtatatgaacgggattgaaac >Feature sequence619 1127 2005 gene locus_tag LOCUS_20850 1127 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence620 2207 150 gene locus_tag LOCUS_20860 2207 150 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence621 <1 684 gene locus_tag LOCUS_20870 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH80:alpha-1,4 glucan phosphorylase 1368 775 gene locus_tag LOCUS_20880 1368 775 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_20880 2385 1834 gene locus_tag LOCUS_20890 2385 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence622 3 1169 gene locus_tag LOCUS_20900 3 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1166 1642 gene locus_tag LOCUS_20910 gene greA 1166 1642 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64282 protein_id gnl|my_center|LOCUS_20910 1672 2118 gene locus_tag LOCUS_20920 1672 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence623 1561 545 gene locus_tag LOCUS_20930 gene ddlA 1561 545 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence624 193 630 gene locus_tag LOCUS_20940 gene infC 193 630 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_20940 963 1319 gene locus_tag LOCUS_20950 gene rplT 963 1319 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A479 protein_id gnl|my_center|LOCUS_20950 >Feature sequence625 198 1265 gene locus_tag LOCUS_20960 198 1265 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_20960 1756 1502 gene locus_tag LOCUS_20970 1756 1502 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence626 330 2393 gene locus_tag LOCUS_20980 gene flhA 330 2393 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence627 1934 1338 gene locus_tag LOCUS_20990 1934 1338 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence628 <1 1191 gene locus_tag LOCUS_21000 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024256.1:histidine kinase >Feature sequence629 2334 139 gene locus_tag LOCUS_21010 2334 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence630 <1 641 gene locus_tag LOCUS_21020 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478689.1:GGDEF domain-containing protein 1504 728 gene locus_tag LOCUS_21030 1504 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence631 357 1445 gene locus_tag LOCUS_21040 gene dusB 357 1445 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_21040 1454 1780 gene locus_tag LOCUS_21050 1454 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence632 312 518 gene locus_tag LOCUS_21060 312 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 705 1598 gene locus_tag LOCUS_21070 gene fieF 705 1598 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPK2 protein_id gnl|my_center|LOCUS_21070 2158 1628 gene locus_tag LOCUS_21080 gene yneN 2158 1628 CDS product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 protein_id gnl|my_center|LOCUS_21080 >Feature sequence633 400 1260 gene locus_tag LOCUS_21090 400 1260 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_21090 1324 1515 gene locus_tag LOCUS_21100 1324 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1561 1710 gene locus_tag LOCUS_21110 1561 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence634 2289 1252 gene locus_tag LOCUS_21120 2289 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence635 384 632 gene locus_tag LOCUS_21130 384 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1943 702 gene locus_tag LOCUS_21140 1943 702 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_21140 2306 1968 gene locus_tag LOCUS_21150 gene glnK 2306 1968 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence636 1094 45 gene locus_tag LOCUS_21160 1094 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2011 1379 gene locus_tag LOCUS_21170 2011 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence637 595 511 gene locus_tag LOCUS_t00180 595 511 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 741 666 gene locus_tag LOCUS_t00190 741 666 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 968 893 gene locus_tag LOCUS_t00200 968 893 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1067 991 gene locus_tag LOCUS_t00210 1067 991 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1221 1145 gene locus_tag LOCUS_t00220 1221 1145 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <2376 1453 gene locus_tag LOCUS_21180 <2376 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114618.1:MFS metabolite transporter >Feature sequence638 <1 611 gene locus_tag LOCUS_21190 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105000.1:two-component sensor histidine kinase 1090 608 gene locus_tag LOCUS_21200 1090 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1796 1098 gene locus_tag LOCUS_21210 1796 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2172 1786 gene locus_tag LOCUS_21220 2172 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence639 2368 1238 gene locus_tag LOCUS_21230 gene oppC 2368 1238 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence640 554 1729 gene locus_tag LOCUS_21240 554 1729 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_21240 1739 2110 gene locus_tag LOCUS_21250 1739 2110 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence641 883 476 gene locus_tag LOCUS_21260 883 476 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_21260 1493 894 gene locus_tag LOCUS_21270 gene tolQ 1493 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881300.1 protein_id gnl|my_center|LOCUS_21270 <2362 1497 gene locus_tag LOCUS_21280 <2362 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459000.1:biopolymer transporter ExbB >Feature sequence642 1027 245 gene locus_tag LOCUS_21290 1027 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2169 1168 gene locus_tag LOCUS_21300 gene yesN 2169 1168 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence643 1784 102 gene locus_tag LOCUS_21310 1784 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence644 1569 670 gene locus_tag LOCUS_21320 1569 670 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_21320 1673 2161 gene locus_tag LOCUS_21330 1673 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2353 2198 gene locus_tag LOCUS_21340 2353 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence645 >Feature sequence646 1964 423 gene locus_tag LOCUS_21350 gene atpA2 1964 423 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_21350 >Feature sequence647 <1 862 gene locus_tag LOCUS_21360 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090710.1:peptide ABC transporter permease 862 2055 gene locus_tag LOCUS_21370 862 2055 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence648 590 147 gene locus_tag LOCUS_21380 590 147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_21380 <2349 626 gene locus_tag LOCUS_21390 <2349 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009934486.1:histidine kinase >Feature sequence649 1189 95 gene locus_tag LOCUS_21400 1189 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_21400 2322 1186 gene locus_tag LOCUS_21410 2322 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence650 984 586 gene locus_tag LOCUS_21420 gene vapC 984 586 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JND5 protein_id gnl|my_center|LOCUS_21420 1217 984 gene locus_tag LOCUS_21430 gene vagC 1217 984 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_21430 1486 1764 gene locus_tag LOCUS_21440 1486 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence651 239 69 gene locus_tag LOCUS_21450 239 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2166 340 gene locus_tag LOCUS_21460 2166 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence652 1006 263 gene locus_tag LOCUS_21470 gene surE 1006 263 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KI21 protein_id gnl|my_center|LOCUS_21470 <2342 1317 gene locus_tag LOCUS_21480 <2342 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9J7:chemotaxis response regulator protein-glutamate methylesterase of group 1 operon >Feature sequence653 1322 1690 gene locus_tag LOCUS_21490 1322 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence654 1515 433 gene locus_tag LOCUS_21500 1515 433 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119671.1 protein_id gnl|my_center|LOCUS_21500 <2341 1512 gene locus_tag LOCUS_21510 <2341 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118252.1:integrase >Feature sequence655 1589 744 gene locus_tag LOCUS_21520 1589 744 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_21520 <2341 1586 gene locus_tag LOCUS_21530 <2341 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WES9:tryptophan--tRNA ligase >Feature sequence656 1772 900 gene locus_tag LOCUS_21540 1772 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1917 1789 gene locus_tag LOCUS_21550 1917 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence657 195 1682 gene locus_tag LOCUS_21560 195 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence658 1185 586 gene locus_tag LOCUS_21570 1185 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1556 1699 gene locus_tag LOCUS_21580 1556 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1735 2076 gene locus_tag LOCUS_21590 1735 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence659 <1 504 gene locus_tag LOCUS_21600 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5FJL4:LexA repressor 1571 597 gene locus_tag LOCUS_21610 1571 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2130 1690 gene locus_tag LOCUS_21620 2130 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence660 1263 286 gene locus_tag LOCUS_21630 gene oppB 1263 286 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_21630 <2301 1270 gene locus_tag LOCUS_21640 <2301 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946694.1:ABC transporter substrate-binding protein >Feature sequence661 632 30 gene locus_tag LOCUS_21650 gene recR 632 30 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFY1 protein_id gnl|my_center|LOCUS_21650 980 654 gene locus_tag LOCUS_21660 980 654 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_21660 <2294 1007 gene locus_tag LOCUS_21670 <2294 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948444.1:DNA polymerase III, subunit gamma and tau >Feature sequence662 <2288 1606 gene locus_tag LOCUS_21680 <2288 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EHN1:CRISPR-associated endonuclease Cas1 >Feature sequence663 891 208 gene locus_tag LOCUS_21690 gene trmB 891 208 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_21690 1724 912 gene locus_tag LOCUS_21700 gene thiG 1724 912 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_21700 1999 1799 gene locus_tag LOCUS_21710 gene thiS 1999 1799 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence664 92 1225 gene locus_tag LOCUS_21720 92 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_21720 1234 1935 gene locus_tag LOCUS_21730 gene aat 1234 1935 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW8 protein_id gnl|my_center|LOCUS_21730 >Feature sequence665 288 1439 gene locus_tag LOCUS_21740 288 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2160 1411 gene locus_tag LOCUS_21750 gene cobS 2160 1411 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN06 protein_id gnl|my_center|LOCUS_21750 >Feature sequence666 1103 201 gene locus_tag LOCUS_21760 1103 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence667 >Feature sequence668 742 44 gene locus_tag LOCUS_21770 gene drrA 742 44 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_21770 1348 752 gene locus_tag LOCUS_21780 1348 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence669 1770 1012 gene locus_tag LOCUS_21790 1770 1012 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence670 >Feature sequence671 <1 600 gene locus_tag LOCUS_21800 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143747.1:LysR family transcriptional regulator 1531 602 gene locus_tag LOCUS_21810 1531 602 CDS product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930109.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence672 <2256 963 gene locus_tag LOCUS_21820 <2256 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036697.1:methionine synthase >Feature sequence673 400 762 gene locus_tag LOCUS_21830 400 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390139.1 protein_id gnl|my_center|LOCUS_21830 1125 796 gene locus_tag LOCUS_21840 1125 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence674 1153 479 gene locus_tag LOCUS_21850 1153 479 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 protein_id gnl|my_center|LOCUS_21850 2093 1164 gene locus_tag LOCUS_21860 2093 1164 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_21860 >Feature sequence675 620 1897 gene locus_tag LOCUS_21870 gene trhB 620 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351840.1 protein_id gnl|my_center|LOCUS_21870 1894 2037 gene locus_tag LOCUS_21880 1894 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2034 2237 gene locus_tag LOCUS_21890 2034 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence676 1476 460 gene locus_tag LOCUS_21900 1476 460 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_21900 <2245 1473 gene locus_tag LOCUS_21910 <2245 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WY86:electron transport complex subunit C >Feature sequence677 <2243 563 gene locus_tag LOCUS_21920 <2243 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKI4:DNA repair protein RecN >Feature sequence678 1858 1283 gene locus_tag LOCUS_21930 1858 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence679 >Feature sequence680 154 1071 gene locus_tag LOCUS_21940 154 1071 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_21940 1804 1986 gene locus_tag LOCUS_21950 1804 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence681 57 1415 gene locus_tag LOCUS_21960 57 1415 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_21960 2160 1441 gene locus_tag LOCUS_21970 2160 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence682 <2232 492 gene locus_tag LOCUS_21980 <2232 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2T9:Lon protease >Feature sequence683 802 323 gene locus_tag LOCUS_21990 802 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2193 823 gene locus_tag LOCUS_22000 2193 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence684 619 1911 gene locus_tag LOCUS_22010 619 1911 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence685 1288 743 gene locus_tag LOCUS_22020 gene kptA 1288 743 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_22020 >Feature sequence686 <2225 1536 gene locus_tag LOCUS_22030 <2225 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092092.1:ABC transporter ATP-binding protein >Feature sequence687 <1 1102 gene locus_tag LOCUS_22040 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P53592:succinate--CoA ligase [ADP-forming] subunit beta 1106 1978 gene locus_tag LOCUS_22050 gene sucD 1106 1978 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08371 protein_id gnl|my_center|LOCUS_22050 >Feature sequence688 >Feature sequence689 1 570 gene locus_tag LOCUS_22060 1 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 563 1348 gene locus_tag LOCUS_22070 563 1348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_22070 1574 1449 gene locus_tag LOCUS_22080 1574 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2116 1730 gene locus_tag LOCUS_22090 2116 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence690 >Feature sequence691 713 1948 gene locus_tag LOCUS_22100 713 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence692 >Feature sequence693 175 852 gene locus_tag LOCUS_22110 175 852 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_22110 <2206 860 gene locus_tag LOCUS_22120 <2206 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence694 467 57 gene locus_tag LOCUS_22130 467 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 877 473 gene locus_tag LOCUS_22140 877 473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_22140 1551 874 gene locus_tag LOCUS_22150 1551 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 protein_id gnl|my_center|LOCUS_22150 1815 2012 gene locus_tag LOCUS_22160 1815 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence695 2 1120 gene locus_tag LOCUS_22170 gene mnmE 2 1120 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2N8 protein_id gnl|my_center|LOCUS_22170 1132 2043 gene locus_tag LOCUS_22180 1132 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence696 1276 929 gene locus_tag LOCUS_22190 1276 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence697 83 571 gene locus_tag LOCUS_22200 83 571 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 protein_id gnl|my_center|LOCUS_22200 1023 610 gene locus_tag LOCUS_22210 1023 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1875 1132 gene locus_tag LOCUS_22220 1875 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence698 >Feature sequence699 1900 551 gene locus_tag LOCUS_22230 gene secY 1900 551 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9K3 protein_id gnl|my_center|LOCUS_22230 >Feature sequence700 1254 1330 gene locus_tag LOCUS_t00230 1254 1330 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence701 <1 621 gene locus_tag LOCUS_22240 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AA8:methionyl-tRNA formyltransferase 637 1947 gene locus_tag LOCUS_22250 637 1947 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSC6 protein_id gnl|my_center|LOCUS_22250 >Feature sequence702 311 1177 gene locus_tag LOCUS_22260 gene sseA 311 1177 CDS product putative 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I452 protein_id gnl|my_center|LOCUS_22260 >Feature sequence703 1147 332 gene locus_tag LOCUS_22270 gene mutM 1147 332 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_22270 2180 1152 gene locus_tag LOCUS_22280 2180 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence704 131 1177 gene locus_tag LOCUS_22290 131 1177 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_22290 1222 2055 gene locus_tag LOCUS_22300 1222 2055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence705 42 569 gene locus_tag LOCUS_22310 42 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence706 >Feature sequence707 464 150 gene locus_tag LOCUS_22320 464 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 996 1415 gene locus_tag LOCUS_22330 996 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2175 1456 gene locus_tag LOCUS_22340 2175 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence708 >Feature sequence709 1369 608 gene locus_tag LOCUS_22350 1369 608 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_22350 >Feature sequence710 548 2092 gene locus_tag LOCUS_22360 gene fha1 548 2092 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence711 638 12 gene locus_tag LOCUS_22370 638 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 1144 689 gene locus_tag LOCUS_22380 1144 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 1292 1894 gene locus_tag LOCUS_22390 1292 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence712 598 960 gene locus_tag LOCUS_22400 598 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 981 1976 gene locus_tag LOCUS_22410 981 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence713 1235 159 gene locus_tag LOCUS_22420 1235 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1827 1381 gene locus_tag LOCUS_22430 1827 1381 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence714 1612 728 gene locus_tag LOCUS_22440 1612 728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_22440 <2152 1619 gene locus_tag LOCUS_22450 <2152 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477064.1:transcriptional regulator >Feature sequence715 745 314 gene locus_tag LOCUS_22460 745 314 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_22460 <2151 770 gene locus_tag LOCUS_22470 <2151 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNP0:transporter >Feature sequence716 >Feature sequence717 >Feature sequence718 192 1010 gene locus_tag LOCUS_22480 192 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1768 1007 gene locus_tag LOCUS_22490 1768 1007 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence719 <1 546 gene locus_tag LOCUS_22500 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038851.1:helicase >Feature sequence720 889 395 gene locus_tag LOCUS_22510 889 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1205 876 gene locus_tag LOCUS_22520 1205 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 <2139 1202 gene locus_tag LOCUS_22530 <2139 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947800.1:type-IV secretion system protein TraC >Feature sequence721 1760 861 gene locus_tag LOCUS_22540 1760 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence722 411 677 gene locus_tag LOCUS_22550 411 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 <2136 732 gene locus_tag LOCUS_22560 <2136 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UTY3:Na(+)/H(+) antiporter NhaA >Feature sequence723 >Feature sequence724 <2134 116 gene locus_tag LOCUS_22570 <2134 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EP48:DNA topoisomerase >Feature sequence725 1931 999 gene locus_tag LOCUS_22580 1931 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence726 <2130 379 gene locus_tag LOCUS_22590 <2130 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z4C3:carbamoyltransferase HypF >Feature sequence727 256 1776 gene locus_tag LOCUS_22600 gene lysS 256 1776 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPL4 protein_id gnl|my_center|LOCUS_22600 >Feature sequence728 1321 2 gene locus_tag LOCUS_22610 1321 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence729 362 1684 gene locus_tag LOCUS_22620 362 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence730 <1 1323 gene locus_tag LOCUS_22630 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein <2114 1604 gene locus_tag LOCUS_22640 <2114 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706632.1:exopolyphosphatase >Feature sequence731 506 312 gene locus_tag LOCUS_22650 506 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1232 525 gene locus_tag LOCUS_22660 1232 525 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_22660 2088 1375 gene locus_tag LOCUS_22670 2088 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence732 597 1382 gene locus_tag LOCUS_22680 597 1382 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence733 >Feature sequence734 637 65 gene locus_tag LOCUS_22690 637 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1034 597 gene locus_tag LOCUS_22700 1034 597 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948012.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence735 1012 242 gene locus_tag LOCUS_22710 gene cmoM 1012 242 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y318 protein_id gnl|my_center|LOCUS_22710 1317 1730 gene locus_tag LOCUS_22720 1317 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence736 48 1028 gene locus_tag LOCUS_22730 48 1028 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence737 >Feature sequence738 535 1278 gene locus_tag LOCUS_22740 gene pdxJ 535 1278 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJY6 protein_id gnl|my_center|LOCUS_22740 1275 1664 gene locus_tag LOCUS_22750 gene acpS 1275 1664 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCP5 protein_id gnl|my_center|LOCUS_22750 1768 1844 gene locus_tag LOCUS_t00240 1768 1844 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence739 >Feature sequence740 1577 525 gene locus_tag LOCUS_22760 gene cobT 1577 525 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_22760 <2091 1574 gene locus_tag LOCUS_22770 <2091 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404268.1:adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase >Feature sequence741 <1 1240 gene locus_tag LOCUS_22780 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8Q5:inosine-5'-monophosphate dehydrogenase >Feature sequence742 <2086 624 gene locus_tag LOCUS_22790 <2086 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967075.1:protease >Feature sequence743 >Feature sequence744 536 144 gene locus_tag LOCUS_22800 536 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1482 607 gene locus_tag LOCUS_22810 1482 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence745 1140 103 gene locus_tag LOCUS_22820 gene cheB1 1140 103 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 protein_id gnl|my_center|LOCUS_22820 <2075 1149 gene locus_tag LOCUS_22830 <2075 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268433.1:chemotaxis protein CheA >Feature sequence746 1111 422 gene locus_tag LOCUS_22840 1111 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1330 1770 gene locus_tag LOCUS_22850 1330 1770 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence747 208 2007 gene locus_tag LOCUS_22860 208 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence748 <2070 367 gene locus_tag LOCUS_22870 <2070 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence749 <1 522 gene locus_tag LOCUS_22880 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2K2:tRNA N6-adenosine threonylcarbamoyltransferase >Feature sequence750 761 267 gene locus_tag LOCUS_22890 761 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1080 748 gene locus_tag LOCUS_22900 1080 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 <2069 1077 gene locus_tag LOCUS_22910 <2069 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947800.1:type-IV secretion system protein TraC >Feature sequence751 454 2049 gene locus_tag LOCUS_22920 gene prfC 454 2049 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX60 protein_id gnl|my_center|LOCUS_22920 >Feature sequence752 129 1175 gene locus_tag LOCUS_22930 129 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1180 1887 gene locus_tag LOCUS_22940 1180 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence753 1 204 gene locus_tag LOCUS_22950 1 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 201 1484 gene locus_tag LOCUS_22960 201 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence754 <1 1059 gene locus_tag LOCUS_22970 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096067.1:carboxyl-terminal protease 1175 1915 gene locus_tag LOCUS_22980 1175 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence755 1114 581 gene locus_tag LOCUS_22990 gene aroK 1114 581 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q56 protein_id gnl|my_center|LOCUS_22990 >Feature sequence756 <1 1217 gene locus_tag LOCUS_23000 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:integrase 1236 1994 gene locus_tag LOCUS_23010 1236 1994 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence757 >Feature sequence758 173 1273 gene locus_tag LOCUS_23020 gene dnaN 173 1273 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_23020 >Feature sequence759 1516 1046 gene locus_tag LOCUS_23030 1516 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence760 <1 1210 gene locus_tag LOCUS_23040 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266274.1:type II secretion system protein E 1238 1780 gene locus_tag LOCUS_23050 1238 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence761 527 78 gene locus_tag LOCUS_23060 527 78 CDS product putative nickel-responsive regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748M1 protein_id gnl|my_center|LOCUS_23060 1215 730 gene locus_tag LOCUS_23070 1215 730 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_23070 1455 1219 gene locus_tag LOCUS_23080 gene moaD 1455 1219 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDC0 protein_id gnl|my_center|LOCUS_23080 1971 1471 gene locus_tag LOCUS_23090 gene moaC 1971 1471 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 protein_id gnl|my_center|LOCUS_23090 >Feature sequence762 >Feature sequence763 >Feature sequence764 461 1375 gene locus_tag LOCUS_23100 461 1375 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195199.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence765 1374 28 gene locus_tag LOCUS_23110 1374 28 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_23110 1454 1942 gene locus_tag LOCUS_23120 1454 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence766 >Feature sequence767 341 1690 gene locus_tag LOCUS_23130 341 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence768 20 1018 gene locus_tag LOCUS_23140 20 1018 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405476.1 protein_id gnl|my_center|LOCUS_23140 <2015 1201 gene locus_tag LOCUS_23150 <2015 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071467.1:transposase >Feature sequence769 <1 974 gene locus_tag LOCUS_23160 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_819280.1:elongation factor Tu 981 1292 gene locus_tag LOCUS_23170 gene rpsJ 981 1292 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_23170 1348 1995 gene locus_tag LOCUS_23180 gene rplC 1348 1995 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY4 protein_id gnl|my_center|LOCUS_23180 >Feature sequence770 5 262 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtgtgctgccgcataggcag 602 468 gene locus_tag LOCUS_23190 602 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 670 1647 gene locus_tag LOCUS_23200 670 1647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence771 <2006 1149 gene locus_tag LOCUS_23210 <2006 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103278.1:malic enzyme >Feature sequence772 268 543 gene locus_tag LOCUS_23220 gene fliQ 268 543 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947514.1 protein_id gnl|my_center|LOCUS_23220 554 1327 gene locus_tag LOCUS_23230 gene fliR 554 1327 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYF6 protein_id gnl|my_center|LOCUS_23230 >Feature sequence773 842 1033 gene locus_tag LOCUS_23240 842 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_23240 1053 1739 gene locus_tag LOCUS_23250 1053 1739 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence774 1736 1020 gene locus_tag LOCUS_23260 1736 1020 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence775 <1 1156 gene locus_tag LOCUS_23270 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51463:flagellar M-ring protein >Feature sequence776 >Feature sequence777 647 1006 gene locus_tag LOCUS_23280 647 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 1003 1728 gene locus_tag LOCUS_23290 1003 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23290 >Feature sequence778 700 80 gene locus_tag LOCUS_23300 gene ubiX 700 80 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_23300 <1990 697 gene locus_tag LOCUS_23310 <1990 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KP18:UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase >Feature sequence779 939 22 gene locus_tag LOCUS_23320 939 22 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_23320 <1989 936 gene locus_tag LOCUS_23330 <1989 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112350.1:TonB-dependent receptor >Feature sequence780 326 1033 gene locus_tag LOCUS_23340 326 1033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 protein_id gnl|my_center|LOCUS_23340 1038 1928 gene locus_tag LOCUS_23350 1038 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23350 >Feature sequence781 389 69 gene locus_tag LOCUS_23360 389 69 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_23360 1596 406 gene locus_tag LOCUS_23370 1596 406 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932631.1 protein_id gnl|my_center|LOCUS_23370 1903 1607 gene locus_tag LOCUS_23380 gene lsrG 1903 1607 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83L16 protein_id gnl|my_center|LOCUS_23380 >Feature sequence782 883 494 gene locus_tag LOCUS_23390 883 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1800 973 gene locus_tag LOCUS_23400 1800 973 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705547.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence783 473 1102 gene locus_tag LOCUS_23410 473 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 1237 1791 gene locus_tag LOCUS_23420 1237 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence784 <1983 1438 gene locus_tag LOCUS_23430 <1983 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54420:asparagine synthetase [glutamine-hydrolyzing] 1 >Feature sequence785 <1 1907 gene locus_tag LOCUS_23440 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930748.1:pyridoxamine 5'-phosphate oxidase >Feature sequence786 <1 661 gene locus_tag LOCUS_23450 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038567.1:sugar kinase 981 1604 gene locus_tag LOCUS_23460 981 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence787 1253 849 gene locus_tag LOCUS_23470 1253 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence788 <1 1043 gene locus_tag LOCUS_23480 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385749.1:iron transporter 1554 1048 gene locus_tag LOCUS_23490 1554 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence789 570 905 gene locus_tag LOCUS_23500 570 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1156 1722 gene locus_tag LOCUS_23510 1156 1722 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence790 <1 1599 gene locus_tag LOCUS_23520 <1 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192719.1:PrkA family serine protein kinase >Feature sequence791 747 316 gene locus_tag LOCUS_23530 747 316 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 protein_id gnl|my_center|LOCUS_23530 829 1749 gene locus_tag LOCUS_23540 829 1749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence792 1657 359 gene locus_tag LOCUS_23550 1657 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence793 1411 1103 gene locus_tag LOCUS_23560 1411 1103 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808669.1 protein_id gnl|my_center|LOCUS_23560 <1965 1416 gene locus_tag LOCUS_23570 <1965 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879161.1:alanine dehydrogenase >Feature sequence794 125 667 gene locus_tag LOCUS_23580 125 667 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence795 547 1017 gene locus_tag LOCUS_23590 547 1017 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948527.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence796 1398 1066 gene locus_tag LOCUS_23600 1398 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence797 >Feature sequence798 >Feature sequence799 240 1373 gene locus_tag LOCUS_23610 240 1373 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_23610 1376 1855 gene locus_tag LOCUS_23620 gene smg 1376 1855 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_23620 >Feature sequence800 1672 89 gene locus_tag LOCUS_23630 1672 89 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence801 <1944 80 gene locus_tag LOCUS_23640 <1944 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPS8:tRNA(Met) cytidine acetyltransferase TmcA >Feature sequence802 >Feature sequence803 1473 1823 gene locus_tag LOCUS_23650 1473 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence804 1035 172 gene locus_tag LOCUS_23660 1035 172 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence805 138 1877 gene locus_tag LOCUS_23670 138 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence806 487 218 gene locus_tag LOCUS_23680 487 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141548.1 protein_id gnl|my_center|LOCUS_23680 1295 477 gene locus_tag LOCUS_23690 1295 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1829 1563 gene locus_tag LOCUS_23700 1829 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence807 1647 799 gene locus_tag LOCUS_23710 gene pabC 1647 799 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_23710 1887 1654 gene locus_tag LOCUS_23720 1887 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence808 1424 597 gene locus_tag LOCUS_23730 1424 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence809 1152 565 gene locus_tag LOCUS_23740 1152 565 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704887.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence810 >Feature sequence811 121 546 gene locus_tag LOCUS_23750 121 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1014 565 gene locus_tag LOCUS_23760 gene fxsA 1014 565 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_23760 1059 1403 gene locus_tag LOCUS_23770 gene cutA 1059 1403 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_23770 >Feature sequence812 1389 1129 gene locus_tag LOCUS_23780 1389 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708739.1 protein_id gnl|my_center|LOCUS_23780 1622 1386 gene locus_tag LOCUS_23790 1622 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence813 891 1271 gene locus_tag LOCUS_23800 891 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1405 1866 gene locus_tag LOCUS_23810 gene rsd 1405 1866 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence814 >Feature sequence815 >Feature sequence816 >Feature sequence817 >Feature sequence818 963 1730 gene locus_tag LOCUS_23820 963 1730 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence819 >Feature sequence820 >Feature sequence821 534 214 gene locus_tag LOCUS_23830 534 214 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_23830 1277 624 gene locus_tag LOCUS_23840 gene pcm 1277 624 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence822 2 490 gene locus_tag LOCUS_23850 2 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 845 615 gene locus_tag LOCUS_23860 845 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1211 1354 gene locus_tag LOCUS_23870 1211 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1335 1799 gene locus_tag LOCUS_23880 1335 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence823 1773 619 gene locus_tag LOCUS_23890 1773 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence824 909 256 gene locus_tag LOCUS_23900 909 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence825 98 991 gene locus_tag LOCUS_23910 98 991 CDS product beta-glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_23910 1086 1304 gene locus_tag LOCUS_23920 1086 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence826 460 1434 gene locus_tag LOCUS_23930 460 1434 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q58 protein_id gnl|my_center|LOCUS_23930 1443 1679 gene locus_tag LOCUS_23940 1443 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence827 >Feature sequence828 389 1351 gene locus_tag LOCUS_23950 389 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 <1875 1373 gene locus_tag LOCUS_23960 <1875 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973635.1:methyltransferase >Feature sequence829 1074 202 gene locus_tag LOCUS_23970 1074 202 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence830 <1 1217 gene locus_tag LOCUS_23980 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_296367.1:serine/threonine protein kinase, putative >Feature sequence831 110 973 gene locus_tag LOCUS_23990 gene atpG 110 973 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_23990 >Feature sequence832 285 1043 gene locus_tag LOCUS_24000 285 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence833 921 604 gene locus_tag LOCUS_24010 921 604 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 protein_id gnl|my_center|LOCUS_24010 <1862 936 gene locus_tag LOCUS_24020 <1862 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000632948.1:methyl-accepting chemotaxis protein >Feature sequence834 133 570 gene locus_tag LOCUS_24030 133 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 <1862 625 gene locus_tag LOCUS_24040 <1862 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase >Feature sequence835 >Feature sequence836 1100 1546 gene locus_tag LOCUS_24050 gene arsC 1100 1546 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence837 106 297 gene locus_tag LOCUS_24060 106 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1023 529 gene locus_tag LOCUS_24070 1023 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 <1855 1020 gene locus_tag LOCUS_24080 <1855 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597449.1:paraslipin >Feature sequence838 >Feature sequence839 <1 1733 gene locus_tag LOCUS_24090 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_639573.2:polysaccharide deacetylase >Feature sequence840 <1 733 gene locus_tag LOCUS_24100 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222151.1:UDP-glucose 4-epimerase >Feature sequence841 1775 1020 gene locus_tag LOCUS_24110 1775 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence842 1227 1009 gene locus_tag LOCUS_24120 1227 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1727 1224 gene locus_tag LOCUS_24130 1727 1224 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583584.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence843 385 1155 gene locus_tag LOCUS_24140 gene cheZ 385 1155 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD5 protein_id gnl|my_center|LOCUS_24140 >Feature sequence844 >Feature sequence845 1534 176 gene locus_tag LOCUS_24150 gene cobQ 1534 176 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885W8 protein_id gnl|my_center|LOCUS_24150 >Feature sequence846 645 1523 gene locus_tag LOCUS_24160 645 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence847 1079 1669 gene locus_tag LOCUS_24170 1079 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence848 1027 584 gene locus_tag LOCUS_24180 1027 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 <1832 1029 gene locus_tag LOCUS_24190 <1832 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087698.1:cation efflux system protein >Feature sequence849 77 739 gene locus_tag LOCUS_24200 77 739 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GU2 protein_id gnl|my_center|LOCUS_24200 747 1415 gene locus_tag LOCUS_24210 747 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence850 526 50 gene locus_tag LOCUS_24220 526 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 <1827 1033 gene locus_tag LOCUS_24230 <1827 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200262.1:flagellar hook-associated protein 3 >Feature sequence851 >Feature sequence852 1278 661 gene locus_tag LOCUS_24240 1278 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence853 1423 437 gene locus_tag LOCUS_24250 1423 437 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence854 <1820 1032 gene locus_tag LOCUS_24260 <1820 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813930.1:NADH-quinone oxidoreductase subunit F >Feature sequence855 1022 324 gene locus_tag LOCUS_24270 1022 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence856 88 534 gene locus_tag LOCUS_24280 88 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1531 608 gene locus_tag LOCUS_24290 1531 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence857 >Feature sequence858 411 770 gene locus_tag LOCUS_24300 411 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 968 1369 gene locus_tag LOCUS_24310 968 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55587 protein_id gnl|my_center|LOCUS_24310 >Feature sequence859 <1 580 gene locus_tag LOCUS_24320 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584147.1:peptidase 712 1314 gene locus_tag LOCUS_24330 712 1314 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence860 1056 52 gene locus_tag LOCUS_24340 1056 52 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107198.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence861 <1 1303 gene locus_tag LOCUS_24350 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881782.1:flagellar biosynthesis regulator FlhF >Feature sequence862 >Feature sequence863 38 811 gene locus_tag LOCUS_24360 gene hisF 38 811 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_24360 820 1218 gene locus_tag LOCUS_24370 gene hisI 820 1218 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE6 protein_id gnl|my_center|LOCUS_24370 1282 1608 gene locus_tag LOCUS_24380 gene hisE 1282 1608 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_24380 >Feature sequence864 <1 1723 gene locus_tag LOCUS_24390 <1 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096801.1:allophanate hydrolase >Feature sequence865 >Feature sequence866 1462 605 gene locus_tag LOCUS_24400 1462 605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence867 >Feature sequence868 520 681 gene locus_tag LOCUS_24410 520 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1247 672 gene locus_tag LOCUS_24420 1247 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence869 183 1394 gene locus_tag LOCUS_24430 gene argG 183 1394 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_24430 >Feature sequence870 845 234 gene locus_tag LOCUS_24440 gene cysC1 845 234 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK5 protein_id gnl|my_center|LOCUS_24440 <1796 868 gene locus_tag LOCUS_24450 <1796 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871027.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence871 >Feature sequence872 744 247 gene locus_tag LOCUS_24460 744 247 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS7 protein_id gnl|my_center|LOCUS_24460 1794 757 gene locus_tag LOCUS_24470 1794 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence873 310 1497 gene locus_tag LOCUS_24480 gene lplT 310 1497 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGZ2 protein_id gnl|my_center|LOCUS_24480 >Feature sequence874 333 1676 gene locus_tag LOCUS_24490 333 1676 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence875 887 1570 gene locus_tag LOCUS_24500 887 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989841.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence876 346 62 gene locus_tag LOCUS_24510 gene ycgL 346 62 CDS product protein YcgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32H41 protein_id gnl|my_center|LOCUS_24510 1111 422 gene locus_tag LOCUS_24520 1111 422 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930881.1 protein_id gnl|my_center|LOCUS_24520 <1787 1142 gene locus_tag LOCUS_24530 <1787 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWU0:phosphate import ATP-binding protein PstB >Feature sequence877 1199 1621 gene locus_tag LOCUS_24540 1199 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence878 <1 885 gene locus_tag LOCUS_24550 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933610.1:TonB-dependent receptor >Feature sequence879 405 737 gene locus_tag LOCUS_24560 405 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 768 1430 gene locus_tag LOCUS_24570 768 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence880 1570 608 gene locus_tag LOCUS_24580 1570 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence881 <1 1116 gene locus_tag LOCUS_24590 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114926.1:cobaltochelatase subunit CobN 1779 1261 gene locus_tag LOCUS_24600 1779 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence882 291 1442 gene locus_tag LOCUS_24610 291 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence883 1473 166 gene locus_tag LOCUS_24620 gene amt 1473 166 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_24620 >Feature sequence884 >Feature sequence885 1762 167 gene locus_tag LOCUS_24630 1762 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence886 >Feature sequence887 33 1364 gene locus_tag LOCUS_24640 33 1364 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941624.1 protein_id gnl|my_center|LOCUS_24640 1732 1481 gene locus_tag LOCUS_24650 1732 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence888 1028 219 gene locus_tag LOCUS_24660 1028 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence889 152 814 gene locus_tag LOCUS_24670 152 814 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_24670 1167 865 gene locus_tag LOCUS_24680 1167 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence890 1176 511 gene locus_tag LOCUS_24690 1176 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1317 1538 gene locus_tag LOCUS_24700 1317 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence891 317 1177 gene locus_tag LOCUS_24710 317 1177 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence892 927 394 gene locus_tag LOCUS_24720 gene nusG 927 394 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_24720 1308 931 gene locus_tag LOCUS_24730 gene secE 1308 931 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV36 protein_id gnl|my_center|LOCUS_24730 1410 1335 gene locus_tag LOCUS_t00250 1410 1335 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1740 1489 gene locus_tag LOCUS_24740 1740 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence893 <1739 725 gene locus_tag LOCUS_24750 <1739 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence894 182 760 gene locus_tag LOCUS_24760 gene pth 182 760 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9L4 protein_id gnl|my_center|LOCUS_24760 >Feature sequence895 >Feature sequence896 <1 1015 gene locus_tag LOCUS_24770 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140949.1:alginate O-acetylation protein >Feature sequence897 192 689 gene locus_tag LOCUS_24780 gene purE 192 689 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8M2 protein_id gnl|my_center|LOCUS_24780 >Feature sequence898 1432 140 gene locus_tag LOCUS_24790 1432 140 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence899 >Feature sequence900 82 543 gene locus_tag LOCUS_24800 82 543 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_24800 <1716 753 gene locus_tag LOCUS_24810 <1716 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940687.1:PAS domain-containing sensor histidine kinase >Feature sequence901 501 794 gene locus_tag LOCUS_24820 501 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 985 1686 gene locus_tag LOCUS_24830 985 1686 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence902 <1 983 gene locus_tag LOCUS_24840 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5V0:UPF0229 protein >Feature sequence903 <1700 315 gene locus_tag LOCUS_24850 <1700 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87TS1:membrane protein insertase YidC >Feature sequence904 595 374 gene locus_tag LOCUS_24860 595 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 976 1533 gene locus_tag LOCUS_24870 gene rpoE3 976 1533 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969891.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence905 >Feature sequence906 948 860 gene locus_tag LOCUS_t00260 948 860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1024 1329 gene locus_tag LOCUS_24880 1024 1329 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531236.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence907 >Feature sequence908 158 1330 gene locus_tag LOCUS_24890 158 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence909 >Feature sequence910 1240 1064 gene locus_tag LOCUS_24900 1240 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence911 <1675 439 gene locus_tag LOCUS_24910 <1675 439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071476.1:U32 family peptidase >Feature sequence912 <1 1241 gene locus_tag LOCUS_24920 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979182.1:peptidase S41 >Feature sequence913 805 389 gene locus_tag LOCUS_24930 805 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_24930 <1669 898 gene locus_tag LOCUS_24940 <1669 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAX8:polyamine aminopropyltransferase >Feature sequence914 <1667 439 gene locus_tag LOCUS_24950 <1667 439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011242282.1:NADH oxidase >Feature sequence915 530 186 gene locus_tag LOCUS_24960 530 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 827 1282 gene locus_tag LOCUS_24970 827 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence916 393 809 gene locus_tag LOCUS_24980 393 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 918 1316 gene locus_tag LOCUS_24990 918 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence917 <1 1151 gene locus_tag LOCUS_25000 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117769.1:hybrid sensor histidine kinase/response regulator >Feature sequence918 141 350 gene locus_tag LOCUS_25010 gene cspG 141 350 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_25010 577 1179 gene locus_tag LOCUS_25020 577 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence919 1041 1505 gene locus_tag LOCUS_25030 1041 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence920 8 952 gene locus_tag LOCUS_25040 8 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence921 89 643 gene locus_tag LOCUS_25050 89 643 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_25050 716 1372 gene locus_tag LOCUS_25060 716 1372 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence922 >Feature sequence923 >Feature sequence924 <1 781 gene locus_tag LOCUS_25070 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533388.1:phosphatidylinositol kinase 855 1265 gene locus_tag LOCUS_25080 855 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence925 350 162 gene locus_tag LOCUS_25090 350 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 985 347 gene locus_tag LOCUS_25100 985 347 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence926 290 610 gene locus_tag LOCUS_25110 290 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 635 1264 gene locus_tag LOCUS_25120 635 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence927 1353 619 gene locus_tag LOCUS_25130 gene cmoA 1353 619 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE7 protein_id gnl|my_center|LOCUS_25130 >Feature sequence928 >Feature sequence929 740 294 gene locus_tag LOCUS_25140 740 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence930 1307 1002 gene locus_tag LOCUS_25150 gene nuoK 1307 1002 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLR2 protein_id gnl|my_center|LOCUS_25150 >Feature sequence931 <1 523 gene locus_tag LOCUS_25160 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816516.1:DEAD/DEAH box helicase 513 1211 gene locus_tag LOCUS_25170 513 1211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence932 <1 852 gene locus_tag LOCUS_25180 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBV1:3-oxoacyl-[acyl-carrier-protein] synthase 3 >Feature sequence933 <1617 729 gene locus_tag LOCUS_25190 <1617 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787020.1:TonB-dependent receptor >Feature sequence934 219 1106 gene locus_tag LOCUS_25200 219 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence935 >Feature sequence936 1321 47 gene locus_tag LOCUS_25210 gene macC 1321 47 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071116.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence937 <1 649 gene locus_tag LOCUS_25220 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388087.1:LysR family transcriptional regulator <1606 708 gene locus_tag LOCUS_25230 <1606 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880031.1:cytochrome-c peroxidase >Feature sequence938 <1 523 gene locus_tag LOCUS_25240 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92L21:histidinol-phosphate aminotransferase 2 >Feature sequence939 717 1250 gene locus_tag LOCUS_25250 717 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence940 <1 599 gene locus_tag LOCUS_25260 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268591.1:nucleoside triphosphate pyrophosphohydrolase 596 1099 gene locus_tag LOCUS_25270 596 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence941 155 1375 gene locus_tag LOCUS_25280 155 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence942 >Feature sequence943 669 1274 gene locus_tag LOCUS_25290 669 1274 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence944 <1 1050 gene locus_tag LOCUS_25300 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868922.1:histidine kinase >Feature sequence945 <1 735 gene locus_tag LOCUS_25310 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2U0:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence946 800 1384 gene locus_tag LOCUS_25320 800 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence947 >Feature sequence948 202 504 gene locus_tag LOCUS_25330 202 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence949 243 1340 gene locus_tag LOCUS_25340 gene aroC 243 1340 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ85 protein_id gnl|my_center|LOCUS_25340 >Feature sequence950 786 202 gene locus_tag LOCUS_25350 786 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 <1580 927 gene locus_tag LOCUS_25360 <1580 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808106.1:histidine kinase >Feature sequence951 <1 760 gene locus_tag LOCUS_25370 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203863.1:ABC transporter ATP-binding protein 768 1178 gene locus_tag LOCUS_25380 768 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1192 1383 gene locus_tag LOCUS_25390 1192 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence952 >Feature sequence953 1436 606 gene locus_tag LOCUS_25400 1436 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence954 >Feature sequence955 >Feature sequence956 >Feature sequence957 754 254 gene locus_tag LOCUS_25410 754 254 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_25410 1062 1277 gene locus_tag LOCUS_25420 1062 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence958 834 28 gene locus_tag LOCUS_25430 834 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1441 845 gene locus_tag LOCUS_25440 1441 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence959 >Feature sequence960 <1 656 gene locus_tag LOCUS_25450 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase/phosphodiesterase >Feature sequence961 1459 752 gene locus_tag LOCUS_25460 1459 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1559 1413 gene locus_tag LOCUS_25470 1559 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence962 307 188 gene locus_tag LOCUS_25480 307 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence963 >Feature sequence964 124 1395 gene locus_tag LOCUS_25490 124 1395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence965 182 1060 gene locus_tag LOCUS_25500 182 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence966 400 792 gene locus_tag LOCUS_25510 400 792 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706955.1 protein_id gnl|my_center|LOCUS_25510 820 1209 gene locus_tag LOCUS_25520 820 1209 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126699.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence967 <1 678 gene locus_tag LOCUS_25530 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404066.1:universal stress protein >Feature sequence968 148 471 gene locus_tag LOCUS_25540 148 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 480 1103 gene locus_tag LOCUS_25550 gene ureG 480 1103 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS0 protein_id gnl|my_center|LOCUS_25550 >Feature sequence969 >Feature sequence970 1368 766 gene locus_tag LOCUS_25560 1368 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence971 >Feature sequence972 226 873 gene locus_tag LOCUS_25570 226 873 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_25570 882 1388 gene locus_tag LOCUS_25580 882 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence973 <1 1394 gene locus_tag LOCUS_25590 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:GGDEF domain-containing protein >Feature sequence974 >Feature sequence975 >Feature sequence976 948 1091 gene locus_tag LOCUS_25600 948 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence977 <1502 428 gene locus_tag LOCUS_25610 <1502 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546431.1:2-amino-3-ketobutyrate CoA ligase