>Feature sequence001 <1 1623 gene locus_tag LOCUS_00010 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932700.1:thiosulfohydrolase SoxB 2768 1671 gene locus_tag LOCUS_00020 gene hemH1 2768 1671 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_00020 2823 3776 gene locus_tag LOCUS_00030 gene hprA 2823 3776 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_00030 3777 4211 gene locus_tag LOCUS_00040 3777 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4313 5017 gene locus_tag LOCUS_00050 4313 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6740 5073 gene locus_tag LOCUS_00060 gene ettA 6740 5073 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45127 protein_id gnl|my_center|LOCUS_00060 6978 8003 gene locus_tag LOCUS_00070 6978 8003 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_00070 8006 11227 gene locus_tag LOCUS_00080 8006 11227 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_00080 11403 12311 gene locus_tag LOCUS_00090 11403 12311 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_00090 12383 12760 gene locus_tag LOCUS_00100 12383 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12761 13846 gene locus_tag LOCUS_00110 12761 13846 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_00110 14022 14894 gene locus_tag LOCUS_00120 14022 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15384 15106 gene locus_tag LOCUS_00130 15384 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15643 15398 gene locus_tag LOCUS_00140 15643 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 >Feature sequence002 653 1897 gene locus_tag LOCUS_00150 gene hemY 653 1897 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_00150 2886 1894 gene locus_tag LOCUS_00160 gene srkA 2886 1894 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_00160 2962 5004 gene locus_tag LOCUS_00170 gene prlC 2962 5004 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_00170 5011 5817 gene locus_tag LOCUS_00180 5011 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5844 7307 gene locus_tag LOCUS_00190 gene ubiD 5844 7307 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_00190 7391 7858 gene locus_tag LOCUS_00200 7391 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8750 7839 gene locus_tag LOCUS_00210 8750 7839 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_00210 8805 9809 gene locus_tag LOCUS_00220 8805 9809 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_00220 10132 9806 gene locus_tag LOCUS_00230 10132 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 11357 10206 gene locus_tag LOCUS_00240 11357 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 11478 12821 gene locus_tag LOCUS_00250 11478 12821 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160779.1 protein_id gnl|my_center|LOCUS_00250 12839 13369 gene locus_tag LOCUS_00260 12839 13369 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 protein_id gnl|my_center|LOCUS_00260 13383 13769 gene locus_tag LOCUS_00270 13383 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_00270 13850 14581 gene locus_tag LOCUS_00280 13850 14581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558842.1 protein_id gnl|my_center|LOCUS_00280 14726 15145 gene locus_tag LOCUS_00290 14726 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence003 1268 2869 gene locus_tag LOCUS_00300 1268 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 3754 2873 gene locus_tag LOCUS_00310 3754 2873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_00310 4253 3771 gene locus_tag LOCUS_00320 4253 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479631.1 protein_id gnl|my_center|LOCUS_00320 4882 4253 gene locus_tag LOCUS_00330 4882 4253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810476.1 protein_id gnl|my_center|LOCUS_00330 7260 4948 gene locus_tag LOCUS_00340 7260 4948 CDS product TonB-dependent heme/hemoglobin receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530812.1 protein_id gnl|my_center|LOCUS_00340 8339 7362 gene locus_tag LOCUS_00350 gene fecR 8339 7362 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 protein_id gnl|my_center|LOCUS_00350 8921 8385 gene locus_tag LOCUS_00360 gene vreI 8921 8385 CDS product ECF sigma factor VreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085329.1 protein_id gnl|my_center|LOCUS_00360 9081 9656 gene locus_tag LOCUS_00370 9081 9656 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_00370 9640 10350 gene locus_tag LOCUS_00380 9640 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 10391 10915 gene locus_tag LOCUS_00390 10391 10915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111411.1 protein_id gnl|my_center|LOCUS_00390 10912 11751 gene locus_tag LOCUS_00400 10912 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11753 12535 gene locus_tag LOCUS_00410 11753 12535 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_00410 12658 13323 gene locus_tag LOCUS_00420 12658 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 13361 13663 gene locus_tag LOCUS_00430 13361 13663 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_00430 13685 14209 gene locus_tag LOCUS_00440 13685 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence004 1946 483 gene locus_tag LOCUS_00450 1946 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2181 3035 gene locus_tag LOCUS_00460 gene motA 2181 3035 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_00460 3062 4105 gene locus_tag LOCUS_00470 3062 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 4998 4102 gene locus_tag LOCUS_00480 gene rsgA1 4998 4102 CDS product putative ribosome biogenesis GTPase RsgA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L00 protein_id gnl|my_center|LOCUS_00480 5333 5001 gene locus_tag LOCUS_00490 5333 5001 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_00490 5636 5334 gene locus_tag LOCUS_00500 5636 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6903 5656 gene locus_tag LOCUS_00510 6903 5656 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_00510 7075 7638 gene locus_tag LOCUS_00520 gene orn 7075 7638 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_00520 7803 8363 gene locus_tag LOCUS_00530 7803 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 8526 9395 gene locus_tag LOCUS_00540 gene fliM 8526 9395 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_00540 9388 9825 gene locus_tag LOCUS_00550 9388 9825 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQU4 protein_id gnl|my_center|LOCUS_00550 9838 10275 gene locus_tag LOCUS_00560 9838 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10332 11021 gene locus_tag LOCUS_00570 gene fliP 10332 11021 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_00570 11036 11305 gene locus_tag LOCUS_00580 gene fliQ 11036 11305 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947514.1 protein_id gnl|my_center|LOCUS_00580 11310 12086 gene locus_tag LOCUS_00590 gene fliR 11310 12086 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_00590 12087 13220 gene locus_tag LOCUS_00600 gene flhB 12087 13220 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence005 1451 54 gene locus_tag LOCUS_00610 gene ntrC 1451 54 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_00610 2548 1454 gene locus_tag LOCUS_00620 2548 1454 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_00620 4062 2929 gene locus_tag LOCUS_00630 4062 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 4972 4070 gene locus_tag LOCUS_00640 gene mshM 4972 4070 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_00640 6718 4982 gene locus_tag LOCUS_00650 gene mshL 6718 4982 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_00650 7082 6735 gene locus_tag LOCUS_00660 7082 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7747 7085 gene locus_tag LOCUS_00670 7747 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 8361 7759 gene locus_tag LOCUS_00680 8361 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9126 8368 gene locus_tag LOCUS_00690 9126 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10984 9578 gene locus_tag LOCUS_00700 gene glnA 10984 9578 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXX6 protein_id gnl|my_center|LOCUS_00700 12364 11174 gene locus_tag LOCUS_00710 12364 11174 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947750.1 protein_id gnl|my_center|LOCUS_00710 12587 12354 gene locus_tag LOCUS_00720 12587 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_00720 <13168 12584 gene locus_tag LOCUS_00730 <13168 12584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947976.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence006 141 458 gene locus_tag LOCUS_00740 gene bolA 141 458 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_00740 1138 455 gene locus_tag LOCUS_00750 1138 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 1247 3322 gene locus_tag LOCUS_00760 gene ppk 1247 3322 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZQ6 protein_id gnl|my_center|LOCUS_00760 4827 3319 gene locus_tag LOCUS_00770 gene ppx 4827 3319 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_00770 5032 5841 gene locus_tag LOCUS_00780 5032 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5838 6887 gene locus_tag LOCUS_00790 5838 6887 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_00790 8011 6815 gene locus_tag LOCUS_00800 8011 6815 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_00800 8597 8058 gene locus_tag LOCUS_00810 8597 8058 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_00810 9889 8672 gene locus_tag LOCUS_00820 gene glcF 9889 8672 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R29 protein_id gnl|my_center|LOCUS_00820 10959 9892 gene locus_tag LOCUS_00830 gene glcE 10959 9892 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_00830 <12198 10974 gene locus_tag LOCUS_00840 <12198 10974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114372.1:glycolate oxidase >Feature sequence007 445 1014 gene locus_tag LOCUS_00850 445 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1030 2925 gene locus_tag LOCUS_00860 1030 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2915 3343 gene locus_tag LOCUS_00870 2915 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3359 5716 gene locus_tag LOCUS_00880 3359 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5697 6290 gene locus_tag LOCUS_00890 5697 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6314 6595 gene locus_tag LOCUS_00900 6314 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6721 7365 gene locus_tag LOCUS_00910 6721 7365 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_00910 7362 7856 gene locus_tag LOCUS_00920 7362 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 7866 8375 gene locus_tag LOCUS_00930 7866 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8378 9340 gene locus_tag LOCUS_00940 8378 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9378 10046 gene locus_tag LOCUS_00950 9378 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence008 596 339 gene locus_tag LOCUS_00960 596 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4075 902 gene locus_tag LOCUS_00970 4075 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4250 4447 gene locus_tag LOCUS_00980 4250 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5871 4759 gene locus_tag LOCUS_00990 5871 4759 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_00990 7260 6277 gene locus_tag LOCUS_01000 7260 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8325 7363 gene locus_tag LOCUS_01010 8325 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 11676 8353 gene locus_tag LOCUS_01020 11676 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence009 1588 884 gene locus_tag LOCUS_01030 1588 884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088237.1 protein_id gnl|my_center|LOCUS_01030 1974 2408 gene locus_tag LOCUS_01040 1974 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 3556 2417 gene locus_tag LOCUS_01050 3556 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3917 3687 gene locus_tag LOCUS_01060 3917 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4249 3986 gene locus_tag LOCUS_01070 4249 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4692 4414 gene locus_tag LOCUS_01080 4692 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5575 4790 gene locus_tag LOCUS_01090 5575 4790 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_01090 5708 6439 gene locus_tag LOCUS_01100 gene trmJ 5708 6439 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_01100 6471 7271 gene locus_tag LOCUS_01110 gene cysE 6471 7271 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_01110 7394 7882 gene locus_tag LOCUS_01120 7394 7882 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_01120 7921 9135 gene locus_tag LOCUS_01130 gene iscS 7921 9135 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S28 protein_id gnl|my_center|LOCUS_01130 9185 9589 gene locus_tag LOCUS_01140 gene iscU 9185 9589 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_01140 9611 9934 gene locus_tag LOCUS_01150 9611 9934 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S26 protein_id gnl|my_center|LOCUS_01150 9949 10488 gene locus_tag LOCUS_01160 gene hscB 9949 10488 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX9 protein_id gnl|my_center|LOCUS_01160 >Feature sequence010 1655 918 gene locus_tag LOCUS_01170 1655 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2034 3524 gene locus_tag LOCUS_01180 2034 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3521 4612 gene locus_tag LOCUS_01190 3521 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6881 4614 gene locus_tag LOCUS_01200 gene parC 6881 4614 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_01200 8793 6907 gene locus_tag LOCUS_01210 gene parE 8793 6907 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_01210 9127 8918 gene locus_tag LOCUS_01220 9127 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 10944 9124 gene locus_tag LOCUS_01230 10944 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 >Feature sequence011 723 4 gene locus_tag LOCUS_01240 723 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 1694 954 gene locus_tag LOCUS_01250 1694 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 1771 2793 gene locus_tag LOCUS_01260 1771 2793 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_01260 2790 3458 gene locus_tag LOCUS_01270 gene mpg1 2790 3458 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_01270 3461 4894 gene locus_tag LOCUS_01280 3461 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933534.1 protein_id gnl|my_center|LOCUS_01280 4897 5913 gene locus_tag LOCUS_01290 4897 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6012 6956 gene locus_tag LOCUS_01300 6012 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6960 8288 gene locus_tag LOCUS_01310 6960 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9046 8285 gene locus_tag LOCUS_01320 9046 8285 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_01320 10023 9052 gene locus_tag LOCUS_01330 gene lipA 10023 9052 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62N16 protein_id gnl|my_center|LOCUS_01330 10689 10036 gene locus_tag LOCUS_01340 gene lipB 10689 10036 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_01340 >Feature sequence012 3252 352 gene locus_tag LOCUS_01350 3252 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3429 3956 gene locus_tag LOCUS_01360 3429 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4009 6027 gene locus_tag LOCUS_01370 gene rep 4009 6027 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI64 protein_id gnl|my_center|LOCUS_01370 6540 6076 gene locus_tag LOCUS_01380 6540 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6801 6877 gene locus_tag LOCUS_t00010 6801 6877 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7328 7933 gene locus_tag LOCUS_01390 7328 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7942 8685 gene locus_tag LOCUS_01400 7942 8685 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_01400 9775 8699 gene locus_tag LOCUS_01410 9775 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence013 828 46 gene locus_tag LOCUS_01420 828 46 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_01420 2172 835 gene locus_tag LOCUS_01430 2172 835 CDS product amine oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_01430 3040 2165 gene locus_tag LOCUS_01440 3040 2165 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_01440 3948 3064 gene locus_tag LOCUS_01450 3948 3064 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344762.1 protein_id gnl|my_center|LOCUS_01450 3997 4218 gene locus_tag LOCUS_01460 3997 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5501 4215 gene locus_tag LOCUS_01470 5501 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_01470 6195 5491 gene locus_tag LOCUS_01480 gene gph 6195 5491 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_01480 6447 6205 gene locus_tag LOCUS_01490 6447 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7163 6453 gene locus_tag LOCUS_01500 gene ubiG 7163 6453 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_01500 8601 7222 gene locus_tag LOCUS_01510 gene mtaD 8601 7222 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E15 protein_id gnl|my_center|LOCUS_01510 8600 9649 gene locus_tag LOCUS_01520 gene mtnA 8600 9649 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_01520 >Feature sequence014 35 268 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgtagtttgcagggaacagccgtttggttacact 646 317 gene locus_tag LOCUS_01530 gene cas2 646 317 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WVJ7 protein_id gnl|my_center|LOCUS_01530 1539 649 gene locus_tag LOCUS_01540 gene cas1 1539 649 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_01540 4642 1532 gene locus_tag LOCUS_01550 gene cas9 4642 1532 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 protein_id gnl|my_center|LOCUS_01550 5122 6212 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgtagtttgaagggaatcgctgtttggttacact 6724 8286 gene locus_tag LOCUS_01560 6724 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 8292 8534 gene locus_tag LOCUS_01570 8292 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8651 9430 gene locus_tag LOCUS_01580 8651 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9784 9473 gene locus_tag LOCUS_01590 9784 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence015 456 169 gene locus_tag LOCUS_01600 456 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_01600 663 1598 gene locus_tag LOCUS_01610 663 1598 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 protein_id gnl|my_center|LOCUS_01610 1718 2146 gene locus_tag LOCUS_01620 1718 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2392 2811 gene locus_tag LOCUS_01630 2392 2811 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_01630 2933 3562 gene locus_tag LOCUS_01640 2933 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4052 3573 gene locus_tag LOCUS_01650 4052 3573 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_01650 4283 4504 gene locus_tag LOCUS_01660 4283 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5301 4501 gene locus_tag LOCUS_01670 gene cysQ 5301 4501 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_01670 5459 6118 gene locus_tag LOCUS_01680 5459 6118 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_01680 6524 6099 gene locus_tag LOCUS_01690 6524 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6683 8641 gene locus_tag LOCUS_01700 6683 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9089 8652 gene locus_tag LOCUS_01710 gene dtd 9089 8652 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNV3 protein_id gnl|my_center|LOCUS_01710 10039 9086 gene locus_tag LOCUS_01720 10039 9086 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH7 protein_id gnl|my_center|LOCUS_01720 >Feature sequence016 1230 76 gene locus_tag LOCUS_01730 1230 76 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214102.1 protein_id gnl|my_center|LOCUS_01730 1836 1393 gene locus_tag LOCUS_01740 1836 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390146.1 protein_id gnl|my_center|LOCUS_01740 3005 1833 gene locus_tag LOCUS_01750 3005 1833 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 protein_id gnl|my_center|LOCUS_01750 3309 5330 gene locus_tag LOCUS_01760 gene hppA 3309 5330 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_01760 5697 5344 gene locus_tag LOCUS_01770 5697 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 5986 5708 gene locus_tag LOCUS_01780 5986 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6276 8153 gene locus_tag LOCUS_01790 6276 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 8735 8157 gene locus_tag LOCUS_01800 8735 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 9408 9764 gene locus_tag LOCUS_01810 gene nuoA 9408 9764 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9S8 protein_id gnl|my_center|LOCUS_01810 >Feature sequence017 279 1931 gene locus_tag LOCUS_01820 gene ubiB 279 1931 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_01820 1935 2573 gene locus_tag LOCUS_01830 1935 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 3559 2570 gene locus_tag LOCUS_01840 3559 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403214.1 protein_id gnl|my_center|LOCUS_01840 4166 3612 gene locus_tag LOCUS_01850 4166 3612 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_01850 4930 4136 gene locus_tag LOCUS_01860 gene yibQ 4930 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_01860 6233 4980 gene locus_tag LOCUS_01870 6233 4980 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946247.1 protein_id gnl|my_center|LOCUS_01870 7498 6383 gene locus_tag LOCUS_01880 7498 6383 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958285.1 protein_id gnl|my_center|LOCUS_01880 9175 7616 gene locus_tag LOCUS_01890 gene gpmI 9175 7616 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_01890 9426 9758 gene locus_tag LOCUS_01900 9426 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence018 1330 821 gene locus_tag LOCUS_01910 1330 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2070 1837 gene locus_tag LOCUS_01920 2070 1837 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_01920 2195 2509 gene locus_tag LOCUS_01930 2195 2509 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143579.1 protein_id gnl|my_center|LOCUS_01930 2645 3502 gene locus_tag LOCUS_01940 2645 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_01940 4072 3596 gene locus_tag LOCUS_01950 4072 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4136 4486 gene locus_tag LOCUS_01960 4136 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4487 4900 gene locus_tag LOCUS_01970 4487 4900 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTP9 protein_id gnl|my_center|LOCUS_01970 5149 7041 gene locus_tag LOCUS_01980 5149 7041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_01980 8243 7047 gene locus_tag LOCUS_01990 gene purT 8243 7047 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2Y2 protein_id gnl|my_center|LOCUS_01990 9766 8240 gene locus_tag LOCUS_02000 9766 8240 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence019 1021 827 gene locus_tag LOCUS_02010 1021 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1778 1029 gene locus_tag LOCUS_02020 1778 1029 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970734.1 protein_id gnl|my_center|LOCUS_02020 3248 1794 gene locus_tag LOCUS_02030 3248 1794 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 protein_id gnl|my_center|LOCUS_02030 4384 3479 gene locus_tag LOCUS_02040 gene cyoE 4384 3479 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV6 protein_id gnl|my_center|LOCUS_02040 5039 4422 gene locus_tag LOCUS_02050 5039 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5648 5049 gene locus_tag LOCUS_02060 5648 5049 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_02060 5825 6028 gene locus_tag LOCUS_02070 5825 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7001 6120 gene locus_tag LOCUS_02080 gene coIII 7001 6120 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_02080 7666 7049 gene locus_tag LOCUS_02090 gene coxG 7666 7049 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948581.1 protein_id gnl|my_center|LOCUS_02090 9282 7843 gene locus_tag LOCUS_02100 gene coxA 9282 7843 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_02100 >Feature sequence020 3 482 gene locus_tag LOCUS_02110 3 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 515 871 gene locus_tag LOCUS_02120 515 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 877 1350 gene locus_tag LOCUS_02130 gene pilE3 877 1350 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_02130 2315 1347 gene locus_tag LOCUS_02140 gene ispH 2315 1347 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_02140 2781 2302 gene locus_tag LOCUS_02150 2781 2302 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S88 protein_id gnl|my_center|LOCUS_02150 3359 2784 gene locus_tag LOCUS_02160 gene lspA 3359 2784 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E3 protein_id gnl|my_center|LOCUS_02160 6218 3375 gene locus_tag LOCUS_02170 gene ileS 6218 3375 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_02170 7232 6249 gene locus_tag LOCUS_02180 7232 6249 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S91 protein_id gnl|my_center|LOCUS_02180 7870 7349 gene locus_tag LOCUS_02190 7870 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8760 7870 gene locus_tag LOCUS_02200 8760 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8946 9206 gene locus_tag LOCUS_02210 gene rpsT 8946 9206 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66508 protein_id gnl|my_center|LOCUS_02210 >Feature sequence021 1170 388 gene locus_tag LOCUS_02220 1170 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2778 1627 gene locus_tag LOCUS_02230 2778 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 protein_id gnl|my_center|LOCUS_02230 3075 2791 gene locus_tag LOCUS_02240 3075 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3065 4027 gene locus_tag LOCUS_02250 3065 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4995 4075 gene locus_tag LOCUS_02260 4995 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5917 4982 gene locus_tag LOCUS_02270 5917 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 6620 5949 gene locus_tag LOCUS_02280 6620 5949 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 protein_id gnl|my_center|LOCUS_02280 7790 6783 gene locus_tag LOCUS_02290 7790 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8162 8341 gene locus_tag LOCUS_02300 8162 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 8345 8836 gene locus_tag LOCUS_02310 8345 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_02310 8829 9104 gene locus_tag LOCUS_02320 8829 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 9097 9375 gene locus_tag LOCUS_02330 9097 9375 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence022 927 1949 gene locus_tag LOCUS_02340 927 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2109 3203 gene locus_tag LOCUS_02350 2109 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4387 3434 gene locus_tag LOCUS_02360 4387 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5646 4384 gene locus_tag LOCUS_02370 5646 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5746 7107 gene locus_tag LOCUS_02380 gene radA 5746 7107 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT0 protein_id gnl|my_center|LOCUS_02380 7480 7094 gene locus_tag LOCUS_02390 7480 7094 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB4 protein_id gnl|my_center|LOCUS_02390 8097 7501 gene locus_tag LOCUS_02400 8097 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 <9005 8258 gene locus_tag LOCUS_02410 <9005 8258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071563.1:membrane protein >Feature sequence023 1065 124 gene locus_tag LOCUS_02420 1065 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1944 1099 gene locus_tag LOCUS_02430 1944 1099 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_02430 2915 1962 gene locus_tag LOCUS_02440 2915 1962 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_02440 4442 3024 gene locus_tag LOCUS_02450 4442 3024 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_02450 5263 4847 gene locus_tag LOCUS_02460 5263 4847 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_02460 5859 5293 gene locus_tag LOCUS_02470 5859 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_02470 7276 5894 gene locus_tag LOCUS_02480 7276 5894 CDS product NrfA- nitrite reduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118576.1 protein_id gnl|my_center|LOCUS_02480 8967 7288 gene locus_tag LOCUS_02490 gene nirB 8967 7288 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence024 208 2025 gene locus_tag LOCUS_02500 208 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1991 2527 gene locus_tag LOCUS_02510 1991 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_02510 2567 2854 gene locus_tag LOCUS_02520 2567 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2922 3305 gene locus_tag LOCUS_02530 gene apaG 2922 3305 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE4 protein_id gnl|my_center|LOCUS_02530 3333 3935 gene locus_tag LOCUS_02540 3333 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3942 4787 gene locus_tag LOCUS_02550 gene apaH 3942 4787 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT6 protein_id gnl|my_center|LOCUS_02550 4986 4789 gene locus_tag LOCUS_02560 4986 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5562 5068 gene locus_tag LOCUS_02570 gene folA 5562 5068 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E867 protein_id gnl|my_center|LOCUS_02570 6356 5562 gene locus_tag LOCUS_02580 gene thyA 6356 5562 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_02580 7328 6501 gene locus_tag LOCUS_02590 gene lgt 7328 6501 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_02590 >Feature sequence025 330 1421 gene locus_tag LOCUS_02600 gene aroB 330 1421 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_02600 1418 2575 gene locus_tag LOCUS_02610 1418 2575 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGI5 protein_id gnl|my_center|LOCUS_02610 2708 2959 gene locus_tag LOCUS_02620 2708 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2956 5139 gene locus_tag LOCUS_02630 2956 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5854 7998 gene locus_tag LOCUS_02640 5854 7998 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence026 339 40 gene locus_tag LOCUS_02650 gene fliE 339 40 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X186 protein_id gnl|my_center|LOCUS_02650 785 336 gene locus_tag LOCUS_02660 785 336 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X185 protein_id gnl|my_center|LOCUS_02660 1177 785 gene locus_tag LOCUS_02670 gene flgB 1177 785 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24500 protein_id gnl|my_center|LOCUS_02670 1448 1167 gene locus_tag LOCUS_02680 1448 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2595 1459 gene locus_tag LOCUS_02690 gene flgI 2595 1459 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_02690 3146 2583 gene locus_tag LOCUS_02700 3146 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4109 3150 gene locus_tag LOCUS_02710 4109 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4890 4111 gene locus_tag LOCUS_02720 gene flgG 4890 4111 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_02720 5645 4905 gene locus_tag LOCUS_02730 5645 4905 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_02730 5922 5605 gene locus_tag LOCUS_02740 5922 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 7163 5925 gene locus_tag LOCUS_02750 7163 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 <8761 7173 gene locus_tag LOCUS_02760 <8761 7173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546817.1:flagellar biosynthesis protein FlhA >Feature sequence027 3847 1397 gene locus_tag LOCUS_02770 3847 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4465 4109 gene locus_tag LOCUS_02780 gene rplS 4465 4109 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH7 protein_id gnl|my_center|LOCUS_02780 5290 4541 gene locus_tag LOCUS_02790 gene trmD 5290 4541 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4I5 protein_id gnl|my_center|LOCUS_02790 5816 5298 gene locus_tag LOCUS_02800 gene rimM 5816 5298 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG24 protein_id gnl|my_center|LOCUS_02800 6081 5842 gene locus_tag LOCUS_02810 gene rpsP 6081 5842 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_02810 7573 6218 gene locus_tag LOCUS_02820 gene ffh 7573 6218 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVF4 protein_id gnl|my_center|LOCUS_02820 8374 7610 gene locus_tag LOCUS_02830 8374 7610 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence028 1718 2095 gene locus_tag LOCUS_02840 1718 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2425 2138 gene locus_tag LOCUS_02850 2425 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_02850 3028 2444 gene locus_tag LOCUS_02860 3028 2444 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_02860 3385 4593 gene locus_tag LOCUS_02870 3385 4593 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_02870 4705 5142 gene locus_tag LOCUS_02880 4705 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5231 5995 gene locus_tag LOCUS_02890 5231 5995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090496.1 protein_id gnl|my_center|LOCUS_02890 5997 6863 gene locus_tag LOCUS_02900 5997 6863 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_02900 6868 7755 gene locus_tag LOCUS_02910 6868 7755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090494.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence029 2759 342 gene locus_tag LOCUS_02920 gene lon 2759 342 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_02920 3261 2881 gene locus_tag LOCUS_02930 3261 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02930 4161 3295 gene locus_tag LOCUS_02940 4161 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02940 4636 4238 gene locus_tag LOCUS_02950 4636 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6079 4778 gene locus_tag LOCUS_02960 gene tig 6079 4778 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 protein_id gnl|my_center|LOCUS_02960 6219 6135 gene locus_tag LOCUS_t00020 6219 6135 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6398 6323 gene locus_tag LOCUS_t00030 6398 6323 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7241 7165 gene locus_tag LOCUS_t00040 7241 7165 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7400 8242 gene locus_tag LOCUS_02970 gene folD 7400 8242 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG21 protein_id gnl|my_center|LOCUS_02970 >Feature sequence030 190 1326 gene locus_tag LOCUS_02980 gene nrdB 190 1326 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BF5 protein_id gnl|my_center|LOCUS_02980 1426 1866 gene locus_tag LOCUS_02990 1426 1866 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_02990 2778 1882 gene locus_tag LOCUS_03000 2778 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5011 2972 gene locus_tag LOCUS_03010 5011 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5712 5008 gene locus_tag LOCUS_03020 5712 5008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390248.1 protein_id gnl|my_center|LOCUS_03020 5861 6391 gene locus_tag LOCUS_03030 5861 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6388 6951 gene locus_tag LOCUS_03040 6388 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6968 8161 gene locus_tag LOCUS_03050 6968 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence031 1320 850 gene locus_tag LOCUS_03060 1320 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2025 1342 gene locus_tag LOCUS_03070 2025 1342 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_03070 2714 2028 gene locus_tag LOCUS_03080 2714 2028 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_03080 3110 2727 gene locus_tag LOCUS_03090 3110 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3857 3243 gene locus_tag LOCUS_03100 3857 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03100 5132 3945 gene locus_tag LOCUS_03110 5132 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03110 5484 6146 gene locus_tag LOCUS_03120 gene pcm 5484 6146 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_03120 6158 6478 gene locus_tag LOCUS_03130 6158 6478 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_03130 6522 7823 gene locus_tag LOCUS_03140 gene tolC 6522 7823 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence032 2262 1039 gene locus_tag LOCUS_03150 2262 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3007 2402 gene locus_tag LOCUS_03160 3007 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3528 3025 gene locus_tag LOCUS_03170 3528 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3759 4187 gene locus_tag LOCUS_03180 3759 4187 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_03180 5197 4193 gene locus_tag LOCUS_03190 5197 4193 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_03190 6093 5209 gene locus_tag LOCUS_03200 6093 5209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_03200 6561 6187 gene locus_tag LOCUS_03210 6561 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7106 6747 gene locus_tag LOCUS_03220 7106 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 <8364 7201 gene locus_tag LOCUS_03230 <8364 7201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704599.1:metallophosphatase >Feature sequence033 1178 714 gene locus_tag LOCUS_03240 1178 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2203 1280 gene locus_tag LOCUS_03250 2203 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2447 3589 gene locus_tag LOCUS_03260 2447 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3647 7879 gene locus_tag LOCUS_03270 3647 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8177 7929 gene locus_tag LOCUS_03280 8177 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence034 2555 3316 gene locus_tag LOCUS_03290 2555 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 protein_id gnl|my_center|LOCUS_03290 3710 4741 gene locus_tag LOCUS_03300 gene pyrC 3710 4741 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_03300 5613 4738 gene locus_tag LOCUS_03310 5613 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972447.1 protein_id gnl|my_center|LOCUS_03310 5692 6336 gene locus_tag LOCUS_03320 gene rnt 5692 6336 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAG3 protein_id gnl|my_center|LOCUS_03320 6716 6402 gene locus_tag LOCUS_03330 6716 6402 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_03330 <8215 6871 gene locus_tag LOCUS_03340 <8215 6871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106635.1:asparagine synthetase B >Feature sequence035 <1 1456 gene locus_tag LOCUS_03350 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z9H0:bifunctional uridylyltransferase/uridylyl-removing enzyme 1829 1449 gene locus_tag LOCUS_03360 1829 1449 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_03360 2727 1813 gene locus_tag LOCUS_03370 2727 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_03370 2787 3983 gene locus_tag LOCUS_03380 2787 3983 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_03380 4061 4885 gene locus_tag LOCUS_03390 gene dapD 4061 4885 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB9 protein_id gnl|my_center|LOCUS_03390 4885 5235 gene locus_tag LOCUS_03400 4885 5235 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_03400 5232 6137 gene locus_tag LOCUS_03410 gene dapE 5232 6137 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03410 6246 6365 gene locus_tag LOCUS_03420 6246 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6830 6357 gene locus_tag LOCUS_03430 6830 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7527 6844 gene locus_tag LOCUS_03440 7527 6844 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706058.1 protein_id gnl|my_center|LOCUS_03440 <8145 7524 gene locus_tag LOCUS_03450 <8145 7524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038053.1:helicase >Feature sequence036 <1 760 gene locus_tag LOCUS_03460 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038356.1:YggW family oxidoreductase 750 938 gene locus_tag LOCUS_03470 750 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719780.1 protein_id gnl|my_center|LOCUS_03470 931 1191 gene locus_tag LOCUS_03480 931 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1191 1670 gene locus_tag LOCUS_03490 1191 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1651 2007 gene locus_tag LOCUS_03500 1651 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_03500 2010 2906 gene locus_tag LOCUS_03510 2010 2906 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816918.1 protein_id gnl|my_center|LOCUS_03510 2962 3645 gene locus_tag LOCUS_03520 gene crp 2962 3645 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_03520 4308 3649 gene locus_tag LOCUS_03530 gene trmB 4308 3649 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_03530 5172 4375 gene locus_tag LOCUS_03540 gene thiG 5172 4375 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_03540 5405 5205 gene locus_tag LOCUS_03550 5405 5205 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_03550 5520 7301 gene locus_tag LOCUS_03560 5520 7301 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084106.1 protein_id gnl|my_center|LOCUS_03560 7309 7383 gene locus_tag LOCUS_t00050 7309 7383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence037 271 1401 gene locus_tag LOCUS_03570 271 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_03570 1626 3893 gene locus_tag LOCUS_03580 gene fadE 1626 3893 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_03580 3906 5264 gene locus_tag LOCUS_03590 3906 5264 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_03590 5273 7324 gene locus_tag LOCUS_03600 gene yfcX 5273 7324 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence038 471 259 gene locus_tag LOCUS_03610 471 259 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 protein_id gnl|my_center|LOCUS_03610 593 1534 gene locus_tag LOCUS_03620 593 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 protein_id gnl|my_center|LOCUS_03620 2493 1540 gene locus_tag LOCUS_03630 gene oxyR 2493 1540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_03630 2658 3593 gene locus_tag LOCUS_03640 2658 3593 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_03640 3656 4093 gene locus_tag LOCUS_03650 3656 4093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056732.1 protein_id gnl|my_center|LOCUS_03650 4090 4383 gene locus_tag LOCUS_03660 4090 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755918.1 protein_id gnl|my_center|LOCUS_03660 4457 5008 gene locus_tag LOCUS_03670 4457 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6813 5098 gene locus_tag LOCUS_03680 gene phoD 6813 5098 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_03680 6960 7352 gene locus_tag LOCUS_03690 6960 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence039 2166 1000 gene locus_tag LOCUS_03700 2166 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2397 2173 gene locus_tag LOCUS_03710 2397 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2896 2402 gene locus_tag LOCUS_03720 2896 2402 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_03720 3558 2917 gene locus_tag LOCUS_03730 3558 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4301 3564 gene locus_tag LOCUS_03740 4301 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7207 4418 gene locus_tag LOCUS_03750 7207 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence040 265 939 gene locus_tag LOCUS_03760 265 939 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_03760 1044 1280 gene locus_tag LOCUS_03770 gene rpmB 1044 1280 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM5 protein_id gnl|my_center|LOCUS_03770 1293 1460 gene locus_tag LOCUS_03780 gene rpmG 1293 1460 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVC7 protein_id gnl|my_center|LOCUS_03780 1609 2829 gene locus_tag LOCUS_03790 gene yuxH 1609 2829 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_03790 4796 2826 gene locus_tag LOCUS_03800 gene hyuA 4796 2826 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_03800 4938 5900 gene locus_tag LOCUS_03810 4938 5900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03810 5897 6652 gene locus_tag LOCUS_03820 5897 6652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence041 723 1334 gene locus_tag LOCUS_03830 gene rnhB 723 1334 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_03830 1403 1972 gene locus_tag LOCUS_03840 1403 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_03840 2070 5522 gene locus_tag LOCUS_03850 gene dnaE 2070 5522 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWX2 protein_id gnl|my_center|LOCUS_03850 5578 6534 gene locus_tag LOCUS_03860 gene accA 5578 6534 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_03860 >Feature sequence042 754 284 gene locus_tag LOCUS_03870 754 284 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_03870 2087 762 gene locus_tag LOCUS_03880 gene rlmD 2087 762 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_03880 2864 2097 gene locus_tag LOCUS_03890 2864 2097 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_03890 3114 3467 gene locus_tag LOCUS_03900 3114 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4209 3460 gene locus_tag LOCUS_03910 gene pdxJ 4209 3460 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQE2 protein_id gnl|my_center|LOCUS_03910 4991 4242 gene locus_tag LOCUS_03920 gene recO 4991 4242 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51838 protein_id gnl|my_center|LOCUS_03920 5880 4978 gene locus_tag LOCUS_03930 gene era 5880 4978 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWZ1 protein_id gnl|my_center|LOCUS_03930 6553 5882 gene locus_tag LOCUS_03940 gene rnc 6553 5882 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB2 protein_id gnl|my_center|LOCUS_03940 6927 6553 gene locus_tag LOCUS_03950 6927 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 <7682 6951 gene locus_tag LOCUS_03960 <7682 6951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87XF9:signal peptidase I >Feature sequence043 406 1218 gene locus_tag LOCUS_03970 gene rhdA 406 1218 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_03970 2110 1220 gene locus_tag LOCUS_03980 2110 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2584 2114 gene locus_tag LOCUS_03990 2584 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880796.1 protein_id gnl|my_center|LOCUS_03990 3249 2584 gene locus_tag LOCUS_04000 gene senC 3249 2584 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_04000 3387 3851 gene locus_tag LOCUS_04010 gene lexA 3387 3851 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187P1 protein_id gnl|my_center|LOCUS_04010 3870 4328 gene locus_tag LOCUS_04020 3870 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4443 5003 gene locus_tag LOCUS_04030 4443 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5970 5005 gene locus_tag LOCUS_04040 gene epmA 5970 5005 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43826 protein_id gnl|my_center|LOCUS_04040 6552 5983 gene locus_tag LOCUS_04050 gene efp 6552 5983 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_04050 6711 7619 gene locus_tag LOCUS_04060 6711 7619 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence044 3676 2939 gene locus_tag LOCUS_04070 3676 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5022 3682 gene locus_tag LOCUS_04080 5022 3682 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343637.1 protein_id gnl|my_center|LOCUS_04080 5521 5060 gene locus_tag LOCUS_04090 5521 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6093 5518 gene locus_tag LOCUS_04100 6093 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7179 6661 gene locus_tag LOCUS_04110 7179 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence045 <1 1183 gene locus_tag LOCUS_04120 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225648.1:cytochrome c biogenesis protein 1198 2562 gene locus_tag LOCUS_04130 1198 2562 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 protein_id gnl|my_center|LOCUS_04130 2714 3367 gene locus_tag LOCUS_04140 gene dsbA 2714 3367 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_04140 3444 5075 gene locus_tag LOCUS_04150 gene ilvB 3444 5075 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_04150 5110 5883 gene locus_tag LOCUS_04160 5110 5883 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence046 <1 1040 gene locus_tag LOCUS_04170 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6D5:phosphoenolpyruvate carboxylase note possible pseudo, internal stop codon 1050 2003 gene locus_tag LOCUS_04180 1050 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04180 2022 3047 gene locus_tag LOCUS_04190 gene queA 2022 3047 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 protein_id gnl|my_center|LOCUS_04190 3059 4156 gene locus_tag LOCUS_04200 gene tgt 3059 4156 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_04200 4234 4581 gene locus_tag LOCUS_04210 gene yajC 4234 4581 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_04210 4606 6462 gene locus_tag LOCUS_04220 gene secD 4606 6462 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S34 protein_id gnl|my_center|LOCUS_04220 6498 7436 gene locus_tag LOCUS_04230 gene secF 6498 7436 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CH4 protein_id gnl|my_center|LOCUS_04230 >Feature sequence047 1809 1540 gene locus_tag LOCUS_04240 gene rpsO 1809 1540 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE0 protein_id gnl|my_center|LOCUS_04240 2838 1918 gene locus_tag LOCUS_04250 gene truB 2838 1918 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI9 protein_id gnl|my_center|LOCUS_04250 3212 2850 gene locus_tag LOCUS_04260 gene rbfA 3212 2850 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_04260 5794 3251 gene locus_tag LOCUS_04270 gene infB 5794 3251 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L5 protein_id gnl|my_center|LOCUS_04270 7323 5821 gene locus_tag LOCUS_04280 gene nusA 7323 5821 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ4 protein_id gnl|my_center|LOCUS_04280 >Feature sequence048 1156 311 gene locus_tag LOCUS_04290 1156 311 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6W0 protein_id gnl|my_center|LOCUS_04290 4464 1174 gene locus_tag LOCUS_04300 4464 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4621 4475 gene locus_tag LOCUS_04310 4621 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5384 4632 gene locus_tag LOCUS_04320 5384 4632 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_04320 5915 5394 gene locus_tag LOCUS_04330 5915 5394 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_04330 <7484 5925 gene locus_tag LOCUS_04340 <7484 5925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037054.1:chemotaxis protein CheA >Feature sequence049 376 158 gene locus_tag LOCUS_04350 376 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1765 401 gene locus_tag LOCUS_04360 1765 401 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105346.1 protein_id gnl|my_center|LOCUS_04360 4509 1762 gene locus_tag LOCUS_04370 4509 1762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_04370 5760 4534 gene locus_tag LOCUS_04380 5760 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 7077 5785 gene locus_tag LOCUS_04390 7077 5785 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence050 1331 168 gene locus_tag LOCUS_04400 1331 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2839 1328 gene locus_tag LOCUS_04410 2839 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_04410 3812 2829 gene locus_tag LOCUS_04420 3812 2829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_04420 4489 3809 gene locus_tag LOCUS_04430 4489 3809 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_04430 5071 4526 gene locus_tag LOCUS_04440 5071 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5977 5246 gene locus_tag LOCUS_04450 5977 5246 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_04450 5904 6179 gene locus_tag LOCUS_04460 5904 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7190 6330 gene locus_tag LOCUS_04470 7190 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence051 826 2514 gene locus_tag LOCUS_04480 826 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2514 2930 gene locus_tag LOCUS_04490 2514 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2944 3270 gene locus_tag LOCUS_04500 gene spoIIAA 2944 3270 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_04500 3273 4088 gene locus_tag LOCUS_04510 3273 4088 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390658.1 protein_id gnl|my_center|LOCUS_04510 4090 4896 gene locus_tag LOCUS_04520 4090 4896 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_04520 4901 5821 gene locus_tag LOCUS_04530 4901 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_04530 5818 6423 gene locus_tag LOCUS_04540 5818 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7292 6420 gene locus_tag LOCUS_04550 7292 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence052 1987 1016 gene locus_tag LOCUS_04560 gene pyrB 1987 1016 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I89 protein_id gnl|my_center|LOCUS_04560 2490 1984 gene locus_tag LOCUS_04570 gene pyrR 2490 1984 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_04570 2927 2499 gene locus_tag LOCUS_04580 gene yqgF 2927 2499 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPT6 protein_id gnl|my_center|LOCUS_04580 3504 2941 gene locus_tag LOCUS_04590 3504 2941 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXZ4 protein_id gnl|my_center|LOCUS_04590 4451 3552 gene locus_tag LOCUS_04600 gene tonB 4451 3552 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_04600 4963 4436 gene locus_tag LOCUS_04610 4963 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5336 4977 gene locus_tag LOCUS_04620 5336 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6394 5333 gene locus_tag LOCUS_04630 6394 5333 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXD0 protein_id gnl|my_center|LOCUS_04630 <7298 6372 gene locus_tag LOCUS_04640 <7298 6372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VA4:glutathione synthetase >Feature sequence053 1826 348 gene locus_tag LOCUS_04650 1826 348 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_04650 1940 5062 gene locus_tag LOCUS_04660 gene putA 1940 5062 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUU6 protein_id gnl|my_center|LOCUS_04660 6342 5059 gene locus_tag LOCUS_04670 6342 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6442 6909 gene locus_tag LOCUS_04680 6442 6909 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W2 protein_id gnl|my_center|LOCUS_04680 >Feature sequence054 <1 1464 gene locus_tag LOCUS_04690 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880089.1:sigma-54-dependent Fis family transcriptional regulator 2150 1461 gene locus_tag LOCUS_04700 2150 1461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_04700 2912 2166 gene locus_tag LOCUS_04710 2912 2166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_04710 4066 2939 gene locus_tag LOCUS_04720 4066 2939 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_04720 5007 4084 gene locus_tag LOCUS_04730 5007 4084 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_04730 6336 5083 gene locus_tag LOCUS_04740 6336 5083 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence055 684 118 gene locus_tag LOCUS_04750 684 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1496 831 gene locus_tag LOCUS_04760 gene tpm 1496 831 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ86 protein_id gnl|my_center|LOCUS_04760 1597 2313 gene locus_tag LOCUS_04770 1597 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2849 2325 gene locus_tag LOCUS_04780 2849 2325 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_04780 3731 2871 gene locus_tag LOCUS_04790 3731 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3866 5077 gene locus_tag LOCUS_04800 gene ispG 3866 5077 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0A6 protein_id gnl|my_center|LOCUS_04800 6394 5078 gene locus_tag LOCUS_04810 gene mltF 6394 5078 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E750 protein_id gnl|my_center|LOCUS_04810 <7215 6451 gene locus_tag LOCUS_04820 <7215 6451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000234354.1:transporter >Feature sequence056 1739 657 gene locus_tag LOCUS_04830 gene mraY 1739 657 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY2 protein_id gnl|my_center|LOCUS_04830 3050 1743 gene locus_tag LOCUS_04840 gene murF 3050 1743 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_04840 4623 3091 gene locus_tag LOCUS_04850 gene murE 4623 3091 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 protein_id gnl|my_center|LOCUS_04850 6350 4620 gene locus_tag LOCUS_04860 gene pbpB 6350 4620 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_04860 6613 6347 gene locus_tag LOCUS_04870 gene ftsL 6613 6347 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK6 protein_id gnl|my_center|LOCUS_04870 <7168 6610 gene locus_tag LOCUS_04880 <7168 6610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVZ5:ribosomal RNA small subunit methyltransferase H >Feature sequence057 1368 2315 gene locus_tag LOCUS_04890 1368 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2379 2765 gene locus_tag LOCUS_04900 2379 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 2773 3732 gene locus_tag LOCUS_04910 2773 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3865 4440 gene locus_tag LOCUS_04920 3865 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4484 5176 gene locus_tag LOCUS_04930 4484 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5576 5199 gene locus_tag LOCUS_04940 5576 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008992036.1 protein_id gnl|my_center|LOCUS_04940 5806 6213 gene locus_tag LOCUS_04950 5806 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_04950 6217 6585 gene locus_tag LOCUS_04960 6217 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence058 1174 731 gene locus_tag LOCUS_04970 1174 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2588 1167 gene locus_tag LOCUS_04980 gene fliI 2588 1167 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268440.1 protein_id gnl|my_center|LOCUS_04980 3216 2578 gene locus_tag LOCUS_04990 3216 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4228 3209 gene locus_tag LOCUS_05000 gene fliG 4228 3209 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_05000 5939 4242 gene locus_tag LOCUS_05010 5939 4242 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT3 protein_id gnl|my_center|LOCUS_05010 6276 5947 gene locus_tag LOCUS_05020 gene fliE 6276 5947 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT2 protein_id gnl|my_center|LOCUS_05020 <7102 6286 gene locus_tag LOCUS_05030 <7102 6286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262361.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence059 974 528 gene locus_tag LOCUS_05040 974 528 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_05040 2100 1000 gene locus_tag LOCUS_05050 2100 1000 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930428.1 protein_id gnl|my_center|LOCUS_05050 3183 2104 gene locus_tag LOCUS_05060 3183 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710123.1 protein_id gnl|my_center|LOCUS_05060 4669 3200 gene locus_tag LOCUS_05070 4669 3200 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336822.1 protein_id gnl|my_center|LOCUS_05070 6005 4743 gene locus_tag LOCUS_05080 6005 4743 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968505.1 protein_id gnl|my_center|LOCUS_05080 6333 6052 gene locus_tag LOCUS_05090 6333 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6581 6390 gene locus_tag LOCUS_05100 6581 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence060 <1 684 gene locus_tag LOCUS_05110 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EB59:hemin import ATP-binding protein HmuV 1781 681 gene locus_tag LOCUS_05120 1781 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2272 4137 gene locus_tag LOCUS_05130 2272 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_05130 7001 4236 gene locus_tag LOCUS_05140 gene bhpP 7001 4236 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331393.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence061 1 264 gene locus_tag LOCUS_05150 1 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 257 1228 gene locus_tag LOCUS_05160 257 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2939 1233 gene locus_tag LOCUS_05170 2939 1233 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_05170 3186 2932 gene locus_tag LOCUS_05180 3186 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708739.1 protein_id gnl|my_center|LOCUS_05180 4654 3191 gene locus_tag LOCUS_05190 4654 3191 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_05190 6126 4651 gene locus_tag LOCUS_05200 6126 4651 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_05200 6482 6126 gene locus_tag LOCUS_05210 6482 6126 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_05210 6901 6482 gene locus_tag LOCUS_05220 6901 6482 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence062 <1 1917 gene locus_tag LOCUS_05230 <1 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZS05:threonine--tRNA ligase 2011 2439 gene locus_tag LOCUS_05240 gene infC 2011 2439 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER8 protein_id gnl|my_center|LOCUS_05240 2515 2712 gene locus_tag LOCUS_05250 gene rpmI 2515 2712 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67917 protein_id gnl|my_center|LOCUS_05250 2725 3081 gene locus_tag LOCUS_05260 gene rplT 2725 3081 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_05260 3207 4229 gene locus_tag LOCUS_05270 gene pheS 3207 4229 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_05270 4273 6648 gene locus_tag LOCUS_05280 gene pheT 4273 6648 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 protein_id gnl|my_center|LOCUS_05280 >Feature sequence063 999 121 gene locus_tag LOCUS_05290 999 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2215 1076 gene locus_tag LOCUS_05300 gene dnaJ 2215 1076 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_05300 4281 2356 gene locus_tag LOCUS_05310 gene dnaK 4281 2356 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_05310 4973 4392 gene locus_tag LOCUS_05320 gene grpE 4973 4392 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY2 protein_id gnl|my_center|LOCUS_05320 6101 5049 gene locus_tag LOCUS_05330 gene hrcA 6101 5049 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence064 529 356 gene locus_tag LOCUS_05340 529 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2169 547 gene locus_tag LOCUS_05350 2169 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2987 2169 gene locus_tag LOCUS_05360 2987 2169 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_05360 3610 3167 gene locus_tag LOCUS_05370 3610 3167 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772128.1 protein_id gnl|my_center|LOCUS_05370 3844 3629 gene locus_tag LOCUS_05380 gene rpsU 3844 3629 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V8 protein_id gnl|my_center|LOCUS_05380 3967 4995 gene locus_tag LOCUS_05390 gene tsaD 3967 4995 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS54 protein_id gnl|my_center|LOCUS_05390 5785 5012 gene locus_tag LOCUS_05400 5785 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6104 5823 gene locus_tag LOCUS_05410 6104 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_05410 6487 6119 gene locus_tag LOCUS_05420 6487 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence065 >Feature sequence066 570 172 gene locus_tag LOCUS_05430 gene rpsF 570 172 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIS8 protein_id gnl|my_center|LOCUS_05430 1450 695 gene locus_tag LOCUS_05440 gene rlmB 1450 695 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_05440 3895 1460 gene locus_tag LOCUS_05450 gene rnr 3895 1460 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_05450 4009 4095 gene locus_tag LOCUS_t00060 4009 4095 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5818 4130 gene locus_tag LOCUS_05460 5818 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6688 5828 gene locus_tag LOCUS_05470 6688 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence067 1 450 gene locus_tag LOCUS_05480 gene rplI 1 450 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z163 protein_id gnl|my_center|LOCUS_05480 639 2051 gene locus_tag LOCUS_05490 gene dnaB 639 2051 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UY2 protein_id gnl|my_center|LOCUS_05490 2048 3139 gene locus_tag LOCUS_05500 gene alr 2048 3139 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI6 protein_id gnl|my_center|LOCUS_05500 6812 3978 gene locus_tag LOCUS_05510 6812 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence068 809 519 gene locus_tag LOCUS_05520 809 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1100 837 gene locus_tag LOCUS_05530 1100 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1776 1159 gene locus_tag LOCUS_05540 1776 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_05540 2296 1889 gene locus_tag LOCUS_05550 2296 1889 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_05550 4050 2350 gene locus_tag LOCUS_05560 4050 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4152 4739 gene locus_tag LOCUS_05570 4152 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6212 4749 gene locus_tag LOCUS_05580 6212 4749 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_05580 6596 6324 gene locus_tag LOCUS_05590 6596 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524257.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence069 2 859 gene locus_tag LOCUS_05600 gene kdsD 2 859 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_05600 873 1400 gene locus_tag LOCUS_05610 873 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_05610 1397 1960 gene locus_tag LOCUS_05620 1397 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1950 2504 gene locus_tag LOCUS_05630 gene lptA 1950 2504 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU2 protein_id gnl|my_center|LOCUS_05630 2501 3226 gene locus_tag LOCUS_05640 2501 3226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_05640 3314 4762 gene locus_tag LOCUS_05650 gene rpoN 3314 4762 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_05650 4788 5114 gene locus_tag LOCUS_05660 gene yfiA-2 4788 5114 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_05660 5138 5602 gene locus_tag LOCUS_05670 gene ptsN 5138 5602 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_05670 5616 6131 gene locus_tag LOCUS_05680 5616 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence070 483 145 gene locus_tag LOCUS_05690 483 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879996.1 protein_id gnl|my_center|LOCUS_05690 849 493 gene locus_tag LOCUS_05700 849 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 966 1424 gene locus_tag LOCUS_05710 966 1424 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_05710 2491 1421 gene locus_tag LOCUS_05720 2491 1421 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223173.1 protein_id gnl|my_center|LOCUS_05720 3543 2479 gene locus_tag LOCUS_05730 3543 2479 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_05730 3752 5233 gene locus_tag LOCUS_05740 gene pepA 3752 5233 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_05740 5241 5672 gene locus_tag LOCUS_05750 gene holC 5241 5672 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_05750 5676 6077 gene locus_tag LOCUS_05760 5676 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence071 2272 1475 gene locus_tag LOCUS_05770 2272 1475 CDS product general secretion pathway protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 protein_id gnl|my_center|LOCUS_05770 2754 2272 gene locus_tag LOCUS_05780 2754 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3977 2754 gene locus_tag LOCUS_05790 3977 2754 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TC9 protein_id gnl|my_center|LOCUS_05790 4924 3980 gene locus_tag LOCUS_05800 4924 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5556 4927 gene locus_tag LOCUS_05810 gene gspJ 5556 4927 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704545.1 protein_id gnl|my_center|LOCUS_05810 5939 5556 gene locus_tag LOCUS_05820 5939 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6454 5939 gene locus_tag LOCUS_05830 6454 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence072 237 992 gene locus_tag LOCUS_05840 gene fliP 237 992 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D2 protein_id gnl|my_center|LOCUS_05840 992 1741 gene locus_tag LOCUS_05850 gene whiG 992 1741 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17211 protein_id gnl|my_center|LOCUS_05850 1821 2396 gene locus_tag LOCUS_05860 1821 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2410 2766 gene locus_tag LOCUS_05870 2410 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3498 2770 gene locus_tag LOCUS_05880 3498 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4049 3495 gene locus_tag LOCUS_05890 gene rpoE4 4049 3495 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970227.1 protein_id gnl|my_center|LOCUS_05890 4515 4312 gene locus_tag LOCUS_05900 4515 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5173 4517 gene locus_tag LOCUS_05910 gene rpiA 5173 4517 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK7 protein_id gnl|my_center|LOCUS_05910 >Feature sequence073 2210 669 gene locus_tag LOCUS_05920 gene atpA2 2210 669 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_05920 2842 2306 gene locus_tag LOCUS_05930 gene atpH 2842 2306 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_05930 3323 2853 gene locus_tag LOCUS_05940 gene atpF 3323 2853 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KA4 protein_id gnl|my_center|LOCUS_05940 3587 3357 gene locus_tag LOCUS_05950 3587 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4533 3640 gene locus_tag LOCUS_05960 gene atpB 4533 3640 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS8 protein_id gnl|my_center|LOCUS_05960 5011 4607 gene locus_tag LOCUS_05970 5011 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6130 5249 gene locus_tag LOCUS_05980 6130 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence074 3662 30 gene locus_tag LOCUS_05990 3662 30 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_05990 4221 3697 gene locus_tag LOCUS_06000 4221 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_06000 5456 4221 gene locus_tag LOCUS_06010 5456 4221 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_06010 5985 5476 gene locus_tag LOCUS_06020 gene pilV 5985 5476 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037628.1 protein_id gnl|my_center|LOCUS_06020 6440 5976 gene locus_tag LOCUS_06030 gene fimU 6440 5976 CDS product type 4 fimbrial biogenesis protein FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102598.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence075 <1 784 gene locus_tag LOCUS_06040 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266287.1:GGDEF domain-containing protein 1015 1989 gene locus_tag LOCUS_06050 1015 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2053 2931 gene locus_tag LOCUS_06060 2053 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3217 4869 gene locus_tag LOCUS_06070 gene ilvB 3217 4869 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_06070 4899 6335 gene locus_tag LOCUS_06080 4899 6335 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence076 1235 468 gene locus_tag LOCUS_06090 1235 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_06090 2956 1439 gene locus_tag LOCUS_06100 gene comM 2956 1439 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_06100 3282 3031 gene locus_tag LOCUS_06110 3282 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_06110 3391 4050 gene locus_tag LOCUS_06120 3391 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_06120 4268 4948 gene locus_tag LOCUS_06130 4268 4948 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_06130 4945 5781 gene locus_tag LOCUS_06140 gene ureD 4945 5781 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_06140 5810 6112 gene locus_tag LOCUS_06150 gene ureA 5810 6112 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_06150 6146 6451 gene locus_tag LOCUS_06160 gene ureB 6146 6451 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN07 protein_id gnl|my_center|LOCUS_06160 >Feature sequence077 3124 2456 gene locus_tag LOCUS_06170 3124 2456 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_06170 3245 4258 gene locus_tag LOCUS_06180 gene hemB 3245 4258 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_06180 4272 5129 gene locus_tag LOCUS_06190 gene aroE 4272 5129 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX8 protein_id gnl|my_center|LOCUS_06190 5530 5126 gene locus_tag LOCUS_06200 5530 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5801 5556 gene locus_tag LOCUS_06210 5801 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6583 5798 gene locus_tag LOCUS_06220 gene lgt 6583 5798 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_06220 >Feature sequence078 1379 843 gene locus_tag LOCUS_06230 1379 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2130 1366 gene locus_tag LOCUS_06240 2130 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3312 2179 gene locus_tag LOCUS_06250 gene gumH 3312 2179 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 protein_id gnl|my_center|LOCUS_06250 3910 3314 gene locus_tag LOCUS_06260 gene wcaF 3910 3314 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 protein_id gnl|my_center|LOCUS_06260 5139 4009 gene locus_tag LOCUS_06270 5139 4009 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence079 1704 631 gene locus_tag LOCUS_06280 gene ascD 1704 631 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_06280 2146 1763 gene locus_tag LOCUS_06290 2146 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3517 2216 gene locus_tag LOCUS_06300 3517 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4316 3666 gene locus_tag LOCUS_06310 4316 3666 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_06310 <6609 4309 gene locus_tag LOCUS_06320 <6609 4309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918645.1:PAS domain-containing sensor histidine kinase >Feature sequence080 197 1051 gene locus_tag LOCUS_06330 197 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1422 4844 gene locus_tag LOCUS_06340 1422 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5183 5518 gene locus_tag LOCUS_06350 5183 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <6590 5579 gene locus_tag LOCUS_06360 <6590 5579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090081.1:membrane protein >Feature sequence081 431 1720 gene locus_tag LOCUS_06370 gene bioA 431 1720 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V66 protein_id gnl|my_center|LOCUS_06370 1730 2455 gene locus_tag LOCUS_06380 1730 2455 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK2 protein_id gnl|my_center|LOCUS_06380 2967 2452 gene locus_tag LOCUS_06390 2967 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3981 2968 gene locus_tag LOCUS_06400 gene chpB 3981 2968 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_06400 6416 4065 gene locus_tag LOCUS_06410 6416 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence082 1777 887 gene locus_tag LOCUS_06420 1777 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2301 1789 gene locus_tag LOCUS_06430 2301 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3321 2350 gene locus_tag LOCUS_06440 3321 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06440 3906 3337 gene locus_tag LOCUS_06450 3906 3337 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence083 409 987 gene locus_tag LOCUS_06460 409 987 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_06460 1027 1611 gene locus_tag LOCUS_06470 1027 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1598 2566 gene locus_tag LOCUS_06480 gene mucB 1598 2566 CDS product sigma factor regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065095.1 protein_id gnl|my_center|LOCUS_06480 2581 3069 gene locus_tag LOCUS_06490 2581 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3086 4498 gene locus_tag LOCUS_06500 gene mucD 3086 4498 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_06500 4495 4731 gene locus_tag LOCUS_06510 4495 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence084 521 147 gene locus_tag LOCUS_06520 521 147 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_06520 759 529 gene locus_tag LOCUS_06530 759 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1552 761 gene locus_tag LOCUS_06540 gene blaA 1552 761 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_06540 2032 1589 gene locus_tag LOCUS_06550 2032 1589 CDS product S-isoprenylcysteine methyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974564.1 protein_id gnl|my_center|LOCUS_06550 2672 2094 gene locus_tag LOCUS_06560 2672 2094 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_06560 3069 2674 gene locus_tag LOCUS_06570 3069 2674 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_06570 3442 3098 gene locus_tag LOCUS_06580 3442 3098 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947851.1 protein_id gnl|my_center|LOCUS_06580 3547 4314 gene locus_tag LOCUS_06590 3547 4314 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_06590 4832 4332 gene locus_tag LOCUS_06600 4832 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6118 4916 gene locus_tag LOCUS_06610 6118 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence085 2 526 gene locus_tag LOCUS_06620 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 634 1188 gene locus_tag LOCUS_06630 634 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1602 1192 gene locus_tag LOCUS_06640 1602 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2031 1624 gene locus_tag LOCUS_06650 2031 1624 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_06650 2614 2195 gene locus_tag LOCUS_06660 2614 2195 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_06660 3326 2637 gene locus_tag LOCUS_06670 3326 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4555 3353 gene locus_tag LOCUS_06680 gene nnrS 4555 3353 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_06680 5978 4794 gene locus_tag LOCUS_06690 gene nhaA 5978 4794 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 protein_id gnl|my_center|LOCUS_06690 >Feature sequence086 2144 831 gene locus_tag LOCUS_06700 gene hisD 2144 831 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_06700 2764 2147 gene locus_tag LOCUS_06710 gene hisG 2764 2147 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_06710 4055 2796 gene locus_tag LOCUS_06720 gene murA 4055 2796 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_06720 4350 4093 gene locus_tag LOCUS_06730 4350 4093 CDS product BolA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348457.1 protein_id gnl|my_center|LOCUS_06730 4750 4445 gene locus_tag LOCUS_06740 4750 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5330 4767 gene locus_tag LOCUS_06750 5330 4767 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_06750 6114 5332 gene locus_tag LOCUS_06760 6114 5332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence087 3341 90 gene locus_tag LOCUS_06770 3341 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5867 3579 gene locus_tag LOCUS_06780 5867 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence088 266 1165 gene locus_tag LOCUS_06790 266 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1377 1811 gene locus_tag LOCUS_06800 1377 1811 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_06800 1939 2490 gene locus_tag LOCUS_06810 1939 2490 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_06810 2730 3803 gene locus_tag LOCUS_06820 2730 3803 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707069.1 protein_id gnl|my_center|LOCUS_06820 3930 4466 gene locus_tag LOCUS_06830 3930 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946173.1 protein_id gnl|my_center|LOCUS_06830 4475 4702 gene locus_tag LOCUS_06840 4475 4702 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 protein_id gnl|my_center|LOCUS_06840 4721 5017 gene locus_tag LOCUS_06850 gene yqjZ 4721 5017 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157881.1 protein_id gnl|my_center|LOCUS_06850 5027 5335 gene locus_tag LOCUS_06860 5027 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5335 5727 gene locus_tag LOCUS_06870 5335 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5888 6325 gene locus_tag LOCUS_06880 5888 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence089 570 109 gene locus_tag LOCUS_06890 570 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1958 594 gene locus_tag LOCUS_06900 1958 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2917 2051 gene locus_tag LOCUS_06910 2917 2051 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_06910 3035 4456 gene locus_tag LOCUS_06920 gene leuC 3035 4456 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AI6 protein_id gnl|my_center|LOCUS_06920 4464 5105 gene locus_tag LOCUS_06930 gene leuD 4464 5105 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZI6 protein_id gnl|my_center|LOCUS_06930 5162 6235 gene locus_tag LOCUS_06940 gene leuB 5162 6235 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_06940 >Feature sequence090 616 1479 gene locus_tag LOCUS_06950 616 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2051 1476 gene locus_tag LOCUS_06960 2051 1476 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980860.1 protein_id gnl|my_center|LOCUS_06960 2791 3855 gene locus_tag LOCUS_06970 2791 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4692 4012 gene locus_tag LOCUS_06980 4692 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5081 6139 gene locus_tag LOCUS_06990 gene ctaA 5081 6139 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGG2 protein_id gnl|my_center|LOCUS_06990 >Feature sequence091 4016 2682 gene locus_tag LOCUS_07000 4016 2682 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266169.1 protein_id gnl|my_center|LOCUS_07000 4375 5022 gene locus_tag LOCUS_07010 4375 5022 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence092 1522 419 gene locus_tag LOCUS_07020 gene dnaN 1522 419 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_07020 3116 1773 gene locus_tag LOCUS_07030 gene dnaA 3116 1773 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD8 protein_id gnl|my_center|LOCUS_07030 3320 3496 gene locus_tag LOCUS_07040 3320 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3533 3883 gene locus_tag LOCUS_07050 gene rnpA 3533 3883 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z7 protein_id gnl|my_center|LOCUS_07050 4133 5863 gene locus_tag LOCUS_07060 gene yidC 4133 5863 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_07060 >Feature sequence093 125 1084 gene locus_tag LOCUS_07070 125 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_07070 1300 2043 gene locus_tag LOCUS_07080 1300 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2299 2985 gene locus_tag LOCUS_07090 gene fklB 2299 2985 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E837 protein_id gnl|my_center|LOCUS_07090 4463 3027 gene locus_tag LOCUS_07100 4463 3027 CDS product signal transduction protein with HDOD/GAF domains inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_07100 4756 5025 gene locus_tag LOCUS_07110 4756 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5197 5574 gene locus_tag LOCUS_07120 5197 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5727 6083 gene locus_tag LOCUS_07130 5727 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence094 444 106 gene locus_tag LOCUS_07140 gene glnB 444 106 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_07140 2204 567 gene locus_tag LOCUS_07150 gene nadE 2204 567 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_07150 3081 2197 gene locus_tag LOCUS_07160 3081 2197 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_07160 4245 3082 gene locus_tag LOCUS_07170 gene sucC 4245 3082 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53592 protein_id gnl|my_center|LOCUS_07170 4447 4695 gene locus_tag LOCUS_07180 4447 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence095 1593 400 gene locus_tag LOCUS_07190 1593 400 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932631.1 protein_id gnl|my_center|LOCUS_07190 1667 2245 gene locus_tag LOCUS_07200 1667 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_07200 2457 2924 gene locus_tag LOCUS_07210 gene pilH 2457 2924 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_07210 4021 2939 gene locus_tag LOCUS_07220 gene zapE 4021 2939 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_07220 4730 4140 gene locus_tag LOCUS_07230 4730 4140 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCJ9 protein_id gnl|my_center|LOCUS_07230 5259 4744 gene locus_tag LOCUS_07240 5259 4744 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_07240 5478 5269 gene locus_tag LOCUS_07250 5478 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence096 3455 2448 gene locus_tag LOCUS_07260 gene ldhA 3455 2448 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_07260 5891 3588 gene locus_tag LOCUS_07270 5891 3588 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971506.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence097 129 2291 gene locus_tag LOCUS_07280 gene katG 129 2291 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_07280 3313 2306 gene locus_tag LOCUS_07290 gene pdxA 3313 2306 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS1 protein_id gnl|my_center|LOCUS_07290 4630 3326 gene locus_tag LOCUS_07300 gene surA 4630 3326 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_07300 <6024 4647 gene locus_tag LOCUS_07310 <6024 4647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCE0:LPS-assembly protein LptD >Feature sequence098 1649 816 gene locus_tag LOCUS_07320 1649 816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_07320 2359 1964 gene locus_tag LOCUS_07330 2359 1964 CDS product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 protein_id gnl|my_center|LOCUS_07330 3085 2369 gene locus_tag LOCUS_07340 3085 2369 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_07340 3504 3136 gene locus_tag LOCUS_07350 3504 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07350 3928 3497 gene locus_tag LOCUS_07360 3928 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07360 4115 5158 gene locus_tag LOCUS_07370 gene cynR 4115 5158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114874.1 protein_id gnl|my_center|LOCUS_07370 <6018 5144 gene locus_tag LOCUS_07380 <6018 5144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3KLW8:glycolate oxidase iron-sulfur subunit >Feature sequence099 >Feature sequence100 1654 1007 gene locus_tag LOCUS_07390 1654 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2803 1673 gene locus_tag LOCUS_07400 gene czcO 2803 1673 CDS product putative oxidoreductase CzcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07085 protein_id gnl|my_center|LOCUS_07400 3858 2842 gene locus_tag LOCUS_07410 3858 2842 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_07410 <6005 3872 gene locus_tag LOCUS_07420 <6005 3872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267241.1:non-ribosomal peptide synthetase >Feature sequence101 995 384 gene locus_tag LOCUS_07430 995 384 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_07430 2240 1068 gene locus_tag LOCUS_07440 2240 1068 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_07440 2864 2436 gene locus_tag LOCUS_07450 2864 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3748 3014 gene locus_tag LOCUS_07460 gene aat 3748 3014 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_07460 4926 3751 gene locus_tag LOCUS_07470 4926 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_07470 5933 4974 gene locus_tag LOCUS_07480 gene trxB1 5933 4974 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_07480 >Feature sequence102 1579 506 gene locus_tag LOCUS_07490 1579 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2253 1576 gene locus_tag LOCUS_07500 gene modB 2253 1576 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_07500 2845 2285 gene locus_tag LOCUS_07510 2845 2285 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC6 protein_id gnl|my_center|LOCUS_07510 3688 3104 gene locus_tag LOCUS_07520 3688 3104 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 protein_id gnl|my_center|LOCUS_07520 5422 3854 gene locus_tag LOCUS_07530 gene aer 5422 3854 CDS product aerotaxis receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence103 1191 151 gene locus_tag LOCUS_07540 1191 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_07540 1715 1230 gene locus_tag LOCUS_07550 1715 1230 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_07550 2215 1751 gene locus_tag LOCUS_07560 gene cheX 2215 1751 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_07560 3022 2327 gene locus_tag LOCUS_07570 3022 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3540 3019 gene locus_tag LOCUS_07580 3540 3019 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK70 protein_id gnl|my_center|LOCUS_07580 3755 4594 gene locus_tag LOCUS_07590 3755 4594 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_07590 4578 5333 gene locus_tag LOCUS_07600 4578 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5704 5420 gene locus_tag LOCUS_07610 5704 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence104 <1 750 gene locus_tag LOCUS_07620 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZRT2:ATP-dependent zinc metalloprotease FtsH 912 1739 gene locus_tag LOCUS_07630 gene folP 912 1739 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_07630 1746 3092 gene locus_tag LOCUS_07640 gene glmM 1746 3092 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_07640 3263 4012 gene locus_tag LOCUS_07650 gene tpiA 3263 4012 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHZ7 protein_id gnl|my_center|LOCUS_07650 4034 4426 gene locus_tag LOCUS_07660 4034 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4445 4531 gene locus_tag LOCUS_t00070 4445 4531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4725 4940 gene locus_tag LOCUS_07670 4725 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5337 4873 gene locus_tag LOCUS_07680 5337 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence105 2035 167 gene locus_tag LOCUS_07690 2035 167 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 protein_id gnl|my_center|LOCUS_07690 3966 2203 gene locus_tag LOCUS_07700 3966 2203 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_07700 4230 3976 gene locus_tag LOCUS_07710 4230 3976 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_07710 4945 4586 gene locus_tag LOCUS_07720 4945 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 <5912 5015 gene locus_tag LOCUS_07730 <5912 5015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence106 1127 555 gene locus_tag LOCUS_07740 1127 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948505.1 protein_id gnl|my_center|LOCUS_07740 1361 2203 gene locus_tag LOCUS_07750 gene glyQ 1361 2203 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_07750 2200 4284 gene locus_tag LOCUS_07760 gene glyS 2200 4284 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43822 protein_id gnl|my_center|LOCUS_07760 4281 4625 gene locus_tag LOCUS_07770 4281 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4626 5162 gene locus_tag LOCUS_07780 4626 5162 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9H1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence107 267 2054 gene locus_tag LOCUS_07790 gene cysJ 267 2054 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ9 protein_id gnl|my_center|LOCUS_07790 2054 3733 gene locus_tag LOCUS_07800 gene cysI 2054 3733 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB00 protein_id gnl|my_center|LOCUS_07800 3726 4448 gene locus_tag LOCUS_07810 gene cysH 3726 4448 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX2 protein_id gnl|my_center|LOCUS_07810 4497 5123 gene locus_tag LOCUS_07820 gene cysC 4497 5123 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP33 protein_id gnl|my_center|LOCUS_07820 5137 5379 gene locus_tag LOCUS_07830 5137 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence108 84 1829 gene locus_tag LOCUS_07840 84 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1911 2786 gene locus_tag LOCUS_07850 gene prmA 1911 2786 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_07850 2910 4397 gene locus_tag LOCUS_07860 2910 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105208.1 protein_id gnl|my_center|LOCUS_07860 4644 5525 gene locus_tag LOCUS_07870 gene dusB 4644 5525 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL87 protein_id gnl|my_center|LOCUS_07870 5522 5812 gene locus_tag LOCUS_07880 gene fis 5522 5812 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64128 protein_id gnl|my_center|LOCUS_07880 >Feature sequence109 89 760 gene locus_tag LOCUS_07890 89 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1086 1292 gene locus_tag LOCUS_07900 gene cspD 1086 1292 CDS product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_07900 1523 1888 gene locus_tag LOCUS_07910 1523 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1943 2503 gene locus_tag LOCUS_07920 gene rpoE 1943 2503 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_07920 2503 2850 gene locus_tag LOCUS_07930 2503 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2870 3055 gene locus_tag LOCUS_07940 2870 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3048 3635 gene locus_tag LOCUS_07950 3048 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4609 3632 gene locus_tag LOCUS_07960 4609 3632 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_07960 4697 5116 gene locus_tag LOCUS_07970 4697 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5191 5493 gene locus_tag LOCUS_07980 5191 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence110 <1 1323 gene locus_tag LOCUS_07990 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548886.1:ferredoxin 1338 1922 gene locus_tag LOCUS_08000 1338 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_08000 2165 3472 gene locus_tag LOCUS_08010 gene pcnB 2165 3472 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_08010 3472 3960 gene locus_tag LOCUS_08020 3472 3960 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_08020 3957 4625 gene locus_tag LOCUS_08030 3957 4625 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_08030 4606 5439 gene locus_tag LOCUS_08040 gene panB 4606 5439 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_08040 >Feature sequence111 2966 978 gene locus_tag LOCUS_08050 2966 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3436 3101 gene locus_tag LOCUS_08060 3436 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 protein_id gnl|my_center|LOCUS_08060 3551 4183 gene locus_tag LOCUS_08070 3551 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5632 4163 gene locus_tag LOCUS_08080 gene nuoN 5632 4163 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR8 protein_id gnl|my_center|LOCUS_08080 >Feature sequence112 431 3658 gene locus_tag LOCUS_08090 431 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3774 4352 gene locus_tag LOCUS_08100 3774 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4357 5136 gene locus_tag LOCUS_08110 gene truA 4357 5136 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX9 protein_id gnl|my_center|LOCUS_08110 5165 5788 gene locus_tag LOCUS_08120 gene trpF 5165 5788 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence113 <1 546 gene locus_tag LOCUS_08130 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WJP8:tyrosine recombinase XerD 636 1373 gene locus_tag LOCUS_08140 636 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2236 1388 gene locus_tag LOCUS_08150 gene trx 2236 1388 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_08150 5612 2292 gene locus_tag LOCUS_08160 5612 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence114 72 1601 gene locus_tag LOCUS_08170 72 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640195.1 protein_id gnl|my_center|LOCUS_08170 1818 2303 gene locus_tag LOCUS_08180 1818 2303 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997068.1 protein_id gnl|my_center|LOCUS_08180 2364 2786 gene locus_tag LOCUS_08190 2364 2786 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096444.1 protein_id gnl|my_center|LOCUS_08190 2789 4555 gene locus_tag LOCUS_08200 2789 4555 CDS product type VI secretion protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 protein_id gnl|my_center|LOCUS_08200 4519 5562 gene locus_tag LOCUS_08210 4519 5562 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence115 1059 514 gene locus_tag LOCUS_08220 1059 514 CDS product pilus biosynthesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 protein_id gnl|my_center|LOCUS_08220 1695 1072 gene locus_tag LOCUS_08230 gene pilO 1695 1072 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_08230 2264 1698 gene locus_tag LOCUS_08240 2264 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3334 2264 gene locus_tag LOCUS_08250 gene pilM 3334 2264 CDS product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence116 1453 464 gene locus_tag LOCUS_08260 1453 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2068 1496 gene locus_tag LOCUS_08270 2068 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4789 2093 gene locus_tag LOCUS_08280 4789 2093 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_08280 5485 4802 gene locus_tag LOCUS_08290 5485 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence117 45 674 gene locus_tag LOCUS_08300 45 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 988 671 gene locus_tag LOCUS_08310 988 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1092 1757 gene locus_tag LOCUS_08320 1092 1757 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_08320 1750 2634 gene locus_tag LOCUS_08330 gene gluQ 1750 2634 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_08330 2694 3437 gene locus_tag LOCUS_08340 gene ycgR 2694 3437 CDS product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8K8 protein_id gnl|my_center|LOCUS_08340 3754 3434 gene locus_tag LOCUS_08350 3754 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence118 1648 3882 gene locus_tag LOCUS_08360 1648 3882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267526.1 protein_id gnl|my_center|LOCUS_08360 5368 3938 gene locus_tag LOCUS_08370 gene pvdH 5368 3938 CDS product diaminobutyrate--2-oxoglutarate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089638.1 protein_id gnl|my_center|LOCUS_08370 5631 5419 gene locus_tag LOCUS_08380 5631 5419 CDS product antibiotic synthesis protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence119 >Feature sequence120 248 323 gene locus_tag LOCUS_t00080 248 323 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 343 681 gene locus_tag LOCUS_08390 gene secE 343 681 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y4 protein_id gnl|my_center|LOCUS_08390 696 1229 gene locus_tag LOCUS_08400 gene nusG 696 1229 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_08400 1437 1868 gene locus_tag LOCUS_08410 gene rplK 1437 1868 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_08410 1870 2562 gene locus_tag LOCUS_08420 gene rplA 1870 2562 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK77 protein_id gnl|my_center|LOCUS_08420 2776 3303 gene locus_tag LOCUS_08430 gene rplJ 2776 3303 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET2 protein_id gnl|my_center|LOCUS_08430 3381 3761 gene locus_tag LOCUS_08440 gene rplL 3381 3761 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence121 <1 975 gene locus_tag LOCUS_08450 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P993:DNA translocase FtsK 999 1601 gene locus_tag LOCUS_08460 gene lolA 999 1601 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P991 protein_id gnl|my_center|LOCUS_08460 1607 2950 gene locus_tag LOCUS_08470 1607 2950 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_08470 2974 3348 gene locus_tag LOCUS_08480 gene crcB 2974 3348 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_08480 3415 4692 gene locus_tag LOCUS_08490 gene serS 3415 4692 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_08490 4858 4676 gene locus_tag LOCUS_08500 4858 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 <5600 4947 gene locus_tag LOCUS_08510 <5600 4947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946684.1:BAX inhibitor protein >Feature sequence122 <1 628 gene locus_tag LOCUS_08520 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNS7:glutamyl-tRNA(Gln) amidotransferase subunit A 829 2259 gene locus_tag LOCUS_08530 gene gatB 829 2259 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_08530 2294 3172 gene locus_tag LOCUS_08540 gene hslO 2294 3172 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_08540 3829 3173 gene locus_tag LOCUS_08550 3829 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4394 3957 gene locus_tag LOCUS_08560 4394 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5537 4407 gene locus_tag LOCUS_08570 5537 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence123 852 331 gene locus_tag LOCUS_08580 852 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1365 1682 gene locus_tag LOCUS_08590 gene fccA 1365 1682 CDS product cytochrome subunit of sulfide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAS5 protein_id gnl|my_center|LOCUS_08590 1710 3008 gene locus_tag LOCUS_08600 gene fccB-2 1710 3008 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_08600 4341 3073 gene locus_tag LOCUS_08610 4341 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5458 4490 gene locus_tag LOCUS_08620 5458 4490 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF24 protein_id gnl|my_center|LOCUS_08620 >Feature sequence124 203 859 gene locus_tag LOCUS_08630 203 859 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_08630 933 2810 gene locus_tag LOCUS_08640 933 2810 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_08640 4546 2807 gene locus_tag LOCUS_08650 4546 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207304.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence125 1059 1286 gene locus_tag LOCUS_08660 1059 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2514 1279 gene locus_tag LOCUS_08670 2514 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3320 2562 gene locus_tag LOCUS_08680 3320 2562 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230655.1 protein_id gnl|my_center|LOCUS_08680 4121 3393 gene locus_tag LOCUS_08690 4121 3393 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957418.1 protein_id gnl|my_center|LOCUS_08690 4715 4200 gene locus_tag LOCUS_08700 4715 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence126 323 694 gene locus_tag LOCUS_08710 323 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2187 718 gene locus_tag LOCUS_08720 2187 718 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPK5 protein_id gnl|my_center|LOCUS_08720 2266 3045 gene locus_tag LOCUS_08730 gene lpxA 2266 3045 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ0 protein_id gnl|my_center|LOCUS_08730 3141 3716 gene locus_tag LOCUS_08740 gene fabA 3141 3716 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_08740 3737 4954 gene locus_tag LOCUS_08750 gene fabB 3737 4954 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence127 84 809 gene locus_tag LOCUS_08760 gene anr 84 809 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_08760 1070 792 gene locus_tag LOCUS_08770 1070 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1593 1081 gene locus_tag LOCUS_08780 gene ccoH 1593 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_08780 2987 1596 gene locus_tag LOCUS_08790 2987 1596 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_08790 3902 3015 gene locus_tag LOCUS_08800 gene ccoP 3902 3015 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_08800 4078 3899 gene locus_tag LOCUS_08810 gene ccoQ 4078 3899 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300779.1 protein_id gnl|my_center|LOCUS_08810 4689 4081 gene locus_tag LOCUS_08820 gene ccoO2 4689 4081 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_08820 <5515 4703 gene locus_tag LOCUS_08830 <5515 4703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212595.1:cytochrome c oxidase, cbb3-type subunit I >Feature sequence128 468 1475 gene locus_tag LOCUS_08840 gene gpsA 468 1475 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43798 protein_id gnl|my_center|LOCUS_08840 1952 1485 gene locus_tag LOCUS_08850 gene trmL 1952 1485 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR4 protein_id gnl|my_center|LOCUS_08850 2016 2984 gene locus_tag LOCUS_08860 gene pyrD 2016 2984 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C3 protein_id gnl|my_center|LOCUS_08860 3093 4844 gene locus_tag LOCUS_08870 3093 4844 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence129 627 94 gene locus_tag LOCUS_08880 627 94 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_08880 1618 635 gene locus_tag LOCUS_08890 1618 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence130 >Feature sequence131 534 458 gene locus_tag LOCUS_t00090 534 458 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1405 569 gene locus_tag LOCUS_08900 1405 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1857 1414 gene locus_tag LOCUS_08910 1857 1414 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_08910 2187 1873 gene locus_tag LOCUS_08920 2187 1873 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_08920 3238 2270 gene locus_tag LOCUS_08930 3238 2270 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230088.2 protein_id gnl|my_center|LOCUS_08930 3413 3724 gene locus_tag LOCUS_08940 gene rplU 3413 3724 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUT0 protein_id gnl|my_center|LOCUS_08940 3738 3998 gene locus_tag LOCUS_08950 gene rpmA 3738 3998 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKQ2 protein_id gnl|my_center|LOCUS_08950 4096 5166 gene locus_tag LOCUS_08960 gene obg 4096 5166 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_08960 >Feature sequence132 <1 610 gene locus_tag LOCUS_08970 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGD0:uroporphyrinogen decarboxylase 646 1032 gene locus_tag LOCUS_08980 gene gloA 646 1032 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_08980 1938 1036 gene locus_tag LOCUS_08990 1938 1036 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_08990 2128 2670 gene locus_tag LOCUS_09000 2128 2670 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_09000 2667 3377 gene locus_tag LOCUS_09010 2667 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 protein_id gnl|my_center|LOCUS_09010 3839 5293 gene locus_tag LOCUS_09020 3839 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence133 1967 252 gene locus_tag LOCUS_09030 1967 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2304 3374 gene locus_tag LOCUS_09040 2304 3374 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194585.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence134 <1 1288 gene locus_tag LOCUS_09050 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62MP0:aspartate--tRNA(Asp/Asn) ligase 1473 4004 gene locus_tag LOCUS_09060 1473 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4030 4851 gene locus_tag LOCUS_09070 gene stp 4030 4851 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence135 790 212 gene locus_tag LOCUS_09080 790 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1729 830 gene locus_tag LOCUS_09090 gene argF 1729 830 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_09090 2916 1726 gene locus_tag LOCUS_09100 gene argD 2916 1726 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_09100 3645 3064 gene locus_tag LOCUS_09110 3645 3064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_09110 3808 5394 gene locus_tag LOCUS_09120 gene hyuB 3808 5394 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence136 1000 539 gene locus_tag LOCUS_09130 1000 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence137 2160 313 gene locus_tag LOCUS_09140 2160 313 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_09140 3469 2363 gene locus_tag LOCUS_09150 3469 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4584 3508 gene locus_tag LOCUS_09160 4584 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence138 700 1872 gene locus_tag LOCUS_09170 gene metK 700 1872 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66765 protein_id gnl|my_center|LOCUS_09170 2112 3530 gene locus_tag LOCUS_09180 gene acyH 2112 3530 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7Y2 protein_id gnl|my_center|LOCUS_09180 3629 4480 gene locus_tag LOCUS_09190 gene metF 3629 4480 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGJ7 protein_id gnl|my_center|LOCUS_09190 <5351 4488 gene locus_tag LOCUS_09200 <5351 4488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869971.1:phosphohydrolase >Feature sequence139 2959 1112 gene locus_tag LOCUS_09210 2959 1112 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_09210 3983 3012 gene locus_tag LOCUS_09220 3983 3012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_09220 4926 3973 gene locus_tag LOCUS_09230 gene oppD 4926 3973 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419857.1 protein_id gnl|my_center|LOCUS_09230 5345 4923 gene locus_tag LOCUS_09240 5345 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence140 1119 1574 gene locus_tag LOCUS_09250 gene rsd 1119 1574 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_09250 2030 3463 gene locus_tag LOCUS_09260 2030 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3787 4524 gene locus_tag LOCUS_09270 3787 4524 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391142.1 protein_id gnl|my_center|LOCUS_09270 <5333 4530 gene locus_tag LOCUS_09280 <5333 4530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070889.1:response regulator >Feature sequence141 669 397 gene locus_tag LOCUS_09290 gene mphM 669 397 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_09290 1683 682 gene locus_tag LOCUS_09300 gene mphL 1683 682 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_09300 1965 1702 gene locus_tag LOCUS_09310 1965 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4635 2284 gene locus_tag LOCUS_09320 gene ppsA 4635 2284 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_09320 >Feature sequence142 1778 186 gene locus_tag LOCUS_09330 1778 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2242 2697 gene locus_tag LOCUS_09340 2242 2697 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_09340 2776 3453 gene locus_tag LOCUS_09350 2776 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3908 5017 gene locus_tag LOCUS_09360 3908 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence143 3 596 gene locus_tag LOCUS_09370 3 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 657 1388 gene locus_tag LOCUS_09380 657 1388 CDS product iron-sulfur cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556370.1 protein_id gnl|my_center|LOCUS_09380 1467 2444 gene locus_tag LOCUS_09390 1467 2444 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_09390 2666 3001 gene locus_tag LOCUS_09400 2666 3001 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_09400 4073 3063 gene locus_tag LOCUS_09410 4073 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4581 5057 gene locus_tag LOCUS_09420 4581 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence144 405 2705 gene locus_tag LOCUS_09430 405 2705 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 protein_id gnl|my_center|LOCUS_09430 3021 4586 gene locus_tag LOCUS_09440 3021 4586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence145 55 2745 gene locus_tag LOCUS_09450 55 2745 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 protein_id gnl|my_center|LOCUS_09450 3865 3257 gene locus_tag LOCUS_09460 gene engB 3865 3257 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT81 protein_id gnl|my_center|LOCUS_09460 4005 4316 gene locus_tag LOCUS_09470 4005 4316 CDS product cytochrome c-555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG93 protein_id gnl|my_center|LOCUS_09470 4358 4939 gene locus_tag LOCUS_09480 gene cc4 4358 4939 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_09480 >Feature sequence146 1204 746 gene locus_tag LOCUS_09490 1204 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1710 1372 gene locus_tag LOCUS_09500 1710 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2073 2456 gene locus_tag LOCUS_09510 2073 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2519 3094 gene locus_tag LOCUS_09520 2519 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_09520 3106 4053 gene locus_tag LOCUS_09530 3106 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence147 112 187 gene locus_tag LOCUS_t00100 112 187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 257 333 gene locus_tag LOCUS_t00110 257 333 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 405 2348 gene locus_tag LOCUS_09540 405 2348 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_09540 2405 3736 gene locus_tag LOCUS_09550 gene gltP 2405 3736 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_09550 4521 3733 gene locus_tag LOCUS_09560 4521 3733 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_09560 >Feature sequence148 >Feature sequence149 >Feature sequence150 459 103 gene locus_tag LOCUS_09570 459 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1409 771 gene locus_tag LOCUS_09580 1409 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2568 1549 gene locus_tag LOCUS_09590 2568 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3029 2571 gene locus_tag LOCUS_09600 3029 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3523 5067 gene locus_tag LOCUS_09610 3523 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence151 689 264 gene locus_tag LOCUS_09620 689 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1841 708 gene locus_tag LOCUS_09630 1841 708 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_09630 2110 1880 gene locus_tag LOCUS_09640 2110 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_09640 2541 2152 gene locus_tag LOCUS_09650 2541 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2763 2572 gene locus_tag LOCUS_09660 2763 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3655 2798 gene locus_tag LOCUS_09670 3655 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971224.1 protein_id gnl|my_center|LOCUS_09670 4642 3788 gene locus_tag LOCUS_09680 4642 3788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_09680 5127 4639 gene locus_tag LOCUS_09690 5127 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence152 67 1080 gene locus_tag LOCUS_09700 gene hupU 67 1080 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_09700 1077 2534 gene locus_tag LOCUS_09710 gene hupV 1077 2534 CDS product HupV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_09710 2551 4959 gene locus_tag LOCUS_09720 gene hypF 2551 4959 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0L9 protein_id gnl|my_center|LOCUS_09720 4950 5069 gene locus_tag LOCUS_09730 4950 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence153 649 1788 gene locus_tag LOCUS_09740 649 1788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_09740 2150 1809 gene locus_tag LOCUS_09750 2150 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3350 2274 gene locus_tag LOCUS_09760 3350 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3797 3381 gene locus_tag LOCUS_09770 3797 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4545 3841 gene locus_tag LOCUS_09780 4545 3841 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970400.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence154 413 928 gene locus_tag LOCUS_09790 413 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 931 3090 gene locus_tag LOCUS_09800 931 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3746 3114 gene locus_tag LOCUS_09810 3746 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4002 3739 gene locus_tag LOCUS_09820 4002 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09820 4302 4069 gene locus_tag LOCUS_09830 4302 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09830 4527 4928 gene locus_tag LOCUS_09840 4527 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence155 468 950 gene locus_tag LOCUS_09850 gene greA 468 950 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKE2 protein_id gnl|my_center|LOCUS_09850 968 1492 gene locus_tag LOCUS_09860 968 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125919.1 protein_id gnl|my_center|LOCUS_09860 1571 2344 gene locus_tag LOCUS_09870 1571 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_09870 2453 2908 gene locus_tag LOCUS_09880 2453 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3188 2901 gene locus_tag LOCUS_09890 3188 2901 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_09890 3297 3917 gene locus_tag LOCUS_09900 gene rlmE 3297 3917 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_09900 >Feature sequence156 1417 500 gene locus_tag LOCUS_09910 1417 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2484 1750 gene locus_tag LOCUS_09920 2484 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3158 2715 gene locus_tag LOCUS_09930 gene ytoQ 3158 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_09930 3562 3242 gene locus_tag LOCUS_09940 3562 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4145 3645 gene locus_tag LOCUS_09950 4145 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4347 4138 gene locus_tag LOCUS_09960 4347 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4642 4878 gene locus_tag LOCUS_09970 4642 4878 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence157 1151 108 gene locus_tag LOCUS_09980 gene mopB 1151 108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_09980 2024 1293 gene locus_tag LOCUS_09990 2024 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_09990 2880 2056 gene locus_tag LOCUS_10000 2880 2056 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_10000 3889 3434 gene locus_tag LOCUS_10010 3889 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_10010 4508 4095 gene locus_tag LOCUS_10020 gene atpC 4508 4095 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_10020 >Feature sequence158 320 192 gene locus_tag LOCUS_10030 320 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 933 340 gene locus_tag LOCUS_10040 933 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 protein_id gnl|my_center|LOCUS_10040 1660 962 gene locus_tag LOCUS_10050 1660 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2281 1811 gene locus_tag LOCUS_10060 2281 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_10060 2638 2294 gene locus_tag LOCUS_10070 2638 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 protein_id gnl|my_center|LOCUS_10070 3258 2761 gene locus_tag LOCUS_10080 3258 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3651 3298 gene locus_tag LOCUS_10090 3651 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4155 3667 gene locus_tag LOCUS_10100 4155 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4429 4160 gene locus_tag LOCUS_10110 4429 4160 CDS product TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777585.1 protein_id gnl|my_center|LOCUS_10110 4782 4492 gene locus_tag LOCUS_10120 4782 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence159 141 428 gene locus_tag LOCUS_10130 141 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 421 1599 gene locus_tag LOCUS_10140 421 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1599 3290 gene locus_tag LOCUS_10150 1599 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_10150 4924 3287 gene locus_tag LOCUS_10160 4924 3287 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence160 106 3162 gene locus_tag LOCUS_10170 106 3162 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_10170 3306 4109 gene locus_tag LOCUS_10180 3306 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence161 <1 1177 gene locus_tag LOCUS_10190 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391199.1:TonB-dependent receptor 2257 1226 gene locus_tag LOCUS_10200 2257 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142817.1 protein_id gnl|my_center|LOCUS_10200 2933 2355 gene locus_tag LOCUS_10210 2933 2355 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 protein_id gnl|my_center|LOCUS_10210 3075 3506 gene locus_tag LOCUS_10220 3075 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3599 4006 gene locus_tag LOCUS_10230 3599 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4020 4685 gene locus_tag LOCUS_10240 gene fabG 4020 4685 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence162 1344 2549 gene locus_tag LOCUS_10250 1344 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_10250 4715 2550 gene locus_tag LOCUS_10260 4715 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence163 77 592 gene locus_tag LOCUS_10270 77 592 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_10270 690 1709 gene locus_tag LOCUS_10280 690 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1902 4478 gene locus_tag LOCUS_10290 1902 4478 CDS product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140365.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence164 454 1377 gene locus_tag LOCUS_10300 454 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1379 2053 gene locus_tag LOCUS_10310 1379 2053 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_10310 2064 3488 gene locus_tag LOCUS_10320 2064 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3543 3797 gene locus_tag LOCUS_10330 gene grx 3543 3797 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_10330 4662 3799 gene locus_tag LOCUS_10340 4662 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4844 4671 gene locus_tag LOCUS_10350 4844 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence165 834 2765 gene locus_tag LOCUS_10360 834 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2874 4853 gene locus_tag LOCUS_10370 2874 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence166 437 75 gene locus_tag LOCUS_10380 437 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 508 807 gene locus_tag LOCUS_10390 508 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1066 794 gene locus_tag LOCUS_10400 1066 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2217 1177 gene locus_tag LOCUS_10410 2217 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2719 3144 gene locus_tag LOCUS_10420 gene iscR 2719 3144 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 protein_id gnl|my_center|LOCUS_10420 3699 3220 gene locus_tag LOCUS_10430 3699 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4005 3706 gene locus_tag LOCUS_10440 4005 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence167 <1 2324 gene locus_tag LOCUS_10450 <1 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPW5:protein translocase subunit SecA 2331 3509 gene locus_tag LOCUS_10460 gene argJ 2331 3509 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ4 protein_id gnl|my_center|LOCUS_10460 3513 4463 gene locus_tag LOCUS_10470 3513 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 protein_id gnl|my_center|LOCUS_10470 4658 4473 gene locus_tag LOCUS_10480 4658 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence168 460 152 gene locus_tag LOCUS_10490 460 152 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338269.1 protein_id gnl|my_center|LOCUS_10490 1155 460 gene locus_tag LOCUS_10500 gene hupD 1155 460 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_10500 1720 2790 gene locus_tag LOCUS_10510 gene hupS 1720 2790 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_10510 2787 4601 gene locus_tag LOCUS_10520 gene hupL 2787 4601 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence169 1473 718 gene locus_tag LOCUS_10530 gene ftsQ 1473 718 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F15 protein_id gnl|my_center|LOCUS_10530 2455 1457 gene locus_tag LOCUS_10540 gene ddl 2455 1457 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_10540 3353 2460 gene locus_tag LOCUS_10550 gene murB 3353 2460 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_10550 4855 3461 gene locus_tag LOCUS_10560 gene murC 4855 3461 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_10560 >Feature sequence170 135 458 gene locus_tag LOCUS_10570 135 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10570 486 617 gene locus_tag LOCUS_10580 486 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10580 608 1006 gene locus_tag LOCUS_10590 gene yraH 608 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07918 protein_id gnl|my_center|LOCUS_10590 1967 1032 gene locus_tag LOCUS_10600 1967 1032 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_10600 2353 1979 gene locus_tag LOCUS_10610 gene dgkA 2353 1979 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT9 protein_id gnl|my_center|LOCUS_10610 3818 2370 gene locus_tag LOCUS_10620 gene gcvPB 3818 2370 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B09 protein_id gnl|my_center|LOCUS_10620 4355 3858 gene locus_tag LOCUS_10630 gene tpx 4355 3858 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KED5 protein_id gnl|my_center|LOCUS_10630 >Feature sequence171 293 24 gene locus_tag LOCUS_10640 gene acyP 293 24 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB0 protein_id gnl|my_center|LOCUS_10640 1063 290 gene locus_tag LOCUS_10650 1063 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2391 1060 gene locus_tag LOCUS_10660 2391 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2963 2424 gene locus_tag LOCUS_10670 2963 2424 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_10670 3445 2987 gene locus_tag LOCUS_10680 3445 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3932 3609 gene locus_tag LOCUS_10690 3932 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4050 4400 gene locus_tag LOCUS_10700 gene yfgD 4050 4400 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 protein_id gnl|my_center|LOCUS_10700 >Feature sequence172 865 83 gene locus_tag LOCUS_10710 gene flgG 865 83 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW66 protein_id gnl|my_center|LOCUS_10710 1649 909 gene locus_tag LOCUS_10720 gene flgF 1649 909 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_10720 2923 1667 gene locus_tag LOCUS_10730 gene flgE 2923 1667 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 protein_id gnl|my_center|LOCUS_10730 3650 2949 gene locus_tag LOCUS_10740 gene flgD 3650 2949 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_10740 4080 3667 gene locus_tag LOCUS_10750 4080 3667 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YZ0 protein_id gnl|my_center|LOCUS_10750 4484 4083 gene locus_tag LOCUS_10760 gene flgB 4484 4083 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_10760 >Feature sequence173 2116 26 gene locus_tag LOCUS_10770 gene recG 2116 26 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ6 protein_id gnl|my_center|LOCUS_10770 2528 2145 gene locus_tag LOCUS_10780 2528 2145 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_10780 <4807 2732 gene locus_tag LOCUS_10790 <4807 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706418.1:methyl-accepting chemotaxis protein >Feature sequence174 264 1091 gene locus_tag LOCUS_10800 gene pabC 264 1091 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_10800 1088 2131 gene locus_tag LOCUS_10810 1088 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_10810 2128 2760 gene locus_tag LOCUS_10820 gene tmk 2128 2760 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_10820 2762 3748 gene locus_tag LOCUS_10830 gene holB 2762 3748 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_10830 3766 4131 gene locus_tag LOCUS_10840 gene pilZ 3766 4131 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence175 423 905 gene locus_tag LOCUS_10850 423 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2212 1091 gene locus_tag LOCUS_10860 2212 1091 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_10860 3130 2219 gene locus_tag LOCUS_10870 gene aguB 3130 2219 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_10870 3228 3641 gene locus_tag LOCUS_10880 3228 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4698 3616 gene locus_tag LOCUS_10890 gene aguA 4698 3616 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence176 <1 1483 gene locus_tag LOCUS_10900 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957975.1:glycosyl transferase 2199 1480 gene locus_tag LOCUS_10910 gene fabG 2199 1480 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_10910 2651 2196 gene locus_tag LOCUS_10920 2651 2196 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_10920 3439 2651 gene locus_tag LOCUS_10930 3439 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_10930 4623 3439 gene locus_tag LOCUS_10940 gene fabF 4623 3439 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence177 823 272 gene locus_tag LOCUS_10950 823 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 977 2020 gene locus_tag LOCUS_10960 977 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2036 2635 gene locus_tag LOCUS_10970 2036 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2721 3092 gene locus_tag LOCUS_10980 2721 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3417 3100 gene locus_tag LOCUS_10990 3417 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3480 4154 gene locus_tag LOCUS_11000 3480 4154 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 protein_id gnl|my_center|LOCUS_11000 >Feature sequence178 4000 2870 gene locus_tag LOCUS_11010 gene carA 4000 2870 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SF4 protein_id gnl|my_center|LOCUS_11010 <4759 4144 gene locus_tag LOCUS_11020 <4759 4144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P38103:4-hydroxy-tetrahydrodipicolinate reductase >Feature sequence179 189 1343 gene locus_tag LOCUS_11030 189 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1409 1963 gene locus_tag LOCUS_11040 gene tsaC 1409 1963 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE2 protein_id gnl|my_center|LOCUS_11040 1963 2868 gene locus_tag LOCUS_11050 gene hemF 1963 2868 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FI90 protein_id gnl|my_center|LOCUS_11050 3838 2852 gene locus_tag LOCUS_11060 3838 2852 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_11060 4565 3876 gene locus_tag LOCUS_11070 gene ompA 4565 3876 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310900.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence180 240 156 gene locus_tag LOCUS_t00120 240 156 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 448 373 gene locus_tag LOCUS_t00130 448 373 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1179 538 gene locus_tag LOCUS_11080 1179 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1933 1190 gene locus_tag LOCUS_11090 gene coaX 1933 1190 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 protein_id gnl|my_center|LOCUS_11090 2915 1938 gene locus_tag LOCUS_11100 gene birA 2915 1938 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP6 protein_id gnl|my_center|LOCUS_11100 3898 2933 gene locus_tag LOCUS_11110 3898 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 <4739 4027 gene locus_tag LOCUS_11120 <4739 4027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268797.1:membrane protein >Feature sequence181 2073 628 gene locus_tag LOCUS_11130 2073 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 <4717 2075 gene locus_tag LOCUS_11140 <4717 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838383.1:acriflavin resistance protein >Feature sequence182 2047 1079 gene locus_tag LOCUS_11150 gene bioB 2047 1079 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_11150 2424 2044 gene locus_tag LOCUS_11160 2424 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2509 3231 gene locus_tag LOCUS_11170 gene comF 2509 3231 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035643.1 protein_id gnl|my_center|LOCUS_11170 3859 3239 gene locus_tag LOCUS_11180 3859 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4702 3989 gene locus_tag LOCUS_11190 gene ubiA 4702 3989 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEP9 protein_id gnl|my_center|LOCUS_11190 >Feature sequence183 2794 3660 gene locus_tag LOCUS_11200 gene purU-3 2794 3660 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X74 protein_id gnl|my_center|LOCUS_11200 4165 3653 gene locus_tag LOCUS_11210 4165 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence184 268 1650 gene locus_tag LOCUS_11220 gene mpl 268 1650 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV8 protein_id gnl|my_center|LOCUS_11220 1647 2264 gene locus_tag LOCUS_11230 gene ubiX 1647 2264 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV7 protein_id gnl|my_center|LOCUS_11230 2381 2965 gene locus_tag LOCUS_11240 2381 2965 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_11240 4269 2989 gene locus_tag LOCUS_11250 gene hemL 4269 2989 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY9 protein_id gnl|my_center|LOCUS_11250 >Feature sequence185 177 1085 gene locus_tag LOCUS_11260 177 1085 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976181.1 protein_id gnl|my_center|LOCUS_11260 1862 2413 gene locus_tag LOCUS_11270 1862 2413 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_11270 3246 2836 gene locus_tag LOCUS_11280 3246 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3803 3342 gene locus_tag LOCUS_11290 3803 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence186 1479 739 gene locus_tag LOCUS_11300 gene cmoA 1479 739 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUL8 protein_id gnl|my_center|LOCUS_11300 1883 1476 gene locus_tag LOCUS_11310 1883 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2854 1964 gene locus_tag LOCUS_11320 gene cysM 2854 1964 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_11320 3820 2966 gene locus_tag LOCUS_11330 3820 2966 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_11330 4199 3852 gene locus_tag LOCUS_11340 gene trxA 4199 3852 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD9 protein_id gnl|my_center|LOCUS_11340 >Feature sequence187 2404 416 gene locus_tag LOCUS_11350 2404 416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 protein_id gnl|my_center|LOCUS_11350 3541 3143 gene locus_tag LOCUS_11360 3541 3143 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence188 123 635 gene locus_tag LOCUS_11370 123 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 636 1472 gene locus_tag LOCUS_11380 636 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_11380 1474 3315 gene locus_tag LOCUS_11390 1474 3315 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_11390 4288 3317 gene locus_tag LOCUS_11400 4288 3317 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence189 419 1306 gene locus_tag LOCUS_11410 gene prk 419 1306 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC81 protein_id gnl|my_center|LOCUS_11410 1389 2489 gene locus_tag LOCUS_11420 1389 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_11420 2621 3664 gene locus_tag LOCUS_11430 2621 3664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_11430 3688 4032 gene locus_tag LOCUS_11440 3688 4032 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957808.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence190 >Feature sequence191 66 590 gene locus_tag LOCUS_11450 66 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2100 619 gene locus_tag LOCUS_11460 2100 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2245 3897 gene locus_tag LOCUS_11470 2245 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence192 302 1393 gene locus_tag LOCUS_11480 302 1393 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIY7 protein_id gnl|my_center|LOCUS_11480 1511 2077 gene locus_tag LOCUS_11490 gene dcd 1511 2077 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDP4 protein_id gnl|my_center|LOCUS_11490 3005 2280 gene locus_tag LOCUS_11500 3005 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3687 3022 gene locus_tag LOCUS_11510 gene purN 3687 3022 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJJ9 protein_id gnl|my_center|LOCUS_11510 <4541 3693 gene locus_tag LOCUS_11520 <4541 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDI8:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence193 647 1486 gene locus_tag LOCUS_11530 647 1486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_11530 1649 3271 gene locus_tag LOCUS_11540 gene nifA-2 1649 3271 CDS product Nif-specific regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_11540 <4540 3268 gene locus_tag LOCUS_11550 <4540 3268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269384.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence194 1746 640 gene locus_tag LOCUS_11560 1746 640 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 protein_id gnl|my_center|LOCUS_11560 3356 1746 gene locus_tag LOCUS_11570 3356 1746 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888239.1 protein_id gnl|my_center|LOCUS_11570 <4515 3471 gene locus_tag LOCUS_11580 <4515 3471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888240.1:ABC transporter substrate-binding protein >Feature sequence195 701 1213 gene locus_tag LOCUS_11590 701 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1215 1613 gene locus_tag LOCUS_11600 1215 1613 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169716.1 protein_id gnl|my_center|LOCUS_11600 1614 2501 gene locus_tag LOCUS_11610 1614 2501 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_11610 2526 2864 gene locus_tag LOCUS_11620 2526 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3157 4059 gene locus_tag LOCUS_11630 gene prfB 3157 4059 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_11630 >Feature sequence196 <1 3154 gene locus_tag LOCUS_11640 <1 3154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWC9:DNA-directed RNA polymerase subunit beta' 3379 3753 gene locus_tag LOCUS_11650 gene rpsL 3379 3753 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L43 protein_id gnl|my_center|LOCUS_11650 3909 4316 gene locus_tag LOCUS_11660 gene rpsG 3909 4316 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ8 protein_id gnl|my_center|LOCUS_11660 >Feature sequence197 874 23 gene locus_tag LOCUS_11670 874 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1461 946 gene locus_tag LOCUS_11680 1461 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2053 1445 gene locus_tag LOCUS_11690 gene mobA 2053 1445 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_11690 2132 2326 gene locus_tag LOCUS_11700 2132 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3383 2316 gene locus_tag LOCUS_11710 gene queG 3383 2316 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_11710 >Feature sequence198 1440 1015 gene locus_tag LOCUS_11720 1440 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2946 1498 gene locus_tag LOCUS_11730 gene fliC 2946 1498 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_11730 <4468 3290 gene locus_tag LOCUS_11740 <4468 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946958.1:flagellar hook-associated protein FlgL >Feature sequence199 482 2272 gene locus_tag LOCUS_11750 482 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3237 2284 gene locus_tag LOCUS_11760 3237 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4464 3238 gene locus_tag LOCUS_11770 4464 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence200 3867 4169 gene locus_tag LOCUS_11780 3867 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence201 1576 677 gene locus_tag LOCUS_11790 gene lipA 1576 677 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C63 protein_id gnl|my_center|LOCUS_11790 3405 1900 gene locus_tag LOCUS_11800 3405 1900 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_11800 <4443 3498 gene locus_tag LOCUS_11810 <4443 3498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141016.1:iron(III) ABC transporter iron (III)-binding protein >Feature sequence202 2974 116 gene locus_tag LOCUS_11820 gene uvrA 2974 116 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_11820 >Feature sequence203 100 756 gene locus_tag LOCUS_11830 100 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1625 783 gene locus_tag LOCUS_11840 1625 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1942 3627 gene locus_tag LOCUS_11850 1942 3627 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039415.1 protein_id gnl|my_center|LOCUS_11850 4428 3643 gene locus_tag LOCUS_11860 4428 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence204 <1 1289 gene locus_tag LOCUS_11870 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402019.1:anthranilate synthase component I 1310 1894 gene locus_tag LOCUS_11880 gene trpG 1310 1894 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_11880 1912 2928 gene locus_tag LOCUS_11890 gene trpD 1912 2928 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_11890 2948 3745 gene locus_tag LOCUS_11900 gene trpC 2948 3745 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAS8 protein_id gnl|my_center|LOCUS_11900 4404 3763 gene locus_tag LOCUS_11910 gene vfr 4404 3763 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_11910 >Feature sequence205 845 30 gene locus_tag LOCUS_11920 845 30 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_11920 1437 838 gene locus_tag LOCUS_11930 gene fbpC 1437 838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 protein_id gnl|my_center|LOCUS_11930 2888 1605 gene locus_tag LOCUS_11940 gene amtB 2888 1605 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_11940 3239 2901 gene locus_tag LOCUS_11950 gene glnK 3239 2901 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_11950 4203 3508 gene locus_tag LOCUS_11960 4203 3508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence206 1113 139 gene locus_tag LOCUS_11970 1113 139 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_11970 1477 2478 gene locus_tag LOCUS_11980 1477 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2716 3150 gene locus_tag LOCUS_11990 2716 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence207 >Feature sequence208 50 976 gene locus_tag LOCUS_12000 50 976 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_12000 966 1256 gene locus_tag LOCUS_12010 966 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_12010 1249 2703 gene locus_tag LOCUS_12020 1249 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2700 4202 gene locus_tag LOCUS_12030 2700 4202 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence209 >Feature sequence210 2279 1461 gene locus_tag LOCUS_12040 2279 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3012 2452 gene locus_tag LOCUS_12050 3012 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_12050 3824 3066 gene locus_tag LOCUS_12060 3824 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_12060 3926 4291 gene locus_tag LOCUS_12070 3926 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence211 2 2470 gene locus_tag LOCUS_12080 2 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2523 3404 gene locus_tag LOCUS_12090 2523 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4070 3387 gene locus_tag LOCUS_12100 4070 3387 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence212 1108 3177 gene locus_tag LOCUS_12110 1108 3177 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268477.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence213 1630 311 gene locus_tag LOCUS_12120 gene pepP 1630 311 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12120 2221 1640 gene locus_tag LOCUS_12130 2221 1640 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_12130 2374 2571 gene locus_tag LOCUS_12140 2374 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2564 2887 gene locus_tag LOCUS_12150 gene zapA 2564 2887 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_12150 3159 3764 gene locus_tag LOCUS_12160 3159 3764 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_12160 3764 4234 gene locus_tag LOCUS_12170 3764 4234 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence214 223 585 gene locus_tag LOCUS_12180 223 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 582 1826 gene locus_tag LOCUS_12190 gene amaB 582 1826 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_12190 1823 2566 gene locus_tag LOCUS_12200 1823 2566 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_12200 2566 4005 gene locus_tag LOCUS_12210 gene dur3 2566 4005 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_12210 4008 4130 gene locus_tag LOCUS_12220 4008 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence215 1364 960 gene locus_tag LOCUS_12230 gene mshP 1364 960 CDS product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073803.1 protein_id gnl|my_center|LOCUS_12230 2139 1354 gene locus_tag LOCUS_12240 gene mshO 2139 1354 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_12240 2669 2139 gene locus_tag LOCUS_12250 gene mshD 2669 2139 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_12250 3087 2659 gene locus_tag LOCUS_12260 3087 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3616 3161 gene locus_tag LOCUS_12270 3616 3161 CDS product MSHA pilin protein MshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543415.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence216 2952 3428 gene locus_tag LOCUS_12280 2952 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence217 2532 1639 gene locus_tag LOCUS_12290 gene pilK 2532 1639 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_12290 <4288 2563 gene locus_tag LOCUS_12300 <4288 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42257:protein PilJ >Feature sequence218 1790 264 gene locus_tag LOCUS_12310 gene purF 1790 264 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_12310 2309 1848 gene locus_tag LOCUS_12320 gene cvpA 2309 1848 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262113.1 protein_id gnl|my_center|LOCUS_12320 2935 2333 gene locus_tag LOCUS_12330 2935 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3468 3346 gene locus_tag LOCUS_12340 gene ybgT 3468 3346 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_12340 <4280 3483 gene locus_tag LOCUS_12350 <4280 3483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097535.1:cytochrome bd oxidase subunit II >Feature sequence219 2 523 gene locus_tag LOCUS_12360 2 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 526 801 gene locus_tag LOCUS_12370 526 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12370 808 3642 gene locus_tag LOCUS_12380 808 3642 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706761.1 protein_id gnl|my_center|LOCUS_12380 4131 3844 gene locus_tag LOCUS_12390 4131 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence220 <1 769 gene locus_tag LOCUS_12400 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000211151.1:GTP-binding protein 1058 852 gene locus_tag LOCUS_12410 gene cspA3 1058 852 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 protein_id gnl|my_center|LOCUS_12410 2472 1303 gene locus_tag LOCUS_12420 2472 1303 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_12420 2671 3084 gene locus_tag LOCUS_12430 2671 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3862 3086 gene locus_tag LOCUS_12440 3862 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence221 1075 275 gene locus_tag LOCUS_12450 gene thiD 1075 275 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_12450 1632 1072 gene locus_tag LOCUS_12460 1632 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2036 1632 gene locus_tag LOCUS_12470 2036 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2249 2992 gene locus_tag LOCUS_12480 2249 2992 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence222 >Feature sequence223 2 322 gene locus_tag LOCUS_12490 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 459 1217 gene locus_tag LOCUS_12500 459 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1240 1590 gene locus_tag LOCUS_12510 1240 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1694 2077 gene locus_tag LOCUS_12520 1694 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2253 2387 gene locus_tag LOCUS_12530 2253 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3834 2437 gene locus_tag LOCUS_12540 gene gor 3834 2437 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06715 protein_id gnl|my_center|LOCUS_12540 >Feature sequence224 48 1433 gene locus_tag LOCUS_12550 48 1433 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_12550 1610 2074 gene locus_tag LOCUS_12560 gene soxY 1610 2074 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_12560 2089 2403 gene locus_tag LOCUS_12570 gene soxZ 2089 2403 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_12570 3793 2507 gene locus_tag LOCUS_12580 3793 2507 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence225 2629 86 gene locus_tag LOCUS_12590 2629 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_12590 3977 3372 gene locus_tag LOCUS_12600 gene plsY 3977 3372 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM5 protein_id gnl|my_center|LOCUS_12600 >Feature sequence226 560 1477 gene locus_tag LOCUS_12610 gene xerC 560 1477 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI3 protein_id gnl|my_center|LOCUS_12610 1540 2538 gene locus_tag LOCUS_12620 1540 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3284 2535 gene locus_tag LOCUS_12630 gene znuB 3284 2535 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_12630 <4165 3281 gene locus_tag LOCUS_12640 <4165 3281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070905.1:zinc ABC transporter substrate-binding protein >Feature sequence227 >Feature sequence228 477 229 gene locus_tag LOCUS_12650 477 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1482 580 gene locus_tag LOCUS_12660 gene pstS 1482 580 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_12660 1801 2169 gene locus_tag LOCUS_12670 1801 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2797 2228 gene locus_tag LOCUS_12680 2797 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence229 329 129 gene locus_tag LOCUS_12690 329 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 448 1200 gene locus_tag LOCUS_12700 gene ttcA 448 1200 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW7 protein_id gnl|my_center|LOCUS_12700 1509 1685 gene locus_tag LOCUS_12710 1509 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1806 1934 gene locus_tag LOCUS_12720 1806 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2388 3113 gene locus_tag LOCUS_12730 2388 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence230 2731 3954 gene locus_tag LOCUS_12740 gene mcp 2731 3954 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence231 657 511 gene locus_tag LOCUS_12750 657 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 815 633 gene locus_tag LOCUS_12760 815 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1389 919 gene locus_tag LOCUS_12770 1389 919 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_12770 3308 1413 gene locus_tag LOCUS_12780 gene htpG 3308 1413 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EL0 protein_id gnl|my_center|LOCUS_12780 >Feature sequence232 2480 1458 gene locus_tag LOCUS_12790 gene cobC 2480 1458 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_12790 4068 2473 gene locus_tag LOCUS_12800 4068 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence233 992 72 gene locus_tag LOCUS_12810 gene ilvE 992 72 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_12810 3862 1013 gene locus_tag LOCUS_12820 gene glnE 3862 1013 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_12820 >Feature sequence234 2012 1152 gene locus_tag LOCUS_12830 gene accD 2012 1152 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E456 protein_id gnl|my_center|LOCUS_12830 2873 2037 gene locus_tag LOCUS_12840 gene trpA 2873 2037 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_12840 <4040 2870 gene locus_tag LOCUS_12850 <4040 2870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2W9Z8:tryptophan synthase beta chain >Feature sequence235 3297 1312 gene locus_tag LOCUS_12860 gene nuoL 3297 1312 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_12860 3606 3301 gene locus_tag LOCUS_12870 gene nuoK 3606 3301 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F625 protein_id gnl|my_center|LOCUS_12870 4006 3620 gene locus_tag LOCUS_12880 4006 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence236 550 1323 gene locus_tag LOCUS_12890 550 1323 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_12890 1448 2956 gene locus_tag LOCUS_12900 gene glsF 1448 2956 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence237 346 801 gene locus_tag LOCUS_12910 346 801 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_12910 794 1900 gene locus_tag LOCUS_12920 gene mnmA 794 1900 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFQ5 protein_id gnl|my_center|LOCUS_12920 1897 2532 gene locus_tag LOCUS_12930 gene hflD 1897 2532 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QM0 protein_id gnl|my_center|LOCUS_12930 >Feature sequence238 331 483 gene locus_tag LOCUS_12940 331 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_12940 1201 521 gene locus_tag LOCUS_12950 1201 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2205 1216 gene locus_tag LOCUS_12960 gene galE 2205 1216 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_12960 2850 2230 gene locus_tag LOCUS_12970 gene cysC1 2850 2230 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK5 protein_id gnl|my_center|LOCUS_12970 3488 2976 gene locus_tag LOCUS_12980 3488 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence239 519 103 gene locus_tag LOCUS_12990 519 103 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_12990 1049 522 gene locus_tag LOCUS_13000 1049 522 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_13000 2389 1073 gene locus_tag LOCUS_13010 gene yadQ 2389 1073 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_13010 2561 3586 gene locus_tag LOCUS_13020 gene argC 2561 3586 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_13020 >Feature sequence240 >Feature sequence241 <1 2114 gene locus_tag LOCUS_13030 <1 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120914.1:cytochrome c 2143 3837 gene locus_tag LOCUS_13040 2143 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence242 1551 454 gene locus_tag LOCUS_13050 gene rlmN 1551 454 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ42 protein_id gnl|my_center|LOCUS_13050 2023 1592 gene locus_tag LOCUS_13060 gene ndk 2023 1592 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C71 protein_id gnl|my_center|LOCUS_13060 2402 2202 gene locus_tag LOCUS_13070 2402 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_13070 2786 2448 gene locus_tag LOCUS_13080 gene fdx 2786 2448 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_13080 <3961 2799 gene locus_tag LOCUS_13090 <3961 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKQ7:chaperone protein HscA >Feature sequence243 <1 881 gene locus_tag LOCUS_13100 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705448.1:nuclease PIN 916 1806 gene locus_tag LOCUS_13110 916 1806 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141348.1 protein_id gnl|my_center|LOCUS_13110 1907 3463 gene locus_tag LOCUS_13120 1907 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3696 3460 gene locus_tag LOCUS_13130 3696 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence244 380 934 gene locus_tag LOCUS_13140 380 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 931 1470 gene locus_tag LOCUS_13150 931 1470 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583584.1 protein_id gnl|my_center|LOCUS_13150 1584 2915 gene locus_tag LOCUS_13160 1584 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3656 2907 gene locus_tag LOCUS_13170 3656 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3912 3670 gene locus_tag LOCUS_13180 3912 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence245 3263 36 gene locus_tag LOCUS_13190 3263 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 <3953 3256 gene locus_tag LOCUS_13200 <3953 3256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267821.1:syrP protein >Feature sequence246 743 408 gene locus_tag LOCUS_13210 743 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1144 746 gene locus_tag LOCUS_13220 1144 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3686 1218 gene locus_tag LOCUS_13230 3686 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence247 >Feature sequence248 196 1377 gene locus_tag LOCUS_13240 196 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_13240 2237 1413 gene locus_tag LOCUS_13250 2237 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2482 2318 gene locus_tag LOCUS_13260 2482 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2803 2522 gene locus_tag LOCUS_13270 2803 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence249 80 1105 gene locus_tag LOCUS_13280 gene lpxD 80 1105 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DT0 protein_id gnl|my_center|LOCUS_13280 1109 1555 gene locus_tag LOCUS_13290 gene fabZ 1109 1555 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_13290 1552 2325 gene locus_tag LOCUS_13300 gene lpxA 1552 2325 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHD2 protein_id gnl|my_center|LOCUS_13300 3458 2322 gene locus_tag LOCUS_13310 gene lpxB 3458 2322 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_13310 >Feature sequence250 <1 1205 gene locus_tag LOCUS_13320 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63XV0:phosphoenolpyruvate-protein phosphotransferase 1273 2637 gene locus_tag LOCUS_13330 1273 2637 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7W9 protein_id gnl|my_center|LOCUS_13330 <3934 2634 gene locus_tag LOCUS_13340 <3934 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112740.1:PmbA protein >Feature sequence251 248 589 gene locus_tag LOCUS_13350 gene dsrC-2 248 589 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_13350 714 920 gene locus_tag LOCUS_13360 714 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1237 1719 gene locus_tag LOCUS_13370 1237 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <3929 1734 gene locus_tag LOCUS_13380 <3929 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331363.1:carbonate dehydratase >Feature sequence252 183 893 gene locus_tag LOCUS_13390 183 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263874.1 protein_id gnl|my_center|LOCUS_13390 1466 939 gene locus_tag LOCUS_13400 1466 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2518 1676 gene locus_tag LOCUS_13410 2518 1676 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_13410 3638 2529 gene locus_tag LOCUS_13420 gene frmA 3638 2529 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_13420 >Feature sequence253 558 1229 gene locus_tag LOCUS_13430 558 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1239 1802 gene locus_tag LOCUS_13440 1239 1802 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885M2 protein_id gnl|my_center|LOCUS_13440 1802 2101 gene locus_tag LOCUS_13450 1802 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_13450 2127 2924 gene locus_tag LOCUS_13460 2127 2924 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V26 protein_id gnl|my_center|LOCUS_13460 2943 3614 gene locus_tag LOCUS_13470 2943 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence254 313 116 gene locus_tag LOCUS_13480 313 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 <3894 509 gene locus_tag LOCUS_13490 <3894 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704375.1:protein MshQ >Feature sequence255 486 905 gene locus_tag LOCUS_13500 486 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 931 1428 gene locus_tag LOCUS_13510 931 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1471 1749 gene locus_tag LOCUS_13520 1471 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1777 2754 gene locus_tag LOCUS_13530 1777 2754 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_13530 2788 3615 gene locus_tag LOCUS_13540 2788 3615 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence256 296 1204 gene locus_tag LOCUS_13550 296 1204 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_13550 1188 2702 gene locus_tag LOCUS_13560 gene lnt 1188 2702 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN93 protein_id gnl|my_center|LOCUS_13560 >Feature sequence257 <1 868 gene locus_tag LOCUS_13570 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000839353.1:multidrug transporter AcrB 1533 865 gene locus_tag LOCUS_13580 1533 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2672 1557 gene locus_tag LOCUS_13590 2672 1557 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_13590 3772 2675 gene locus_tag LOCUS_13600 gene pilT-3 3772 2675 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence258 <1 1092 gene locus_tag LOCUS_13610 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIB1:phosphoglycerate kinase 1178 2635 gene locus_tag LOCUS_13620 gene pyk 1178 2635 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU7 protein_id gnl|my_center|LOCUS_13620 2688 3761 gene locus_tag LOCUS_13630 2688 3761 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687252.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence259 <1 1074 gene locus_tag LOCUS_13640 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZU94:pyrophosphate--fructose 6-phosphate 1-phosphotransferase 1079 1255 gene locus_tag LOCUS_13650 1079 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1578 1312 gene locus_tag LOCUS_13660 1578 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705045.1 protein_id gnl|my_center|LOCUS_13660 1999 1703 gene locus_tag LOCUS_13670 1999 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3717 2014 gene locus_tag LOCUS_13680 3717 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence260 843 466 gene locus_tag LOCUS_13690 843 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_13690 2208 859 gene locus_tag LOCUS_13700 gene hslU 2208 859 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFN0 protein_id gnl|my_center|LOCUS_13700 2753 2214 gene locus_tag LOCUS_13710 gene hslV 2753 2214 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_13710 <3842 2832 gene locus_tag LOCUS_13720 <3842 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003859383.1:Na+-dependent transporter >Feature sequence261 <1 602 gene locus_tag LOCUS_13730 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KM38:flagellar P-ring protein 743 1642 gene locus_tag LOCUS_13740 gene flgJ 743 1642 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_13740 1645 3786 gene locus_tag LOCUS_13750 1645 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence262 1240 365 gene locus_tag LOCUS_13760 gene pstB 1240 365 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_13760 2901 1243 gene locus_tag LOCUS_13770 gene pstA 2901 1243 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_13770 <3830 2912 gene locus_tag LOCUS_13780 <3830 2912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071862.1:ABC high affinity phosphate uptake system permease PstC >Feature sequence263 1145 465 gene locus_tag LOCUS_13790 1145 465 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 protein_id gnl|my_center|LOCUS_13790 1852 1148 gene locus_tag LOCUS_13800 1852 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1970 2878 gene locus_tag LOCUS_13810 1970 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3709 2888 gene locus_tag LOCUS_13820 3709 2888 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence264 <1 730 gene locus_tag LOCUS_13830 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056430.1:sucrose-phosphate synthase 2897 732 gene locus_tag LOCUS_13840 gene sps 2897 732 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_13840 3786 2914 gene locus_tag LOCUS_13850 gene scrK 3786 2914 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence265 716 291 gene locus_tag LOCUS_13860 716 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 935 1327 gene locus_tag LOCUS_13870 935 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2273 1407 gene locus_tag LOCUS_13880 2273 1407 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788892.1 protein_id gnl|my_center|LOCUS_13880 2395 3396 gene locus_tag LOCUS_13890 2395 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3483 3704 gene locus_tag LOCUS_13900 3483 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence266 241 1164 gene locus_tag LOCUS_13910 241 1164 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085751.1 protein_id gnl|my_center|LOCUS_13910 1725 1165 gene locus_tag LOCUS_13920 1725 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2429 1722 gene locus_tag LOCUS_13930 2429 1722 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886889.1 protein_id gnl|my_center|LOCUS_13930 2699 3622 gene locus_tag LOCUS_13940 2699 3622 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085751.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence267 1039 1731 gene locus_tag LOCUS_13950 1039 1731 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence268 534 1118 gene locus_tag LOCUS_13960 534 1118 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938036.1 protein_id gnl|my_center|LOCUS_13960 2410 1121 gene locus_tag LOCUS_13970 gene cpx 2410 1121 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_13970 3614 2565 gene locus_tag LOCUS_13980 3614 2565 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence269 1967 1284 gene locus_tag LOCUS_13990 gene bioD 1967 1284 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QN3 protein_id gnl|my_center|LOCUS_13990 2859 1987 gene locus_tag LOCUS_14000 gene bioC 2859 1987 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF5 protein_id gnl|my_center|LOCUS_14000 3638 2856 gene locus_tag LOCUS_14010 gene bioH 3638 2856 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF11 protein_id gnl|my_center|LOCUS_14010 3772 3641 gene locus_tag LOCUS_14020 3772 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence270 1406 438 gene locus_tag LOCUS_14030 1406 438 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_14030 2086 1406 gene locus_tag LOCUS_14040 2086 1406 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_14040 3033 2083 gene locus_tag LOCUS_14050 3033 2083 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_14050 >Feature sequence271 155 1027 gene locus_tag LOCUS_14060 gene prmC 155 1027 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT28 protein_id gnl|my_center|LOCUS_14060 1020 1760 gene locus_tag LOCUS_14070 1020 1760 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266735.1 protein_id gnl|my_center|LOCUS_14070 2338 1763 gene locus_tag LOCUS_14080 2338 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2873 2361 gene locus_tag LOCUS_14090 2873 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_14090 3557 2976 gene locus_tag LOCUS_14100 3557 2976 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence272 <1 788 gene locus_tag LOCUS_14110 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616461.1:chorismate mutase 792 1919 gene locus_tag LOCUS_14120 gene hisC2 792 1919 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_14120 1916 2788 gene locus_tag LOCUS_14130 1916 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence273 1510 212 gene locus_tag LOCUS_14140 gene rsmB 1510 212 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KD3 protein_id gnl|my_center|LOCUS_14140 2460 1507 gene locus_tag LOCUS_14150 gene fmt 2460 1507 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q7 protein_id gnl|my_center|LOCUS_14150 3067 2552 gene locus_tag LOCUS_14160 gene def 3067 2552 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S9 protein_id gnl|my_center|LOCUS_14160 >Feature sequence274 <1 2638 gene locus_tag LOCUS_14170 <1 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence275 959 180 gene locus_tag LOCUS_14180 959 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1167 1595 gene locus_tag LOCUS_14190 1167 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2838 1597 gene locus_tag LOCUS_14200 2838 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3008 3304 gene locus_tag LOCUS_14210 3008 3304 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence276 286 1164 gene locus_tag LOCUS_14220 gene dapA 286 1164 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_14220 1170 2273 gene locus_tag LOCUS_14230 1170 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2292 3056 gene locus_tag LOCUS_14240 2292 3056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence277 <1 2038 gene locus_tag LOCUS_14250 <1 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141946.1:acyl-CoA synthetase 2296 2784 gene locus_tag LOCUS_14260 2296 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2811 3509 gene locus_tag LOCUS_14270 2811 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence278 853 2076 gene locus_tag LOCUS_14280 853 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388809.1 protein_id gnl|my_center|LOCUS_14280 2088 2366 gene locus_tag LOCUS_14290 2088 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2413 3486 gene locus_tag LOCUS_14300 2413 3486 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405436.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence279 446 1090 gene locus_tag LOCUS_14310 gene pyrE 446 1090 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_14310 1822 1103 gene locus_tag LOCUS_14320 1822 1103 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_14320 1936 2571 gene locus_tag LOCUS_14330 1936 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3148 2564 gene locus_tag LOCUS_14340 gene slmA 3148 2564 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_14340 <3697 3154 gene locus_tag LOCUS_14350 <3697 3154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTN2:acetylglutamate kinase >Feature sequence280 2239 1412 gene locus_tag LOCUS_14360 2239 1412 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_14360 3140 2271 gene locus_tag LOCUS_14370 gene pstA2 3140 2271 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_14370 <3675 3133 gene locus_tag LOCUS_14380 <3675 3133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E9I6:phosphate transport system permease protein >Feature sequence281 1511 54 gene locus_tag LOCUS_14390 1511 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_14390 2319 1492 gene locus_tag LOCUS_14400 2319 1492 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_14400 2644 2333 gene locus_tag LOCUS_14410 2644 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 <3656 2705 gene locus_tag LOCUS_14420 <3656 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073797.1:DUF3971 domain-containing protein >Feature sequence282 3425 2274 gene locus_tag LOCUS_14430 3425 2274 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence283 1283 984 gene locus_tag LOCUS_14440 1283 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3247 1433 gene locus_tag LOCUS_14450 gene recJ 3247 1433 CDS product single-stranded-DNA-specific exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence284 1526 252 gene locus_tag LOCUS_14460 gene sqr 1526 252 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_14460 1826 2494 gene locus_tag LOCUS_14470 1826 2494 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_14470 2571 2762 gene locus_tag LOCUS_14480 2571 2762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_14480 2905 3429 gene locus_tag LOCUS_14490 2905 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence285 323 1423 gene locus_tag LOCUS_14500 323 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_14500 1420 1980 gene locus_tag LOCUS_14510 1420 1980 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_14510 1987 3039 gene locus_tag LOCUS_14520 1987 3039 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence286 49 426 gene locus_tag LOCUS_14530 gene tolR 49 426 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772109.1 protein_id gnl|my_center|LOCUS_14530 428 1276 gene locus_tag LOCUS_14540 428 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1280 2602 gene locus_tag LOCUS_14550 gene tolB 1280 2602 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_14550 2629 3153 gene locus_tag LOCUS_14560 2629 3153 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence287 1692 1057 gene locus_tag LOCUS_14570 1692 1057 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_14570 3495 1777 gene locus_tag LOCUS_14580 3495 1777 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence288 531 1772 gene locus_tag LOCUS_14590 gene cca 531 1772 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW2 protein_id gnl|my_center|LOCUS_14590 1841 3160 gene locus_tag LOCUS_14600 gene rimO 1841 3160 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UQ8 protein_id gnl|my_center|LOCUS_14600 >Feature sequence289 765 1664 gene locus_tag LOCUS_14610 765 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_14610 1867 2430 gene locus_tag LOCUS_14620 1867 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence290 <1 1133 gene locus_tag LOCUS_14630 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZHK5:lysine--tRNA ligase 1976 1146 gene locus_tag LOCUS_14640 1976 1146 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14640 3092 2061 gene locus_tag LOCUS_14650 3092 2061 CDS product folate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_14650 3174 3557 gene locus_tag LOCUS_14660 gene sdhC 3174 3557 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence291 1460 360 gene locus_tag LOCUS_14670 gene anmK 1460 360 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_14670 2850 1471 gene locus_tag LOCUS_14680 2850 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence292 1208 774 gene locus_tag LOCUS_14690 gene rplO 1208 774 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ7 protein_id gnl|my_center|LOCUS_14690 1395 1210 gene locus_tag LOCUS_14700 gene rpmD 1395 1210 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E896 protein_id gnl|my_center|LOCUS_14700 1905 1399 gene locus_tag LOCUS_14710 gene rpsE 1905 1399 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 protein_id gnl|my_center|LOCUS_14710 2261 1908 gene locus_tag LOCUS_14720 gene rplR 2261 1908 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV2 protein_id gnl|my_center|LOCUS_14720 2799 2275 gene locus_tag LOCUS_14730 gene rplF 2799 2275 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ9 protein_id gnl|my_center|LOCUS_14730 3204 2812 gene locus_tag LOCUS_14740 gene rpsH 3204 2812 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK55 protein_id gnl|my_center|LOCUS_14740 3539 3234 gene locus_tag LOCUS_14750 gene rpsN 3539 3234 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV5 protein_id gnl|my_center|LOCUS_14750 >Feature sequence293 869 2137 gene locus_tag LOCUS_14760 gene glgC 869 2137 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_14760 >Feature sequence294 2523 364 gene locus_tag LOCUS_14770 2523 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14770 3507 2527 gene locus_tag LOCUS_14780 3507 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14780 >Feature sequence295 <1 1479 gene locus_tag LOCUS_14790 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKR6:Trk system potassium uptake protein 1483 1815 gene locus_tag LOCUS_14800 1483 1815 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B1 protein_id gnl|my_center|LOCUS_14800 1891 2988 gene locus_tag LOCUS_14810 1891 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2985 3431 gene locus_tag LOCUS_14820 2985 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3577 3440 gene locus_tag LOCUS_14830 3577 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence296 1107 46 gene locus_tag LOCUS_14840 1107 46 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLL0 protein_id gnl|my_center|LOCUS_14840 2065 1412 gene locus_tag LOCUS_14850 2065 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2265 2098 gene locus_tag LOCUS_14860 2265 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3020 2289 gene locus_tag LOCUS_14870 gene dltE 3020 2289 CDS product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 protein_id gnl|my_center|LOCUS_14870 >Feature sequence297 231 554 gene locus_tag LOCUS_14880 gene fdxA 231 554 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_14880 582 3485 gene locus_tag LOCUS_14890 582 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence298 1021 743 gene locus_tag LOCUS_14900 1021 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1372 1028 gene locus_tag LOCUS_14910 1372 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1846 1376 gene locus_tag LOCUS_14920 1846 1376 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246093.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence299 1116 1664 gene locus_tag LOCUS_14930 1116 1664 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 protein_id gnl|my_center|LOCUS_14930 1699 2847 gene locus_tag LOCUS_14940 1699 2847 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088481.1 protein_id gnl|my_center|LOCUS_14940 2857 3264 gene locus_tag LOCUS_14950 2857 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence300 1142 1603 gene locus_tag LOCUS_14960 1142 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2165 3184 gene locus_tag LOCUS_14970 2165 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence301 3305 2085 gene locus_tag LOCUS_14980 3305 2085 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence302 <1 3113 gene locus_tag LOCUS_14990 <1 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3I6:chromosome partition protein Smc >Feature sequence303 <1 954 gene locus_tag LOCUS_15000 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6B9:electron transport complex subunit D 951 1568 gene locus_tag LOCUS_15010 951 1568 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_15010 1570 2241 gene locus_tag LOCUS_15020 1570 2241 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_15020 >Feature sequence304 500 784 gene locus_tag LOCUS_15030 500 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 796 1539 gene locus_tag LOCUS_15040 gene ispD 796 1539 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH5 protein_id gnl|my_center|LOCUS_15040 1539 2030 gene locus_tag LOCUS_15050 gene ispF 1539 2030 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_15050 2038 3081 gene locus_tag LOCUS_15060 gene truD 2038 3081 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_15060 >Feature sequence305 999 115 gene locus_tag LOCUS_15070 999 115 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_15070 1371 2447 gene locus_tag LOCUS_15080 1371 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2866 2444 gene locus_tag LOCUS_15090 2866 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <3485 2982 gene locus_tag LOCUS_15100 <3485 2982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940868.1:sorbosone dehydrogenase >Feature sequence306 <1 867 gene locus_tag LOCUS_15110 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2VI31:dihydrolipoyl dehydrogenase 976 2181 gene locus_tag LOCUS_15120 976 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence307 <1 943 gene locus_tag LOCUS_15130 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140328.1:AraC family transcriptional regulator 1155 3245 gene locus_tag LOCUS_15140 1155 3245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388593.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence308 2 646 gene locus_tag LOCUS_15150 2 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1059 673 gene locus_tag LOCUS_15160 1059 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_15160 1167 2351 gene locus_tag LOCUS_15170 gene yfdZ 1167 2351 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence309 242 3 gene locus_tag LOCUS_15180 242 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2049 373 gene locus_tag LOCUS_15190 2049 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 <3449 2156 gene locus_tag LOCUS_15200 <3449 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AR5:primosomal protein N' >Feature sequence310 216 461 gene locus_tag LOCUS_15210 216 461 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_15210 475 2049 gene locus_tag LOCUS_15220 475 2049 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061275.1 protein_id gnl|my_center|LOCUS_15220 2046 2945 gene locus_tag LOCUS_15230 2046 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence311 <1 1326 gene locus_tag LOCUS_15240 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123571.1:N-acetylmuramoyl-L-alanine amidase 1720 2868 gene locus_tag LOCUS_15250 1720 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence312 461 907 gene locus_tag LOCUS_15260 461 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1643 930 gene locus_tag LOCUS_15270 1643 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_15270 3024 1636 gene locus_tag LOCUS_15280 gene ampG 3024 1636 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence313 469 167 gene locus_tag LOCUS_15290 469 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224860.1 protein_id gnl|my_center|LOCUS_15290 1643 900 gene locus_tag LOCUS_15300 gene dam 1643 900 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXS7 protein_id gnl|my_center|LOCUS_15300 3066 1729 gene locus_tag LOCUS_15310 gene argA 3066 1729 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z421 protein_id gnl|my_center|LOCUS_15310 >Feature sequence314 <1 965 gene locus_tag LOCUS_15320 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000470240.1:transposase <3406 1918 gene locus_tag LOCUS_15330 <3406 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105567.1:TonB-dependent receptor >Feature sequence315 213 731 gene locus_tag LOCUS_15340 gene nudF 213 731 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_15340 1433 738 gene locus_tag LOCUS_15350 1433 738 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_15350 1560 2096 gene locus_tag LOCUS_15360 1560 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 <3403 2101 gene locus_tag LOCUS_15370 <3403 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039015.1:two-component sensor histidine kinase >Feature sequence316 203 832 gene locus_tag LOCUS_15380 gene nuoC 203 832 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN7 protein_id gnl|my_center|LOCUS_15380 825 2078 gene locus_tag LOCUS_15390 gene nuoD 825 2078 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN0 protein_id gnl|my_center|LOCUS_15390 2075 2590 gene locus_tag LOCUS_15400 2075 2590 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence317 1 483 gene locus_tag LOCUS_15410 1 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 572 1366 gene locus_tag LOCUS_15420 572 1366 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727S2 protein_id gnl|my_center|LOCUS_15420 1436 1855 gene locus_tag LOCUS_15430 1436 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence318 375 1637 gene locus_tag LOCUS_15440 gene moeA 375 1637 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 protein_id gnl|my_center|LOCUS_15440 2036 1656 gene locus_tag LOCUS_15450 2036 1656 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4N0 protein_id gnl|my_center|LOCUS_15450 2492 2040 gene locus_tag LOCUS_15460 2492 2040 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_15460 2881 2489 gene locus_tag LOCUS_15470 2881 2489 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUF6 protein_id gnl|my_center|LOCUS_15470 3262 2882 gene locus_tag LOCUS_15480 3262 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence319 2832 1516 gene locus_tag LOCUS_15490 2832 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence320 475 53 gene locus_tag LOCUS_15500 475 53 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_15500 666 947 gene locus_tag LOCUS_15510 gene xseB 666 947 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_15510 952 1842 gene locus_tag LOCUS_15520 952 1842 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence321 1520 1020 gene locus_tag LOCUS_15530 1520 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2347 1544 gene locus_tag LOCUS_15540 2347 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3038 2361 gene locus_tag LOCUS_15550 3038 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence322 894 373 gene locus_tag LOCUS_15560 894 373 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 protein_id gnl|my_center|LOCUS_15560 1898 978 gene locus_tag LOCUS_15570 1898 978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 protein_id gnl|my_center|LOCUS_15570 2026 2571 gene locus_tag LOCUS_15580 2026 2571 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_15580 2616 3188 gene locus_tag LOCUS_15590 2616 3188 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_15590 >Feature sequence323 <1 1471 gene locus_tag LOCUS_15600 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024256.1:histidine kinase 1483 1869 gene locus_tag LOCUS_15610 1483 1869 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence324 1927 392 gene locus_tag LOCUS_15620 gene xcpR 1927 392 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_15620 <3350 1932 gene locus_tag LOCUS_15630 <3350 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262833.1:type II secretion system protein GspD >Feature sequence325 1540 2436 gene locus_tag LOCUS_15640 1540 2436 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_15640 2638 3321 gene locus_tag LOCUS_15650 2638 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence326 708 151 gene locus_tag LOCUS_15660 708 151 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX3 protein_id gnl|my_center|LOCUS_15660 1292 708 gene locus_tag LOCUS_15670 gene rnfA 1292 708 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_15670 <3345 1453 gene locus_tag LOCUS_15680 <3345 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KKF6:methionine--tRNA ligase >Feature sequence327 <1 1360 gene locus_tag LOCUS_15690 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EII0:histidine kinase 2428 1367 gene locus_tag LOCUS_15700 2428 1367 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931085.1 protein_id gnl|my_center|LOCUS_15700 2617 3084 gene locus_tag LOCUS_15710 2617 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence328 458 847 gene locus_tag LOCUS_15720 gene queF 458 847 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_15720 901 2154 gene locus_tag LOCUS_15730 901 2154 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 protein_id gnl|my_center|LOCUS_15730 2154 2918 gene locus_tag LOCUS_15740 gene cysZ 2154 2918 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF4 protein_id gnl|my_center|LOCUS_15740 >Feature sequence329 1864 221 gene locus_tag LOCUS_15750 1864 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1983 2456 gene locus_tag LOCUS_15760 1983 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3005 2457 gene locus_tag LOCUS_15770 3005 2457 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_15770 3227 3009 gene locus_tag LOCUS_15780 3227 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence330 1230 1721 gene locus_tag LOCUS_15790 1230 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence331 1748 1326 gene locus_tag LOCUS_15800 gene exbD 1748 1326 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_15800 2378 1749 gene locus_tag LOCUS_15810 2378 1749 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_15810 <3296 2468 gene locus_tag LOCUS_15820 <3296 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004540034.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence332 1837 962 gene locus_tag LOCUS_15830 gene hmuB 1837 962 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073468.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence333 1264 1133 gene locus_tag LOCUS_15840 1264 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2751 1342 gene locus_tag LOCUS_15850 gene gltX 2751 1342 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLB3 protein_id gnl|my_center|LOCUS_15850 >Feature sequence334 894 127 gene locus_tag LOCUS_15860 894 127 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_15860 1735 878 gene locus_tag LOCUS_15870 1735 878 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_15870 2121 1759 gene locus_tag LOCUS_15880 2121 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3017 2382 gene locus_tag LOCUS_15890 gene nth 3017 2382 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT92 protein_id gnl|my_center|LOCUS_15890 >Feature sequence335 1692 763 gene locus_tag LOCUS_15900 gene fabD 1692 763 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH2 protein_id gnl|my_center|LOCUS_15900 2674 1706 gene locus_tag LOCUS_15910 gene fabH 2674 1706 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_15910 <3277 2674 gene locus_tag LOCUS_15920 <3277 2674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PEG2:phosphate acyltransferase >Feature sequence336 1365 550 gene locus_tag LOCUS_15930 1365 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_15930 2413 1397 gene locus_tag LOCUS_15940 2413 1397 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_15940 <3270 2403 gene locus_tag LOCUS_15950 <3270 2403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707028.1:rod shape-determining protein RodA >Feature sequence337 1525 1100 gene locus_tag LOCUS_15960 1525 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2781 1537 gene locus_tag LOCUS_15970 2781 1537 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence338 233 565 gene locus_tag LOCUS_15980 233 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 733 2571 gene locus_tag LOCUS_15990 733 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence339 1122 709 gene locus_tag LOCUS_16000 1122 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1216 1794 gene locus_tag LOCUS_16010 1216 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2738 1776 gene locus_tag LOCUS_16020 2738 1776 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919953.1 protein_id gnl|my_center|LOCUS_16020 <3251 2731 gene locus_tag LOCUS_16030 <3251 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919952.1:ABC transporter ATP-binding protein >Feature sequence340 2258 1578 gene locus_tag LOCUS_16040 gene cmk 2258 1578 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ97 protein_id gnl|my_center|LOCUS_16040 <3246 2261 gene locus_tag LOCUS_16050 <3246 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C7J3:xanthan biosynthesis protein XanB >Feature sequence341 1489 299 gene locus_tag LOCUS_16060 gene aatA 1489 299 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZE1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence342 <1 1973 gene locus_tag LOCUS_16070 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085593.1:nitrate reductase 1983 2321 gene locus_tag LOCUS_16080 gene tusE 1983 2321 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45184 protein_id gnl|my_center|LOCUS_16080 2639 2322 gene locus_tag LOCUS_16090 2639 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence343 1179 505 gene locus_tag LOCUS_16100 1179 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1511 2305 gene locus_tag LOCUS_16110 1511 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence344 <1 848 gene locus_tag LOCUS_16120 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0L5:isocitrate dehydrogenase [NADP] 1147 914 gene locus_tag LOCUS_16130 gene cspD 1147 914 CDS product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_16130 1362 1688 gene locus_tag LOCUS_16140 gene clpS 1362 1688 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_16140 >Feature sequence345 1393 1022 gene locus_tag LOCUS_16150 1393 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1788 2336 gene locus_tag LOCUS_16160 1788 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence346 212 625 gene locus_tag LOCUS_16170 212 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 628 2109 gene locus_tag LOCUS_16180 gene hoxA 628 2109 CDS product hydrogenase transcriptional regulatory protein HoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31908 protein_id gnl|my_center|LOCUS_16180 >Feature sequence347 848 54 gene locus_tag LOCUS_16190 gene uppP 848 54 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_16190 2057 861 gene locus_tag LOCUS_16200 2057 861 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_16200 2140 2874 gene locus_tag LOCUS_16210 gene ptr1 2140 2874 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence348 >Feature sequence349 594 1652 gene locus_tag LOCUS_16220 594 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1675 2349 gene locus_tag LOCUS_16230 1675 2349 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 protein_id gnl|my_center|LOCUS_16230 2818 2609 gene locus_tag LOCUS_16240 2818 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence350 2450 1902 gene locus_tag LOCUS_16250 2450 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence351 <1 1575 gene locus_tag LOCUS_16260 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUP3:chaperone protein ClpB 2244 1618 gene locus_tag LOCUS_16270 2244 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence352 <1 930 gene locus_tag LOCUS_16280 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VJ8:ATP phosphoribosyltransferase regulatory subunit 950 2260 gene locus_tag LOCUS_16290 gene purA 950 2260 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_16290 <3189 2281 gene locus_tag LOCUS_16300 <3189 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAI9:fumarate hydratase class II >Feature sequence353 1350 664 gene locus_tag LOCUS_16310 1350 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 <3183 1343 gene locus_tag LOCUS_16320 <3183 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase >Feature sequence354 443 1195 gene locus_tag LOCUS_16330 443 1195 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_16330 1240 1533 gene locus_tag LOCUS_16340 1240 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2165 1587 gene locus_tag LOCUS_16350 2165 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2817 2167 gene locus_tag LOCUS_16360 2817 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence355 1032 589 gene locus_tag LOCUS_16370 1032 589 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_16370 2872 1019 gene locus_tag LOCUS_16380 2872 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence356 1053 277 gene locus_tag LOCUS_16390 1053 277 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_16390 1967 1050 gene locus_tag LOCUS_16400 1967 1050 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 protein_id gnl|my_center|LOCUS_16400 <3155 1979 gene locus_tag LOCUS_16410 <3155 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E749:phosphoribosylformylglycinamidine synthase >Feature sequence357 <1 521 gene locus_tag LOCUS_16420 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73LE0:peptidyl-prolyl cis-trans isomerase 530 877 gene locus_tag LOCUS_16430 530 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16430 911 1906 gene locus_tag LOCUS_16440 911 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16440 >Feature sequence358 345 875 gene locus_tag LOCUS_16450 gene gcvR 345 875 CDS product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_16450 914 1390 gene locus_tag LOCUS_16460 914 1390 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_16460 1451 2863 gene locus_tag LOCUS_16470 1451 2863 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence359 584 1015 gene locus_tag LOCUS_16480 gene hspA 584 1015 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_16480 1133 1630 gene locus_tag LOCUS_16490 1133 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1630 3003 gene locus_tag LOCUS_16500 gene degQ 1630 3003 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence360 663 1106 gene locus_tag LOCUS_16510 663 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1212 2015 gene locus_tag LOCUS_16520 1212 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2097 3011 gene locus_tag LOCUS_16530 2097 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence361 1612 1100 gene locus_tag LOCUS_16540 1612 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2202 1885 gene locus_tag LOCUS_16550 2202 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence362 1037 570 gene locus_tag LOCUS_16560 1037 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1763 1227 gene locus_tag LOCUS_16570 1763 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2259 1798 gene locus_tag LOCUS_16580 2259 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3018 2287 gene locus_tag LOCUS_16590 3018 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence363 779 60 gene locus_tag LOCUS_16600 gene pcpS 779 60 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 protein_id gnl|my_center|LOCUS_16600 1053 1862 gene locus_tag LOCUS_16610 1053 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1890 2294 gene locus_tag LOCUS_16620 1890 2294 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_16620 2294 2707 gene locus_tag LOCUS_16630 2294 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence364 235 900 gene locus_tag LOCUS_16640 gene queE 235 900 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F56 protein_id gnl|my_center|LOCUS_16640 884 1579 gene locus_tag LOCUS_16650 gene queC 884 1579 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_16650 1714 2979 gene locus_tag LOCUS_16660 1714 2979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085683.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence365 60 662 gene locus_tag LOCUS_16670 60 662 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence366 1946 735 gene locus_tag LOCUS_16680 gene trpS 1946 735 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_16680 2637 2011 gene locus_tag LOCUS_16690 2637 2011 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence367 <1 740 gene locus_tag LOCUS_16700 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266692.1:response regulator 743 1735 gene locus_tag LOCUS_16710 743 1735 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_16710 <3094 1718 gene locus_tag LOCUS_16720 <3094 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZX03:membrane-bound lytic murein transglycosylase F >Feature sequence368 <1 604 gene locus_tag LOCUS_16730 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208017.1:membrane protein >Feature sequence369 117 1010 gene locus_tag LOCUS_16740 117 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1171 1695 gene locus_tag LOCUS_16750 1171 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2087 1728 gene locus_tag LOCUS_16760 2087 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2726 2199 gene locus_tag LOCUS_16770 2726 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence370 54 275 gene locus_tag LOCUS_16780 54 275 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_16780 310 1737 gene locus_tag LOCUS_16790 gene hldE 310 1737 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQV6 protein_id gnl|my_center|LOCUS_16790 1744 2700 gene locus_tag LOCUS_16800 gene hldD 1744 2700 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD21 protein_id gnl|my_center|LOCUS_16800 >Feature sequence371 247 846 gene locus_tag LOCUS_16810 247 846 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence372 2823 448 gene locus_tag LOCUS_16820 gene nuoG 2823 448 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU4 protein_id gnl|my_center|LOCUS_16820 >Feature sequence373 <1 578 gene locus_tag LOCUS_16830 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262323.1:serine protease 633 1706 gene locus_tag LOCUS_16840 633 1706 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_16840 2630 1899 gene locus_tag LOCUS_16850 2630 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence374 507 7 gene locus_tag LOCUS_16860 507 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 784 2331 gene locus_tag LOCUS_16870 gene leuA 784 2331 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_16870 >Feature sequence375 <1 923 gene locus_tag LOCUS_16880 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963848.1:transcriptional regulator 1539 988 gene locus_tag LOCUS_16890 1539 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194523.1 protein_id gnl|my_center|LOCUS_16890 <3049 1716 gene locus_tag LOCUS_16900 <3049 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038259.1:cation transporter >Feature sequence376 255 797 gene locus_tag LOCUS_16910 255 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_16910 800 2317 gene locus_tag LOCUS_16920 800 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2951 2328 gene locus_tag LOCUS_16930 2951 2328 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence377 331 699 gene locus_tag LOCUS_16940 331 699 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_16940 <3046 696 gene locus_tag LOCUS_16950 <3046 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence378 2706 3032 gene locus_tag LOCUS_16960 2706 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence379 1142 186 gene locus_tag LOCUS_16970 1142 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1639 2169 gene locus_tag LOCUS_16980 1639 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence380 111 1250 gene locus_tag LOCUS_16990 111 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2447 1284 gene locus_tag LOCUS_17000 2447 1284 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 protein_id gnl|my_center|LOCUS_17000 <3035 2444 gene locus_tag LOCUS_17010 <3035 2444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8THH7:ribonuclease D >Feature sequence381 264 1718 gene locus_tag LOCUS_17020 264 1718 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_17020 1723 2511 gene locus_tag LOCUS_17030 1723 2511 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence382 961 1362 gene locus_tag LOCUS_17040 gene fliS 961 1362 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_17040 1376 1693 gene locus_tag LOCUS_17050 1376 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1736 2233 gene locus_tag LOCUS_17060 1736 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence383 2428 1265 gene locus_tag LOCUS_17070 2428 1265 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_17070 2911 2435 gene locus_tag LOCUS_17080 2911 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence384 1392 94 gene locus_tag LOCUS_17090 1392 94 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958508.1 protein_id gnl|my_center|LOCUS_17090 1479 1601 gene locus_tag LOCUS_17100 1479 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1745 2131 gene locus_tag LOCUS_17110 gene pilG 1745 2131 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_17110 2176 2535 gene locus_tag LOCUS_17120 2176 2535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence385 524 1045 gene locus_tag LOCUS_17130 gene blc 524 1045 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_17130 1062 2003 gene locus_tag LOCUS_17140 gene desC 1062 2003 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence386 <1 682 gene locus_tag LOCUS_17150 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105555.1:pyruvate carboxylase subunit B 782 1366 gene locus_tag LOCUS_17160 gene yceF 782 1366 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58628 protein_id gnl|my_center|LOCUS_17160 >Feature sequence387 <1 992 gene locus_tag LOCUS_17170 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268569.1:GGDEF domain-containing protein >Feature sequence388 1794 193 gene locus_tag LOCUS_17180 1794 193 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_17180 2173 1802 gene locus_tag LOCUS_17190 2173 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence389 535 1290 gene locus_tag LOCUS_17200 535 1290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_17200 1287 2087 gene locus_tag LOCUS_17210 1287 2087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 protein_id gnl|my_center|LOCUS_17210 2084 2806 gene locus_tag LOCUS_17220 2084 2806 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence390 561 2018 gene locus_tag LOCUS_17230 561 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence391 710 54 gene locus_tag LOCUS_17240 710 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1258 710 gene locus_tag LOCUS_17250 gene SigD 1258 710 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087693.1 protein_id gnl|my_center|LOCUS_17250 2010 1321 gene locus_tag LOCUS_17260 2010 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_17260 2650 2216 gene locus_tag LOCUS_17270 gene gloA 2650 2216 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence392 <1 557 gene locus_tag LOCUS_17280 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528524.1:aminopeptidase 625 1713 gene locus_tag LOCUS_17290 625 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_17290 1982 1722 gene locus_tag LOCUS_17300 1982 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 <2956 2213 gene locus_tag LOCUS_17310 <2956 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein >Feature sequence393 746 84 gene locus_tag LOCUS_17320 746 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence394 2096 198 gene locus_tag LOCUS_17330 gene speA 2096 198 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIP8 protein_id gnl|my_center|LOCUS_17330 >Feature sequence395 809 1375 gene locus_tag LOCUS_17340 809 1375 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 protein_id gnl|my_center|LOCUS_17340 1404 2285 gene locus_tag LOCUS_17350 gene cobD 1404 2285 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHT1 protein_id gnl|my_center|LOCUS_17350 2304 2825 gene locus_tag LOCUS_17360 gene cobP 2304 2825 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_17360 >Feature sequence396 536 165 gene locus_tag LOCUS_17370 536 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 798 550 gene locus_tag LOCUS_17380 798 550 CDS product GIY-YIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255828.1 protein_id gnl|my_center|LOCUS_17380 2073 805 gene locus_tag LOCUS_17390 2073 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2532 2239 gene locus_tag LOCUS_17400 2532 2239 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence397 261 620 gene locus_tag LOCUS_17410 261 620 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119294.1 protein_id gnl|my_center|LOCUS_17410 730 1263 gene locus_tag LOCUS_17420 gene rpoE2 730 1263 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_17420 1330 2115 gene locus_tag LOCUS_17430 1330 2115 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_17430 2822 2136 gene locus_tag LOCUS_17440 2822 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989841.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence398 >Feature sequence399 <1 779 gene locus_tag LOCUS_17450 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P23222:sensor protein FixL 772 1386 gene locus_tag LOCUS_17460 gene nodW 772 1386 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974147.1 protein_id gnl|my_center|LOCUS_17460 1515 2060 gene locus_tag LOCUS_17470 1515 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700968.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence400 293 583 gene locus_tag LOCUS_17480 293 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1074 574 gene locus_tag LOCUS_17490 1074 574 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_17490 1449 1078 gene locus_tag LOCUS_17500 gene sspB 1449 1078 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_17500 2098 1472 gene locus_tag LOCUS_17510 gene sspA 2098 1472 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_17510 <2913 2189 gene locus_tag LOCUS_17520 <2913 2189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479715.1:cytochrome c >Feature sequence401 670 1389 gene locus_tag LOCUS_17530 670 1389 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_17530 1393 2682 gene locus_tag LOCUS_17540 1393 2682 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence402 1072 86 gene locus_tag LOCUS_17550 1072 86 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 protein_id gnl|my_center|LOCUS_17550 1178 1735 gene locus_tag LOCUS_17560 1178 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence403 35 1324 gene locus_tag LOCUS_17570 gene hmp 35 1324 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49852 protein_id gnl|my_center|LOCUS_17570 1397 1879 gene locus_tag LOCUS_17580 1397 1879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_17580 2536 1949 gene locus_tag LOCUS_17590 2536 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence404 364 999 gene locus_tag LOCUS_17600 364 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2568 1039 gene locus_tag LOCUS_17610 2568 1039 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence405 >Feature sequence406 1913 414 gene locus_tag LOCUS_17620 1913 414 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_17620 <2866 1900 gene locus_tag LOCUS_17630 <2866 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390852.1:PEP-CTERM-box response regulator transcription factor >Feature sequence407 >Feature sequence408 950 321 gene locus_tag LOCUS_17640 950 321 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_17640 <2856 1029 gene locus_tag LOCUS_17650 <2856 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073766.1:methyl-accepting chemotaxis protein >Feature sequence409 93 857 gene locus_tag LOCUS_17660 93 857 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44029 protein_id gnl|my_center|LOCUS_17660 1888 854 gene locus_tag LOCUS_17670 1888 854 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence410 1002 169 gene locus_tag LOCUS_17680 1002 169 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVB2 protein_id gnl|my_center|LOCUS_17680 2691 1030 gene locus_tag LOCUS_17690 gene mphR 2691 1030 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence411 <1 832 gene locus_tag LOCUS_17700 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63R35:phospho-2-dehydro-3-deoxyheptonate aldolase 1683 829 gene locus_tag LOCUS_17710 1683 829 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence412 480 1712 gene locus_tag LOCUS_17720 gene lysC 480 1712 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_17720 1824 2009 gene locus_tag LOCUS_17730 gene csrA 1824 2009 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57484 protein_id gnl|my_center|LOCUS_17730 2456 2548 gene locus_tag LOCUS_t00140 2456 2548 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence413 >Feature sequence414 304 119 gene locus_tag LOCUS_17740 304 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 753 1031 gene locus_tag LOCUS_17750 753 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1054 1356 gene locus_tag LOCUS_17760 1054 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1357 2631 gene locus_tag LOCUS_17770 gene acd 1357 2631 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227551.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence415 572 2200 gene locus_tag LOCUS_17780 gene vasJ 572 2200 CDS product type VI secretion system protein VasJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096439.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence416 <1 2613 gene locus_tag LOCUS_17790 <1 2613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211927.1:ClpV1 family T6SS ATPase >Feature sequence417 1019 435 gene locus_tag LOCUS_17800 1019 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_17800 1681 1022 gene locus_tag LOCUS_17810 gene pcm 1681 1022 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_17810 2429 1665 gene locus_tag LOCUS_17820 gene surE 2429 1665 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KI21 protein_id gnl|my_center|LOCUS_17820 >Feature sequence418 1497 754 gene locus_tag LOCUS_17830 1497 754 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259141.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence419 1019 495 gene locus_tag LOCUS_17840 1019 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1855 1055 gene locus_tag LOCUS_17850 1855 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence420 1906 752 gene locus_tag LOCUS_17860 gene hypD 1906 752 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_17860 2607 1903 gene locus_tag LOCUS_17870 gene gmhA 2607 1903 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence421 1969 305 gene locus_tag LOCUS_17880 1969 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_17880 2727 2257 gene locus_tag LOCUS_17890 2727 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence422 <1 1113 gene locus_tag LOCUS_17900 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529845.1:fatty acid biosynthesis-related CoA ligase 1183 1443 gene locus_tag LOCUS_17910 1183 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1440 2597 gene locus_tag LOCUS_17920 1440 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence423 253 65 gene locus_tag LOCUS_17930 253 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1548 250 gene locus_tag LOCUS_17940 1548 250 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707831.1 protein_id gnl|my_center|LOCUS_17940 <2761 1549 gene locus_tag LOCUS_17950 <2761 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058017.1:prenyltransferase >Feature sequence424 817 1890 gene locus_tag LOCUS_17960 817 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence425 974 354 gene locus_tag LOCUS_17970 974 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1305 985 gene locus_tag LOCUS_17980 1305 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1997 1473 gene locus_tag LOCUS_17990 gene hmuZ 1997 1473 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 protein_id gnl|my_center|LOCUS_17990 2414 2013 gene locus_tag LOCUS_18000 2414 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence426 138 1514 gene locus_tag LOCUS_18010 138 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1648 2481 gene locus_tag LOCUS_18020 gene rpoH 1648 2481 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E201 protein_id gnl|my_center|LOCUS_18020 >Feature sequence427 56 253 gene locus_tag LOCUS_18030 56 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 250 474 gene locus_tag LOCUS_18040 250 474 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_18040 569 1024 gene locus_tag LOCUS_18050 569 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1125 1337 gene locus_tag LOCUS_18060 1125 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1436 1780 gene locus_tag LOCUS_18070 1436 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2010 2291 gene locus_tag LOCUS_18080 2010 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence428 382 930 gene locus_tag LOCUS_18090 gene ppa 382 930 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8Y6 protein_id gnl|my_center|LOCUS_18090 934 1491 gene locus_tag LOCUS_18100 934 1491 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY72 protein_id gnl|my_center|LOCUS_18100 1952 1512 gene locus_tag LOCUS_18110 1952 1512 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_18110 2188 1955 gene locus_tag LOCUS_18120 gene moaD 2188 1955 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTX2 protein_id gnl|my_center|LOCUS_18120 >Feature sequence429 <1 1644 gene locus_tag LOCUS_18130 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037530.1:gamma-glutamyltranspeptidase 2469 1654 gene locus_tag LOCUS_18140 gene mutM 2469 1654 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVC5 protein_id gnl|my_center|LOCUS_18140 >Feature sequence430 85 279 gene locus_tag LOCUS_18150 85 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 304 1005 gene locus_tag LOCUS_18160 gene hupC 304 1005 CDS product putative Ni/Fe-hydrogenase B-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21960 protein_id gnl|my_center|LOCUS_18160 1184 1546 gene locus_tag LOCUS_18170 1184 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1559 2212 gene locus_tag LOCUS_18180 1559 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence431 1115 246 gene locus_tag LOCUS_18190 gene tatC 1115 246 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVQ3 protein_id gnl|my_center|LOCUS_18190 1560 1084 gene locus_tag LOCUS_18200 1560 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1841 1593 gene locus_tag LOCUS_18210 gene tatA 1841 1593 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_18210 2489 2169 gene locus_tag LOCUS_18220 gene hisE 2489 2169 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_18220 >Feature sequence432 2658 457 gene locus_tag LOCUS_18230 2658 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence433 1001 1957 gene locus_tag LOCUS_18240 1001 1957 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_18240 1974 2372 gene locus_tag LOCUS_18250 1974 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence434 1041 1652 gene locus_tag LOCUS_18260 1041 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1656 2213 gene locus_tag LOCUS_18270 1656 2213 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence435 746 252 gene locus_tag LOCUS_18280 gene tadA 746 252 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM18 protein_id gnl|my_center|LOCUS_18280 1240 1584 gene locus_tag LOCUS_18290 1240 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1590 1880 gene locus_tag LOCUS_18300 1590 1880 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_18300 1877 2203 gene locus_tag LOCUS_18310 1877 2203 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence436 351 1448 gene locus_tag LOCUS_18320 351 1448 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_18320 1449 2456 gene locus_tag LOCUS_18330 1449 2456 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence437 <1 734 gene locus_tag LOCUS_18340 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105056.1:heterokaryon incompatibility induction protein PhcA 859 1686 gene locus_tag LOCUS_18350 859 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1721 2605 gene locus_tag LOCUS_18360 1721 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence438 112 456 gene locus_tag LOCUS_18370 112 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1230 517 gene locus_tag LOCUS_18380 gene yoxB 1230 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28671 protein_id gnl|my_center|LOCUS_18380 1322 2296 gene locus_tag LOCUS_18390 gene cphA1 1322 2296 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence439 1209 1610 gene locus_tag LOCUS_18400 1209 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1858 1649 gene locus_tag LOCUS_18410 1858 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence440 >Feature sequence441 1439 657 gene locus_tag LOCUS_18420 1439 657 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 protein_id gnl|my_center|LOCUS_18420 1776 2231 gene locus_tag LOCUS_18430 1776 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence442 >Feature sequence443 >Feature sequence444 >Feature sequence445 <2612 924 gene locus_tag LOCUS_18440 <2612 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:multidrug transporter AcrB >Feature sequence446 997 515 gene locus_tag LOCUS_18450 997 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1102 1314 gene locus_tag LOCUS_18460 1102 1314 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_18460 1772 1362 gene locus_tag LOCUS_18470 1772 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1960 2529 gene locus_tag LOCUS_18480 1960 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence447 148 1197 gene locus_tag LOCUS_18490 148 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176622.1 protein_id gnl|my_center|LOCUS_18490 1220 2428 gene locus_tag LOCUS_18500 1220 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence448 920 297 gene locus_tag LOCUS_18510 920 297 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_18510 1193 930 gene locus_tag LOCUS_18520 1193 930 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124711.1 protein_id gnl|my_center|LOCUS_18520 1684 1208 gene locus_tag LOCUS_18530 gene bfr 1684 1208 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN4 protein_id gnl|my_center|LOCUS_18530 2033 1719 gene locus_tag LOCUS_18540 gene ccmK 2033 1719 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A328 protein_id gnl|my_center|LOCUS_18540 2388 2074 gene locus_tag LOCUS_18550 gene ccmK 2388 2074 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A328 protein_id gnl|my_center|LOCUS_18550 >Feature sequence449 2219 750 gene locus_tag LOCUS_18560 2219 750 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence450 731 141 gene locus_tag LOCUS_18570 731 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1797 781 gene locus_tag LOCUS_18580 gene ilvC 1797 781 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_18580 2334 1831 gene locus_tag LOCUS_18590 gene ilvH 2334 1831 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence451 <1 608 gene locus_tag LOCUS_18600 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMK9:3-deoxy-manno-octulosonate cytidylyltransferase 907 605 gene locus_tag LOCUS_18610 907 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 944 1429 gene locus_tag LOCUS_18620 gene ptpA 944 1429 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_18620 1817 1419 gene locus_tag LOCUS_18630 1817 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence452 873 595 gene locus_tag LOCUS_18640 873 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1050 1892 gene locus_tag LOCUS_18650 gene ybbO 1050 1892 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence453 660 346 gene locus_tag LOCUS_18660 660 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1471 782 gene locus_tag LOCUS_18670 gene pyrF 1471 782 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_18670 <2597 1471 gene locus_tag LOCUS_18680 <2597 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83E07:lipopolysaccharide assembly protein B >Feature sequence454 1216 620 gene locus_tag LOCUS_18690 1216 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 <2595 1218 gene locus_tag LOCUS_18700 <2595 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YI49:flagellar M-ring protein >Feature sequence455 <1 2173 gene locus_tag LOCUS_18710 <1 2173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114668.1:cation-transporting P-type ATPase 2173 2352 gene locus_tag LOCUS_18720 2173 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence456 <2590 787 gene locus_tag LOCUS_18730 <2590 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC56:DNA-directed RNA polymerase subunit beta >Feature sequence457 <2589 1692 gene locus_tag LOCUS_18740 <2589 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979851.1:sulfurtransferase >Feature sequence458 <1 726 gene locus_tag LOCUS_18750 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVL9:glutamate 5-kinase 723 1592 gene locus_tag LOCUS_18760 723 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2195 1578 gene locus_tag LOCUS_18770 2195 1578 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence459 1264 923 gene locus_tag LOCUS_18780 gene erpA 1264 923 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBH1 protein_id gnl|my_center|LOCUS_18780 1781 1365 gene locus_tag LOCUS_18790 1781 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2497 1796 gene locus_tag LOCUS_18800 2497 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence460 165 1106 gene locus_tag LOCUS_18810 165 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence461 854 486 gene locus_tag LOCUS_18820 gene soxX 854 486 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932695.1 protein_id gnl|my_center|LOCUS_18820 2451 1030 gene locus_tag LOCUS_18830 2451 1030 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_18830 >Feature sequence462 1 345 gene locus_tag LOCUS_18840 1 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1021 350 gene locus_tag LOCUS_18850 1021 350 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_18850 1169 1669 gene locus_tag LOCUS_18860 1169 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence463 >Feature sequence464 121 1422 gene locus_tag LOCUS_18870 121 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 1614 1808 gene locus_tag LOCUS_18880 1614 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence465 71 640 gene locus_tag LOCUS_18890 gene wzb 71 640 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482887.1 protein_id gnl|my_center|LOCUS_18890 1820 630 gene locus_tag LOCUS_18900 1820 630 CDS product ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_18900 <2553 1817 gene locus_tag LOCUS_18910 <2553 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94361:putative polysaccharide deacetylase YxkH >Feature sequence466 >Feature sequence467 <1 2029 gene locus_tag LOCUS_18920 <1 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWS0:outer membrane protein assembly factor BamA >Feature sequence468 503 162 gene locus_tag LOCUS_18930 503 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 888 601 gene locus_tag LOCUS_18940 888 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1557 919 gene locus_tag LOCUS_18950 1557 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2020 1631 gene locus_tag LOCUS_18960 2020 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072486.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence469 >Feature sequence470 43 630 gene locus_tag LOCUS_18970 43 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 644 1156 gene locus_tag LOCUS_18980 644 1156 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497611.1 protein_id gnl|my_center|LOCUS_18980 1181 1933 gene locus_tag LOCUS_18990 1181 1933 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_18990 1983 2285 gene locus_tag LOCUS_19000 1983 2285 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence471 577 1344 gene locus_tag LOCUS_19010 gene map 577 1344 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_19010 >Feature sequence472 1346 555 gene locus_tag LOCUS_19020 1346 555 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_19020 2136 1351 gene locus_tag LOCUS_19030 2136 1351 CDS product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_19030 2507 2220 gene locus_tag LOCUS_19040 2507 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence473 1087 794 gene locus_tag LOCUS_19050 1087 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1617 1192 gene locus_tag LOCUS_19060 1617 1192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905438.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence474 870 100 gene locus_tag LOCUS_19070 870 100 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TX2 protein_id gnl|my_center|LOCUS_19070 1787 867 gene locus_tag LOCUS_19080 gene nodI 1787 867 CDS product Nod factor export ATP-binding protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P412 protein_id gnl|my_center|LOCUS_19080 2421 1792 gene locus_tag LOCUS_19090 2421 1792 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence475 2019 1504 gene locus_tag LOCUS_19100 gene rppH 2019 1504 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPE1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence476 218 1330 gene locus_tag LOCUS_19110 gene purK 218 1330 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL98 protein_id gnl|my_center|LOCUS_19110 1802 1386 gene locus_tag LOCUS_19120 1802 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2129 1881 gene locus_tag LOCUS_19130 2129 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2403 2122 gene locus_tag LOCUS_19140 2403 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence477 >Feature sequence478 <1 770 gene locus_tag LOCUS_19150 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958293.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence479 171 1178 gene locus_tag LOCUS_19160 171 1178 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_19160 1178 1948 gene locus_tag LOCUS_19170 1178 1948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_19170 2484 1945 gene locus_tag LOCUS_19180 2484 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence480 791 120 gene locus_tag LOCUS_19190 gene yccA 791 120 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_19190 1190 819 gene locus_tag LOCUS_19200 1190 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1310 2203 gene locus_tag LOCUS_19210 1310 2203 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence481 165 584 gene locus_tag LOCUS_19220 165 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_19220 616 2250 gene locus_tag LOCUS_19230 616 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence482 2468 2271 gene locus_tag LOCUS_19240 2468 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence483 236 829 gene locus_tag LOCUS_19250 236 829 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_19250 906 1370 gene locus_tag LOCUS_19260 906 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1851 1492 gene locus_tag LOCUS_19270 1851 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2437 1892 gene locus_tag LOCUS_19280 2437 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence484 <1 1326 gene locus_tag LOCUS_19290 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113940.1:aminopeptidase N 2241 1489 gene locus_tag LOCUS_19300 2241 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence485 1351 407 gene locus_tag LOCUS_19310 gene oppB 1351 407 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_19310 <2455 1356 gene locus_tag LOCUS_19320 <2455 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706430.1:peptide ABC transporter substrate-binding protein >Feature sequence486 416 796 gene locus_tag LOCUS_19330 416 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_19330 1110 1664 gene locus_tag LOCUS_19340 1110 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1820 2077 gene locus_tag LOCUS_19350 1820 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence487 1502 69 gene locus_tag LOCUS_19360 gene cysS 1502 69 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXE6 protein_id gnl|my_center|LOCUS_19360 1583 2212 gene locus_tag LOCUS_19370 gene ppiB-1 1583 2212 CDS product peptidyl-prolyl cis-trans isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_009508.2 protein_id gnl|my_center|LOCUS_19370 >Feature sequence488 669 346 gene locus_tag LOCUS_19380 gene rplX 669 346 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF32 protein_id gnl|my_center|LOCUS_19380 1052 684 gene locus_tag LOCUS_19390 gene rplN 1052 684 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF31 protein_id gnl|my_center|LOCUS_19390 1354 1085 gene locus_tag LOCUS_19400 gene rpsQ 1354 1085 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_19400 1548 1351 gene locus_tag LOCUS_19410 gene rpmC 1548 1351 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_19410 1961 1548 gene locus_tag LOCUS_19420 gene rplP 1961 1548 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence489 >Feature sequence490 <1 611 gene locus_tag LOCUS_19430 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093316.1:riboflavin synthase subunit alpha 670 1788 gene locus_tag LOCUS_19440 gene ribB 670 1788 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU3 protein_id gnl|my_center|LOCUS_19440 1809 2282 gene locus_tag LOCUS_19450 gene ribH1 1809 2282 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q6 protein_id gnl|my_center|LOCUS_19450 >Feature sequence491 822 148 gene locus_tag LOCUS_19460 gene modB 822 148 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_19460 1210 824 gene locus_tag LOCUS_19470 1210 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1526 1254 gene locus_tag LOCUS_19480 1526 1254 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_19480 2296 1544 gene locus_tag LOCUS_19490 2296 1544 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence492 <1 1277 gene locus_tag LOCUS_19500 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096848.1:acetyl-CoA carboxylase subunit alpha >Feature sequence493 <1 888 gene locus_tag LOCUS_19510 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230639.1:sulfonate ABC transporter substrate-binding protein >Feature sequence494 706 1017 gene locus_tag LOCUS_19520 706 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1317 1829 gene locus_tag LOCUS_19530 1317 1829 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390150.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence495 2130 622 gene locus_tag LOCUS_19540 2130 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence496 312 1367 gene locus_tag LOCUS_19550 gene ruvB 312 1367 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44631 protein_id gnl|my_center|LOCUS_19550 1625 2299 gene locus_tag LOCUS_19560 gene tolQ 1625 2299 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence497 210 974 gene locus_tag LOCUS_19570 gene fliR 210 974 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35537 protein_id gnl|my_center|LOCUS_19570 981 2066 gene locus_tag LOCUS_19580 gene flhB 981 2066 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35538 protein_id gnl|my_center|LOCUS_19580 >Feature sequence498 1026 601 gene locus_tag LOCUS_19590 1026 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1222 2352 gene locus_tag LOCUS_19600 1222 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence499 228 1550 gene locus_tag LOCUS_19610 gene hflX 228 1550 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence500 <2380 794 gene locus_tag LOCUS_19620 <2380 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942623.1:exosortase A >Feature sequence501 <1 1272 gene locus_tag LOCUS_19630 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000514626.1:thiol oxidoreductase >Feature sequence502 <1 2014 gene locus_tag LOCUS_19640 <1 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204849.1:oxidoreductase >Feature sequence503 182 646 gene locus_tag LOCUS_19650 182 646 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970650.1 protein_id gnl|my_center|LOCUS_19650 684 1202 gene locus_tag LOCUS_19660 684 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103756.1 protein_id gnl|my_center|LOCUS_19660 1248 1886 gene locus_tag LOCUS_19670 1248 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1954 2364 gene locus_tag LOCUS_19680 1954 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence504 >Feature sequence505 363 1307 gene locus_tag LOCUS_19690 363 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence506 63 515 gene locus_tag LOCUS_19700 63 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 542 1054 gene locus_tag LOCUS_19710 542 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence507 <1 624 gene locus_tag LOCUS_19720 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481069.1:flagellar biosynthesis protein FlhA 654 1946 gene locus_tag LOCUS_19730 gene flhF 654 1946 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766980.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence508 >Feature sequence509 >Feature sequence510 >Feature sequence511 492 2144 gene locus_tag LOCUS_19740 492 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence512 >Feature sequence513 134 1852 gene locus_tag LOCUS_19750 gene pilB 134 1852 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_19750 >Feature sequence514 396 545 gene locus_tag LOCUS_19760 396 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 592 786 gene locus_tag LOCUS_19770 592 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1478 807 gene locus_tag LOCUS_19780 1478 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence515 392 1243 gene locus_tag LOCUS_19790 392 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 <2304 1305 gene locus_tag LOCUS_19800 <2304 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266362.1:methyl-accepting chemotaxis protein >Feature sequence516 1340 108 gene locus_tag LOCUS_19810 gene nhaP 1340 108 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_19810 <2296 1488 gene locus_tag LOCUS_19820 <2296 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000983782.1:2-octaprenyl-6-methoxyphenol hydroxylase >Feature sequence517 <1 782 gene locus_tag LOCUS_19830 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267347.1:non-ribosomal peptide synthetase >Feature sequence518 383 838 gene locus_tag LOCUS_19840 gene zur 383 838 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971685.1 protein_id gnl|my_center|LOCUS_19840 1412 849 gene locus_tag LOCUS_19850 1412 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707301.1 protein_id gnl|my_center|LOCUS_19850 1481 2161 gene locus_tag LOCUS_19860 1481 2161 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence519 2277 313 gene locus_tag LOCUS_19870 2277 313 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268433.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence520 398 994 gene locus_tag LOCUS_19880 398 994 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_19880 >Feature sequence521 <1 921 gene locus_tag LOCUS_19890 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZXX2:ribose-phosphate pyrophosphokinase 1096 1740 gene locus_tag LOCUS_19900 gene rplY 1096 1740 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_19900 >Feature sequence522 <2275 1098 gene locus_tag LOCUS_19910 <2275 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390842.1:O-antigen polymerase >Feature sequence523 984 262 gene locus_tag LOCUS_19920 984 262 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_19920 1426 998 gene locus_tag LOCUS_19930 gene rnhA 1426 998 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVL1 protein_id gnl|my_center|LOCUS_19930 2230 1427 gene locus_tag LOCUS_19940 2230 1427 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence524 >Feature sequence525 559 1944 gene locus_tag LOCUS_19950 559 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1941 2243 gene locus_tag LOCUS_19960 1941 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence526 512 318 gene locus_tag LOCUS_19970 512 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 488 868 gene locus_tag LOCUS_19980 gene panD 488 868 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_19980 920 1004 gene locus_tag LOCUS_t00150 920 1004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <2247 1007 gene locus_tag LOCUS_19990 <2247 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDQ7:glucose-6-phosphate isomerase >Feature sequence527 >Feature sequence528 521 1192 gene locus_tag LOCUS_20000 gene spoU 521 1192 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE14 protein_id gnl|my_center|LOCUS_20000 2203 1178 gene locus_tag LOCUS_20010 gene pdxB 2203 1178 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVH7 protein_id gnl|my_center|LOCUS_20010 >Feature sequence529 347 562 gene locus_tag LOCUS_20020 347 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 788 1777 gene locus_tag LOCUS_20030 788 1777 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071718.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence530 1357 272 gene locus_tag LOCUS_20040 gene mutY 1357 272 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_20040 1874 1317 gene locus_tag LOCUS_20050 1874 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence531 252 1046 gene locus_tag LOCUS_20060 252 1046 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence532 <1 676 gene locus_tag LOCUS_20070 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256670.1:membrane protein 849 1613 gene locus_tag LOCUS_20080 gene dheII 849 1613 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_20080 1763 2143 gene locus_tag LOCUS_20090 1763 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence533 >Feature sequence534 281 1249 gene locus_tag LOCUS_20100 281 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1279 1950 gene locus_tag LOCUS_20110 gene ftsE 1279 1950 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence535 1542 658 gene locus_tag LOCUS_20120 1542 658 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_20120 <2223 1557 gene locus_tag LOCUS_20130 <2223 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140342.1:tetracenomycin C synthesis protein >Feature sequence536 3 380 gene locus_tag LOCUS_20140 3 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 563 1030 gene locus_tag LOCUS_20150 563 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1334 1879 gene locus_tag LOCUS_20160 1334 1879 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105296.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence537 2073 1000 gene locus_tag LOCUS_20170 2073 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence538 721 254 gene locus_tag LOCUS_20180 721 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1450 770 gene locus_tag LOCUS_20190 1450 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1969 1586 gene locus_tag LOCUS_20200 1969 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence539 1263 103 gene locus_tag LOCUS_20210 1263 103 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P7 protein_id gnl|my_center|LOCUS_20210 2035 1253 gene locus_tag LOCUS_20220 2035 1253 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence540 695 240 gene locus_tag LOCUS_20230 695 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 <2193 789 gene locus_tag LOCUS_20240 <2193 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQY9:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence541 <1 1270 gene locus_tag LOCUS_20250 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224765.1:ATPase >Feature sequence542 <1 2050 gene locus_tag LOCUS_20260 <1 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895708.1:ribonucleoside-diphosphate reductase >Feature sequence543 <1 741 gene locus_tag LOCUS_20270 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVZ9:UDP-N-acetylmuramoylalanine--D-glutamate ligase 738 1916 gene locus_tag LOCUS_20280 gene ftsW 738 1916 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_20280 >Feature sequence544 1272 541 gene locus_tag LOCUS_20290 1272 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1422 2021 gene locus_tag LOCUS_20300 1422 2021 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence545 96 1673 gene locus_tag LOCUS_20310 gene deaD-1 96 1673 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_20310 >Feature sequence546 664 14 gene locus_tag LOCUS_20320 664 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 867 1028 gene locus_tag LOCUS_20330 867 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1013 2149 gene locus_tag LOCUS_20340 1013 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence547 >Feature sequence548 2 1501 gene locus_tag LOCUS_20350 gene pyrG 2 1501 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_20350 >Feature sequence549 869 282 gene locus_tag LOCUS_20360 869 282 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090825.1 protein_id gnl|my_center|LOCUS_20360 958 1380 gene locus_tag LOCUS_20370 958 1380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence550 <1 529 gene locus_tag LOCUS_20380 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038182.1:TonB-dependent vitamin B12 receptor 544 1125 gene locus_tag LOCUS_20390 544 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638412.2 protein_id gnl|my_center|LOCUS_20390 1137 1739 gene locus_tag LOCUS_20400 gene cobO 1137 1739 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_20400 >Feature sequence551 943 56 gene locus_tag LOCUS_20410 943 56 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_20410 1906 965 gene locus_tag LOCUS_20420 1906 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence552 >Feature sequence553 1 351 gene locus_tag LOCUS_20430 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 365 733 gene locus_tag LOCUS_20440 365 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1942 725 gene locus_tag LOCUS_20450 1942 725 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632948.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence554 1394 474 gene locus_tag LOCUS_20460 gene metR 1394 474 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence555 1996 323 gene locus_tag LOCUS_20470 gene recN 1996 323 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI9 protein_id gnl|my_center|LOCUS_20470 >Feature sequence556 982 1206 gene locus_tag LOCUS_20480 982 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1264 1677 gene locus_tag LOCUS_20490 1264 1677 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence557 428 1513 gene locus_tag LOCUS_20500 428 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence558 >Feature sequence559 149 1615 gene locus_tag LOCUS_20510 149 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence560 1956 100 gene locus_tag LOCUS_20520 1956 100 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence561 477 1763 gene locus_tag LOCUS_20530 gene hisS 477 1763 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_20530 >Feature sequence562 472 840 gene locus_tag LOCUS_20540 472 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 911 2056 gene locus_tag LOCUS_20550 911 2056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence563 >Feature sequence564 <1 655 gene locus_tag LOCUS_20560 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AD3:pyruvate dehydrogenase E1 component subunit alpha 676 1656 gene locus_tag LOCUS_20570 676 1656 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_20570 1764 2006 gene locus_tag LOCUS_20580 1764 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence565 3 320 gene locus_tag LOCUS_20590 3 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 301 1032 gene locus_tag LOCUS_20600 301 1032 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_20600 1534 1016 gene locus_tag LOCUS_20610 1534 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence566 <1 608 gene locus_tag LOCUS_20620 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P06722:DNA mismatch repair protein MutH 2062 605 gene locus_tag LOCUS_20630 gene glsF 2062 605 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence567 <1 1006 gene locus_tag LOCUS_20640 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100959.1:twitching motility protein PilU 1890 1012 gene locus_tag LOCUS_20650 gene pyrK 1890 1012 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL9 protein_id gnl|my_center|LOCUS_20650 >Feature sequence568 164 1030 gene locus_tag LOCUS_20660 164 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_20660 1030 1653 gene locus_tag LOCUS_20670 gene gmk 1030 1653 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329K8 protein_id gnl|my_center|LOCUS_20670 1748 2098 gene locus_tag LOCUS_20680 1748 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence569 <1 603 gene locus_tag LOCUS_20690 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P78283:protein translocase subunit SecY 904 1260 gene locus_tag LOCUS_20700 gene rpsM 904 1260 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_20700 1278 1667 gene locus_tag LOCUS_20710 gene rpsK 1278 1667 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF43 protein_id gnl|my_center|LOCUS_20710 >Feature sequence570 1768 86 gene locus_tag LOCUS_20720 gene ilvD 1768 86 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_20720 >Feature sequence571 <1 901 gene locus_tag LOCUS_20730 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112717.1:transporter ExbB 918 1322 gene locus_tag LOCUS_20740 gene exbD2 918 1322 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_20740 1360 2004 gene locus_tag LOCUS_20750 1360 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence572 813 478 gene locus_tag LOCUS_20760 813 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 866 1318 gene locus_tag LOCUS_20770 gene fxsA 866 1318 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_20770 1660 1950 gene locus_tag LOCUS_20780 gene groS 1660 1950 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_20780 >Feature sequence573 818 69 gene locus_tag LOCUS_20790 818 69 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_20790 1267 818 gene locus_tag LOCUS_20800 1267 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 <2094 1326 gene locus_tag LOCUS_20810 <2094 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933900.1:glutamate synthase >Feature sequence574 411 196 gene locus_tag LOCUS_20820 411 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20820 1713 586 gene locus_tag LOCUS_20830 1713 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence575 67 372 gene locus_tag LOCUS_20840 67 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 484 1848 gene locus_tag LOCUS_20850 gene xseA 484 1848 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX12 protein_id gnl|my_center|LOCUS_20850 >Feature sequence576 666 31 gene locus_tag LOCUS_20860 gene nadD 666 31 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN74 protein_id gnl|my_center|LOCUS_20860 1957 686 gene locus_tag LOCUS_20870 gene proA 1957 686 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_20870 >Feature sequence577 2085 157 gene locus_tag LOCUS_20880 2085 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence578 1201 725 gene locus_tag LOCUS_20890 1201 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence579 443 1120 gene locus_tag LOCUS_20900 443 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1299 1865 gene locus_tag LOCUS_20910 1299 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence580 549 1805 gene locus_tag LOCUS_20920 gene glyA 549 1805 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A825 protein_id gnl|my_center|LOCUS_20920 >Feature sequence581 1830 1021 gene locus_tag LOCUS_20930 1830 1021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence582 >Feature sequence583 <2071 415 gene locus_tag LOCUS_20940 <2071 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039372.1:ferrisiderophore receptor >Feature sequence584 785 1387 gene locus_tag LOCUS_20950 785 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence585 743 186 gene locus_tag LOCUS_20960 743 186 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_20960 1364 750 gene locus_tag LOCUS_20970 1364 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence586 991 110 gene locus_tag LOCUS_20980 991 110 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_20980 1084 1650 gene locus_tag LOCUS_20990 1084 1650 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence587 1077 286 gene locus_tag LOCUS_21000 gene rluB 1077 286 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7D5 protein_id gnl|my_center|LOCUS_21000 1837 1115 gene locus_tag LOCUS_21010 gene scpB 1837 1115 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP9 protein_id gnl|my_center|LOCUS_21010 >Feature sequence588 428 1453 gene locus_tag LOCUS_21020 428 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence589 250 1563 gene locus_tag LOCUS_21030 250 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1875 1564 gene locus_tag LOCUS_21040 1875 1564 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence590 872 234 gene locus_tag LOCUS_21050 872 234 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_21050 1492 917 gene locus_tag LOCUS_21060 gene gacA 1492 917 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51373 protein_id gnl|my_center|LOCUS_21060 1785 1698 gene locus_tag LOCUS_t00160 1785 1698 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence591 >Feature sequence592 1190 276 gene locus_tag LOCUS_21070 1190 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence593 1298 882 gene locus_tag LOCUS_21080 1298 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1968 1363 gene locus_tag LOCUS_21090 1968 1363 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence594 >Feature sequence595 <1 1819 gene locus_tag LOCUS_21100 <1 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071046.1:TonB-dependent receptor 2032 1871 gene locus_tag LOCUS_21110 2032 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence596 <2031 145 gene locus_tag LOCUS_21120 <2031 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0AES6:DNA gyrase subunit B >Feature sequence597 289 20 gene locus_tag LOCUS_21130 289 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1253 282 gene locus_tag LOCUS_21140 gene rluD 1253 282 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI4 protein_id gnl|my_center|LOCUS_21140 >Feature sequence598 636 397 gene locus_tag LOCUS_21150 636 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 732 1142 gene locus_tag LOCUS_21160 732 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1747 1112 gene locus_tag LOCUS_21170 1747 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence599 1187 576 gene locus_tag LOCUS_21180 1187 576 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266400.1 protein_id gnl|my_center|LOCUS_21180 1471 1196 gene locus_tag LOCUS_21190 gene acpC 1471 1196 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639351.2 protein_id gnl|my_center|LOCUS_21190 >Feature sequence600 >Feature sequence601 >Feature sequence602 1360 1941 gene locus_tag LOCUS_21200 1360 1941 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119975.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence603 639 729 gene locus_tag LOCUS_t00170 639 729 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 964 1497 gene locus_tag LOCUS_21210 964 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1552 2004 gene locus_tag LOCUS_21220 1552 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence604 >Feature sequence605 <1 1606 gene locus_tag LOCUS_21230 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c551 peroxidase >Feature sequence606 168 989 gene locus_tag LOCUS_21240 gene folE2 168 989 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_21240 1423 1025 gene locus_tag LOCUS_21250 1423 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1928 1437 gene locus_tag LOCUS_21260 gene pgpA 1928 1437 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_21260 >Feature sequence607 914 486 gene locus_tag LOCUS_21270 914 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1970 1032 gene locus_tag LOCUS_21280 1970 1032 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence608 361 1557 gene locus_tag LOCUS_21290 gene bamB 361 1557 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQB5 protein_id gnl|my_center|LOCUS_21290 >Feature sequence609 >Feature sequence610 >Feature sequence611 <1975 91 gene locus_tag LOCUS_21300 <1975 91 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096603.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence612 <1 834 gene locus_tag LOCUS_21310 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZZF8:2-methylisocitrate lyase >Feature sequence613 <1 933 gene locus_tag LOCUS_21320 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P19572:diaminopimelate decarboxylase 991 1821 gene locus_tag LOCUS_21330 gene dapF 991 1821 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H5 protein_id gnl|my_center|LOCUS_21330 >Feature sequence614 836 600 gene locus_tag LOCUS_21340 836 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1464 853 gene locus_tag LOCUS_21350 1464 853 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence615 445 86 gene locus_tag LOCUS_21360 445 86 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 protein_id gnl|my_center|LOCUS_21360 <1942 464 gene locus_tag LOCUS_21370 <1942 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103096.1:penicillin-binding protein activator >Feature sequence616 <1 577 gene locus_tag LOCUS_21380 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGX4:urease subunit alpha 579 1040 gene locus_tag LOCUS_21390 gene ureE 579 1040 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E729 protein_id gnl|my_center|LOCUS_21390 1009 1707 gene locus_tag LOCUS_21400 gene ureF 1009 1707 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_21400 >Feature sequence617 1591 1848 gene locus_tag LOCUS_21410 1591 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence618 769 545 gene locus_tag LOCUS_21420 769 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 1620 766 gene locus_tag LOCUS_21430 gene hupH 1620 766 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence619 <1921 299 gene locus_tag LOCUS_21440 <1921 299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146597.1:alpha-glucan phosphorylase >Feature sequence620 921 271 gene locus_tag LOCUS_21450 gene adk 921 271 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence621 <1 565 gene locus_tag LOCUS_21460 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039034.1:nucleotide sugar dehydrogenase 596 1603 gene locus_tag LOCUS_21470 596 1603 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence622 1107 16 gene locus_tag LOCUS_21480 1107 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1875 1402 gene locus_tag LOCUS_21490 1875 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21490 >Feature sequence623 455 530 gene locus_tag LOCUS_t00180 455 530 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1632 751 gene locus_tag LOCUS_21500 gene galU 1632 751 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G7 protein_id gnl|my_center|LOCUS_21500 >Feature sequence624 1277 279 gene locus_tag LOCUS_21510 gene gapA 1277 279 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 protein_id gnl|my_center|LOCUS_21510 <1892 1323 gene locus_tag LOCUS_21520 <1892 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KLW7:transketolase 2 >Feature sequence625 <1 850 gene locus_tag LOCUS_21530 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34753:putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase >Feature sequence626 471 396 gene locus_tag LOCUS_t00190 471 396 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 952 527 gene locus_tag LOCUS_21540 952 527 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_21540 <1879 1006 gene locus_tag LOCUS_21550 <1879 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266588.1:glycine oxidase ThiO >Feature sequence627 >Feature sequence628 919 434 gene locus_tag LOCUS_21560 919 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 <1868 983 gene locus_tag LOCUS_21570 <1868 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3K7:GTP 3',8-cyclase 2 >Feature sequence629 1693 929 gene locus_tag LOCUS_21580 1693 929 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030538.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence630 >Feature sequence631 983 291 gene locus_tag LOCUS_21590 983 291 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMI2 protein_id gnl|my_center|LOCUS_21590 1679 990 gene locus_tag LOCUS_21600 1679 990 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMI1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence632 >Feature sequence633 <1 1598 gene locus_tag LOCUS_21610 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037460.1:ATP-dependent DNA helicase >Feature sequence634 >Feature sequence635 1705 356 gene locus_tag LOCUS_21620 1705 356 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence636 220 1419 gene locus_tag LOCUS_21630 220 1419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence637 187 792 gene locus_tag LOCUS_21640 gene tsaA 187 792 CDS product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_21640 1314 844 gene locus_tag LOCUS_21650 1314 844 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U4 protein_id gnl|my_center|LOCUS_21650 1801 1337 gene locus_tag LOCUS_21660 gene bfrB 1801 1337 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_21660 >Feature sequence638 497 1159 gene locus_tag LOCUS_21670 497 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44272 protein_id gnl|my_center|LOCUS_21670 >Feature sequence639 >Feature sequence640 22 474 gene locus_tag LOCUS_21680 gene ssb 22 474 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_21680 574 1473 gene locus_tag LOCUS_21690 574 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence641 >Feature sequence642 746 144 gene locus_tag LOCUS_21700 746 144 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_21700 1810 743 gene locus_tag LOCUS_21710 gene cobT 1810 743 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ66 protein_id gnl|my_center|LOCUS_21710 >Feature sequence643 102 1097 gene locus_tag LOCUS_21720 102 1097 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence644 561 1238 gene locus_tag LOCUS_21730 561 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1329 1637 gene locus_tag LOCUS_21740 1329 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence645 371 658 gene locus_tag LOCUS_21750 371 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 670 1245 gene locus_tag LOCUS_21760 670 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence646 1598 540 gene locus_tag LOCUS_21770 1598 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence647 307 1596 gene locus_tag LOCUS_21780 gene amtB 307 1596 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTR7 protein_id gnl|my_center|LOCUS_21780 >Feature sequence648 783 1205 gene locus_tag LOCUS_21790 783 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence649 59 1135 gene locus_tag LOCUS_21800 gene thrC 59 1135 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_21800 >Feature sequence650 61 1245 gene locus_tag LOCUS_21810 gene sat 61 1245 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_21810 >Feature sequence651 1154 117 gene locus_tag LOCUS_21820 gene pilT 1154 117 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_21820 >Feature sequence652 1191 451 gene locus_tag LOCUS_21830 gene motC 1191 451 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_21830 <1776 1195 gene locus_tag LOCUS_21840 <1776 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O87125:chemotaxis response regulator protein-glutamate methylesterase of group 1 operon >Feature sequence653 <1 758 gene locus_tag LOCUS_21850 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329097.1:aspartate carbamoyltransferase >Feature sequence654 993 238 gene locus_tag LOCUS_21860 993 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21860 1553 987 gene locus_tag LOCUS_21870 1553 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 >Feature sequence655 <1 1205 gene locus_tag LOCUS_21880 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088479.1:transcriptional regulator 1202 1363 gene locus_tag LOCUS_21890 1202 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence656 1667 420 gene locus_tag LOCUS_21900 1667 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence657 >Feature sequence658 530 1183 gene locus_tag LOCUS_21910 530 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence659 <1 635 gene locus_tag LOCUS_21920 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039086.1:AMP-ligase 652 945 gene locus_tag LOCUS_21930 652 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 951 1712 gene locus_tag LOCUS_21940 951 1712 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence660 <1757 588 gene locus_tag LOCUS_21950 <1757 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140960.1:urea carboxylase >Feature sequence661 <1 848 gene locus_tag LOCUS_21960 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881061.1:metal-dependent phosphohydrolase >Feature sequence662 1282 134 gene locus_tag LOCUS_21970 gene ftsZ 1282 134 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW8 protein_id gnl|my_center|LOCUS_21970 >Feature sequence663 196 891 gene locus_tag LOCUS_21980 gene nfi 196 891 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_21980 >Feature sequence664 >Feature sequence665 <1 866 gene locus_tag LOCUS_21990 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482874.1:3-methyladenine DNA glycosylase >Feature sequence666 461 1705 gene locus_tag LOCUS_22000 461 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence667 <1739 377 gene locus_tag LOCUS_22010 <1739 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVU2:leucine--tRNA ligase >Feature sequence668 765 1106 gene locus_tag LOCUS_22020 765 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence669 412 804 gene locus_tag LOCUS_22030 gene gcvH 412 804 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_22030 >Feature sequence670 <1724 900 gene locus_tag LOCUS_22040 <1724 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124706.1:carboxysome shell protein >Feature sequence671 <1 727 gene locus_tag LOCUS_22050 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036625.1:deoxyribodipyrimidine photo-lyase 1645 797 gene locus_tag LOCUS_22060 1645 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence672 <1718 826 gene locus_tag LOCUS_22070 <1718 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TFK8:quinolinate synthase A >Feature sequence673 <1 1179 gene locus_tag LOCUS_22080 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:hybrid sensor histidine kinase/response regulator 1193 1582 gene locus_tag LOCUS_22090 1193 1582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence674 460 137 gene locus_tag LOCUS_22100 460 137 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_22100 <1714 476 gene locus_tag LOCUS_22110 <1714 476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114673.1:DNA polymerase III subunit gamma/tau >Feature sequence675 <1 855 gene locus_tag LOCUS_22120 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267337.1:non-ribosomal peptide synthetase >Feature sequence676 479 1135 gene locus_tag LOCUS_22130 gene narL 479 1135 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_22130 1132 1593 gene locus_tag LOCUS_22140 1132 1593 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence677 1 246 gene locus_tag LOCUS_22150 1 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 400 792 gene locus_tag LOCUS_22160 400 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1427 804 gene locus_tag LOCUS_22170 1427 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence678 <1 854 gene locus_tag LOCUS_22180 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316803.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence679 >Feature sequence680 <1699 440 gene locus_tag LOCUS_22190 <1699 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870076.1:EscN/YscN/HrcN family type III secretion system ATPase >Feature sequence681 >Feature sequence682 322 708 gene locus_tag LOCUS_22200 gene cheY 322 708 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_22200 722 1453 gene locus_tag LOCUS_22210 gene cheZ 722 1453 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI22 protein_id gnl|my_center|LOCUS_22210 >Feature sequence683 <1 575 gene locus_tag LOCUS_22220 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932575.1:phosphate ABC transporter substrate-binding protein >Feature sequence684 <1 909 gene locus_tag LOCUS_22230 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058242.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence685 122 667 gene locus_tag LOCUS_22240 gene mogA 122 667 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_22240 677 1564 gene locus_tag LOCUS_22250 gene prmB 677 1564 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECQ4 protein_id gnl|my_center|LOCUS_22250 >Feature sequence686 1164 355 gene locus_tag LOCUS_22260 gene djlA 1164 355 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_22260 >Feature sequence687 >Feature sequence688 552 1352 gene locus_tag LOCUS_22270 gene mreC 552 1352 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXC0 protein_id gnl|my_center|LOCUS_22270 >Feature sequence689 >Feature sequence690 >Feature sequence691 1136 363 gene locus_tag LOCUS_22280 gene hisF1 1136 363 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_22280 <1647 1145 gene locus_tag LOCUS_22290 <1647 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63Q91:1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase >Feature sequence692 211 498 gene locus_tag LOCUS_22300 211 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 808 503 gene locus_tag LOCUS_22310 808 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence693 >Feature sequence694 484 804 gene locus_tag LOCUS_22320 484 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 804 1277 gene locus_tag LOCUS_22330 804 1277 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204913.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence695 <1 608 gene locus_tag LOCUS_22340 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YKS0:dihydrolipoyl dehydrogenase 559 936 gene locus_tag LOCUS_22350 gene gcvH 559 936 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4L2 protein_id gnl|my_center|LOCUS_22350 1074 1466 gene locus_tag LOCUS_22360 1074 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence696 <1 1095 gene locus_tag LOCUS_22370 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P30903:aspartate-semialdehyde dehydrogenase >Feature sequence697 <1 764 gene locus_tag LOCUS_22380 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094421.1:two-component sensor histidine kinase 761 1291 gene locus_tag LOCUS_22390 761 1291 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence698 >Feature sequence699 >Feature sequence700 >Feature sequence701 764 1450 gene locus_tag LOCUS_22400 764 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence702 <1610 750 gene locus_tag LOCUS_22410 <1610 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530004.1:non-ribosomal peptide synthase >Feature sequence703 >Feature sequence704 66 659 gene locus_tag LOCUS_22420 gene hisB 66 659 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_22420 682 1332 gene locus_tag LOCUS_22430 gene hisH1 682 1332 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_22430 >Feature sequence705 <1 537 gene locus_tag LOCUS_22440 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42807:glutamyl-tRNA reductase >Feature sequence706 547 146 gene locus_tag LOCUS_22450 547 146 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_22450 <1596 547 gene locus_tag LOCUS_22460 <1596 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084106.1:AMP-dependent synthetase >Feature sequence707 1587 886 gene locus_tag LOCUS_22470 1587 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence708 <1 1227 gene locus_tag LOCUS_22480 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q44767:flagellar hook protein FlgE >Feature sequence709 107 31 gene locus_tag LOCUS_t00200 107 31 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence710 449 1213 gene locus_tag LOCUS_22490 gene hemD 449 1213 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence711 >Feature sequence712 <1 515 gene locus_tag LOCUS_22500 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888233.1:6-phosphogluconate dehydrogenase >Feature sequence713 1371 853 gene locus_tag LOCUS_22510 1371 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence714 <1566 988 gene locus_tag LOCUS_22520 <1566 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948608.1:ABC transporter ATP-binding protein >Feature sequence715 1219 656 gene locus_tag LOCUS_22530 1219 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1501 1235 gene locus_tag LOCUS_22540 1501 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence716 >Feature sequence717 144 728 gene locus_tag LOCUS_22550 144 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 812 1345 gene locus_tag LOCUS_22560 812 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence718 >Feature sequence719 749 997 gene locus_tag LOCUS_22570 749 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence720 <1 609 gene locus_tag LOCUS_22580 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0Q1:UvrABC system protein C 613 1182 gene locus_tag LOCUS_22590 gene pgsA 613 1182 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_22590 1257 1332 gene locus_tag LOCUS_t00210 1257 1332 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1413 1486 gene locus_tag LOCUS_t00220 1413 1486 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence721 669 136 gene locus_tag LOCUS_22600 gene lolB 669 136 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 protein_id gnl|my_center|LOCUS_22600 <1529 734 gene locus_tag LOCUS_22610 <1529 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42810:TPR repeat-containing protein >Feature sequence722 <1528 265 gene locus_tag LOCUS_22620 <1528 265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DX3:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence723 <1 508 gene locus_tag LOCUS_22630 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979688.1:MBL fold metallo-hydrolase >Feature sequence724 238 116 gene locus_tag LOCUS_22640 238 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 520 446 gene locus_tag LOCUS_t00230 520 446 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <1525 791 gene locus_tag LOCUS_22650 <1525 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KN01:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase >Feature sequence725 >Feature sequence726 >Feature sequence727 >Feature sequence728 <1 1035 gene locus_tag LOCUS_22660 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPA5:proline--tRNA ligase >Feature sequence729 540 974 gene locus_tag LOCUS_22670 540 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence730 1506 733 gene locus_tag LOCUS_22680 1506 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence731 <1506 257 gene locus_tag LOCUS_22690 <1506 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FJ9:bifunctional purine biosynthesis protein PurH >Feature sequence732 147 371 gene locus_tag LOCUS_22700 147 371 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190152.1 protein_id gnl|my_center|LOCUS_22700 1012 368 gene locus_tag LOCUS_22710 1012 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence733 1231 83 gene locus_tag LOCUS_22720 gene rubB 1231 83 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 protein_id gnl|my_center|LOCUS_22720 1417 1253 gene locus_tag LOCUS_22730 1417 1253 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 protein_id gnl|my_center|LOCUS_22730 >Feature sequence734 >Feature sequence735 >Feature sequence736 1490 57 gene locus_tag LOCUS_22740 1490 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence737 >Feature sequence738 <1491 6 gene locus_tag LOCUS_22750 <1491 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926982.1:TonB-dependent receptor >Feature sequence739 <1 1080 gene locus_tag LOCUS_22760 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104597.1:lytic transglycosylase 1215 1376 gene locus_tag LOCUS_22770 1215 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence740 >Feature sequence741 >Feature sequence742 244 1113 gene locus_tag LOCUS_22780 244 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence743 1035 274 gene locus_tag LOCUS_22790 1035 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence744 532 308 gene locus_tag LOCUS_22800 532 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 689 1057 gene locus_tag LOCUS_22810 689 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence745 <1463 272 gene locus_tag LOCUS_22820 <1463 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091085.1:lipase >Feature sequence746 >Feature sequence747 1424 735 gene locus_tag LOCUS_22830 1424 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence748 484 8 gene locus_tag LOCUS_22840 gene coaD 484 8 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_22840 1087 521 gene locus_tag LOCUS_22850 1087 521 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_22850 >Feature sequence749 48 662 gene locus_tag LOCUS_22860 48 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1395 637 gene locus_tag LOCUS_22870 1395 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence750 1353 640 gene locus_tag LOCUS_22880 gene lpxC 1353 640 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22880 >Feature sequence751 >Feature sequence752 549 262 gene locus_tag LOCUS_22890 gene gatC 549 262 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_22890 >Feature sequence753 >Feature sequence754 357 1172 gene locus_tag LOCUS_22900 357 1172 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence755 <1 927 gene locus_tag LOCUS_22910 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZRL6:siroheme synthase >Feature sequence756 >Feature sequence757 1147 146 gene locus_tag LOCUS_22920 gene rpoA 1147 146 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_22920 >Feature sequence758 <1416 508 gene locus_tag LOCUS_22930 <1416 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P7B3:transcription-repair-coupling factor >Feature sequence759 <1 522 gene locus_tag LOCUS_22940 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887814.1:ATPase >Feature sequence760 373 975 gene locus_tag LOCUS_22950 gene petA 373 975 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_22950 >Feature sequence761 398 1147 gene locus_tag LOCUS_22960 398 1147 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence762 84 1067 gene locus_tag LOCUS_22970 84 1067 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence763 >Feature sequence764 >Feature sequence765 >Feature sequence766 >Feature sequence767 >Feature sequence768 >Feature sequence769 <1 1290 gene locus_tag LOCUS_22980 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107678.1:cell envelope integrity protein CreD >Feature sequence770 878 348 gene locus_tag LOCUS_22990 878 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence771 >Feature sequence772 >Feature sequence773 <1 1298 gene locus_tag LOCUS_23000 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389558.1:diguanylate cyclase >Feature sequence774 301 759 gene locus_tag LOCUS_23010 301 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1259 810 gene locus_tag LOCUS_23020 1259 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence775 >Feature sequence776 >Feature sequence777 <1 551 gene locus_tag LOCUS_23030 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327495.1:phosphoesterase 1004 597 gene locus_tag LOCUS_23040 1004 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1338 1039 gene locus_tag LOCUS_23050 1338 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence778 >Feature sequence779 >Feature sequence780 450 262 gene locus_tag LOCUS_23060 450 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1335 538 gene locus_tag LOCUS_23070 gene hflC 1335 538 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_23070 >Feature sequence781 >Feature sequence782 280 1074 gene locus_tag LOCUS_23080 280 1074 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence783 781 383 gene locus_tag LOCUS_23090 gene msrB 781 383 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 protein_id gnl|my_center|LOCUS_23090 1187 792 gene locus_tag LOCUS_23100 1187 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence784 >Feature sequence785 617 1066 gene locus_tag LOCUS_23110 617 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923257.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence786 458 81 gene locus_tag LOCUS_23120 458 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence787 >Feature sequence788 1009 290 gene locus_tag LOCUS_23130 gene lpxH 1009 290 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLW6 protein_id gnl|my_center|LOCUS_23130 >Feature sequence789 198 998 gene locus_tag LOCUS_23140 198 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence790 >Feature sequence791 <1274 528 gene locus_tag LOCUS_23150 <1274 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000665274.1:nicotinate-nucleotide diphosphorylase >Feature sequence792 <1 1016 gene locus_tag LOCUS_23160 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DC7:peptide chain release factor 3 >Feature sequence793 >Feature sequence794 187 822 gene locus_tag LOCUS_23170 187 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence795 <1 568 gene locus_tag LOCUS_23180 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391142.1:LuxR family transcriptional regulator >Feature sequence796 469 152 gene locus_tag LOCUS_23190 gene soxZ 469 152 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_23190 973 503 gene locus_tag LOCUS_23200 gene soxY 973 503 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence797 <1 543 gene locus_tag LOCUS_23210 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPD3:L-aspartate oxidase 833 507 gene locus_tag LOCUS_23220 833 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1173 910 gene locus_tag LOCUS_23230 1173 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_23230 >Feature sequence798 >Feature sequence799 >Feature sequence800 >Feature sequence801 <1 827 gene locus_tag LOCUS_23240 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886N7:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence802 183 1199 gene locus_tag LOCUS_23250 183 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_23250 >Feature sequence803 >Feature sequence804 <1223 573 gene locus_tag LOCUS_23260 <1223 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I7C3:DNA replication and repair protein RecF >Feature sequence805 654 208 gene locus_tag LOCUS_23270 654 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence806 >Feature sequence807 >Feature sequence808 <1 572 gene locus_tag LOCUS_23280 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390149.1:iron dicitrate transporter FecR >Feature sequence809 >Feature sequence810 939 145 gene locus_tag LOCUS_23290 939 145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_23290 1202 951 gene locus_tag LOCUS_23300 1202 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence811 244 672 gene locus_tag LOCUS_23310 gene rplM 244 672 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG2 protein_id gnl|my_center|LOCUS_23310 688 1077 gene locus_tag LOCUS_23320 gene rpsI 688 1077 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_23320 >Feature sequence812 >Feature sequence813 >Feature sequence814 <1178 36 gene locus_tag LOCUS_23330 <1178 36 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070883.1:sensor histidine kinase >Feature sequence815 >Feature sequence816 522 106 gene locus_tag LOCUS_23340 522 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 <1166 525 gene locus_tag LOCUS_23350 <1166 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815420.1:membrane protein >Feature sequence817 >Feature sequence818 <1 641 gene locus_tag LOCUS_23360 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJP8:type 4 prepilin-like proteins leader peptide-processing enzyme >Feature sequence819 >Feature sequence820 >Feature sequence821 >Feature sequence822 >Feature sequence823 <1148 323 gene locus_tag LOCUS_23370 <1148 323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9J7:chemotaxis response regulator protein-glutamate methylesterase of group 1 operon >Feature sequence824 >Feature sequence825 >Feature sequence826 <1 915 gene locus_tag LOCUS_23380 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703430.1:2-octaprenyl-6-methoxyphenyl hydroxylase >Feature sequence827 831 469 gene locus_tag LOCUS_23390 831 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence828 >Feature sequence829 >Feature sequence830 <1 816 gene locus_tag LOCUS_23400 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58067:beta-hexosaminidase >Feature sequence831 <1 751 gene locus_tag LOCUS_23410 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter >Feature sequence832 >Feature sequence833 <1 1095 gene locus_tag LOCUS_23420 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JQF1:selenide, water dikinase >Feature sequence834 <1109 39 gene locus_tag LOCUS_23430 <1109 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931919.1:glycosyl transferase >Feature sequence835 126 1070 gene locus_tag LOCUS_23440 126 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence836 280 651 gene locus_tag LOCUS_23450 280 651 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975238.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence837 >Feature sequence838 >Feature sequence839 90 1001 gene locus_tag LOCUS_23460 90 1001 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266744.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence840 960 625 gene locus_tag LOCUS_23470 gene rbcS 960 625 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence841 >Feature sequence842 >Feature sequence843 >Feature sequence844 <1 584 gene locus_tag LOCUS_23480 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZW81:quinolinate synthase A 746 943 gene locus_tag LOCUS_23490 746 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence845 >Feature sequence846 908 267 gene locus_tag LOCUS_23500 gene coq7 908 267 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_23500 >Feature sequence847 >Feature sequence848 <1067 195 gene locus_tag LOCUS_23510 <1067 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001277248.1:WYL domain-containing protein >Feature sequence849 >Feature sequence850 910 416 gene locus_tag LOCUS_23520 910 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence851 418 990 gene locus_tag LOCUS_23530 gene tag 418 990 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence852 <1 501 gene locus_tag LOCUS_23540 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005621194.1:glutamate synthase subunit beta >Feature sequence853 >Feature sequence854 <1046 155 gene locus_tag LOCUS_23550 <1046 155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:C4-dicarboxylate ABC transporter >Feature sequence855 317 622 gene locus_tag LOCUS_23560 gene ihfB 317 622 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T0 protein_id gnl|my_center|LOCUS_23560 723 1016 gene locus_tag LOCUS_23570 723 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence856 >Feature sequence857 >Feature sequence858 >Feature sequence859 668 411 gene locus_tag LOCUS_23580 gene grxC 668 411 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_23580 1033 674 gene locus_tag LOCUS_23590 1033 674 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence860 >Feature sequence861 <1030 242 gene locus_tag LOCUS_23600 <1030 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402848.1:alpha/beta hydrolase >Feature sequence862 >Feature sequence863 2 532 gene locus_tag LOCUS_23610 2 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence864 >Feature sequence865