>Feature sequence001 166 603 gene locus_tag LOCUS_00010 166 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 877 662 gene locus_tag LOCUS_00020 877 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 943 1656 gene locus_tag LOCUS_00030 943 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_00030 3475 1664 gene locus_tag LOCUS_00040 3475 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5466 3472 gene locus_tag LOCUS_00050 5466 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7044 5542 gene locus_tag LOCUS_00060 7044 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7158 9719 gene locus_tag LOCUS_00070 7158 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9981 11597 gene locus_tag LOCUS_00080 9981 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11789 12685 gene locus_tag LOCUS_00090 11789 12685 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_00090 14147 12693 gene locus_tag LOCUS_00100 14147 12693 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_00100 16105 15104 gene locus_tag LOCUS_00110 gene argF 16105 15104 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7U4 protein_id gnl|my_center|LOCUS_00110 16332 16826 gene locus_tag LOCUS_00120 16332 16826 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_00120 16934 17134 gene locus_tag LOCUS_00130 16934 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17131 17388 gene locus_tag LOCUS_00140 17131 17388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00140 17498 17851 gene locus_tag LOCUS_00150 17498 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_00150 18052 18726 gene locus_tag LOCUS_00160 18052 18726 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_00160 18823 22476 gene locus_tag LOCUS_00170 18823 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22641 24053 gene locus_tag LOCUS_00180 gene pepQ 22641 24053 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_00180 24267 24638 gene locus_tag LOCUS_00190 24267 24638 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546202.1 protein_id gnl|my_center|LOCUS_00190 26520 24682 gene locus_tag LOCUS_00200 26520 24682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26728 27654 gene locus_tag LOCUS_00210 gene moaA 26728 27654 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S72 protein_id gnl|my_center|LOCUS_00210 28754 27675 gene locus_tag LOCUS_00220 28754 27675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_00220 30256 28910 gene locus_tag LOCUS_00230 30256 28910 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_00230 30724 32544 gene locus_tag LOCUS_00240 30724 32544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32541 34742 gene locus_tag LOCUS_00250 32541 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34907 36022 gene locus_tag LOCUS_00260 34907 36022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36019 37182 gene locus_tag LOCUS_00270 36019 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37525 42219 gene locus_tag LOCUS_00280 37525 42219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 43829 42357 gene locus_tag LOCUS_00290 43829 42357 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_00290 44651 44028 gene locus_tag LOCUS_00300 44651 44028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 45723 44680 gene locus_tag LOCUS_00310 45723 44680 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_00310 45870 47000 gene locus_tag LOCUS_00320 45870 47000 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_00320 48630 47005 gene locus_tag LOCUS_00330 48630 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 48719 49234 gene locus_tag LOCUS_00340 48719 49234 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707174.1 protein_id gnl|my_center|LOCUS_00340 49236 51632 gene locus_tag LOCUS_00350 49236 51632 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_00350 51629 52492 gene locus_tag LOCUS_00360 gene cutM 51629 52492 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_00360 52550 53140 gene locus_tag LOCUS_00370 52550 53140 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_00370 53153 55759 gene locus_tag LOCUS_00380 53153 55759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 56705 55761 gene locus_tag LOCUS_00390 56705 55761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 58111 56987 gene locus_tag LOCUS_00400 58111 56987 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_00400 59388 58135 gene locus_tag LOCUS_00410 59388 58135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 60503 59409 gene locus_tag LOCUS_00420 60503 59409 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_00420 60665 61084 gene locus_tag LOCUS_00430 60665 61084 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_00430 63621 61423 gene locus_tag LOCUS_00440 gene fadJ 63621 61423 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_00440 64000 65265 gene locus_tag LOCUS_00450 64000 65265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 65422 67176 gene locus_tag LOCUS_00460 65422 67176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 67176 68669 gene locus_tag LOCUS_00470 67176 68669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 68819 70258 gene locus_tag LOCUS_00480 68819 70258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 protein_id gnl|my_center|LOCUS_00480 71063 70242 gene locus_tag LOCUS_00490 71063 70242 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_00490 72030 71116 gene locus_tag LOCUS_00500 gene waaM 72030 71116 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_00500 74234 72270 gene locus_tag LOCUS_00510 gene htpG 74234 72270 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64412 protein_id gnl|my_center|LOCUS_00510 79274 74451 gene locus_tag LOCUS_00520 79274 74451 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_00520 81027 79648 gene locus_tag LOCUS_00530 81027 79648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_00530 82694 81081 gene locus_tag LOCUS_00540 82694 81081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_00540 83213 84601 gene locus_tag LOCUS_00550 83213 84601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 84637 86358 gene locus_tag LOCUS_00560 84637 86358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 88481 86382 gene locus_tag LOCUS_00570 88481 86382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 88643 89191 gene locus_tag LOCUS_00580 88643 89191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 91503 89152 gene locus_tag LOCUS_00590 91503 89152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 92791 91796 gene locus_tag LOCUS_00600 92791 91796 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_00600 93106 95073 gene locus_tag LOCUS_00610 gene speA 93106 95073 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_00610 96581 95103 gene locus_tag LOCUS_00620 96581 95103 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_00620 96695 97735 gene locus_tag LOCUS_00630 96695 97735 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_00630 98003 98785 gene locus_tag LOCUS_00640 98003 98785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 99025 100386 gene locus_tag LOCUS_00650 99025 100386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 100618 101184 gene locus_tag LOCUS_00660 100618 101184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 101257 101745 gene locus_tag LOCUS_00670 101257 101745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 101873 104329 gene locus_tag LOCUS_00680 101873 104329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00680 104531 104956 gene locus_tag LOCUS_00690 104531 104956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 104953 105927 gene locus_tag LOCUS_00700 104953 105927 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_00700 105906 107624 gene locus_tag LOCUS_00710 105906 107624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 108046 107642 gene locus_tag LOCUS_00720 108046 107642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 108309 108052 gene locus_tag LOCUS_00730 108309 108052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 109187 108420 gene locus_tag LOCUS_00740 109187 108420 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_00740 109897 109325 gene locus_tag LOCUS_00750 109897 109325 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405477.1 protein_id gnl|my_center|LOCUS_00750 110403 109984 gene locus_tag LOCUS_00760 110403 109984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 110912 110400 gene locus_tag LOCUS_00770 110912 110400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 111347 111153 gene locus_tag LOCUS_00780 111347 111153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 112179 111448 gene locus_tag LOCUS_00790 112179 111448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 113775 112276 gene locus_tag LOCUS_00800 113775 112276 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_00800 113911 115317 gene locus_tag LOCUS_00810 113911 115317 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 protein_id gnl|my_center|LOCUS_00810 115481 115990 gene locus_tag LOCUS_00820 115481 115990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 116057 117826 gene locus_tag LOCUS_00830 116057 117826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 118115 117879 gene locus_tag LOCUS_00840 118115 117879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 119526 118126 gene locus_tag LOCUS_00850 119526 118126 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_00850 120131 121186 gene locus_tag LOCUS_00860 120131 121186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 121372 123828 gene locus_tag LOCUS_00870 121372 123828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 124009 125673 gene locus_tag LOCUS_00880 124009 125673 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_00880 125666 126292 gene locus_tag LOCUS_00890 125666 126292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 126529 127806 gene locus_tag LOCUS_00900 126529 127806 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_00900 127879 129210 gene locus_tag LOCUS_00910 127879 129210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 131521 129221 gene locus_tag LOCUS_00920 131521 129221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 131705 132628 gene locus_tag LOCUS_00930 131705 132628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 132877 133614 gene locus_tag LOCUS_00940 132877 133614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 133715 134683 gene locus_tag LOCUS_00950 133715 134683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 135254 134688 gene locus_tag LOCUS_00960 135254 134688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 135754 135254 gene locus_tag LOCUS_00970 135754 135254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 136183 135779 gene locus_tag LOCUS_00980 136183 135779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 136615 136310 gene locus_tag LOCUS_00990 136615 136310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 137097 136699 gene locus_tag LOCUS_01000 137097 136699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 138193 137117 gene locus_tag LOCUS_01010 138193 137117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01010 138380 138186 gene locus_tag LOCUS_01020 138380 138186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 138725 138444 gene locus_tag LOCUS_01030 138725 138444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 139133 138798 gene locus_tag LOCUS_01040 139133 138798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 139649 139152 gene locus_tag LOCUS_01050 139649 139152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 140116 139658 gene locus_tag LOCUS_01060 140116 139658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 140595 140131 gene locus_tag LOCUS_01070 140595 140131 CDS product lumazine-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_01070 143263 140726 gene locus_tag LOCUS_01080 143263 140726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_01080 143975 143265 gene locus_tag LOCUS_01090 143975 143265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 145409 143979 gene locus_tag LOCUS_01100 145409 143979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 146188 145454 gene locus_tag LOCUS_01110 146188 145454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 147312 146185 gene locus_tag LOCUS_01120 147312 146185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 149239 147500 gene locus_tag LOCUS_01130 149239 147500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 150891 149479 gene locus_tag LOCUS_01140 150891 149479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 152835 151081 gene locus_tag LOCUS_01150 152835 151081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 156074 153039 gene locus_tag LOCUS_01160 156074 153039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 157885 156092 gene locus_tag LOCUS_01170 157885 156092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 158041 160863 gene locus_tag LOCUS_01180 gene uvrA 158041 160863 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34863 protein_id gnl|my_center|LOCUS_01180 160899 161627 gene locus_tag LOCUS_01190 160899 161627 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_01190 162134 161697 gene locus_tag LOCUS_01200 162134 161697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 162267 162716 gene locus_tag LOCUS_01210 162267 162716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 163517 162750 gene locus_tag LOCUS_01220 163517 162750 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_01220 163592 165004 gene locus_tag LOCUS_01230 163592 165004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029003.1 protein_id gnl|my_center|LOCUS_01230 165623 165009 gene locus_tag LOCUS_01240 165623 165009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703789.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence002 4233 1345 gene locus_tag LOCUS_01250 4233 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4889 6679 gene locus_tag LOCUS_01260 4889 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6676 8460 gene locus_tag LOCUS_01270 6676 8460 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01270 8472 10610 gene locus_tag LOCUS_01280 8472 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 11198 14512 gene locus_tag LOCUS_01290 11198 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 17293 14564 gene locus_tag LOCUS_01300 17293 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 19200 17596 gene locus_tag LOCUS_01310 19200 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 21036 19222 gene locus_tag LOCUS_01320 21036 19222 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01320 23225 21033 gene locus_tag LOCUS_01330 23225 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 25273 23222 gene locus_tag LOCUS_01340 25273 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 25639 25361 gene locus_tag LOCUS_01350 25639 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 26282 25734 gene locus_tag LOCUS_01360 26282 25734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 27223 26492 gene locus_tag LOCUS_01370 27223 26492 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_01370 27424 28917 gene locus_tag LOCUS_01380 27424 28917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 28988 31990 gene locus_tag LOCUS_01390 28988 31990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 31978 33561 gene locus_tag LOCUS_01400 31978 33561 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_01400 35269 33650 gene locus_tag LOCUS_01410 gene pckA2 35269 33650 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_01410 36503 35466 gene locus_tag LOCUS_01420 gene pdxA 36503 35466 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D3 protein_id gnl|my_center|LOCUS_01420 37905 36634 gene locus_tag LOCUS_01430 37905 36634 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073912.1 protein_id gnl|my_center|LOCUS_01430 38431 38114 gene locus_tag LOCUS_01440 38431 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 39261 38428 gene locus_tag LOCUS_01450 39261 38428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 41013 39739 gene locus_tag LOCUS_01460 gene purD 41013 39739 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_01460 42020 41010 gene locus_tag LOCUS_01470 42020 41010 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016960.1 protein_id gnl|my_center|LOCUS_01470 42149 43207 gene locus_tag LOCUS_01480 gene mtnA 42149 43207 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X013 protein_id gnl|my_center|LOCUS_01480 43219 45081 gene locus_tag LOCUS_01490 43219 45081 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_01490 45545 45159 gene locus_tag LOCUS_01500 45545 45159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 46934 45666 gene locus_tag LOCUS_01510 46934 45666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 47880 47128 gene locus_tag LOCUS_01520 47880 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_01520 48317 47877 gene locus_tag LOCUS_01530 48317 47877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 49318 48317 gene locus_tag LOCUS_01540 49318 48317 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_01540 50995 49376 gene locus_tag LOCUS_01550 gene bshC 50995 49376 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P5 protein_id gnl|my_center|LOCUS_01550 51674 50949 gene locus_tag LOCUS_01560 51674 50949 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_01560 53803 51827 gene locus_tag LOCUS_01570 53803 51827 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_01570 55225 53909 gene locus_tag LOCUS_01580 gene fahA 55225 53909 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_01580 56203 55313 gene locus_tag LOCUS_01590 56203 55313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_01590 61675 56435 gene locus_tag LOCUS_01600 61675 56435 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338366.1 protein_id gnl|my_center|LOCUS_01600 62059 61799 gene locus_tag LOCUS_01610 62059 61799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 61958 65197 gene locus_tag LOCUS_01620 61958 65197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 65346 66989 gene locus_tag LOCUS_01630 65346 66989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 66986 69229 gene locus_tag LOCUS_01640 66986 69229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 69226 70914 gene locus_tag LOCUS_01650 gene hpnJ 69226 70914 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_01650 70911 71831 gene locus_tag LOCUS_01660 70911 71831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 71833 72846 gene locus_tag LOCUS_01670 71833 72846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 73415 72810 gene locus_tag LOCUS_01680 73415 72810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896139.1 protein_id gnl|my_center|LOCUS_01680 74740 73412 gene locus_tag LOCUS_01690 74740 73412 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_01690 75876 74788 gene locus_tag LOCUS_01700 75876 74788 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_01700 76473 76006 gene locus_tag LOCUS_01710 76473 76006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 76977 76628 gene locus_tag LOCUS_tm00010 76977 76628 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 78058 77039 gene locus_tag LOCUS_01720 78058 77039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 79095 78055 gene locus_tag LOCUS_01730 gene lpxK 79095 78055 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_01730 80438 79092 gene locus_tag LOCUS_01740 gene kdtA 80438 79092 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891565.1 protein_id gnl|my_center|LOCUS_01740 80870 81535 gene locus_tag LOCUS_01750 80870 81535 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_01750 81532 82107 gene locus_tag LOCUS_01760 81532 82107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 82203 82973 gene locus_tag LOCUS_01770 82203 82973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 83012 84229 gene locus_tag LOCUS_01780 gene pulF 83012 84229 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_01780 84249 85919 gene locus_tag LOCUS_01790 gene pulE 84249 85919 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_01790 85969 86862 gene locus_tag LOCUS_01800 85969 86862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 86864 88327 gene locus_tag LOCUS_01810 86864 88327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 88324 89046 gene locus_tag LOCUS_01820 88324 89046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 89043 89621 gene locus_tag LOCUS_01830 89043 89621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 89647 91578 gene locus_tag LOCUS_01840 89647 91578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 91687 92172 gene locus_tag LOCUS_01850 gene pulG 91687 92172 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_01850 92177 92686 gene locus_tag LOCUS_01860 gene oxpG 92177 92686 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01860 92680 93648 gene locus_tag LOCUS_01870 92680 93648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 93659 94096 gene locus_tag LOCUS_01880 gene dut 93659 94096 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S160 protein_id gnl|my_center|LOCUS_01880 94272 94706 gene locus_tag LOCUS_01890 94272 94706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 94728 95804 gene locus_tag LOCUS_01900 94728 95804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 96940 95813 gene locus_tag LOCUS_01910 96940 95813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 97365 97727 gene locus_tag LOCUS_01920 97365 97727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 97851 98489 gene locus_tag LOCUS_01930 97851 98489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 99010 98480 gene locus_tag LOCUS_01940 99010 98480 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_01940 99094 99507 gene locus_tag LOCUS_01950 99094 99507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 99510 101861 gene locus_tag LOCUS_01960 99510 101861 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NC2 protein_id gnl|my_center|LOCUS_01960 103820 101883 gene locus_tag LOCUS_01970 103820 101883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 105601 103940 gene locus_tag LOCUS_01980 105601 103940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 107699 105912 gene locus_tag LOCUS_01990 107699 105912 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_01990 107934 110825 gene locus_tag LOCUS_02000 gene uvrA2 107934 110825 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF05 protein_id gnl|my_center|LOCUS_02000 112203 110833 gene locus_tag LOCUS_02010 112203 110833 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_02010 114924 112213 gene locus_tag LOCUS_02020 114924 112213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 115196 114990 gene locus_tag LOCUS_02030 115196 114990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 115975 115223 gene locus_tag LOCUS_02040 115975 115223 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_02040 116640 116071 gene locus_tag LOCUS_02050 116640 116071 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ9 protein_id gnl|my_center|LOCUS_02050 116974 119664 gene locus_tag LOCUS_02060 116974 119664 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_02060 119890 120276 gene locus_tag LOCUS_02070 gene queD 119890 120276 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_02070 120309 121016 gene locus_tag LOCUS_02080 gene queE 120309 121016 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F56 protein_id gnl|my_center|LOCUS_02080 121040 122623 gene locus_tag LOCUS_02090 121040 122623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_02090 124935 122632 gene locus_tag LOCUS_02100 124935 122632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 127301 124932 gene locus_tag LOCUS_02110 127301 124932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 127415 128284 gene locus_tag LOCUS_02120 127415 128284 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_02120 130068 128275 gene locus_tag LOCUS_02130 130068 128275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 130218 131648 gene locus_tag LOCUS_02140 130218 131648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_02140 131897 132421 gene locus_tag LOCUS_02150 131897 132421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 132496 133278 gene locus_tag LOCUS_02160 gene pilD 132496 133278 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_02160 133275 134972 gene locus_tag LOCUS_02170 133275 134972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 135308 135931 gene locus_tag LOCUS_02180 135308 135931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 135952 136839 gene locus_tag LOCUS_02190 135952 136839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 137149 137886 gene locus_tag LOCUS_02200 137149 137886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 137895 139310 gene locus_tag LOCUS_02210 137895 139310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 139307 140065 gene locus_tag LOCUS_02220 139307 140065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 140103 145379 gene locus_tag LOCUS_02230 140103 145379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 146819 145539 gene locus_tag LOCUS_02240 146819 145539 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_02240 148192 146852 gene locus_tag LOCUS_02250 gene selA 148192 146852 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61736 protein_id gnl|my_center|LOCUS_02250 148280 148852 gene locus_tag LOCUS_02260 148280 148852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 148921 150120 gene locus_tag LOCUS_02270 148921 150120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 151586 150282 gene locus_tag LOCUS_02280 151586 150282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 152905 151583 gene locus_tag LOCUS_02290 152905 151583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 153083 154663 gene locus_tag LOCUS_02300 153083 154663 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_02300 154705 155151 gene locus_tag LOCUS_02310 154705 155151 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_02310 155205 156458 gene locus_tag LOCUS_02320 gene glyA 155205 156458 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_02320 156442 157740 gene locus_tag LOCUS_02330 gene folC 156442 157740 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_02330 158796 157756 gene locus_tag LOCUS_02340 158796 157756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 160109 158871 gene locus_tag LOCUS_02350 160109 158871 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_02350 160960 160106 gene locus_tag LOCUS_02360 gene accD 160960 160106 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_02360 161340 161116 gene locus_tag LOCUS_02370 161340 161116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 163022 161436 gene locus_tag LOCUS_02380 163022 161436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence003 47 394 gene locus_tag LOCUS_02390 gene rplS 47 394 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_02390 492 1292 gene locus_tag LOCUS_02400 492 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1292 4522 gene locus_tag LOCUS_02410 1292 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4663 5775 gene locus_tag LOCUS_02420 4663 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5855 6865 gene locus_tag LOCUS_02430 gene citC 5855 6865 CDS product isocitrate dehydrogenase, NAD-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_02430 7058 8320 gene locus_tag LOCUS_02440 7058 8320 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_02440 8907 8353 gene locus_tag LOCUS_02450 8907 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9162 12458 gene locus_tag LOCUS_02460 9162 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_02460 13082 14941 gene locus_tag LOCUS_02470 13082 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 15250 16056 gene locus_tag LOCUS_02480 gene mscS 15250 16056 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_02480 16194 18446 gene locus_tag LOCUS_02490 16194 18446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 18875 21847 gene locus_tag LOCUS_02500 18875 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23412 22057 gene locus_tag LOCUS_02510 gene manB 23412 22057 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_02510 24609 23668 gene locus_tag LOCUS_02520 24609 23668 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056343.1 protein_id gnl|my_center|LOCUS_02520 24761 25423 gene locus_tag LOCUS_02530 24761 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 25475 26038 gene locus_tag LOCUS_02540 gene def 25475 26038 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB26 protein_id gnl|my_center|LOCUS_02540 26075 26545 gene locus_tag LOCUS_02550 gene rlmH 26075 26545 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7G2 protein_id gnl|my_center|LOCUS_02550 26689 27105 gene locus_tag LOCUS_02560 26689 27105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 27196 28653 gene locus_tag LOCUS_02570 27196 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 29387 28695 gene locus_tag LOCUS_02580 29387 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 29761 29414 gene locus_tag LOCUS_02590 gene spoIIAA 29761 29414 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_02590 31057 29885 gene locus_tag LOCUS_02600 31057 29885 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_02600 31288 33894 gene locus_tag LOCUS_02610 31288 33894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 33983 34615 gene locus_tag LOCUS_02620 gene algU 33983 34615 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_02620 34605 35063 gene locus_tag LOCUS_02630 34605 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 35060 35638 gene locus_tag LOCUS_02640 35060 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 35834 36871 gene locus_tag LOCUS_02650 35834 36871 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_02650 36991 38445 gene locus_tag LOCUS_02660 36991 38445 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_02660 38524 38754 gene locus_tag LOCUS_02670 38524 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 39058 38696 gene locus_tag LOCUS_02680 39058 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 39203 40048 gene locus_tag LOCUS_02690 39203 40048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 40151 41185 gene locus_tag LOCUS_02700 40151 41185 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_02700 41242 41718 gene locus_tag LOCUS_02710 41242 41718 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016760.1 protein_id gnl|my_center|LOCUS_02710 41757 42779 gene locus_tag LOCUS_02720 41757 42779 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_02720 42956 44680 gene locus_tag LOCUS_02730 gene pilB 42956 44680 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_02730 44871 47486 gene locus_tag LOCUS_02740 44871 47486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 47602 48282 gene locus_tag LOCUS_02750 47602 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02750 48306 48575 gene locus_tag LOCUS_02760 48306 48575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 51007 48716 gene locus_tag LOCUS_02770 51007 48716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 52355 51414 gene locus_tag LOCUS_02780 52355 51414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 52700 52401 gene locus_tag LOCUS_02790 52700 52401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 54232 53549 gene locus_tag LOCUS_02800 54232 53549 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_02800 54954 54268 gene locus_tag LOCUS_02810 54954 54268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_02810 55675 54980 gene locus_tag LOCUS_02820 55675 54980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_02820 57068 55809 gene locus_tag LOCUS_02830 57068 55809 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_02830 59849 57531 gene locus_tag LOCUS_02840 59849 57531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 60283 61107 gene locus_tag LOCUS_02850 60283 61107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 61280 63316 gene locus_tag LOCUS_02860 61280 63316 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_02860 63445 64917 gene locus_tag LOCUS_02870 gene gltX 63445 64917 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG1 protein_id gnl|my_center|LOCUS_02870 65100 66110 gene locus_tag LOCUS_02880 65100 66110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 66997 66182 gene locus_tag LOCUS_02890 66997 66182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 67236 67403 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgaaaagtcccatacaaattttgagac 67582 68124 gene locus_tag LOCUS_02900 67582 68124 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_02900 68525 68121 gene locus_tag LOCUS_02910 68525 68121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 68648 68526 gene locus_tag LOCUS_02920 68648 68526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 69062 69607 gene locus_tag LOCUS_02930 69062 69607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 70386 69616 gene locus_tag LOCUS_02940 70386 69616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 71597 70383 gene locus_tag LOCUS_02950 71597 70383 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_02950 72826 71594 gene locus_tag LOCUS_02960 72826 71594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 73101 76997 gene locus_tag LOCUS_02970 73101 76997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 77201 80500 gene locus_tag LOCUS_02980 77201 80500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_02980 80633 81649 gene locus_tag LOCUS_02990 80633 81649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_02990 82434 81652 gene locus_tag LOCUS_03000 gene pcm 82434 81652 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_03000 83234 82692 gene locus_tag LOCUS_03010 83234 82692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 84475 83234 gene locus_tag LOCUS_03020 84475 83234 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_03020 85497 84472 gene locus_tag LOCUS_03030 gene ltaE 85497 84472 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_03030 86453 85608 gene locus_tag LOCUS_03040 86453 85608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 86714 88030 gene locus_tag LOCUS_03050 86714 88030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 88750 88289 gene locus_tag LOCUS_03060 88750 88289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 89161 89382 gene locus_tag LOCUS_03070 89161 89382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 89543 89743 gene locus_tag LOCUS_03080 89543 89743 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_03080 89827 90912 gene locus_tag LOCUS_03090 89827 90912 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_03090 90906 92009 gene locus_tag LOCUS_03100 gene argC 90906 92009 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD17 protein_id gnl|my_center|LOCUS_03100 92042 92929 gene locus_tag LOCUS_03110 92042 92929 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIL8 protein_id gnl|my_center|LOCUS_03110 92926 94203 gene locus_tag LOCUS_03120 gene argD 92926 94203 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_03120 94200 95348 gene locus_tag LOCUS_03130 94200 95348 CDS product acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_03130 95957 95367 gene locus_tag LOCUS_03140 95957 95367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 96371 98758 gene locus_tag LOCUS_03150 96371 98758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 98870 99784 gene locus_tag LOCUS_03160 98870 99784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 99781 100791 gene locus_tag LOCUS_03170 99781 100791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056901.1 protein_id gnl|my_center|LOCUS_03170 100784 101761 gene locus_tag LOCUS_03180 100784 101761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 101830 102525 gene locus_tag LOCUS_03190 101830 102525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 102522 103832 gene locus_tag LOCUS_03200 102522 103832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 103897 104895 gene locus_tag LOCUS_03210 gene moxR2 103897 104895 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419775.1 protein_id gnl|my_center|LOCUS_03210 105044 106393 gene locus_tag LOCUS_03220 105044 106393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057917.1 protein_id gnl|my_center|LOCUS_03220 106390 107667 gene locus_tag LOCUS_03230 gene kynU 106390 107667 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y5 protein_id gnl|my_center|LOCUS_03230 108189 107824 gene locus_tag LOCUS_03240 108189 107824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 110315 108303 gene locus_tag LOCUS_03250 110315 108303 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124155.1 protein_id gnl|my_center|LOCUS_03250 111523 110417 gene locus_tag LOCUS_03260 111523 110417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 114283 111545 gene locus_tag LOCUS_03270 114283 111545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 116036 114537 gene locus_tag LOCUS_03280 gene gltB2 116036 114537 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_03280 118042 116237 gene locus_tag LOCUS_03290 118042 116237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 118536 118051 gene locus_tag LOCUS_03300 118536 118051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 118812 119237 gene locus_tag LOCUS_03310 gene yhcV 118812 119237 CDS product CBS domain-containing protein YhcV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54606 protein_id gnl|my_center|LOCUS_03310 119659 121950 gene locus_tag LOCUS_03320 119659 121950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 122593 122033 gene locus_tag LOCUS_03330 gene msrB 122593 122033 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EK2 protein_id gnl|my_center|LOCUS_03330 123318 122773 gene locus_tag LOCUS_03340 123318 122773 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_03340 125738 123477 gene locus_tag LOCUS_03350 125738 123477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 126679 125930 gene locus_tag LOCUS_03360 126679 125930 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_03360 126852 127562 gene locus_tag LOCUS_03370 126852 127562 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_03370 127860 129956 gene locus_tag LOCUS_03380 127860 129956 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_03380 129946 130566 gene locus_tag LOCUS_03390 129946 130566 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence004 809 1636 gene locus_tag LOCUS_03400 809 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 10288 1739 gene locus_tag LOCUS_03410 10288 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 11001 11318 gene locus_tag LOCUS_03420 gene rplU 11001 11318 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84425 protein_id gnl|my_center|LOCUS_03420 11351 11611 gene locus_tag LOCUS_03430 gene rpmA 11351 11611 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_03430 11677 12936 gene locus_tag LOCUS_03440 gene obg 11677 12936 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44915 protein_id gnl|my_center|LOCUS_03440 12933 13574 gene locus_tag LOCUS_03450 gene nadD 12933 13574 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX46 protein_id gnl|my_center|LOCUS_03450 13576 14040 gene locus_tag LOCUS_03460 13576 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14061 14972 gene locus_tag LOCUS_03470 14061 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 15551 16828 gene locus_tag LOCUS_03480 15551 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 17651 16830 gene locus_tag LOCUS_03490 17651 16830 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_03490 19256 17661 gene locus_tag LOCUS_03500 19256 17661 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_03500 20364 19303 gene locus_tag LOCUS_03510 gene idiA 20364 19303 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_03510 20267 20563 gene locus_tag LOCUS_03520 20267 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 21693 20581 gene locus_tag LOCUS_03530 gene arcT 21693 20581 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_03530 21810 22883 gene locus_tag LOCUS_03540 gene ocd2 21810 22883 CDS product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888383.1 protein_id gnl|my_center|LOCUS_03540 23580 22891 gene locus_tag LOCUS_03550 23580 22891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967255.1 protein_id gnl|my_center|LOCUS_03550 23723 24274 gene locus_tag LOCUS_03560 23723 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 24278 25180 gene locus_tag LOCUS_03570 24278 25180 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_03570 25231 26316 gene locus_tag LOCUS_03580 25231 26316 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_03580 26884 26330 gene locus_tag LOCUS_03590 26884 26330 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC87 protein_id gnl|my_center|LOCUS_03590 27405 26935 gene locus_tag LOCUS_03600 gene smpB 27405 26935 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_03600 27636 28211 gene locus_tag LOCUS_03610 27636 28211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 28225 30447 gene locus_tag LOCUS_03620 28225 30447 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_03620 32739 30475 gene locus_tag LOCUS_03630 32739 30475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_03630 34004 33003 gene locus_tag LOCUS_03640 34004 33003 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_03640 35137 34007 gene locus_tag LOCUS_03650 35137 34007 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_03650 35277 38303 gene locus_tag LOCUS_03660 35277 38303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 41879 38691 gene locus_tag LOCUS_03670 41879 38691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 42039 44801 gene locus_tag LOCUS_03680 42039 44801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 44813 47413 gene locus_tag LOCUS_03690 44813 47413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 47417 48013 gene locus_tag LOCUS_03700 47417 48013 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_03700 49241 48249 gene locus_tag LOCUS_03710 49241 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 49804 51750 gene locus_tag LOCUS_03720 49804 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 54253 51779 gene locus_tag LOCUS_03730 54253 51779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 55796 54384 gene locus_tag LOCUS_03740 55796 54384 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_03740 58487 56049 gene locus_tag LOCUS_03750 58487 56049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 59086 58691 gene locus_tag LOCUS_03760 59086 58691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 59428 59832 gene locus_tag LOCUS_03770 59428 59832 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_03770 59880 61463 gene locus_tag LOCUS_03780 59880 61463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 61770 61429 gene locus_tag LOCUS_03790 61770 61429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 61801 62784 gene locus_tag LOCUS_03800 61801 62784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 62923 64137 gene locus_tag LOCUS_03810 gene aspC 62923 64137 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335565.1 protein_id gnl|my_center|LOCUS_03810 64145 65674 gene locus_tag LOCUS_03820 64145 65674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_03820 65687 66835 gene locus_tag LOCUS_03830 65687 66835 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257083.1 protein_id gnl|my_center|LOCUS_03830 66832 68553 gene locus_tag LOCUS_03840 66832 68553 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_03840 68550 69362 gene locus_tag LOCUS_03850 68550 69362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_03850 70014 69367 gene locus_tag LOCUS_03860 70014 69367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 71041 70007 gene locus_tag LOCUS_03870 71041 70007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_03870 71171 72427 gene locus_tag LOCUS_03880 71171 72427 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_03880 72447 73889 gene locus_tag LOCUS_03890 gene cls-2 72447 73889 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_03890 73956 74324 gene locus_tag LOCUS_03900 73956 74324 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ7 protein_id gnl|my_center|LOCUS_03900 74653 75600 gene locus_tag LOCUS_03910 74653 75600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 77216 75597 gene locus_tag LOCUS_03920 77216 75597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 78726 78346 gene locus_tag LOCUS_03930 78726 78346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 78996 81272 gene locus_tag LOCUS_03940 78996 81272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 81917 81258 gene locus_tag LOCUS_03950 81917 81258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 82288 83076 gene locus_tag LOCUS_03960 gene mutM 82288 83076 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_03960 83154 83966 gene locus_tag LOCUS_03970 83154 83966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 84262 84522 gene locus_tag LOCUS_03980 84262 84522 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_03980 85353 84667 gene locus_tag LOCUS_03990 85353 84667 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_03990 85649 86128 gene locus_tag LOCUS_04000 85649 86128 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_04000 88501 86198 gene locus_tag LOCUS_04010 88501 86198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 89356 88508 gene locus_tag LOCUS_04020 gene dnaC 89356 88508 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_04020 89577 91691 gene locus_tag LOCUS_04030 89577 91691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 91800 92051 gene locus_tag LOCUS_04040 91800 92051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 92048 93526 gene locus_tag LOCUS_04050 92048 93526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 94708 93764 gene locus_tag LOCUS_04060 94708 93764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 95502 94870 gene locus_tag LOCUS_04070 95502 94870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 98279 95535 gene locus_tag LOCUS_04080 98279 95535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 98335 98694 gene locus_tag LOCUS_04090 98335 98694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 98838 100262 gene locus_tag LOCUS_04100 98838 100262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 100897 100448 gene locus_tag LOCUS_04110 100897 100448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 101353 103263 gene locus_tag LOCUS_04120 101353 103263 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_04120 103600 105204 gene locus_tag LOCUS_04130 103600 105204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 105386 106816 gene locus_tag LOCUS_04140 gene dacB 105386 106816 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_04140 106944 108185 gene locus_tag LOCUS_04150 106944 108185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 109360 108182 gene locus_tag LOCUS_04160 109360 108182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 111456 109615 gene locus_tag LOCUS_04170 111456 109615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 111823 113487 gene locus_tag LOCUS_04180 111823 113487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 113635 115005 gene locus_tag LOCUS_04190 113635 115005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 115015 115539 gene locus_tag LOCUS_04200 115015 115539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04200 115597 116433 gene locus_tag LOCUS_04210 115597 116433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 117279 116443 gene locus_tag LOCUS_04220 117279 116443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 119708 117276 gene locus_tag LOCUS_04230 gene dinG 119708 117276 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_04230 120719 119748 gene locus_tag LOCUS_04240 120719 119748 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence005 2614 401 gene locus_tag LOCUS_04250 2614 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3329 2631 gene locus_tag LOCUS_04260 3329 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3734 3375 gene locus_tag LOCUS_04270 3734 3375 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_04270 4721 3897 gene locus_tag LOCUS_04280 4721 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6220 4724 gene locus_tag LOCUS_04290 6220 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6596 9421 gene locus_tag LOCUS_04300 6596 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 10012 9434 gene locus_tag LOCUS_04310 10012 9434 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_04310 10329 10628 gene locus_tag LOCUS_04320 10329 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 12323 10746 gene locus_tag LOCUS_04330 12323 10746 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887609.1 protein_id gnl|my_center|LOCUS_04330 12563 16474 gene locus_tag LOCUS_04340 gene purL 12563 16474 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_04340 16825 16529 gene locus_tag LOCUS_04350 16825 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17150 16857 gene locus_tag LOCUS_04360 17150 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 17693 18682 gene locus_tag LOCUS_04370 17693 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 19166 19591 gene locus_tag LOCUS_04380 gene gntR 19166 19591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_04380 19588 20463 gene locus_tag LOCUS_04390 19588 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20467 22185 gene locus_tag LOCUS_04400 20467 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 22999 22223 gene locus_tag LOCUS_04410 22999 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 24315 23011 gene locus_tag LOCUS_04420 24315 23011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 24490 25032 gene locus_tag LOCUS_04430 24490 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 25360 25548 gene locus_tag LOCUS_04440 25360 25548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 27700 26021 gene locus_tag LOCUS_04450 27700 26021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 28202 30718 gene locus_tag LOCUS_04460 28202 30718 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_04460 30715 31395 gene locus_tag LOCUS_04470 30715 31395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 31432 31722 gene locus_tag LOCUS_04480 31432 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 32612 31776 gene locus_tag LOCUS_04490 32612 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 34960 32660 gene locus_tag LOCUS_04500 34960 32660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 35417 35031 gene locus_tag LOCUS_04510 35417 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 36790 36230 gene locus_tag LOCUS_04520 36790 36230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 40076 36912 gene locus_tag LOCUS_04530 40076 36912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 42008 40467 gene locus_tag LOCUS_04540 gene guaA 42008 40467 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_04540 43744 42713 gene locus_tag LOCUS_04550 gene gpsA 43744 42713 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_04550 45069 43741 gene locus_tag LOCUS_04560 gene cinA 45069 43741 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKI6 protein_id gnl|my_center|LOCUS_04560 45288 47912 gene locus_tag LOCUS_04570 45288 47912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 49666 48044 gene locus_tag LOCUS_04580 49666 48044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 53303 49680 gene locus_tag LOCUS_04590 53303 49680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 53484 54104 gene locus_tag LOCUS_04600 53484 54104 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404452.1 protein_id gnl|my_center|LOCUS_04600 54097 54720 gene locus_tag LOCUS_04610 54097 54720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 54717 55376 gene locus_tag LOCUS_04620 54717 55376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 56296 55412 gene locus_tag LOCUS_04630 56296 55412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 56508 57182 gene locus_tag LOCUS_04640 56508 57182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 57823 57212 gene locus_tag LOCUS_04650 57823 57212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 58088 61108 gene locus_tag LOCUS_04660 58088 61108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_04660 61890 61357 gene locus_tag LOCUS_04670 61890 61357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 62321 62142 gene locus_tag LOCUS_04680 62321 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 65410 62642 gene locus_tag LOCUS_04690 65410 62642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 65505 66335 gene locus_tag LOCUS_04700 65505 66335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 67389 66352 gene locus_tag LOCUS_04710 gene rtcA 67389 66352 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NE24 protein_id gnl|my_center|LOCUS_04710 67542 69164 gene locus_tag LOCUS_04720 gene rtcR 67542 69164 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_04720 69270 70604 gene locus_tag LOCUS_04730 gene hemA 69270 70604 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHI6 protein_id gnl|my_center|LOCUS_04730 70601 71527 gene locus_tag LOCUS_04740 gene hemC 70601 71527 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS3 protein_id gnl|my_center|LOCUS_04740 71534 72328 gene locus_tag LOCUS_04750 71534 72328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 72388 73683 gene locus_tag LOCUS_04760 gene hemL 72388 73683 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HV8 protein_id gnl|my_center|LOCUS_04760 73680 74834 gene locus_tag LOCUS_04770 73680 74834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 74883 75599 gene locus_tag LOCUS_04780 74883 75599 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_04780 75596 76663 gene locus_tag LOCUS_04790 gene hemE 75596 76663 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_04790 76745 77896 gene locus_tag LOCUS_04800 gene hemH 76745 77896 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTB6 protein_id gnl|my_center|LOCUS_04800 78328 79044 gene locus_tag LOCUS_04810 78328 79044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 79453 79148 gene locus_tag LOCUS_04820 gene rpsN 79453 79148 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 protein_id gnl|my_center|LOCUS_04820 80382 79741 gene locus_tag LOCUS_04830 80382 79741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 80606 80400 gene locus_tag LOCUS_04840 80606 80400 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_04840 83732 80742 gene locus_tag LOCUS_04850 83732 80742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 84008 85765 gene locus_tag LOCUS_04860 84008 85765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 88064 85902 gene locus_tag LOCUS_04870 88064 85902 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_04870 89392 88268 gene locus_tag LOCUS_04880 89392 88268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 92650 89744 gene locus_tag LOCUS_04890 92650 89744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 93039 94253 gene locus_tag LOCUS_04900 93039 94253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 94253 95650 gene locus_tag LOCUS_04910 94253 95650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 95784 98021 gene locus_tag LOCUS_04920 95784 98021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 99196 98507 gene locus_tag LOCUS_04930 99196 98507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 99837 99196 gene locus_tag LOCUS_04940 gene rpoE 99837 99196 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_04940 101842 100004 gene locus_tag LOCUS_04950 101842 100004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 103388 101892 gene locus_tag LOCUS_04960 gene gatA 103388 101892 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF0 protein_id gnl|my_center|LOCUS_04960 103754 103461 gene locus_tag LOCUS_04970 103754 103461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 105294 103828 gene locus_tag LOCUS_04980 105294 103828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 107197 105449 gene locus_tag LOCUS_04990 107197 105449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence006 303 2303 gene locus_tag LOCUS_05000 303 2303 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_05000 2309 2581 gene locus_tag LOCUS_05010 2309 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3490 2471 gene locus_tag LOCUS_05020 3490 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5289 3487 gene locus_tag LOCUS_05030 5289 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6675 5629 gene locus_tag LOCUS_05040 6675 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 8203 7496 gene locus_tag LOCUS_05050 8203 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 8400 8194 gene locus_tag LOCUS_05060 8400 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8946 9875 gene locus_tag LOCUS_05070 8946 9875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_05070 9865 11502 gene locus_tag LOCUS_05080 9865 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_05080 11795 13177 gene locus_tag LOCUS_05090 11795 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 13518 13967 gene locus_tag LOCUS_05100 13518 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 13967 15724 gene locus_tag LOCUS_05110 13967 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15853 16767 gene locus_tag LOCUS_05120 15853 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_05120 17530 16811 gene locus_tag LOCUS_05130 17530 16811 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_05130 19351 17540 gene locus_tag LOCUS_05140 19351 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 19402 19968 gene locus_tag LOCUS_05150 19402 19968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 20595 20023 gene locus_tag LOCUS_05160 20595 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 20887 21891 gene locus_tag LOCUS_05170 20887 21891 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403447.1 protein_id gnl|my_center|LOCUS_05170 22613 22038 gene locus_tag LOCUS_05180 22613 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 23384 22779 gene locus_tag LOCUS_05190 23384 22779 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_05190 24544 23450 gene locus_tag LOCUS_05200 gene murB 24544 23450 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L7 protein_id gnl|my_center|LOCUS_05200 27101 24705 gene locus_tag LOCUS_05210 27101 24705 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887384.1 protein_id gnl|my_center|LOCUS_05210 28166 27150 gene locus_tag LOCUS_05220 gene deoC 28166 27150 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y407 protein_id gnl|my_center|LOCUS_05220 29511 28387 gene locus_tag LOCUS_05230 29511 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 32660 29508 gene locus_tag LOCUS_05240 32660 29508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 32892 34433 gene locus_tag LOCUS_05250 32892 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 34833 35723 gene locus_tag LOCUS_05260 34833 35723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 37155 35740 gene locus_tag LOCUS_05270 37155 35740 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635937.2 protein_id gnl|my_center|LOCUS_05270 37602 40175 gene locus_tag LOCUS_05280 37602 40175 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_05280 40799 40332 gene locus_tag LOCUS_05290 40799 40332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 42256 41177 gene locus_tag LOCUS_05300 gene mnmA 42256 41177 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_05300 44376 42253 gene locus_tag LOCUS_05310 44376 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 46261 44447 gene locus_tag LOCUS_05320 46261 44447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 46756 47187 gene locus_tag LOCUS_05330 gene hit 46756 47187 CDS product protein hit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 protein_id gnl|my_center|LOCUS_05330 47374 49827 gene locus_tag LOCUS_05340 47374 49827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 49994 51151 gene locus_tag LOCUS_05350 gene mvaS 49994 51151 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_05350 51148 52410 gene locus_tag LOCUS_05360 51148 52410 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_05360 52858 52457 gene locus_tag LOCUS_05370 52858 52457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 54394 53063 gene locus_tag LOCUS_05380 54394 53063 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_05380 54704 55987 gene locus_tag LOCUS_05390 54704 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 56012 57577 gene locus_tag LOCUS_05400 56012 57577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 57574 58344 gene locus_tag LOCUS_05410 57574 58344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_05410 58598 63337 gene locus_tag LOCUS_05420 58598 63337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 65345 63369 gene locus_tag LOCUS_05430 65345 63369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 65516 65866 gene locus_tag LOCUS_05440 65516 65866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 65909 67207 gene locus_tag LOCUS_05450 65909 67207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 67224 68255 gene locus_tag LOCUS_05460 67224 68255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_05460 68471 70126 gene locus_tag LOCUS_05470 68471 70126 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538261.1 protein_id gnl|my_center|LOCUS_05470 70718 70110 gene locus_tag LOCUS_05480 70718 70110 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_05480 70822 71784 gene locus_tag LOCUS_05490 gene fmt 70822 71784 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K5 protein_id gnl|my_center|LOCUS_05490 72379 71798 gene locus_tag LOCUS_05500 72379 71798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 72507 73301 gene locus_tag LOCUS_05510 72507 73301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_05510 73294 74016 gene locus_tag LOCUS_05520 gene lipB 73294 74016 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_05520 74020 75072 gene locus_tag LOCUS_05530 74020 75072 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969045.1 protein_id gnl|my_center|LOCUS_05530 76934 75090 gene locus_tag LOCUS_05540 76934 75090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 78411 76954 gene locus_tag LOCUS_05550 gene purB 78411 76954 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_05550 78791 80062 gene locus_tag LOCUS_05560 gene arcA 78791 80062 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZA0 protein_id gnl|my_center|LOCUS_05560 80157 81875 gene locus_tag LOCUS_05570 80157 81875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 81975 82529 gene locus_tag LOCUS_05580 81975 82529 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_05580 83971 82958 gene locus_tag LOCUS_05590 83971 82958 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05590 85456 84059 gene locus_tag LOCUS_05600 85456 84059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 86444 85530 gene locus_tag LOCUS_05610 86444 85530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 86819 87535 gene locus_tag LOCUS_05620 gene pyrE 86819 87535 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5H4 protein_id gnl|my_center|LOCUS_05620 88709 87543 gene locus_tag LOCUS_05630 88709 87543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 90605 88770 gene locus_tag LOCUS_05640 gene bipA 90605 88770 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_05640 91497 90877 gene locus_tag LOCUS_05650 gene radC 91497 90877 CDS product UPF0758 protein YicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENI1 protein_id gnl|my_center|LOCUS_05650 92759 91521 gene locus_tag LOCUS_05660 92759 91521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 93263 94327 gene locus_tag LOCUS_05670 93263 94327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 94640 94933 gene locus_tag LOCUS_05680 94640 94933 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556155.1 protein_id gnl|my_center|LOCUS_05680 95337 97151 gene locus_tag LOCUS_05690 95337 97151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 97282 98931 gene locus_tag LOCUS_05700 97282 98931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 99298 99101 gene locus_tag LOCUS_05710 99298 99101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 99260 101812 gene locus_tag LOCUS_05720 99260 101812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence007 1 420 gene locus_tag LOCUS_05730 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 620 2452 gene locus_tag LOCUS_05740 620 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2449 4734 gene locus_tag LOCUS_05750 2449 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4731 5939 gene locus_tag LOCUS_05760 4731 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6792 6022 gene locus_tag LOCUS_05770 6792 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7991 6957 gene locus_tag LOCUS_05780 7991 6957 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_05780 8568 8014 gene locus_tag LOCUS_05790 8568 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 10023 8611 gene locus_tag LOCUS_05800 10023 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_05800 10492 10082 gene locus_tag LOCUS_05810 10492 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11324 10668 gene locus_tag LOCUS_05820 11324 10668 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_05820 13974 11362 gene locus_tag LOCUS_05830 gene gyrA 13974 11362 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_05830 16538 14082 gene locus_tag LOCUS_05840 gene gyrB 16538 14082 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_05840 17921 16821 gene locus_tag LOCUS_05850 gene recF 17921 16821 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9U9 protein_id gnl|my_center|LOCUS_05850 19044 17953 gene locus_tag LOCUS_05860 gene dnaN 19044 17953 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_05860 20467 19391 gene locus_tag LOCUS_05870 20467 19391 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140868.1 protein_id gnl|my_center|LOCUS_05870 21013 22299 gene locus_tag LOCUS_05880 gene dnaA 21013 22299 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXP7 protein_id gnl|my_center|LOCUS_05880 23326 22334 gene locus_tag LOCUS_05890 23326 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 23961 23386 gene locus_tag LOCUS_05900 23961 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 25264 23969 gene locus_tag LOCUS_05910 25264 23969 CDS product 4-aminobutyrate aminotransferase GabT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704934.1 protein_id gnl|my_center|LOCUS_05910 25848 25264 gene locus_tag LOCUS_05920 gene recR 25848 25264 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_05920 26147 25854 gene locus_tag LOCUS_05930 26147 25854 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK81 protein_id gnl|my_center|LOCUS_05930 28057 26144 gene locus_tag LOCUS_05940 28057 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 28511 28993 gene locus_tag LOCUS_05950 gene tadA 28511 28993 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H28 protein_id gnl|my_center|LOCUS_05950 29023 29112 gene locus_tag LOCUS_t00010 29023 29112 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29212 29301 gene locus_tag LOCUS_t00020 29212 29301 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30338 32056 gene locus_tag LOCUS_05960 gene yidC 30338 32056 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_05960 32176 33219 gene locus_tag LOCUS_05970 32176 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 33331 34146 gene locus_tag LOCUS_05980 33331 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 34495 35253 gene locus_tag LOCUS_05990 gene parA 34495 35253 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_05990 35256 36149 gene locus_tag LOCUS_06000 35256 36149 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_06000 36149 36565 gene locus_tag LOCUS_06010 36149 36565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 38391 36721 gene locus_tag LOCUS_06020 38391 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 38885 38523 gene locus_tag LOCUS_06030 38885 38523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 39680 38988 gene locus_tag LOCUS_06040 gene lepB 39680 38988 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E75 protein_id gnl|my_center|LOCUS_06040 40096 40500 gene locus_tag LOCUS_06050 40096 40500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 40592 41206 gene locus_tag LOCUS_06060 40592 41206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 41263 41628 gene locus_tag LOCUS_06070 41263 41628 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979305.1 protein_id gnl|my_center|LOCUS_06070 42066 41725 gene locus_tag LOCUS_06080 42066 41725 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_06080 42539 42093 gene locus_tag LOCUS_06090 42539 42093 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_06090 43817 42549 gene locus_tag LOCUS_06100 43817 42549 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_06100 45211 43883 gene locus_tag LOCUS_06110 45211 43883 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_06110 45995 45222 gene locus_tag LOCUS_06120 gene ynhD 45995 45222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_06120 47564 46119 gene locus_tag LOCUS_06130 gene ycf24 47564 46119 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_06130 48219 47725 gene locus_tag LOCUS_06140 48219 47725 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_06140 50387 48561 gene locus_tag LOCUS_06150 50387 48561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 51542 50388 gene locus_tag LOCUS_06160 gene tqsA 51542 50388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_06160 51951 51610 gene locus_tag LOCUS_06170 51951 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 52267 52920 gene locus_tag LOCUS_06180 gene msrA 52267 52920 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_06180 53241 52936 gene locus_tag LOCUS_06190 53241 52936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 53615 54838 gene locus_tag LOCUS_06200 gene livJ 53615 54838 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726149.1 protein_id gnl|my_center|LOCUS_06200 55008 55850 gene locus_tag LOCUS_06210 55008 55850 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_06210 55847 57169 gene locus_tag LOCUS_06220 55847 57169 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_06220 57214 57510 gene locus_tag LOCUS_06230 57214 57510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_06230 57546 58856 gene locus_tag LOCUS_06240 57546 58856 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_06240 59089 60750 gene locus_tag LOCUS_06250 59089 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 60865 61410 gene locus_tag LOCUS_06260 60865 61410 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_06260 64792 61373 gene locus_tag LOCUS_06270 64792 61373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 64963 66495 gene locus_tag LOCUS_06280 64963 66495 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_06280 66495 67004 gene locus_tag LOCUS_06290 66495 67004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 67001 67618 gene locus_tag LOCUS_06300 67001 67618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 67709 68815 gene locus_tag LOCUS_06310 67709 68815 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_06310 68812 69411 gene locus_tag LOCUS_06320 68812 69411 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_06320 69408 69704 gene locus_tag LOCUS_06330 69408 69704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 69694 71502 gene locus_tag LOCUS_06340 69694 71502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 71499 72680 gene locus_tag LOCUS_06350 71499 72680 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_06350 73222 72689 gene locus_tag LOCUS_06360 73222 72689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 74813 73341 gene locus_tag LOCUS_06370 gene panF 74813 73341 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_06370 75079 74813 gene locus_tag LOCUS_06380 75079 74813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 75190 75930 gene locus_tag LOCUS_06390 gene smuG1 75190 75930 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_06390 76435 75944 gene locus_tag LOCUS_06400 76435 75944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_06400 77777 76428 gene locus_tag LOCUS_06410 77777 76428 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_06410 80187 77884 gene locus_tag LOCUS_06420 80187 77884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 80413 81501 gene locus_tag LOCUS_06430 80413 81501 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_06430 81537 82703 gene locus_tag LOCUS_06440 81537 82703 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_06440 82772 83383 gene locus_tag LOCUS_06450 82772 83383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 83550 84269 gene locus_tag LOCUS_06460 83550 84269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 84379 85539 gene locus_tag LOCUS_06470 84379 85539 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_06470 85541 86473 gene locus_tag LOCUS_06480 85541 86473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 86543 87565 gene locus_tag LOCUS_06490 86543 87565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 87651 88823 gene locus_tag LOCUS_06500 87651 88823 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_06500 89509 88838 gene locus_tag LOCUS_06510 89509 88838 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040230.1 protein_id gnl|my_center|LOCUS_06510 89803 89877 gene locus_tag LOCUS_t00030 89803 89877 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 89997 91358 gene locus_tag LOCUS_06520 89997 91358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 93515 91713 gene locus_tag LOCUS_06530 93515 91713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 95972 93705 gene locus_tag LOCUS_06540 95972 93705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 97481 95976 gene locus_tag LOCUS_06550 gene cafA 97481 95976 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_06550 98630 97491 gene locus_tag LOCUS_06560 gene rodA 98630 97491 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_06560 <100062 98587 gene locus_tag LOCUS_06570 <100062 98587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence008 455 679 gene locus_tag LOCUS_06580 455 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 881 2113 gene locus_tag LOCUS_06590 881 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_06590 2336 3127 gene locus_tag LOCUS_06600 2336 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4327 3191 gene locus_tag LOCUS_06610 4327 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5268 4324 gene locus_tag LOCUS_06620 5268 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5935 5723 gene locus_tag LOCUS_06630 5935 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6286 6726 gene locus_tag LOCUS_06640 6286 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6973 7251 gene locus_tag LOCUS_06650 6973 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8333 7308 gene locus_tag LOCUS_06660 8333 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 8877 8320 gene locus_tag LOCUS_06670 8877 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8980 10515 gene locus_tag LOCUS_06680 8980 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10576 11133 gene locus_tag LOCUS_06690 10576 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13559 11235 gene locus_tag LOCUS_06700 13559 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 13622 14686 gene locus_tag LOCUS_06710 13622 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 15814 14678 gene locus_tag LOCUS_06720 15814 14678 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_06720 15996 16856 gene locus_tag LOCUS_06730 15996 16856 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_06730 17439 16870 gene locus_tag LOCUS_06740 17439 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_06740 18383 17454 gene locus_tag LOCUS_06750 18383 17454 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_06750 19622 18396 gene locus_tag LOCUS_06760 19622 18396 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_06760 21345 19816 gene locus_tag LOCUS_06770 21345 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21505 21861 gene locus_tag LOCUS_06780 21505 21861 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_06780 22205 24916 gene locus_tag LOCUS_06790 22205 24916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25356 26651 gene locus_tag LOCUS_06800 25356 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 27081 26719 gene locus_tag LOCUS_06810 27081 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 27414 30338 gene locus_tag LOCUS_06820 gene gcvP 27414 30338 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_06820 30406 34116 gene locus_tag LOCUS_06830 30406 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 35475 34225 gene locus_tag LOCUS_06840 35475 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 36343 35492 gene locus_tag LOCUS_06850 36343 35492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_06850 37346 36804 gene locus_tag LOCUS_06860 37346 36804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 38862 37441 gene locus_tag LOCUS_06870 38862 37441 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_06870 39715 38873 gene locus_tag LOCUS_06880 39715 38873 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_06880 40040 39696 gene locus_tag LOCUS_06890 40040 39696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 41641 40037 gene locus_tag LOCUS_06900 gene prnC 41641 40037 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_06900 42596 41634 gene locus_tag LOCUS_06910 42596 41634 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118476.1 protein_id gnl|my_center|LOCUS_06910 43928 42603 gene locus_tag LOCUS_06920 43928 42603 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_06920 44556 44041 gene locus_tag LOCUS_06930 44556 44041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 44790 45662 gene locus_tag LOCUS_06940 44790 45662 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_06940 46255 48219 gene locus_tag LOCUS_06950 46255 48219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 48335 51328 gene locus_tag LOCUS_06960 48335 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 51419 53779 gene locus_tag LOCUS_06970 gene mrcB 51419 53779 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_06970 53776 54192 gene locus_tag LOCUS_06980 53776 54192 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_06980 56046 54217 gene locus_tag LOCUS_06990 56046 54217 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_06990 56357 56043 gene locus_tag LOCUS_07000 56357 56043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 57862 56357 gene locus_tag LOCUS_07010 57862 56357 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_07010 59370 57859 gene locus_tag LOCUS_07020 59370 57859 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_07020 59723 59367 gene locus_tag LOCUS_07030 59723 59367 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_07030 60215 59769 gene locus_tag LOCUS_07040 60215 59769 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_07040 60853 60212 gene locus_tag LOCUS_07050 60853 60212 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_07050 61179 60850 gene locus_tag LOCUS_07060 61179 60850 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_07060 61475 61170 gene locus_tag LOCUS_07070 61475 61170 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_07070 62002 61472 gene locus_tag LOCUS_07080 62002 61472 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_07080 62555 62112 gene locus_tag LOCUS_07090 62555 62112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 63309 62728 gene locus_tag LOCUS_07100 63309 62728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 64735 63737 gene locus_tag LOCUS_07110 64735 63737 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_07110 65751 64732 gene locus_tag LOCUS_07120 gene gap 65751 64732 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_07120 67126 65798 gene locus_tag LOCUS_07130 gene pfkA 67126 65798 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXU6 protein_id gnl|my_center|LOCUS_07130 67777 67205 gene locus_tag LOCUS_07140 67777 67205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 68293 67799 gene locus_tag LOCUS_07150 68293 67799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 68799 68491 gene locus_tag LOCUS_07160 68799 68491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 71093 68916 gene locus_tag LOCUS_07170 71093 68916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 71252 71899 gene locus_tag LOCUS_07180 gene algU 71252 71899 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_07180 71896 73020 gene locus_tag LOCUS_07190 71896 73020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 73017 73649 gene locus_tag LOCUS_07200 73017 73649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 73799 76597 gene locus_tag LOCUS_07210 73799 76597 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227885.1 protein_id gnl|my_center|LOCUS_07210 76635 77675 gene locus_tag LOCUS_07220 76635 77675 CDS product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_07220 77974 79374 gene locus_tag LOCUS_07230 77974 79374 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_07230 80808 79480 gene locus_tag LOCUS_07240 80808 79480 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX8 protein_id gnl|my_center|LOCUS_07240 81222 82034 gene locus_tag LOCUS_07250 81222 82034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 82055 83599 gene locus_tag LOCUS_07260 gene merA 82055 83599 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_07260 84132 86954 gene locus_tag LOCUS_07270 84132 86954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 88914 86977 gene locus_tag LOCUS_07280 88914 86977 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_07280 89668 88934 gene locus_tag LOCUS_07290 89668 88934 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_07290 90534 89665 gene locus_tag LOCUS_07300 gene prmA 90534 89665 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD89 protein_id gnl|my_center|LOCUS_07300 91667 90552 gene locus_tag LOCUS_07310 gene dnaJ 91667 90552 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_07310 93664 91847 gene locus_tag LOCUS_07320 gene dnaK 93664 91847 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_07320 94671 93904 gene locus_tag LOCUS_07330 94671 93904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 95944 94781 gene locus_tag LOCUS_07340 gene hrcA 95944 94781 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_07340 96099 96962 gene locus_tag LOCUS_07350 96099 96962 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence009 <1 1980 gene locus_tag LOCUS_07360 <1 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54741:serine/threonine-protein kinase AfsK 2672 2028 gene locus_tag LOCUS_07370 gene lexA 2672 2028 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A92 protein_id gnl|my_center|LOCUS_07370 2838 4103 gene locus_tag LOCUS_07380 2838 4103 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_07380 4195 5547 gene locus_tag LOCUS_07390 4195 5547 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_07390 6817 5567 gene locus_tag LOCUS_07400 6817 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_07400 8730 6814 gene locus_tag LOCUS_07410 8730 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 9029 11104 gene locus_tag LOCUS_07420 gene fusA-1 9029 11104 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_07420 12011 11133 gene locus_tag LOCUS_07430 12011 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 12488 12258 gene locus_tag LOCUS_07440 12488 12258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12393 13328 gene locus_tag LOCUS_07450 gene gcvT 12393 13328 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_07450 13449 13838 gene locus_tag LOCUS_07460 gene gcvH 13449 13838 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_07460 13923 14318 gene locus_tag LOCUS_07470 13923 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 15991 14336 gene locus_tag LOCUS_07480 15991 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 17200 16085 gene locus_tag LOCUS_07490 17200 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18864 17212 gene locus_tag LOCUS_07500 18864 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 19073 19822 gene locus_tag LOCUS_07510 19073 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 22823 19827 gene locus_tag LOCUS_07520 22823 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 23643 22855 gene locus_tag LOCUS_07530 23643 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 24288 23647 gene locus_tag LOCUS_07540 24288 23647 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_07540 24421 26229 gene locus_tag LOCUS_07550 24421 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 26305 27144 gene locus_tag LOCUS_07560 26305 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 27679 27185 gene locus_tag LOCUS_07570 27679 27185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 28014 28217 gene locus_tag LOCUS_07580 28014 28217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_07580 28463 29344 gene locus_tag LOCUS_07590 28463 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 30746 29667 gene locus_tag LOCUS_07600 30746 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106537.1 protein_id gnl|my_center|LOCUS_07600 31038 32528 gene locus_tag LOCUS_07610 31038 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 32525 33271 gene locus_tag LOCUS_07620 32525 33271 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_07620 33268 35010 gene locus_tag LOCUS_07630 33268 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 35177 37102 gene locus_tag LOCUS_07640 35177 37102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 37165 39144 gene locus_tag LOCUS_07650 37165 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 40192 39107 gene locus_tag LOCUS_07660 40192 39107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_07660 40332 40691 gene locus_tag LOCUS_07670 40332 40691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 40874 42238 gene locus_tag LOCUS_07680 40874 42238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 42238 43929 gene locus_tag LOCUS_07690 42238 43929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 43929 47096 gene locus_tag LOCUS_07700 43929 47096 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_07700 47155 47685 gene locus_tag LOCUS_07710 47155 47685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 49530 47911 gene locus_tag LOCUS_07720 49530 47911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 49963 49523 gene locus_tag LOCUS_07730 49963 49523 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_07730 50312 51985 gene locus_tag LOCUS_07740 50312 51985 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_07740 52119 53297 gene locus_tag LOCUS_07750 52119 53297 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW7 protein_id gnl|my_center|LOCUS_07750 53297 55726 gene locus_tag LOCUS_07760 53297 55726 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_07760 60548 56007 gene locus_tag LOCUS_07770 60548 56007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 63006 60715 gene locus_tag LOCUS_07780 63006 60715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 64904 62997 gene locus_tag LOCUS_07790 64904 62997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 65724 69983 gene locus_tag LOCUS_07800 65724 69983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 70736 70305 gene locus_tag LOCUS_07810 70736 70305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07810 70989 70738 gene locus_tag LOCUS_07820 70989 70738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 73023 71290 gene locus_tag LOCUS_07830 73023 71290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 73270 74088 gene locus_tag LOCUS_07840 gene paaG 73270 74088 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_07840 74624 74220 gene locus_tag LOCUS_07850 74624 74220 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_07850 75409 74621 gene locus_tag LOCUS_07860 75409 74621 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_07860 77913 75595 gene locus_tag LOCUS_07870 77913 75595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 78041 78349 gene locus_tag LOCUS_07880 78041 78349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 78757 78930 gene locus_tag LOCUS_07890 78757 78930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 79056 79784 gene locus_tag LOCUS_07900 79056 79784 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_07900 80356 82539 gene locus_tag LOCUS_07910 80356 82539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 82663 85908 gene locus_tag LOCUS_07920 82663 85908 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_07920 85931 86638 gene locus_tag LOCUS_07930 85931 86638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 88294 86696 gene locus_tag LOCUS_07940 88294 86696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 88658 88308 gene locus_tag LOCUS_07950 88658 88308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 89099 88674 gene locus_tag LOCUS_07960 gene rsbW 89099 88674 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_07960 89342 89184 gene locus_tag LOCUS_07970 89342 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 91166 89643 gene locus_tag LOCUS_07980 91166 89643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 91247 92740 gene locus_tag LOCUS_07990 91247 92740 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_07990 94195 92747 gene locus_tag LOCUS_08000 94195 92747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 95291 94230 gene locus_tag LOCUS_08010 95291 94230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence010 2064 1318 gene locus_tag LOCUS_08020 gene drrA 2064 1318 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_08020 3596 2199 gene locus_tag LOCUS_08030 3596 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 3831 5105 gene locus_tag LOCUS_08040 3831 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5102 5842 gene locus_tag LOCUS_08050 5102 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5913 5815 gene locus_tag LOCUS_t00040 5913 5815 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7369 6719 gene locus_tag LOCUS_08060 7369 6719 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_08060 8793 7366 gene locus_tag LOCUS_08070 8793 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8951 9202 gene locus_tag LOCUS_08080 8951 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 9297 10136 gene locus_tag LOCUS_08090 9297 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11399 10167 gene locus_tag LOCUS_08100 gene mauG 11399 10167 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_08100 11896 11390 gene locus_tag LOCUS_08110 11896 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12817 12035 gene locus_tag LOCUS_08120 12817 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14349 13090 gene locus_tag LOCUS_08130 14349 13090 CDS product aminopeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42778 protein_id gnl|my_center|LOCUS_08130 14443 15210 gene locus_tag LOCUS_08140 gene paaG 14443 15210 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_08140 19547 16068 gene locus_tag LOCUS_08150 19547 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 19917 22388 gene locus_tag LOCUS_08160 19917 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22428 22991 gene locus_tag LOCUS_08170 22428 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 23123 24667 gene locus_tag LOCUS_08180 gene cysS 23123 24667 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_08180 25152 24676 gene locus_tag LOCUS_08190 25152 24676 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 protein_id gnl|my_center|LOCUS_08190 25220 26503 gene locus_tag LOCUS_08200 25220 26503 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_08200 26812 26576 gene locus_tag LOCUS_08210 26812 26576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 26708 27835 gene locus_tag LOCUS_08220 26708 27835 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089757.1 protein_id gnl|my_center|LOCUS_08220 27892 31071 gene locus_tag LOCUS_08230 27892 31071 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_08230 31113 31697 gene locus_tag LOCUS_08240 31113 31697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 31899 32729 gene locus_tag LOCUS_08250 31899 32729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 33022 33402 gene locus_tag LOCUS_08260 33022 33402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 34739 33546 gene locus_tag LOCUS_08270 gene chrA 34739 33546 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_08270 36022 34853 gene locus_tag LOCUS_08280 36022 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 37229 36339 gene locus_tag LOCUS_08290 gene pstB 37229 36339 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_08290 39208 37253 gene locus_tag LOCUS_08300 39208 37253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 41991 39250 gene locus_tag LOCUS_08310 41991 39250 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_08310 43284 42304 gene locus_tag LOCUS_08320 gene pstS 43284 42304 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_08320 43538 44314 gene locus_tag LOCUS_08330 43538 44314 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_08330 44472 46757 gene locus_tag LOCUS_08340 44472 46757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 46951 48450 gene locus_tag LOCUS_08350 46951 48450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 51276 48541 gene locus_tag LOCUS_08360 51276 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 52097 51273 gene locus_tag LOCUS_08370 52097 51273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 52395 52781 gene locus_tag LOCUS_08380 52395 52781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 55060 52796 gene locus_tag LOCUS_08390 55060 52796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 55445 56827 gene locus_tag LOCUS_08400 55445 56827 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_08400 57294 59453 gene locus_tag LOCUS_08410 57294 59453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 60036 59539 gene locus_tag LOCUS_08420 60036 59539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 60413 60129 gene locus_tag LOCUS_08430 60413 60129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 61207 60410 gene locus_tag LOCUS_08440 61207 60410 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_08440 61839 61330 gene locus_tag LOCUS_08450 61839 61330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 62792 62037 gene locus_tag LOCUS_08460 62792 62037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 64460 63102 gene locus_tag LOCUS_08470 64460 63102 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_08470 66619 64457 gene locus_tag LOCUS_08480 66619 64457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 67032 68075 gene locus_tag LOCUS_08490 gene gapA 67032 68075 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP4 protein_id gnl|my_center|LOCUS_08490 68096 69301 gene locus_tag LOCUS_08500 gene pgk 68096 69301 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_08500 69298 70062 gene locus_tag LOCUS_08510 gene tpiA 69298 70062 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_08510 70133 70621 gene locus_tag LOCUS_08520 70133 70621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 70767 70853 gene locus_tag LOCUS_t00050 70767 70853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70976 71692 gene locus_tag LOCUS_08530 gene mobA 70976 71692 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX0 protein_id gnl|my_center|LOCUS_08530 72031 73305 gene locus_tag LOCUS_08540 gene gltA 72031 73305 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_08540 73701 73444 gene locus_tag LOCUS_08550 73701 73444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 74936 73962 gene locus_tag LOCUS_08560 74936 73962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 76930 75125 gene locus_tag LOCUS_08570 76930 75125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 77163 77636 gene locus_tag LOCUS_08580 77163 77636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 77731 78225 gene locus_tag LOCUS_08590 gene mglB 77731 78225 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_08590 78238 78822 gene locus_tag LOCUS_08600 gene mglA 78238 78822 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_08600 78977 79459 gene locus_tag LOCUS_08610 78977 79459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 79536 80564 gene locus_tag LOCUS_08620 79536 80564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 80557 81954 gene locus_tag LOCUS_08630 gene glmU 80557 81954 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KB0 protein_id gnl|my_center|LOCUS_08630 >Feature sequence011 353 982 gene locus_tag LOCUS_08640 353 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 979 1854 gene locus_tag LOCUS_08650 979 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942018.1 protein_id gnl|my_center|LOCUS_08650 3174 1837 gene locus_tag LOCUS_08660 gene dgt 3174 1837 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_08660 3818 3267 gene locus_tag LOCUS_08670 3818 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3990 4754 gene locus_tag LOCUS_08680 3990 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5608 4811 gene locus_tag LOCUS_08690 5608 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6075 6590 gene locus_tag LOCUS_08700 6075 6590 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808853.1 protein_id gnl|my_center|LOCUS_08700 6795 8960 gene locus_tag LOCUS_08710 6795 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9209 9772 gene locus_tag LOCUS_08720 9209 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 9870 12944 gene locus_tag LOCUS_08730 9870 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 13183 14976 gene locus_tag LOCUS_08740 13183 14976 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB80 protein_id gnl|my_center|LOCUS_08740 15836 15126 gene locus_tag LOCUS_08750 15836 15126 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865376.1 protein_id gnl|my_center|LOCUS_08750 16954 16130 gene locus_tag LOCUS_08760 16954 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 17237 19123 gene locus_tag LOCUS_08770 17237 19123 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_08770 19414 19235 gene locus_tag LOCUS_08780 19414 19235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 19522 21015 gene locus_tag LOCUS_08790 19522 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 21930 21019 gene locus_tag LOCUS_08800 21930 21019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 23731 21902 gene locus_tag LOCUS_08810 23731 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 25615 23774 gene locus_tag LOCUS_08820 25615 23774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 25832 26626 gene locus_tag LOCUS_08830 gene ycgL 25832 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94389 protein_id gnl|my_center|LOCUS_08830 26655 27524 gene locus_tag LOCUS_08840 26655 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 27653 28555 gene locus_tag LOCUS_08850 27653 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 29977 28721 gene locus_tag LOCUS_08860 29977 28721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_08860 30198 31838 gene locus_tag LOCUS_08870 30198 31838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 33234 31864 gene locus_tag LOCUS_08880 33234 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 34847 33375 gene locus_tag LOCUS_08890 gene guaB 34847 33375 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_08890 35190 35759 gene locus_tag LOCUS_08900 35190 35759 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_08900 35845 36498 gene locus_tag LOCUS_08910 35845 36498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 36719 38731 gene locus_tag LOCUS_08920 36719 38731 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457972.1 protein_id gnl|my_center|LOCUS_08920 38877 40061 gene locus_tag LOCUS_08930 38877 40061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 40875 40063 gene locus_tag LOCUS_08940 40875 40063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 41656 40889 gene locus_tag LOCUS_08950 41656 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 42861 42178 gene locus_tag LOCUS_08960 42861 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 43607 43242 gene locus_tag LOCUS_08970 43607 43242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_08970 44125 43640 gene locus_tag LOCUS_08980 44125 43640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 44706 44122 gene locus_tag LOCUS_08990 gene algU 44706 44122 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_08990 45103 46818 gene locus_tag LOCUS_09000 45103 46818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_09000 47128 50364 gene locus_tag LOCUS_09010 47128 50364 CDS product 4-aminobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 protein_id gnl|my_center|LOCUS_09010 50650 52404 gene locus_tag LOCUS_09020 50650 52404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 53741 52422 gene locus_tag LOCUS_09030 53741 52422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 55420 53957 gene locus_tag LOCUS_09040 55420 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 56788 55652 gene locus_tag LOCUS_09050 56788 55652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 57013 57462 gene locus_tag LOCUS_09060 57013 57462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 57725 58504 gene locus_tag LOCUS_09070 57725 58504 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_09070 61553 58698 gene locus_tag LOCUS_09080 61553 58698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 62133 61573 gene locus_tag LOCUS_09090 62133 61573 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_09090 62548 62246 gene locus_tag LOCUS_09100 62548 62246 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPS6 protein_id gnl|my_center|LOCUS_09100 62896 64647 gene locus_tag LOCUS_09110 62896 64647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 64700 65257 gene locus_tag LOCUS_09120 64700 65257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 65441 67273 gene locus_tag LOCUS_09130 65441 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 68245 67310 gene locus_tag LOCUS_09140 68245 67310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 70062 68287 gene locus_tag LOCUS_09150 70062 68287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 70388 71251 gene locus_tag LOCUS_09160 70388 71251 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_09160 71268 71711 gene locus_tag LOCUS_09170 71268 71711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 71708 72481 gene locus_tag LOCUS_09180 71708 72481 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709510.1 protein_id gnl|my_center|LOCUS_09180 72564 73577 gene locus_tag LOCUS_09190 72564 73577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 74722 73589 gene locus_tag LOCUS_09200 74722 73589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_09200 74851 75180 gene locus_tag LOCUS_09210 gene clpS 74851 75180 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWS9 protein_id gnl|my_center|LOCUS_09210 75243 77636 gene locus_tag LOCUS_09220 75243 77636 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_09220 78300 77644 gene locus_tag LOCUS_09230 78300 77644 CDS product lipoprotein, RlpA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546239.1 protein_id gnl|my_center|LOCUS_09230 78545 80224 gene locus_tag LOCUS_09240 78545 80224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 80224 80766 gene locus_tag LOCUS_09250 80224 80766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence012 22521 3241 gene locus_tag LOCUS_09260 22521 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 28509 22903 gene locus_tag LOCUS_09270 28509 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 31395 29068 gene locus_tag LOCUS_09280 31395 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 31566 32933 gene locus_tag LOCUS_09290 gene pepT 31566 32933 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_09290 34438 33038 gene locus_tag LOCUS_09300 34438 33038 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_09300 34716 34486 gene locus_tag LOCUS_09310 34716 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 34625 35866 gene locus_tag LOCUS_09320 34625 35866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 35928 37712 gene locus_tag LOCUS_09330 35928 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 37709 38227 gene locus_tag LOCUS_09340 37709 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 38303 39325 gene locus_tag LOCUS_09350 38303 39325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 40539 39361 gene locus_tag LOCUS_09360 40539 39361 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_09360 40977 40558 gene locus_tag LOCUS_09370 40977 40558 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 protein_id gnl|my_center|LOCUS_09370 41401 41063 gene locus_tag LOCUS_09380 41401 41063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 41730 43679 gene locus_tag LOCUS_09390 41730 43679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 44361 43735 gene locus_tag LOCUS_09400 44361 43735 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024390.1 protein_id gnl|my_center|LOCUS_09400 44651 45943 gene locus_tag LOCUS_09410 44651 45943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47080 45974 gene locus_tag LOCUS_09420 47080 45974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 51562 47360 gene locus_tag LOCUS_09430 51562 47360 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_09430 52783 51725 gene locus_tag LOCUS_09440 52783 51725 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_09440 53015 54655 gene locus_tag LOCUS_09450 53015 54655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 55744 54842 gene locus_tag LOCUS_09460 55744 54842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 56983 55859 gene locus_tag LOCUS_09470 56983 55859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 protein_id gnl|my_center|LOCUS_09470 58723 56990 gene locus_tag LOCUS_09480 58723 56990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 59233 60084 gene locus_tag LOCUS_09490 gene hbd 59233 60084 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_09490 60189 62057 gene locus_tag LOCUS_09500 60189 62057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 62156 63853 gene locus_tag LOCUS_09510 gene proS 62156 63853 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_09510 64608 63940 gene locus_tag LOCUS_09520 64608 63940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 65784 64780 gene locus_tag LOCUS_09530 65784 64780 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YX1 protein_id gnl|my_center|LOCUS_09530 65968 66741 gene locus_tag LOCUS_09540 65968 66741 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259051.1 protein_id gnl|my_center|LOCUS_09540 66972 68456 gene locus_tag LOCUS_09550 66972 68456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 68465 71134 gene locus_tag LOCUS_09560 68465 71134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 71131 71580 gene locus_tag LOCUS_09570 71131 71580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 73414 71588 gene locus_tag LOCUS_09580 73414 71588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 75052 73733 gene locus_tag LOCUS_09590 75052 73733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 76829 76131 gene locus_tag LOCUS_09600 76829 76131 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259307.1 protein_id gnl|my_center|LOCUS_09600 77167 77676 gene locus_tag LOCUS_09610 77167 77676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 78092 80014 gene locus_tag LOCUS_09620 78092 80014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence013 2420 1299 gene locus_tag LOCUS_09630 2420 1299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 protein_id gnl|my_center|LOCUS_09630 3570 2506 gene locus_tag LOCUS_09640 3570 2506 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_09640 3903 3691 gene locus_tag LOCUS_09650 3903 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6205 3959 gene locus_tag LOCUS_09660 6205 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7261 6305 gene locus_tag LOCUS_09670 7261 6305 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_09670 7918 7388 gene locus_tag LOCUS_09680 7918 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9594 8122 gene locus_tag LOCUS_09690 9594 8122 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_09690 11477 9591 gene locus_tag LOCUS_09700 11477 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 11668 12648 gene locus_tag LOCUS_09710 11668 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_09710 12653 13945 gene locus_tag LOCUS_09720 12653 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 16148 13962 gene locus_tag LOCUS_09730 gene ppk1 16148 13962 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_09730 16167 16670 gene locus_tag LOCUS_09740 16167 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950516.1 protein_id gnl|my_center|LOCUS_09740 18186 16705 gene locus_tag LOCUS_09750 gene ppx 18186 16705 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_09750 18146 18310 gene locus_tag LOCUS_09760 18146 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 18449 19138 gene locus_tag LOCUS_09770 18449 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 19189 20799 gene locus_tag LOCUS_09780 19189 20799 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_09780 21002 21658 gene locus_tag LOCUS_09790 gene phoU 21002 21658 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_09790 21976 21737 gene locus_tag LOCUS_09800 21976 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 21890 22594 gene locus_tag LOCUS_09810 gene phoB 21890 22594 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_09810 22591 24462 gene locus_tag LOCUS_09820 gene phoR 22591 24462 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_09820 25518 24469 gene locus_tag LOCUS_09830 25518 24469 CDS product rhizopine catabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_09830 25800 26369 gene locus_tag LOCUS_09840 25800 26369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_09840 26366 26884 gene locus_tag LOCUS_09850 26366 26884 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_09850 26972 28429 gene locus_tag LOCUS_09860 26972 28429 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_09860 28436 29206 gene locus_tag LOCUS_09870 28436 29206 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5Q8 protein_id gnl|my_center|LOCUS_09870 32187 29215 gene locus_tag LOCUS_09880 32187 29215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 32350 34356 gene locus_tag LOCUS_09890 32350 34356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 34468 36522 gene locus_tag LOCUS_09900 gene uvrD 34468 36522 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_09900 37756 36542 gene locus_tag LOCUS_09910 37756 36542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_09910 38576 37767 gene locus_tag LOCUS_09920 38576 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 40265 38619 gene locus_tag LOCUS_09930 40265 38619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 42646 40499 gene locus_tag LOCUS_09940 42646 40499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 42908 43195 gene locus_tag LOCUS_09950 42908 43195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 44271 43192 gene locus_tag LOCUS_09960 44271 43192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 44458 45012 gene locus_tag LOCUS_09970 44458 45012 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_09970 45044 45490 gene locus_tag LOCUS_09980 45044 45490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 47135 45507 gene locus_tag LOCUS_09990 47135 45507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 49001 47181 gene locus_tag LOCUS_10000 49001 47181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 49760 49023 gene locus_tag LOCUS_10010 49760 49023 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_10010 49958 51493 gene locus_tag LOCUS_10020 49958 51493 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_10020 51682 51509 gene locus_tag LOCUS_10030 51682 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 51826 53760 gene locus_tag LOCUS_10040 gene gaa 51826 53760 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_10040 53953 55059 gene locus_tag LOCUS_10050 53953 55059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 57271 55220 gene locus_tag LOCUS_10060 57271 55220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 57485 58495 gene locus_tag LOCUS_10070 57485 58495 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_10070 58560 60647 gene locus_tag LOCUS_10080 58560 60647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 60658 62694 gene locus_tag LOCUS_10090 60658 62694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 62691 64415 gene locus_tag LOCUS_10100 62691 64415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 64430 65674 gene locus_tag LOCUS_10110 64430 65674 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_10110 66248 65649 gene locus_tag LOCUS_10120 66248 65649 CDS product cysteine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833331.1 protein_id gnl|my_center|LOCUS_10120 67260 66361 gene locus_tag LOCUS_10130 gene ctaB 67260 66361 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_10130 67614 68414 gene locus_tag LOCUS_10140 67614 68414 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_10140 68392 69738 gene locus_tag LOCUS_10150 gene aroA2 68392 69738 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L213 protein_id gnl|my_center|LOCUS_10150 69735 73109 gene locus_tag LOCUS_10160 69735 73109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 73642 74376 gene locus_tag LOCUS_10170 73642 74376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 75528 74449 gene locus_tag LOCUS_10180 gene thiL 75528 74449 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSL2 protein_id gnl|my_center|LOCUS_10180 78028 75518 gene locus_tag LOCUS_10190 gene lon 78028 75518 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CU2 protein_id gnl|my_center|LOCUS_10190 78677 78156 gene locus_tag LOCUS_10200 gene nrdR 78677 78156 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZG2 protein_id gnl|my_center|LOCUS_10200 >Feature sequence014 1360 584 gene locus_tag LOCUS_10210 gene truA 1360 584 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DWH1 protein_id gnl|my_center|LOCUS_10210 2808 1357 gene locus_tag LOCUS_10220 2808 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_10220 2808 4295 gene locus_tag LOCUS_10230 2808 4295 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_10230 4378 6174 gene locus_tag LOCUS_10240 4378 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6570 7745 gene locus_tag LOCUS_10250 gene czcB 6570 7745 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_10250 7742 11485 gene locus_tag LOCUS_10260 gene acrD 7742 11485 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_10260 11482 14673 gene locus_tag LOCUS_10270 gene acrD 11482 14673 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_10270 14889 15296 gene locus_tag LOCUS_10280 14889 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15379 15903 gene locus_tag LOCUS_10290 15379 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 15900 17429 gene locus_tag LOCUS_10300 15900 17429 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_10300 18389 17448 gene locus_tag LOCUS_10310 18389 17448 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 protein_id gnl|my_center|LOCUS_10310 19386 18454 gene locus_tag LOCUS_10320 gene mvrA 19386 18454 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086612.1 protein_id gnl|my_center|LOCUS_10320 19443 20234 gene locus_tag LOCUS_10330 19443 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 22772 20247 gene locus_tag LOCUS_10340 22772 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23457 22855 gene locus_tag LOCUS_10350 23457 22855 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_10350 23896 23588 gene locus_tag LOCUS_10360 23896 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 24306 23968 gene locus_tag LOCUS_10370 24306 23968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 24692 24399 gene locus_tag LOCUS_10380 24692 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26820 25192 gene locus_tag LOCUS_10390 26820 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 27050 27448 gene locus_tag LOCUS_10400 27050 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 28655 27456 gene locus_tag LOCUS_10410 gene ada 28655 27456 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_10410 29512 28742 gene locus_tag LOCUS_10420 29512 28742 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_10420 30702 29611 gene locus_tag LOCUS_10430 30702 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 31454 30699 gene locus_tag LOCUS_10440 31454 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 31673 32611 gene locus_tag LOCUS_10450 31673 32611 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_10450 34909 33005 gene locus_tag LOCUS_10460 gene uup 34909 33005 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_10460 35223 36131 gene locus_tag LOCUS_10470 35223 36131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 38736 36163 gene locus_tag LOCUS_10480 38736 36163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 39061 42735 gene locus_tag LOCUS_10490 39061 42735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 42859 43953 gene locus_tag LOCUS_10500 42859 43953 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_10500 44040 48458 gene locus_tag LOCUS_10510 44040 48458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 48615 49844 gene locus_tag LOCUS_10520 48615 49844 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_10520 49951 50538 gene locus_tag LOCUS_10530 49951 50538 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_10530 50586 51575 gene locus_tag LOCUS_10540 50586 51575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 51760 52467 gene locus_tag LOCUS_10550 gene sfsA 51760 52467 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_10550 52534 53604 gene locus_tag LOCUS_10560 52534 53604 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_10560 53620 54366 gene locus_tag LOCUS_10570 53620 54366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_10570 54986 54393 gene locus_tag LOCUS_10580 gene ppa 54986 54393 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67501 protein_id gnl|my_center|LOCUS_10580 54918 55124 gene locus_tag LOCUS_10590 54918 55124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 55182 55757 gene locus_tag LOCUS_10600 55182 55757 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_10600 55766 56665 gene locus_tag LOCUS_10610 55766 56665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 58766 56595 gene locus_tag LOCUS_10620 58766 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 59464 58787 gene locus_tag LOCUS_10630 59464 58787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 61161 59530 gene locus_tag LOCUS_10640 61161 59530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 61558 61148 gene locus_tag LOCUS_10650 61558 61148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976348.1 protein_id gnl|my_center|LOCUS_10650 62118 61582 gene locus_tag LOCUS_10660 62118 61582 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_10660 68215 62165 gene locus_tag LOCUS_10670 68215 62165 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_10670 68390 69088 gene locus_tag LOCUS_10680 68390 69088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 70221 69313 gene locus_tag LOCUS_10690 70221 69313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 71491 70385 gene locus_tag LOCUS_10700 71491 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 71720 71496 gene locus_tag LOCUS_10710 71720 71496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 73149 71740 gene locus_tag LOCUS_10720 73149 71740 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y1 protein_id gnl|my_center|LOCUS_10720 73744 73208 gene locus_tag LOCUS_10730 73744 73208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 73981 77046 gene locus_tag LOCUS_10740 73981 77046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 77877 77083 gene locus_tag LOCUS_10750 77877 77083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence015 1136 156 gene locus_tag LOCUS_10760 1136 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1027 1281 gene locus_tag LOCUS_10770 1027 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1804 1376 gene locus_tag LOCUS_10780 1804 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2503 1817 gene locus_tag LOCUS_10790 2503 1817 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_10790 4162 2516 gene locus_tag LOCUS_10800 4162 2516 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_10800 5162 4179 gene locus_tag LOCUS_10810 5162 4179 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_10810 6074 5163 gene locus_tag LOCUS_10820 6074 5163 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_10820 6634 6074 gene locus_tag LOCUS_10830 6634 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 7889 6627 gene locus_tag LOCUS_10840 7889 6627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_10840 8625 7882 gene locus_tag LOCUS_10850 8625 7882 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_10850 9208 8612 gene locus_tag LOCUS_10860 9208 8612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_10860 10640 9219 gene locus_tag LOCUS_10870 10640 9219 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_10870 14003 10707 gene locus_tag LOCUS_10880 14003 10707 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_10880 14712 14050 gene locus_tag LOCUS_10890 14712 14050 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_10890 15624 17303 gene locus_tag LOCUS_10900 15624 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 18927 17416 gene locus_tag LOCUS_10910 18927 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20291 19050 gene locus_tag LOCUS_10920 gene ftsA 20291 19050 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_10920 21713 20313 gene locus_tag LOCUS_10930 21713 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23131 21710 gene locus_tag LOCUS_10940 gene murC 23131 21710 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_10940 24314 23124 gene locus_tag LOCUS_10950 gene murG 24314 23124 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ0 protein_id gnl|my_center|LOCUS_10950 25411 24317 gene locus_tag LOCUS_10960 gene ftsW 25411 24317 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_10960 26876 25401 gene locus_tag LOCUS_10970 gene murD 26876 25401 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Q2 protein_id gnl|my_center|LOCUS_10970 27992 26907 gene locus_tag LOCUS_10980 gene mraY 27992 26907 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_10980 29455 27992 gene locus_tag LOCUS_10990 gene murF 29455 27992 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_10990 31007 29448 gene locus_tag LOCUS_11000 gene murE 31007 29448 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_11000 33016 31004 gene locus_tag LOCUS_11010 gene ftsI 33016 31004 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_11010 33360 33013 gene locus_tag LOCUS_11020 33360 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 34523 33432 gene locus_tag LOCUS_11030 gene rsmH 34523 33432 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W4 protein_id gnl|my_center|LOCUS_11030 34963 34523 gene locus_tag LOCUS_11040 gene mraZ 34963 34523 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX20 protein_id gnl|my_center|LOCUS_11040 35656 37365 gene locus_tag LOCUS_11050 35656 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 37365 38210 gene locus_tag LOCUS_11060 37365 38210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 38296 38916 gene locus_tag LOCUS_11070 38296 38916 CDS product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 protein_id gnl|my_center|LOCUS_11070 38916 40823 gene locus_tag LOCUS_11080 38916 40823 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 protein_id gnl|my_center|LOCUS_11080 41644 40871 gene locus_tag LOCUS_11090 41644 40871 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_11090 42234 41641 gene locus_tag LOCUS_11100 42234 41641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 43240 42281 gene locus_tag LOCUS_11110 43240 42281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 44227 43406 gene locus_tag LOCUS_11120 44227 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 45300 45950 gene locus_tag LOCUS_11130 gene dck 45300 45950 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_11130 46233 47198 gene locus_tag LOCUS_11140 gene panB 46233 47198 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_11140 47191 48156 gene locus_tag LOCUS_11150 gene panC 47191 48156 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_11150 48192 48596 gene locus_tag LOCUS_11160 48192 48596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 49540 48713 gene locus_tag LOCUS_11170 49540 48713 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_11170 49689 50711 gene locus_tag LOCUS_11180 49689 50711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_11180 50839 51909 gene locus_tag LOCUS_11190 gene tsaD 50839 51909 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C11 protein_id gnl|my_center|LOCUS_11190 52024 53304 gene locus_tag LOCUS_11200 gene aspC 52024 53304 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_11200 54415 53396 gene locus_tag LOCUS_11210 54415 53396 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390526.1 protein_id gnl|my_center|LOCUS_11210 54557 56200 gene locus_tag LOCUS_11220 54557 56200 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_11220 56268 57914 gene locus_tag LOCUS_11230 56268 57914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223080.1 protein_id gnl|my_center|LOCUS_11230 58230 57985 gene locus_tag LOCUS_11240 58230 57985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 58141 59670 gene locus_tag LOCUS_11250 58141 59670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 60455 59667 gene locus_tag LOCUS_11260 60455 59667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 60967 60689 gene locus_tag LOCUS_11270 60967 60689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 62591 65107 gene locus_tag LOCUS_11280 62591 65107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 65234 66427 gene locus_tag LOCUS_11290 65234 66427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 66922 66485 gene locus_tag LOCUS_11300 66922 66485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11300 67197 66919 gene locus_tag LOCUS_11310 67197 66919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 67400 69055 gene locus_tag LOCUS_11320 67400 69055 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_11320 70401 69142 gene locus_tag LOCUS_11330 70401 69142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205443.1 protein_id gnl|my_center|LOCUS_11330 70700 70398 gene locus_tag LOCUS_11340 70700 70398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 70912 70730 gene locus_tag LOCUS_11350 70912 70730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 72431 70962 gene locus_tag LOCUS_11360 72431 70962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_11360 73142 72531 gene locus_tag LOCUS_11370 73142 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_11370 73141 73314 gene locus_tag LOCUS_11380 73141 73314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 73470 74777 gene locus_tag LOCUS_11390 73470 74777 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_11390 75985 74774 gene locus_tag LOCUS_11400 gene fldA 75985 74774 CDS product FldA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_11400 77277 76063 gene locus_tag LOCUS_11410 77277 76063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence016 <1 1226 gene locus_tag LOCUS_11420 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DK5:glucose-6-phosphate isomerase 1444 1833 gene locus_tag LOCUS_11430 1444 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3172 1841 gene locus_tag LOCUS_11440 3172 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4151 3516 gene locus_tag LOCUS_11450 4151 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5067 4429 gene locus_tag LOCUS_11460 5067 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5107 5520 gene locus_tag LOCUS_11470 5107 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5795 5472 gene locus_tag LOCUS_11480 5795 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5941 6753 gene locus_tag LOCUS_11490 5941 6753 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729131.1 protein_id gnl|my_center|LOCUS_11490 6947 8287 gene locus_tag LOCUS_11500 6947 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_11500 11016 8347 gene locus_tag LOCUS_11510 11016 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 11618 11133 gene locus_tag LOCUS_11520 11618 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12340 11627 gene locus_tag LOCUS_11530 12340 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 12494 14173 gene locus_tag LOCUS_11540 12494 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14613 14182 gene locus_tag LOCUS_11550 14613 14182 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084163.1 protein_id gnl|my_center|LOCUS_11550 15443 14679 gene locus_tag LOCUS_11560 15443 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 16022 15636 gene locus_tag LOCUS_11570 16022 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 16808 16029 gene locus_tag LOCUS_11580 16808 16029 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229587.1 protein_id gnl|my_center|LOCUS_11580 17236 16805 gene locus_tag LOCUS_11590 17236 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 17786 17361 gene locus_tag LOCUS_11600 17786 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 18443 18240 gene locus_tag LOCUS_11610 18443 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 18570 19451 gene locus_tag LOCUS_11620 18570 19451 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_11620 19615 21036 gene locus_tag LOCUS_11630 19615 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 21175 22473 gene locus_tag LOCUS_11640 gene adh 21175 22473 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_11640 22473 23660 gene locus_tag LOCUS_11650 22473 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 23784 24620 gene locus_tag LOCUS_11660 23784 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_11660 25216 24632 gene locus_tag LOCUS_11670 25216 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 27755 25248 gene locus_tag LOCUS_11680 27755 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 28351 27752 gene locus_tag LOCUS_11690 28351 27752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 34229 28488 gene locus_tag LOCUS_11700 34229 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 35326 34880 gene locus_tag LOCUS_11710 35326 34880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 35850 35323 gene locus_tag LOCUS_11720 35850 35323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 37787 37263 gene locus_tag LOCUS_11730 37787 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 38216 37797 gene locus_tag LOCUS_11740 38216 37797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 39385 38255 gene locus_tag LOCUS_11750 39385 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 39963 39382 gene locus_tag LOCUS_11760 39963 39382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 40796 39963 gene locus_tag LOCUS_11770 40796 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 41859 40807 gene locus_tag LOCUS_11780 41859 40807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950891.1 protein_id gnl|my_center|LOCUS_11780 41988 42332 gene locus_tag LOCUS_11790 41988 42332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 42992 42357 gene locus_tag LOCUS_11800 42992 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 43582 44082 gene locus_tag LOCUS_11810 43582 44082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 44082 45329 gene locus_tag LOCUS_11820 44082 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 45694 46263 gene locus_tag LOCUS_11830 45694 46263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 46298 48610 gene locus_tag LOCUS_11840 46298 48610 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_11840 48729 49511 gene locus_tag LOCUS_11850 48729 49511 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_11850 49515 50534 gene locus_tag LOCUS_11860 gene fabH 49515 50534 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S83 protein_id gnl|my_center|LOCUS_11860 50687 50481 gene locus_tag LOCUS_11870 50687 50481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 50659 51663 gene locus_tag LOCUS_11880 50659 51663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 51674 52693 gene locus_tag LOCUS_11890 51674 52693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 52686 53774 gene locus_tag LOCUS_11900 52686 53774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445820.1 protein_id gnl|my_center|LOCUS_11900 53761 55416 gene locus_tag LOCUS_11910 53761 55416 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_11910 55413 56285 gene locus_tag LOCUS_11920 55413 56285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 56322 57833 gene locus_tag LOCUS_11930 56322 57833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 58040 59590 gene locus_tag LOCUS_11940 58040 59590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 59914 61518 gene locus_tag LOCUS_11950 59914 61518 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037204.1 protein_id gnl|my_center|LOCUS_11950 61833 64220 gene locus_tag LOCUS_11960 61833 64220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 65331 64312 gene locus_tag LOCUS_11970 65331 64312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 65767 67404 gene locus_tag LOCUS_11980 65767 67404 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_11980 68212 67517 gene locus_tag LOCUS_11990 68212 67517 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_11990 68631 68308 gene locus_tag LOCUS_12000 68631 68308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 70321 68696 gene locus_tag LOCUS_12010 70321 68696 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_12010 70846 70364 gene locus_tag LOCUS_12020 70846 70364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 71273 72736 gene locus_tag LOCUS_12030 71273 72736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 72903 73691 gene locus_tag LOCUS_12040 72903 73691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 74593 73835 gene locus_tag LOCUS_12050 74593 73835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 74972 75445 gene locus_tag LOCUS_12060 74972 75445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 78561 75442 gene locus_tag LOCUS_12070 78561 75442 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence017 3492 1801 gene locus_tag LOCUS_12080 3492 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3644 5686 gene locus_tag LOCUS_12090 3644 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5779 7209 gene locus_tag LOCUS_12100 gene asnS 5779 7209 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43829 protein_id gnl|my_center|LOCUS_12100 7337 8194 gene locus_tag LOCUS_12110 7337 8194 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122377.1 protein_id gnl|my_center|LOCUS_12110 8643 11744 gene locus_tag LOCUS_12120 8643 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12193 11774 gene locus_tag LOCUS_12130 12193 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14096 12348 gene locus_tag LOCUS_12140 14096 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 16029 14293 gene locus_tag LOCUS_12150 16029 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 17541 16537 gene locus_tag LOCUS_12160 17541 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 19814 17643 gene locus_tag LOCUS_12170 19814 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 20906 19980 gene locus_tag LOCUS_12180 gene fdhD 20906 19980 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_12180 23206 20903 gene locus_tag LOCUS_12190 23206 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 26910 23203 gene locus_tag LOCUS_12200 26910 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 27070 29871 gene locus_tag LOCUS_12210 27070 29871 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405361.1 protein_id gnl|my_center|LOCUS_12210 29868 30128 gene locus_tag LOCUS_12220 29868 30128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 30314 32191 gene locus_tag LOCUS_12230 30314 32191 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_12230 32181 34601 gene locus_tag LOCUS_12240 32181 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 34736 36415 gene locus_tag LOCUS_12250 34736 36415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 36412 38250 gene locus_tag LOCUS_12260 36412 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943809.1 protein_id gnl|my_center|LOCUS_12260 39050 38682 gene locus_tag LOCUS_12270 39050 38682 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_12270 39339 39061 gene locus_tag LOCUS_12280 39339 39061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 39752 39333 gene locus_tag LOCUS_12290 39752 39333 CDS product UPF0403 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E36 protein_id gnl|my_center|LOCUS_12290 40245 41180 gene locus_tag LOCUS_12300 40245 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 41226 42872 gene locus_tag LOCUS_12310 gene gpmI 41226 42872 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG7 protein_id gnl|my_center|LOCUS_12310 43448 43086 gene locus_tag LOCUS_12320 43448 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 44208 43564 gene locus_tag LOCUS_12330 44208 43564 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_12330 45404 44508 gene locus_tag LOCUS_12340 45404 44508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 45800 47905 gene locus_tag LOCUS_12350 45800 47905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 50498 47916 gene locus_tag LOCUS_12360 50498 47916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 51151 50498 gene locus_tag LOCUS_12370 51151 50498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 51963 51166 gene locus_tag LOCUS_12380 51963 51166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 54579 52237 gene locus_tag LOCUS_12390 54579 52237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 56003 54576 gene locus_tag LOCUS_12400 56003 54576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 56254 59511 gene locus_tag LOCUS_12410 56254 59511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 60931 59954 gene locus_tag LOCUS_12420 gene etfA 60931 59954 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_12420 61722 60931 gene locus_tag LOCUS_12430 gene fixA 61722 60931 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_12430 62267 63001 gene locus_tag LOCUS_12440 62267 63001 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_12440 63017 63442 gene locus_tag LOCUS_12450 63017 63442 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886263.1 protein_id gnl|my_center|LOCUS_12450 63462 64241 gene locus_tag LOCUS_12460 63462 64241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 64276 65673 gene locus_tag LOCUS_12470 gene tolB 64276 65673 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_12470 65871 66443 gene locus_tag LOCUS_12480 65871 66443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 66620 67396 gene locus_tag LOCUS_12490 66620 67396 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_12490 67728 67991 gene locus_tag LOCUS_12500 gene rpsT 67728 67991 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AU4 protein_id gnl|my_center|LOCUS_12500 68817 68206 gene locus_tag LOCUS_12510 68817 68206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 69818 68823 gene locus_tag LOCUS_12520 69818 68823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 70450 69893 gene locus_tag LOCUS_12530 gene nusB 70450 69893 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_12530 70932 70447 gene locus_tag LOCUS_12540 gene ribH 70932 70447 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_12540 71155 71079 gene locus_tag LOCUS_t00060 71155 71079 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 71665 71231 gene locus_tag LOCUS_12550 71665 71231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 72036 71713 gene locus_tag LOCUS_12560 gene ihfA-1 72036 71713 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ8 protein_id gnl|my_center|LOCUS_12560 73640 72330 gene locus_tag LOCUS_12570 gene der 73640 72330 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_12570 74313 73762 gene locus_tag LOCUS_12580 74313 73762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 74747 74833 gene locus_tag LOCUS_t00070 74747 74833 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 75340 74912 gene locus_tag LOCUS_12590 75340 74912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 75611 75333 gene locus_tag LOCUS_12600 gene acpP-1 75611 75333 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_12600 75907 76533 gene locus_tag LOCUS_12610 75907 76533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence018 1063 17 gene locus_tag LOCUS_12620 1063 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1224 1060 gene locus_tag LOCUS_12630 1224 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2213 1266 gene locus_tag LOCUS_12640 2213 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2761 2372 gene locus_tag LOCUS_12650 2761 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4110 2746 gene locus_tag LOCUS_12660 4110 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4516 4214 gene locus_tag LOCUS_12670 4516 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5007 4516 gene locus_tag LOCUS_12680 5007 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5705 5061 gene locus_tag LOCUS_12690 5705 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6100 5702 gene locus_tag LOCUS_12700 6100 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5990 6196 gene locus_tag LOCUS_12710 5990 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 6499 7794 gene locus_tag LOCUS_12720 6499 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 8099 7797 gene locus_tag LOCUS_12730 8099 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 8319 8657 gene locus_tag LOCUS_12740 8319 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 8651 9409 gene locus_tag LOCUS_12750 8651 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10430 11536 gene locus_tag LOCUS_12760 10430 11536 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706035.1 protein_id gnl|my_center|LOCUS_12760 11614 12756 gene locus_tag LOCUS_12770 11614 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 13628 12762 gene locus_tag LOCUS_12780 13628 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 14289 13621 gene locus_tag LOCUS_12790 14289 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 15490 14312 gene locus_tag LOCUS_12800 15490 14312 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_12800 15766 17766 gene locus_tag LOCUS_12810 15766 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 17766 18260 gene locus_tag LOCUS_12820 17766 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 18329 21853 gene locus_tag LOCUS_12830 18329 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 21936 25517 gene locus_tag LOCUS_12840 21936 25517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 26490 25687 gene locus_tag LOCUS_12850 26490 25687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 26731 30240 gene locus_tag LOCUS_12860 26731 30240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 30237 32309 gene locus_tag LOCUS_12870 30237 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 32317 33195 gene locus_tag LOCUS_12880 32317 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 34166 33225 gene locus_tag LOCUS_12890 34166 33225 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_12890 34957 34229 gene locus_tag LOCUS_12900 34957 34229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 35172 36221 gene locus_tag LOCUS_12910 35172 36221 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259276.1 protein_id gnl|my_center|LOCUS_12910 36211 36786 gene locus_tag LOCUS_12920 gene rfbC 36211 36786 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403366.1 protein_id gnl|my_center|LOCUS_12920 36840 37739 gene locus_tag LOCUS_12930 gene fcl 36840 37739 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_12930 38730 37756 gene locus_tag LOCUS_12940 38730 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 39764 38811 gene locus_tag LOCUS_12950 39764 38811 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_12950 41131 39761 gene locus_tag LOCUS_12960 41131 39761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088729.1 protein_id gnl|my_center|LOCUS_12960 42514 41180 gene locus_tag LOCUS_12970 42514 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 43569 42529 gene locus_tag LOCUS_12980 43569 42529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 46078 43571 gene locus_tag LOCUS_12990 46078 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 46047 46283 gene locus_tag LOCUS_13000 46047 46283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 46342 47265 gene locus_tag LOCUS_13010 gene ykcC 46342 47265 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_13010 54309 47800 gene locus_tag LOCUS_13020 54309 47800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 54911 54693 gene locus_tag LOCUS_13030 54911 54693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 56071 54944 gene locus_tag LOCUS_13040 56071 54944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 57408 56308 gene locus_tag LOCUS_13050 57408 56308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 57692 57964 gene locus_tag LOCUS_13060 57692 57964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 59554 57965 gene locus_tag LOCUS_13070 59554 57965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 60403 60741 gene locus_tag LOCUS_13080 60403 60741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 61374 60781 gene locus_tag LOCUS_13090 61374 60781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 62036 61374 gene locus_tag LOCUS_13100 62036 61374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 62775 63869 gene locus_tag LOCUS_13110 62775 63869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 65324 64767 gene locus_tag LOCUS_13120 gene clpP 65324 64767 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE24 protein_id gnl|my_center|LOCUS_13120 65230 65559 gene locus_tag LOCUS_13130 65230 65559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 65564 67696 gene locus_tag LOCUS_13140 65564 67696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 67693 68724 gene locus_tag LOCUS_13150 67693 68724 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_13150 69436 72426 gene locus_tag LOCUS_13160 69436 72426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 72614 73351 gene locus_tag LOCUS_13170 72614 73351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_13170 73895 73509 gene locus_tag LOCUS_13180 73895 73509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 74311 73919 gene locus_tag LOCUS_13190 74311 73919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 74789 74385 gene locus_tag LOCUS_13200 74789 74385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 <76194 74807 gene locus_tag LOCUS_13210 <76194 74807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:cell well associated RhsD protein >Feature sequence019 11 87 gene locus_tag LOCUS_t00080 11 87 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 127 203 gene locus_tag LOCUS_t00090 127 203 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 279 354 gene locus_tag LOCUS_t00100 279 354 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 420 1391 gene locus_tag LOCUS_13220 gene mmuM 420 1391 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258939.1 protein_id gnl|my_center|LOCUS_13220 1634 1458 gene locus_tag LOCUS_13230 1634 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1576 1725 gene locus_tag LOCUS_13240 1576 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3153 1774 gene locus_tag LOCUS_13250 3153 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4489 3209 gene locus_tag LOCUS_13260 gene metB 4489 3209 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_13260 5054 6268 gene locus_tag LOCUS_13270 5054 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 6917 6261 gene locus_tag LOCUS_13280 6917 6261 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_13280 7164 8648 gene locus_tag LOCUS_13290 gene mtaD 7164 8648 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLB7 protein_id gnl|my_center|LOCUS_13290 9985 8771 gene locus_tag LOCUS_13300 9985 8771 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_13300 10135 12132 gene locus_tag LOCUS_13310 10135 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 12647 12150 gene locus_tag LOCUS_13320 12647 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13320 14979 12817 gene locus_tag LOCUS_13330 14979 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_13330 17033 15102 gene locus_tag LOCUS_13340 17033 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 17173 19899 gene locus_tag LOCUS_13350 17173 19899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 19937 20188 gene locus_tag LOCUS_13360 19937 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 20533 21720 gene locus_tag LOCUS_13370 20533 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 21717 24020 gene locus_tag LOCUS_13380 21717 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 24443 24126 gene locus_tag LOCUS_13390 24443 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 27146 24648 gene locus_tag LOCUS_13400 27146 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 28879 27254 gene locus_tag LOCUS_13410 28879 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_13410 29071 31101 gene locus_tag LOCUS_13420 29071 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 31135 31443 gene locus_tag LOCUS_13430 31135 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 31609 32370 gene locus_tag LOCUS_13440 31609 32370 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_13440 32418 33455 gene locus_tag LOCUS_13450 32418 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_13450 33452 34351 gene locus_tag LOCUS_13460 33452 34351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_13460 34437 35261 gene locus_tag LOCUS_13470 34437 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 35293 35928 gene locus_tag LOCUS_13480 35293 35928 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_13480 36287 36018 gene locus_tag LOCUS_13490 36287 36018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 36318 38171 gene locus_tag LOCUS_13500 36318 38171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 40921 38216 gene locus_tag LOCUS_13510 40921 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 41911 41147 gene locus_tag LOCUS_13520 41911 41147 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_13520 42974 41970 gene locus_tag LOCUS_13530 42974 41970 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_13530 44862 42976 gene locus_tag LOCUS_13540 44862 42976 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_13540 45321 47429 gene locus_tag LOCUS_13550 45321 47429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 47982 47389 gene locus_tag LOCUS_13560 47982 47389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 48036 49499 gene locus_tag LOCUS_13570 48036 49499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 49780 50313 gene locus_tag LOCUS_13580 49780 50313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13580 50794 50354 gene locus_tag LOCUS_13590 50794 50354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812808.1 protein_id gnl|my_center|LOCUS_13590 51081 53984 gene locus_tag LOCUS_13600 51081 53984 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389813.1 protein_id gnl|my_center|LOCUS_13600 54002 55459 gene locus_tag LOCUS_13610 54002 55459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704376.1 protein_id gnl|my_center|LOCUS_13610 57171 55543 gene locus_tag LOCUS_13620 57171 55543 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_13620 57831 57406 gene locus_tag LOCUS_13630 57831 57406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 58347 59315 gene locus_tag LOCUS_13640 58347 59315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 60116 59343 gene locus_tag LOCUS_13650 60116 59343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 60951 60331 gene locus_tag LOCUS_13660 60951 60331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 61597 61049 gene locus_tag LOCUS_13670 61597 61049 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_13670 63750 61711 gene locus_tag LOCUS_13680 63750 61711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 63656 63895 gene locus_tag LOCUS_13690 63656 63895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 63903 64541 gene locus_tag LOCUS_13700 63903 64541 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_13700 64522 65193 gene locus_tag LOCUS_13710 64522 65193 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_13710 65236 65907 gene locus_tag LOCUS_13720 65236 65907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 65965 66084 gene locus_tag LOCUS_13730 65965 66084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 66104 66649 gene locus_tag LOCUS_13740 66104 66649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 66740 69016 gene locus_tag LOCUS_13750 66740 69016 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_13750 71134 69167 gene locus_tag LOCUS_13760 71134 69167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 71874 71167 gene locus_tag LOCUS_13770 71874 71167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 <72670 72101 gene locus_tag LOCUS_13780 <72670 72101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550362.1:outer membrane protein >Feature sequence020 813 2366 gene locus_tag LOCUS_13790 gene lysS 813 2366 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK7 protein_id gnl|my_center|LOCUS_13790 2413 3624 gene locus_tag LOCUS_13800 gene lolE 2413 3624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_13800 3621 4343 gene locus_tag LOCUS_13810 gene lolD 3621 4343 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ16 protein_id gnl|my_center|LOCUS_13810 4469 6898 gene locus_tag LOCUS_13820 4469 6898 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_13820 7204 6854 gene locus_tag LOCUS_13830 7204 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7286 9805 gene locus_tag LOCUS_13840 7286 9805 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_13840 9967 10500 gene locus_tag LOCUS_13850 9967 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 10513 11580 gene locus_tag LOCUS_13860 gene lpxD 10513 11580 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS9 protein_id gnl|my_center|LOCUS_13860 11715 12152 gene locus_tag LOCUS_13870 gene fabZ 11715 12152 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MG76 protein_id gnl|my_center|LOCUS_13870 12167 12985 gene locus_tag LOCUS_13880 gene lpxA 12167 12985 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH5 protein_id gnl|my_center|LOCUS_13880 13013 13963 gene locus_tag LOCUS_13890 gene gnnA 13013 13963 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_13890 14046 14909 gene locus_tag LOCUS_13900 gene mtnP 14046 14909 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_13900 14946 15710 gene locus_tag LOCUS_13910 gene surE 14946 15710 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_13910 15732 16388 gene locus_tag LOCUS_13920 gene pcm 15732 16388 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG96 protein_id gnl|my_center|LOCUS_13920 16385 16717 gene locus_tag LOCUS_13930 gene acyP 16385 16717 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35031 protein_id gnl|my_center|LOCUS_13930 16730 17245 gene locus_tag LOCUS_13940 gene apt 16730 17245 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_13940 17434 19251 gene locus_tag LOCUS_13950 gene nolO 17434 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_13950 19356 19775 gene locus_tag LOCUS_13960 19356 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975330.1 protein_id gnl|my_center|LOCUS_13960 19843 19995 gene locus_tag LOCUS_13970 19843 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 20199 21443 gene locus_tag LOCUS_13980 20199 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 21440 22210 gene locus_tag LOCUS_13990 gene rfbF 21440 22210 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_13990 22733 22218 gene locus_tag LOCUS_14000 22733 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 22829 24268 gene locus_tag LOCUS_14010 22829 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 24265 25530 gene locus_tag LOCUS_14020 24265 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 25549 26328 gene locus_tag LOCUS_14030 25549 26328 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_14030 27197 26325 gene locus_tag LOCUS_14040 27197 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 27996 27340 gene locus_tag LOCUS_14050 27996 27340 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_14050 28814 29074 gene locus_tag LOCUS_14060 28814 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 29632 29078 gene locus_tag LOCUS_14070 gene mogA 29632 29078 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_14070 29970 29629 gene locus_tag LOCUS_14080 29970 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_14080 30681 30049 gene locus_tag LOCUS_14090 30681 30049 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_14090 33319 30728 gene locus_tag LOCUS_14100 33319 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 33801 33316 gene locus_tag LOCUS_14110 33801 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_14110 35119 33860 gene locus_tag LOCUS_14120 35119 33860 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_14120 35693 35370 gene locus_tag LOCUS_14130 35693 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 37573 35900 gene locus_tag LOCUS_14140 gene ggtB 37573 35900 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_14140 38056 39165 gene locus_tag LOCUS_14150 38056 39165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 39162 39995 gene locus_tag LOCUS_14160 39162 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 41212 40007 gene locus_tag LOCUS_14170 41212 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 41604 42128 gene locus_tag LOCUS_14180 41604 42128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 42477 44483 gene locus_tag LOCUS_14190 42477 44483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 45547 44501 gene locus_tag LOCUS_14200 45547 44501 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_14200 46016 45537 gene locus_tag LOCUS_14210 46016 45537 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977400.1 protein_id gnl|my_center|LOCUS_14210 46304 47650 gene locus_tag LOCUS_14220 46304 47650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 49070 48114 gene locus_tag LOCUS_14230 49070 48114 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_14230 49692 49180 gene locus_tag LOCUS_14240 49692 49180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 50835 49765 gene locus_tag LOCUS_14250 gene fabH2 50835 49765 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_14250 51504 50887 gene locus_tag LOCUS_14260 51504 50887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 51797 51985 gene locus_tag LOCUS_14270 51797 51985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846377.1 protein_id gnl|my_center|LOCUS_14270 52852 52073 gene locus_tag LOCUS_14280 52852 52073 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_14280 53368 52895 gene locus_tag LOCUS_14290 53368 52895 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 protein_id gnl|my_center|LOCUS_14290 55505 53433 gene locus_tag LOCUS_14300 55505 53433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 56715 55651 gene locus_tag LOCUS_14310 56715 55651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_14310 57836 56997 gene locus_tag LOCUS_14320 57836 56997 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_14320 60731 57855 gene locus_tag LOCUS_14330 gene ileS 60731 57855 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66651 protein_id gnl|my_center|LOCUS_14330 61344 62351 gene locus_tag LOCUS_14340 61344 62351 CDS product oxidoreductase ion channel protein IolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877963.1 protein_id gnl|my_center|LOCUS_14340 62540 63112 gene locus_tag LOCUS_14350 62540 63112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 63278 64555 gene locus_tag LOCUS_14360 gene ftsA 63278 64555 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_14360 64552 66090 gene locus_tag LOCUS_14370 64552 66090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 66225 67253 gene locus_tag LOCUS_14380 gene trpS 66225 67253 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA78 protein_id gnl|my_center|LOCUS_14380 67286 68590 gene locus_tag LOCUS_14390 67286 68590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 68655 71276 gene locus_tag LOCUS_14400 68655 71276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence021 594 941 gene locus_tag LOCUS_14410 594 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1104 2645 gene locus_tag LOCUS_14420 1104 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_14420 3348 2662 gene locus_tag LOCUS_14430 3348 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3893 4162 gene locus_tag LOCUS_14440 3893 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4183 5526 gene locus_tag LOCUS_14450 gene hemN 4183 5526 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_14450 5541 6245 gene locus_tag LOCUS_14460 5541 6245 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_14460 6390 7178 gene locus_tag LOCUS_14470 6390 7178 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_14470 7223 7924 gene locus_tag LOCUS_14480 7223 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7933 9033 gene locus_tag LOCUS_14490 gene ABC-NBD 7933 9033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240806.1 protein_id gnl|my_center|LOCUS_14490 9030 9848 gene locus_tag LOCUS_14500 9030 9848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_14500 9850 10665 gene locus_tag LOCUS_14510 9850 10665 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760712.1 protein_id gnl|my_center|LOCUS_14510 10682 11977 gene locus_tag LOCUS_14520 gene lysA 10682 11977 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971789.1 protein_id gnl|my_center|LOCUS_14520 11974 13533 gene locus_tag LOCUS_14530 gene fadD 11974 13533 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_14530 13550 13810 gene locus_tag LOCUS_14540 13550 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 13822 14943 gene locus_tag LOCUS_14550 13822 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14936 15784 gene locus_tag LOCUS_14560 14936 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106510.1 protein_id gnl|my_center|LOCUS_14560 15966 18701 gene locus_tag LOCUS_14570 15966 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 19001 20644 gene locus_tag LOCUS_14580 19001 20644 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_14580 20645 22132 gene locus_tag LOCUS_14590 20645 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 22319 22669 gene locus_tag LOCUS_14600 gene ywzG 22319 22669 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_14600 22666 25365 gene locus_tag LOCUS_14610 22666 25365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_14610 27637 25385 gene locus_tag LOCUS_14620 27637 25385 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_14620 27957 30650 gene locus_tag LOCUS_14630 27957 30650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 30718 31803 gene locus_tag LOCUS_14640 30718 31803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_14640 33748 31847 gene locus_tag LOCUS_14650 33748 31847 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104005.1 protein_id gnl|my_center|LOCUS_14650 34671 33919 gene locus_tag LOCUS_14660 34671 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882802.1 protein_id gnl|my_center|LOCUS_14660 36421 34766 gene locus_tag LOCUS_14670 36421 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_14670 36506 37447 gene locus_tag LOCUS_14680 36506 37447 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_14680 37876 37559 gene locus_tag LOCUS_14690 37876 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14690 39785 38697 gene locus_tag LOCUS_14700 39785 38697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40514 40206 gene locus_tag LOCUS_14710 40514 40206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 41284 40514 gene locus_tag LOCUS_14720 gene parA 41284 40514 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721721.1 protein_id gnl|my_center|LOCUS_14720 41627 42328 gene locus_tag LOCUS_14730 41627 42328 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_14730 45007 42845 gene locus_tag LOCUS_14740 45007 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 45672 45992 gene locus_tag LOCUS_14750 45672 45992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 48133 45995 gene locus_tag LOCUS_14760 48133 45995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 48189 49835 gene locus_tag LOCUS_14770 48189 49835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 50136 51794 gene locus_tag LOCUS_14780 50136 51794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 51807 53477 gene locus_tag LOCUS_14790 51807 53477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 53562 55355 gene locus_tag LOCUS_14800 53562 55355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 55383 56171 gene locus_tag LOCUS_14810 55383 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 57104 56217 gene locus_tag LOCUS_14820 57104 56217 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_14820 57873 57364 gene locus_tag LOCUS_14830 57873 57364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 61038 58021 gene locus_tag LOCUS_14840 61038 58021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 61468 61878 gene locus_tag LOCUS_14850 61468 61878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 65301 61858 gene locus_tag LOCUS_14860 65301 61858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 65793 66179 gene locus_tag LOCUS_14870 65793 66179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 67919 66243 gene locus_tag LOCUS_14880 67919 66243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence022 3331 2435 gene locus_tag LOCUS_14890 3331 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_14890 4134 3349 gene locus_tag LOCUS_14900 4134 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4441 4169 gene locus_tag LOCUS_14910 4441 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6228 4438 gene locus_tag LOCUS_14920 6228 4438 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223844.1 protein_id gnl|my_center|LOCUS_14920 8282 6225 gene locus_tag LOCUS_14930 8282 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8790 8452 gene locus_tag LOCUS_14940 8790 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 9783 8872 gene locus_tag LOCUS_14950 9783 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12643 9776 gene locus_tag LOCUS_14960 12643 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 15438 12832 gene locus_tag LOCUS_14970 15438 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 16349 15477 gene locus_tag LOCUS_14980 16349 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 18732 16513 gene locus_tag LOCUS_14990 18732 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 19127 21136 gene locus_tag LOCUS_15000 19127 21136 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_15000 21133 22281 gene locus_tag LOCUS_15010 21133 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_15010 22737 23360 gene locus_tag LOCUS_15020 22737 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 23642 25189 gene locus_tag LOCUS_15030 23642 25189 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_15030 25361 27973 gene locus_tag LOCUS_15040 25361 27973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 28115 28507 gene locus_tag LOCUS_15050 28115 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 28805 29077 gene locus_tag LOCUS_15060 28805 29077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_15060 29319 31997 gene locus_tag LOCUS_15070 29319 31997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 33749 31977 gene locus_tag LOCUS_15080 33749 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 37709 34260 gene locus_tag LOCUS_15090 37709 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 40032 38302 gene locus_tag LOCUS_15100 40032 38302 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_15100 40131 40499 gene locus_tag LOCUS_15110 40131 40499 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_15110 40496 41581 gene locus_tag LOCUS_15120 40496 41581 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_15120 41960 41625 gene locus_tag LOCUS_15130 41960 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 43808 42021 gene locus_tag LOCUS_15140 43808 42021 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124155.1 protein_id gnl|my_center|LOCUS_15140 44132 46456 gene locus_tag LOCUS_15150 44132 46456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 46541 47497 gene locus_tag LOCUS_15160 46541 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 47494 48906 gene locus_tag LOCUS_15170 47494 48906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 49214 50875 gene locus_tag LOCUS_15180 49214 50875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 50872 51783 gene locus_tag LOCUS_15190 50872 51783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 51901 53061 gene locus_tag LOCUS_15200 51901 53061 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_15200 53061 54119 gene locus_tag LOCUS_15210 53061 54119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 54135 54710 gene locus_tag LOCUS_15220 54135 54710 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_15220 55723 54731 gene locus_tag LOCUS_15230 55723 54731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 55858 56469 gene locus_tag LOCUS_15240 55858 56469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 56520 57959 gene locus_tag LOCUS_15250 56520 57959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 58500 58030 gene locus_tag LOCUS_15260 58500 58030 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_15260 58797 58994 gene locus_tag LOCUS_15270 58797 58994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 58994 60424 gene locus_tag LOCUS_15280 58994 60424 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_15280 60820 60512 gene locus_tag LOCUS_15290 60820 60512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 61045 60845 gene locus_tag LOCUS_15300 61045 60845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 62086 61052 gene locus_tag LOCUS_15310 62086 61052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 63410 62136 gene locus_tag LOCUS_15320 gene erg3 63410 62136 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_15320 63457 64542 gene locus_tag LOCUS_15330 63457 64542 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_15330 64539 65075 gene locus_tag LOCUS_15340 64539 65075 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011081969.1 protein_id gnl|my_center|LOCUS_15340 65075 66385 gene locus_tag LOCUS_15350 65075 66385 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_15350 66660 67211 gene locus_tag LOCUS_15360 66660 67211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence023 45504 47645 gene locus_tag LOCUS_15370 gene pksE 45504 47645 CDS product polyketide biosynthesis protein PksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34787 protein_id gnl|my_center|LOCUS_15370 47924 50089 gene locus_tag LOCUS_15380 47924 50089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 50598 50167 gene locus_tag LOCUS_15390 50598 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 50800 52230 gene locus_tag LOCUS_15400 50800 52230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 52536 53972 gene locus_tag LOCUS_15410 52536 53972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 54897 54010 gene locus_tag LOCUS_15420 54897 54010 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_15420 55149 56417 gene locus_tag LOCUS_15430 55149 56417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 56427 56828 gene locus_tag LOCUS_15440 56427 56828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 57134 56844 gene locus_tag LOCUS_15450 57134 56844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142687.1 protein_id gnl|my_center|LOCUS_15450 58229 57198 gene locus_tag LOCUS_15460 58229 57198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 59762 58548 gene locus_tag LOCUS_15470 59762 58548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090651.1 protein_id gnl|my_center|LOCUS_15470 61660 59807 gene locus_tag LOCUS_15480 61660 59807 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_15480 62445 61657 gene locus_tag LOCUS_15490 62445 61657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_15490 63233 62445 gene locus_tag LOCUS_15500 63233 62445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_15500 64306 63230 gene locus_tag LOCUS_15510 64306 63230 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_15510 65175 64306 gene locus_tag LOCUS_15520 65175 64306 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_15520 65291 66688 gene locus_tag LOCUS_15530 65291 66688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 <67365 66784 gene locus_tag LOCUS_15540 <67365 66784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202509.1:methyltransferase type 11 >Feature sequence024 1739 168 gene locus_tag LOCUS_15550 1739 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3738 1795 gene locus_tag LOCUS_15560 3738 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4821 3919 gene locus_tag LOCUS_15570 4821 3919 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974448.1 protein_id gnl|my_center|LOCUS_15570 5322 6068 gene locus_tag LOCUS_15580 gene map 5322 6068 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAS8 protein_id gnl|my_center|LOCUS_15580 6940 6266 gene locus_tag LOCUS_15590 6940 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938870.1 protein_id gnl|my_center|LOCUS_15590 7632 7147 gene locus_tag LOCUS_15600 7632 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 7598 9211 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggacgatccccgcgtgtgcgggggagac 10040 9504 gene locus_tag LOCUS_15610 10040 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10390 10037 gene locus_tag LOCUS_15620 10390 10037 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_15620 11325 10552 gene locus_tag LOCUS_15630 11325 10552 CDS product CRISPR-associated protein Cse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_15630 12085 11318 gene locus_tag LOCUS_15640 12085 11318 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_15640 13314 12082 gene locus_tag LOCUS_15650 13314 12082 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_15650 13971 13339 gene locus_tag LOCUS_15660 13971 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 14873 13968 gene locus_tag LOCUS_15670 14873 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 17908 16043 gene locus_tag LOCUS_15680 17908 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 19521 18907 gene locus_tag LOCUS_15690 19521 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 20314 19745 gene locus_tag LOCUS_15700 20314 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 20698 21633 gene locus_tag LOCUS_15710 20698 21633 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061131.1 protein_id gnl|my_center|LOCUS_15710 21644 22492 gene locus_tag LOCUS_15720 gene pstC 21644 22492 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 protein_id gnl|my_center|LOCUS_15720 22489 23364 gene locus_tag LOCUS_15730 22489 23364 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KN93 protein_id gnl|my_center|LOCUS_15730 23361 24143 gene locus_tag LOCUS_15740 gene pstB 23361 24143 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7S9 protein_id gnl|my_center|LOCUS_15740 24420 24184 gene locus_tag LOCUS_15750 24420 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 25100 24435 gene locus_tag LOCUS_15760 25100 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 25875 25630 gene locus_tag LOCUS_15770 25875 25630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 25936 26496 gene locus_tag LOCUS_15780 25936 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 26510 29992 gene locus_tag LOCUS_15790 26510 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 29989 33222 gene locus_tag LOCUS_15800 29989 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 35989 33296 gene locus_tag LOCUS_15810 35989 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_15810 36340 36002 gene locus_tag LOCUS_15820 36340 36002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 36607 36416 gene locus_tag LOCUS_15830 36607 36416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 36960 37487 gene locus_tag LOCUS_15840 36960 37487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 37535 38032 gene locus_tag LOCUS_15850 37535 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 38025 39524 gene locus_tag LOCUS_15860 gene dur3 38025 39524 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_15860 39816 40838 gene locus_tag LOCUS_15870 gene pyrB 39816 40838 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_15870 40906 42825 gene locus_tag LOCUS_15880 gene asnB 40906 42825 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_15880 42825 43679 gene locus_tag LOCUS_15890 42825 43679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 43676 44998 gene locus_tag LOCUS_15900 43676 44998 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_15900 45551 47542 gene locus_tag LOCUS_15910 45551 47542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 47663 48244 gene locus_tag LOCUS_15920 47663 48244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 48540 49163 gene locus_tag LOCUS_15930 48540 49163 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_15930 49160 49627 gene locus_tag LOCUS_15940 49160 49627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15940 49634 51904 gene locus_tag LOCUS_15950 49634 51904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15950 52113 52670 gene locus_tag LOCUS_15960 52113 52670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 52899 53159 gene locus_tag LOCUS_15970 52899 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 53296 53595 gene locus_tag LOCUS_15980 53296 53595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 54201 54626 gene locus_tag LOCUS_15990 54201 54626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 54623 55756 gene locus_tag LOCUS_16000 54623 55756 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_16000 56397 62135 gene locus_tag LOCUS_16010 56397 62135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 63671 62343 gene locus_tag LOCUS_16020 63671 62343 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_16020 64250 63705 gene locus_tag LOCUS_16030 64250 63705 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887702.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence025 3021 2065 gene locus_tag LOCUS_16040 3021 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3617 3018 gene locus_tag LOCUS_16050 3617 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3685 6981 gene locus_tag LOCUS_16060 3685 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142889.1 protein_id gnl|my_center|LOCUS_16060 7239 7790 gene locus_tag LOCUS_16070 7239 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7860 9440 gene locus_tag LOCUS_16080 7860 9440 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_16080 10224 9661 gene locus_tag LOCUS_16090 10224 9661 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970944.1 protein_id gnl|my_center|LOCUS_16090 10414 13140 gene locus_tag LOCUS_16100 10414 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 15570 13165 gene locus_tag LOCUS_16110 15570 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16110 15958 16344 gene locus_tag LOCUS_16120 15958 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 17561 16296 gene locus_tag LOCUS_16130 17561 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 17896 20898 gene locus_tag LOCUS_16140 17896 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_16140 21806 21081 gene locus_tag LOCUS_16150 21806 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 22161 24983 gene locus_tag LOCUS_16160 22161 24983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 25081 24896 gene locus_tag LOCUS_16170 25081 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 25512 28694 gene locus_tag LOCUS_16180 25512 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 32372 28671 gene locus_tag LOCUS_16190 32372 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 33705 32482 gene locus_tag LOCUS_16200 33705 32482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 34083 33721 gene locus_tag LOCUS_16210 34083 33721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 34815 34111 gene locus_tag LOCUS_16220 34815 34111 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_16220 34949 37456 gene locus_tag LOCUS_16230 34949 37456 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_16230 37531 38376 gene locus_tag LOCUS_16240 gene miaA 37531 38376 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16240 38552 38761 gene locus_tag LOCUS_16250 gene hfq 38552 38761 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A74 protein_id gnl|my_center|LOCUS_16250 38776 40221 gene locus_tag LOCUS_16260 38776 40221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 40407 41330 gene locus_tag LOCUS_16270 40407 41330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 41327 41857 gene locus_tag LOCUS_16280 41327 41857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 41918 43561 gene locus_tag LOCUS_16290 41918 43561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_16290 44858 43596 gene locus_tag LOCUS_16300 44858 43596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_16300 45299 47098 gene locus_tag LOCUS_16310 45299 47098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 47103 51215 gene locus_tag LOCUS_16320 47103 51215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 51281 52849 gene locus_tag LOCUS_16330 51281 52849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 52909 53640 gene locus_tag LOCUS_16340 52909 53640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 53688 53999 gene locus_tag LOCUS_16350 53688 53999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 54167 53970 gene locus_tag LOCUS_16360 54167 53970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 55591 54149 gene locus_tag LOCUS_16370 55591 54149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 56179 55700 gene locus_tag LOCUS_16380 56179 55700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 56817 56176 gene locus_tag LOCUS_16390 gene sigH 56817 56176 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121971.1 protein_id gnl|my_center|LOCUS_16390 57918 56986 gene locus_tag LOCUS_16400 57918 56986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 58045 58443 gene locus_tag LOCUS_16410 gene yciH 58045 58443 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_16410 58938 58432 gene locus_tag LOCUS_16420 58938 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 60796 59000 gene locus_tag LOCUS_16430 60796 59000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 60993 62018 gene locus_tag LOCUS_16440 60993 62018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 62346 63605 gene locus_tag LOCUS_16450 62346 63605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence026 503 117 gene locus_tag LOCUS_16460 503 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2023 503 gene locus_tag LOCUS_16470 2023 503 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_16470 2835 2020 gene locus_tag LOCUS_16480 2835 2020 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_16480 4005 3037 gene locus_tag LOCUS_16490 gene coaA 4005 3037 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB3 protein_id gnl|my_center|LOCUS_16490 4160 4927 gene locus_tag LOCUS_16500 4160 4927 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_16500 4931 5398 gene locus_tag LOCUS_16510 4931 5398 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_16510 7239 5629 gene locus_tag LOCUS_16520 7239 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7677 8240 gene locus_tag LOCUS_16530 7677 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8338 8808 gene locus_tag LOCUS_16540 8338 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9621 8872 gene locus_tag LOCUS_16550 9621 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9684 10460 gene locus_tag LOCUS_16560 9684 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11461 10463 gene locus_tag LOCUS_16570 11461 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 13605 11461 gene locus_tag LOCUS_16580 13605 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 13788 14537 gene locus_tag LOCUS_16590 gene ate 13788 14537 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_16590 14530 17109 gene locus_tag LOCUS_16600 gene glgB 14530 17109 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 protein_id gnl|my_center|LOCUS_16600 17117 18835 gene locus_tag LOCUS_16610 17117 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 19117 19935 gene locus_tag LOCUS_16620 19117 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 20122 21369 gene locus_tag LOCUS_16630 gene fadA 20122 21369 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_16630 21382 22698 gene locus_tag LOCUS_16640 21382 22698 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_16640 23617 23129 gene locus_tag LOCUS_16650 23617 23129 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_16650 23778 25094 gene locus_tag LOCUS_16660 23778 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 25640 25104 gene locus_tag LOCUS_16670 25640 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 28140 25807 gene locus_tag LOCUS_16680 28140 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 28363 30690 gene locus_tag LOCUS_16690 gene glnS 28363 30690 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_16690 30736 32376 gene locus_tag LOCUS_16700 30736 32376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 34067 32472 gene locus_tag LOCUS_16710 34067 32472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 34623 34228 gene locus_tag LOCUS_16720 gene msrB 34623 34228 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDS5 protein_id gnl|my_center|LOCUS_16720 34888 35463 gene locus_tag LOCUS_16730 34888 35463 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_16730 37960 35507 gene locus_tag LOCUS_16740 37960 35507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16740 38179 38730 gene locus_tag LOCUS_16750 gene algU 38179 38730 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_16750 38767 39282 gene locus_tag LOCUS_16760 38767 39282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 39947 39279 gene locus_tag LOCUS_16770 39947 39279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 40630 40076 gene locus_tag LOCUS_16780 40630 40076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 41163 40744 gene locus_tag LOCUS_16790 41163 40744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 42052 41561 gene locus_tag LOCUS_16800 42052 41561 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUM0 protein_id gnl|my_center|LOCUS_16800 42397 43206 gene locus_tag LOCUS_16810 42397 43206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 43731 45542 gene locus_tag LOCUS_16820 43731 45542 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_16820 45633 47612 gene locus_tag LOCUS_16830 45633 47612 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_16830 47779 48135 gene locus_tag LOCUS_16840 47779 48135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 51498 48196 gene locus_tag LOCUS_16850 51498 48196 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_16850 55347 51844 gene locus_tag LOCUS_16860 55347 51844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 55979 55446 gene locus_tag LOCUS_16870 55979 55446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 56305 57711 gene locus_tag LOCUS_16880 56305 57711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 59220 57745 gene locus_tag LOCUS_16890 59220 57745 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_16890 59521 59240 gene locus_tag LOCUS_16900 59521 59240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 59797 61251 gene locus_tag LOCUS_16910 gene ffh 59797 61251 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1Q1 protein_id gnl|my_center|LOCUS_16910 61643 61978 gene locus_tag LOCUS_16920 61643 61978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 61975 62262 gene locus_tag LOCUS_16930 61975 62262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 62414 62860 gene locus_tag LOCUS_16940 62414 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 62842 63615 gene locus_tag LOCUS_16950 gene trmD 62842 63615 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_16950 >Feature sequence027 886 1392 gene locus_tag LOCUS_16960 886 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4330 1907 gene locus_tag LOCUS_16970 4330 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4968 4417 gene locus_tag LOCUS_16980 4968 4417 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_16980 5226 6410 gene locus_tag LOCUS_16990 5226 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 11141 6483 gene locus_tag LOCUS_17000 11141 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13285 11267 gene locus_tag LOCUS_17010 13285 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 14591 13644 gene locus_tag LOCUS_17020 14591 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 16233 14620 gene locus_tag LOCUS_17030 16233 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 17506 16244 gene locus_tag LOCUS_17040 17506 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 19508 17481 gene locus_tag LOCUS_17050 19508 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 19809 21137 gene locus_tag LOCUS_17060 19809 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 21174 22289 gene locus_tag LOCUS_17070 21174 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 22306 23034 gene locus_tag LOCUS_17080 22306 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 23776 25023 gene locus_tag LOCUS_17090 23776 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 24998 27502 gene locus_tag LOCUS_17100 24998 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 27968 27462 gene locus_tag LOCUS_17110 27968 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 29740 27965 gene locus_tag LOCUS_17120 29740 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 30326 29724 gene locus_tag LOCUS_17130 30326 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 32192 30408 gene locus_tag LOCUS_17140 32192 30408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 36741 32641 gene locus_tag LOCUS_17150 36741 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 37013 38113 gene locus_tag LOCUS_17160 37013 38113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_17160 40808 38085 gene locus_tag LOCUS_17170 40808 38085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 40880 43264 gene locus_tag LOCUS_17180 40880 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 43996 43277 gene locus_tag LOCUS_17190 43996 43277 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_17190 44627 44055 gene locus_tag LOCUS_17200 44627 44055 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_17200 46987 44741 gene locus_tag LOCUS_17210 46987 44741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 48273 46990 gene locus_tag LOCUS_17220 48273 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 49568 48291 gene locus_tag LOCUS_17230 49568 48291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 50422 49577 gene locus_tag LOCUS_17240 50422 49577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 51918 50419 gene locus_tag LOCUS_17250 51918 50419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 52541 52002 gene locus_tag LOCUS_17260 52541 52002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 54058 52583 gene locus_tag LOCUS_17270 54058 52583 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021862.1 protein_id gnl|my_center|LOCUS_17270 54576 54055 gene locus_tag LOCUS_17280 54576 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 55048 54569 gene locus_tag LOCUS_17290 55048 54569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 57118 55157 gene locus_tag LOCUS_17300 57118 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 57990 57394 gene locus_tag LOCUS_17310 57990 57394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 59285 58626 gene locus_tag LOCUS_17320 59285 58626 CDS product multiple promoter invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904906.1 protein_id gnl|my_center|LOCUS_17320 59464 61545 gene locus_tag LOCUS_17330 59464 61545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 62064 61738 gene locus_tag LOCUS_17340 62064 61738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 62351 62064 gene locus_tag LOCUS_17350 62351 62064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 62554 62360 gene locus_tag LOCUS_17360 62554 62360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence028 519 1511 gene locus_tag LOCUS_17370 519 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1524 2534 gene locus_tag LOCUS_17380 1524 2534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_17380 2534 3484 gene locus_tag LOCUS_17390 2534 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3538 5343 gene locus_tag LOCUS_17400 gene batD 3538 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_17400 5358 6137 gene locus_tag LOCUS_17410 5358 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6253 6642 gene locus_tag LOCUS_17420 6253 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7269 6985 gene locus_tag LOCUS_17430 7269 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7966 9120 gene locus_tag LOCUS_17440 7966 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 9399 9968 gene locus_tag LOCUS_17450 9399 9968 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_17450 11437 10007 gene locus_tag LOCUS_17460 11437 10007 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_17460 11687 12844 gene locus_tag LOCUS_17470 11687 12844 CDS product 1,3-propanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_17470 14024 12894 gene locus_tag LOCUS_17480 14024 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 15927 14017 gene locus_tag LOCUS_17490 15927 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 16852 15938 gene locus_tag LOCUS_17500 16852 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 18434 16818 gene locus_tag LOCUS_17510 18434 16818 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_17510 19619 18438 gene locus_tag LOCUS_17520 19619 18438 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_17520 20652 19684 gene locus_tag LOCUS_17530 gene wbtF 20652 19684 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_17530 22847 20745 gene locus_tag LOCUS_17540 22847 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 23101 24231 gene locus_tag LOCUS_17550 23101 24231 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_17550 26901 24247 gene locus_tag LOCUS_17560 26901 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 27618 26920 gene locus_tag LOCUS_17570 27618 26920 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_17570 28334 27615 gene locus_tag LOCUS_17580 28334 27615 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_17580 29389 28334 gene locus_tag LOCUS_17590 29389 28334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 29887 30714 gene locus_tag LOCUS_17600 29887 30714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 30803 31999 gene locus_tag LOCUS_17610 gene argE 30803 31999 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_17610 32003 33334 gene locus_tag LOCUS_17620 gene hutF 32003 33334 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_17620 33397 34524 gene locus_tag LOCUS_17630 33397 34524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 36094 34463 gene locus_tag LOCUS_17640 36094 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 37761 36487 gene locus_tag LOCUS_17650 37761 36487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 39077 37758 gene locus_tag LOCUS_17660 39077 37758 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090216.1 protein_id gnl|my_center|LOCUS_17660 39973 39104 gene locus_tag LOCUS_17670 gene cpdA 39973 39104 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_17670 40344 39970 gene locus_tag LOCUS_17680 40344 39970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 41002 40451 gene locus_tag LOCUS_17690 41002 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 41187 42506 gene locus_tag LOCUS_17700 41187 42506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 42541 43140 gene locus_tag LOCUS_17710 42541 43140 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_17710 43137 45776 gene locus_tag LOCUS_17720 43137 45776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 47184 45787 gene locus_tag LOCUS_17730 47184 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 47714 51676 gene locus_tag LOCUS_17740 47714 51676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 52240 51869 gene locus_tag LOCUS_17750 52240 51869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 52804 52376 gene locus_tag LOCUS_17760 52804 52376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 53697 53044 gene locus_tag LOCUS_17770 53697 53044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 53908 54927 gene locus_tag LOCUS_17780 gene adhP 53908 54927 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_17780 56275 54965 gene locus_tag LOCUS_17790 56275 54965 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 protein_id gnl|my_center|LOCUS_17790 56694 57149 gene locus_tag LOCUS_17800 56694 57149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 57299 58090 gene locus_tag LOCUS_17810 57299 58090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 protein_id gnl|my_center|LOCUS_17810 58143 58715 gene locus_tag LOCUS_17820 58143 58715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030373.1 protein_id gnl|my_center|LOCUS_17820 58992 58768 gene locus_tag LOCUS_17830 58992 58768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence029 <1 1581 gene locus_tag LOCUS_17840 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:histidine kinase 3455 1587 gene locus_tag LOCUS_17850 3455 1587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068662.1 protein_id gnl|my_center|LOCUS_17850 3926 3465 gene locus_tag LOCUS_17860 3926 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3957 5225 gene locus_tag LOCUS_17870 3957 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5798 5268 gene locus_tag LOCUS_17880 5798 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 8125 5795 gene locus_tag LOCUS_17890 8125 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9431 8163 gene locus_tag LOCUS_17900 gene murA 9431 8163 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q84 protein_id gnl|my_center|LOCUS_17900 9797 10876 gene locus_tag LOCUS_17910 gene ascD 9797 10876 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_17910 10908 11972 gene locus_tag LOCUS_17920 10908 11972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_17920 12056 12760 gene locus_tag LOCUS_17930 gene nikE 12056 12760 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33594 protein_id gnl|my_center|LOCUS_17930 12757 13719 gene locus_tag LOCUS_17940 gene oppB 12757 13719 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880275.1 protein_id gnl|my_center|LOCUS_17940 13716 14669 gene locus_tag LOCUS_17950 13716 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 14679 16607 gene locus_tag LOCUS_17960 14679 16607 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081378.1 protein_id gnl|my_center|LOCUS_17960 16628 17212 gene locus_tag LOCUS_17970 16628 17212 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972148.1 protein_id gnl|my_center|LOCUS_17970 17209 20088 gene locus_tag LOCUS_17980 17209 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 20391 21008 gene locus_tag LOCUS_17990 20391 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21047 22438 gene locus_tag LOCUS_18000 21047 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 22568 23779 gene locus_tag LOCUS_18010 22568 23779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_18010 24044 25468 gene locus_tag LOCUS_18020 24044 25468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 25686 25417 gene locus_tag LOCUS_18030 25686 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 25573 26643 gene locus_tag LOCUS_18040 25573 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 27406 26648 gene locus_tag LOCUS_18050 27406 26648 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_18050 28575 27403 gene locus_tag LOCUS_18060 28575 27403 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_18060 28703 29542 gene locus_tag LOCUS_18070 28703 29542 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_18070 30598 29639 gene locus_tag LOCUS_18080 30598 29639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 32172 30898 gene locus_tag LOCUS_18090 32172 30898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 32609 32169 gene locus_tag LOCUS_18100 32609 32169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 32778 33575 gene locus_tag LOCUS_18110 gene trmJ 32778 33575 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_18110 34348 33590 gene locus_tag LOCUS_18120 34348 33590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 35207 35362 gene locus_tag LOCUS_18130 35207 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 37077 35473 gene locus_tag LOCUS_18140 gene glgA 37077 35473 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816G8 protein_id gnl|my_center|LOCUS_18140 38356 37091 gene locus_tag LOCUS_18150 gene glgC 38356 37091 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_18150 38656 39876 gene locus_tag LOCUS_18160 38656 39876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 39980 41200 gene locus_tag LOCUS_18170 39980 41200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 42219 41188 gene locus_tag LOCUS_18180 42219 41188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 44181 42436 gene locus_tag LOCUS_18190 44181 42436 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_18190 44415 45038 gene locus_tag LOCUS_18200 44415 45038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 45590 45087 gene locus_tag LOCUS_18210 45590 45087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_18210 45859 47055 gene locus_tag LOCUS_18220 45859 47055 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_18220 47079 49730 gene locus_tag LOCUS_18230 47079 49730 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_18230 50299 49964 gene locus_tag LOCUS_18240 50299 49964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 50615 50283 gene locus_tag LOCUS_18250 50615 50283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 50950 51285 gene locus_tag LOCUS_18260 50950 51285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 52564 51374 gene locus_tag LOCUS_18270 52564 51374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 53356 55014 gene locus_tag LOCUS_18280 gene leuA 53356 55014 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI93 protein_id gnl|my_center|LOCUS_18280 55123 56541 gene locus_tag LOCUS_18290 gene leuC 55123 56541 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_18290 56538 57179 gene locus_tag LOCUS_18300 gene leuD 56538 57179 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_18300 57176 58300 gene locus_tag LOCUS_18310 gene leuB 57176 58300 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 protein_id gnl|my_center|LOCUS_18310 >Feature sequence030 1220 372 gene locus_tag LOCUS_18320 1220 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2423 1266 gene locus_tag LOCUS_18330 gene ddeI 2423 1266 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H720 protein_id gnl|my_center|LOCUS_18330 4382 2610 gene locus_tag LOCUS_18340 4382 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5613 4513 gene locus_tag LOCUS_18350 5613 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 7411 5771 gene locus_tag LOCUS_18360 7411 5771 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_18360 7943 7587 gene locus_tag LOCUS_18370 7943 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 8161 10476 gene locus_tag LOCUS_18380 8161 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 12521 10506 gene locus_tag LOCUS_18390 12521 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388240.1 protein_id gnl|my_center|LOCUS_18390 13493 12660 gene locus_tag LOCUS_18400 13493 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_18400 15481 13529 gene locus_tag LOCUS_18410 15481 13529 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_18410 16574 15609 gene locus_tag LOCUS_18420 gene glk 16574 15609 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_18420 18764 16713 gene locus_tag LOCUS_18430 gene glgX 18764 16713 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KR57 protein_id gnl|my_center|LOCUS_18430 18827 19264 gene locus_tag LOCUS_18440 18827 19264 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123303.1 protein_id gnl|my_center|LOCUS_18440 19763 19353 gene locus_tag LOCUS_18450 19763 19353 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_18450 20914 19763 gene locus_tag LOCUS_18460 20914 19763 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_18460 21325 21507 gene locus_tag LOCUS_18470 21325 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22144 23277 gene locus_tag LOCUS_18480 22144 23277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 23695 23946 gene locus_tag LOCUS_18490 23695 23946 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706824.1 protein_id gnl|my_center|LOCUS_18490 23943 24767 gene locus_tag LOCUS_18500 23943 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 25967 24873 gene locus_tag LOCUS_18510 25967 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 27772 25964 gene locus_tag LOCUS_18520 27772 25964 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_18520 28136 28645 gene locus_tag LOCUS_18530 28136 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532976.1 protein_id gnl|my_center|LOCUS_18530 28688 29386 gene locus_tag LOCUS_18540 28688 29386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_18540 29484 30227 gene locus_tag LOCUS_18550 29484 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 30418 31311 gene locus_tag LOCUS_18560 gene hbd 30418 31311 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_18560 31317 32081 gene locus_tag LOCUS_18570 31317 32081 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189909.1 protein_id gnl|my_center|LOCUS_18570 32091 33032 gene locus_tag LOCUS_18580 32091 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 33150 34334 gene locus_tag LOCUS_18590 33150 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 34439 35884 gene locus_tag LOCUS_18600 34439 35884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 36650 36081 gene locus_tag LOCUS_18610 36650 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 37734 36601 gene locus_tag LOCUS_18620 37734 36601 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H77 protein_id gnl|my_center|LOCUS_18620 38533 37712 gene locus_tag LOCUS_18630 38533 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 42118 38633 gene locus_tag LOCUS_18640 gene mfd 42118 38633 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMB9 protein_id gnl|my_center|LOCUS_18640 42568 42248 gene locus_tag LOCUS_18650 42568 42248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 44010 42565 gene locus_tag LOCUS_18660 gene eno 44010 42565 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEL5 protein_id gnl|my_center|LOCUS_18660 44176 44252 gene locus_tag LOCUS_t00110 44176 44252 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44337 44413 gene locus_tag LOCUS_t00120 44337 44413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44487 45800 gene locus_tag LOCUS_18670 44487 45800 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_18670 45797 47659 gene locus_tag LOCUS_18680 45797 47659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 48657 47671 gene locus_tag LOCUS_18690 48657 47671 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_18690 49747 48704 gene locus_tag LOCUS_18700 49747 48704 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_18700 50020 49944 gene locus_tag LOCUS_t00130 50020 49944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 50146 50070 gene locus_tag LOCUS_t00140 50146 50070 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 50322 50249 gene locus_tag LOCUS_t00150 50322 50249 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51372 50395 gene locus_tag LOCUS_18710 51372 50395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_18710 51665 52480 gene locus_tag LOCUS_18720 gene kynA 51665 52480 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_18720 52520 53743 gene locus_tag LOCUS_18730 52520 53743 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_18730 53745 54830 gene locus_tag LOCUS_18740 53745 54830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_18740 55439 54939 gene locus_tag LOCUS_18750 55439 54939 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_18750 55919 58291 gene locus_tag LOCUS_18760 55919 58291 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence031 1961 1734 gene locus_tag LOCUS_18770 1961 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2080 2307 gene locus_tag LOCUS_18780 2080 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3698 2217 gene locus_tag LOCUS_18790 3698 2217 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_18790 5409 3718 gene locus_tag LOCUS_18800 gene aceB 5409 3718 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706619.1 protein_id gnl|my_center|LOCUS_18800 5754 7265 gene locus_tag LOCUS_18810 5754 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 10258 7193 gene locus_tag LOCUS_18820 10258 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_18820 10935 10255 gene locus_tag LOCUS_18830 10935 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11612 10932 gene locus_tag LOCUS_18840 11612 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 12205 13065 gene locus_tag LOCUS_18850 12205 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 13661 13188 gene locus_tag LOCUS_18860 13661 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 14802 13708 gene locus_tag LOCUS_18870 14802 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 17415 14938 gene locus_tag LOCUS_18880 17415 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 17762 18319 gene locus_tag LOCUS_18890 17762 18319 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_18890 18316 19233 gene locus_tag LOCUS_18900 18316 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 21136 19286 gene locus_tag LOCUS_18910 21136 19286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 21708 22409 gene locus_tag LOCUS_18920 21708 22409 CDS product dUMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169692.1 protein_id gnl|my_center|LOCUS_18920 22539 23441 gene locus_tag LOCUS_18930 22539 23441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 25810 23633 gene locus_tag LOCUS_18940 25810 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 26958 25807 gene locus_tag LOCUS_18950 26958 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_18950 27069 29546 gene locus_tag LOCUS_18960 27069 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 30169 29561 gene locus_tag LOCUS_18970 30169 29561 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_18970 30345 30806 gene locus_tag LOCUS_18980 30345 30806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 31298 33781 gene locus_tag LOCUS_18990 31298 33781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 34863 34078 gene locus_tag LOCUS_19000 34863 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 36001 34856 gene locus_tag LOCUS_19010 36001 34856 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_19010 37482 36046 gene locus_tag LOCUS_19020 37482 36046 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_19020 38567 37509 gene locus_tag LOCUS_19030 38567 37509 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_19030 39766 38564 gene locus_tag LOCUS_19040 39766 38564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 40893 39781 gene locus_tag LOCUS_19050 40893 39781 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_19050 41361 42017 gene locus_tag LOCUS_19060 41361 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 42014 42469 gene locus_tag LOCUS_19070 42014 42469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 42627 44078 gene locus_tag LOCUS_19080 42627 44078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083904.1 protein_id gnl|my_center|LOCUS_19080 44079 45167 gene locus_tag LOCUS_19090 44079 45167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 45350 46489 gene locus_tag LOCUS_19100 gene pntA 45350 46489 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_19100 46486 46773 gene locus_tag LOCUS_19110 46486 46773 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_19110 46770 48209 gene locus_tag LOCUS_19120 gene pntB 46770 48209 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_19120 48348 50120 gene locus_tag LOCUS_19130 gene ggt 48348 50120 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976285.1 protein_id gnl|my_center|LOCUS_19130 50296 50886 gene locus_tag LOCUS_19140 50296 50886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 50900 53122 gene locus_tag LOCUS_19150 gene relA 50900 53122 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_19150 53444 54502 gene locus_tag LOCUS_19160 gene pilM 53444 54502 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_19160 54506 55129 gene locus_tag LOCUS_19170 54506 55129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 55144 55725 gene locus_tag LOCUS_19180 55144 55725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 55722 56321 gene locus_tag LOCUS_19190 55722 56321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence032 965 1960 gene locus_tag LOCUS_19200 965 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2383 1976 gene locus_tag LOCUS_19210 2383 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2509 3327 gene locus_tag LOCUS_19220 2509 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3352 3771 gene locus_tag LOCUS_19230 3352 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5012 3795 gene locus_tag LOCUS_19240 gene aspC 5012 3795 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_19240 5144 6163 gene locus_tag LOCUS_19250 5144 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6249 8072 gene locus_tag LOCUS_19260 6249 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 8065 9042 gene locus_tag LOCUS_19270 8065 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 9779 11842 gene locus_tag LOCUS_19280 9779 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 12762 12061 gene locus_tag LOCUS_19290 gene fabG 12762 12061 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_19290 12788 14329 gene locus_tag LOCUS_19300 12788 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14471 15271 gene locus_tag LOCUS_19310 14471 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 16855 15302 gene locus_tag LOCUS_19320 16855 15302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040799.1 protein_id gnl|my_center|LOCUS_19320 18514 16931 gene locus_tag LOCUS_19330 18514 16931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_19330 19244 18693 gene locus_tag LOCUS_19340 19244 18693 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_19340 21667 19253 gene locus_tag LOCUS_19350 21667 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 21751 22587 gene locus_tag LOCUS_19360 21751 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 24663 22663 gene locus_tag LOCUS_19370 24663 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 24871 24798 gene locus_tag LOCUS_t00160 24871 24798 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 24969 24896 gene locus_tag LOCUS_t00170 24969 24896 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25067 24993 gene locus_tag LOCUS_t00180 25067 24993 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25159 25084 gene locus_tag LOCUS_t00190 25159 25084 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26071 26721 gene locus_tag LOCUS_19380 26071 26721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_19380 29095 26894 gene locus_tag LOCUS_19390 29095 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 31245 29098 gene locus_tag LOCUS_19400 31245 29098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 32207 31245 gene locus_tag LOCUS_19410 32207 31245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939653.1 protein_id gnl|my_center|LOCUS_19410 32596 32204 gene locus_tag LOCUS_19420 32596 32204 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_19420 32892 33875 gene locus_tag LOCUS_19430 32892 33875 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704299.1 protein_id gnl|my_center|LOCUS_19430 33939 35072 gene locus_tag LOCUS_19440 33939 35072 CDS product D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637768.2 protein_id gnl|my_center|LOCUS_19440 35065 35340 gene locus_tag LOCUS_19450 gene soxA 35065 35340 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_19450 35337 36761 gene locus_tag LOCUS_19460 35337 36761 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205391.1 protein_id gnl|my_center|LOCUS_19460 36758 37666 gene locus_tag LOCUS_19470 gene dapA 36758 37666 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_19470 37941 38771 gene locus_tag LOCUS_19480 37941 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 40500 38887 gene locus_tag LOCUS_19490 40500 38887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 41133 40933 gene locus_tag LOCUS_19500 41133 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 41704 41192 gene locus_tag LOCUS_19510 41704 41192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 43429 41864 gene locus_tag LOCUS_19520 43429 41864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 44934 44152 gene locus_tag LOCUS_19530 44934 44152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 47590 45056 gene locus_tag LOCUS_19540 47590 45056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 48177 47587 gene locus_tag LOCUS_19550 48177 47587 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120523.1 protein_id gnl|my_center|LOCUS_19550 49017 48442 gene locus_tag LOCUS_19560 49017 48442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 49402 50244 gene locus_tag LOCUS_19570 49402 50244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 50277 50684 gene locus_tag LOCUS_19580 50277 50684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 50681 51175 gene locus_tag LOCUS_19590 50681 51175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 51560 51907 gene locus_tag LOCUS_19600 51560 51907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 52023 55946 gene locus_tag LOCUS_19610 52023 55946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence033 <1 1058 gene locus_tag LOCUS_19620 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879889.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 1238 2908 gene locus_tag LOCUS_19630 1238 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2874 4358 gene locus_tag LOCUS_19640 2874 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4414 5937 gene locus_tag LOCUS_19650 4414 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 6130 7488 gene locus_tag LOCUS_19660 6130 7488 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_19660 8435 7515 gene locus_tag LOCUS_19670 8435 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8899 8432 gene locus_tag LOCUS_19680 8899 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 9681 8947 gene locus_tag LOCUS_19690 9681 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 10045 9668 gene locus_tag LOCUS_19700 gene cheY 10045 9668 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4H5 protein_id gnl|my_center|LOCUS_19700 11987 10077 gene locus_tag LOCUS_19710 11987 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 13039 12146 gene locus_tag LOCUS_19720 gene menB 13039 12146 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYX3 protein_id gnl|my_center|LOCUS_19720 13217 15667 gene locus_tag LOCUS_19730 13217 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_19730 15969 18305 gene locus_tag LOCUS_19740 15969 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 18811 18344 gene locus_tag LOCUS_19750 18811 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_19750 19299 21701 gene locus_tag LOCUS_19760 19299 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 22116 21595 gene locus_tag LOCUS_19770 22116 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 22037 25444 gene locus_tag LOCUS_19780 22037 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 25441 26658 gene locus_tag LOCUS_19790 25441 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 26772 27917 gene locus_tag LOCUS_19800 26772 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 27914 28939 gene locus_tag LOCUS_19810 27914 28939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 28994 29806 gene locus_tag LOCUS_19820 28994 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 29803 30357 gene locus_tag LOCUS_19830 29803 30357 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222724.1 protein_id gnl|my_center|LOCUS_19830 32101 30686 gene locus_tag LOCUS_19840 32101 30686 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 protein_id gnl|my_center|LOCUS_19840 32991 32197 gene locus_tag LOCUS_19850 32991 32197 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_19850 33357 34988 gene locus_tag LOCUS_19860 33357 34988 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_19860 34994 35641 gene locus_tag LOCUS_19870 34994 35641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 35638 36756 gene locus_tag LOCUS_19880 35638 36756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 36834 37658 gene locus_tag LOCUS_19890 36834 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 37655 39493 gene locus_tag LOCUS_19900 37655 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 39504 40667 gene locus_tag LOCUS_19910 39504 40667 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_19910 40679 41521 gene locus_tag LOCUS_19920 40679 41521 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_19920 42849 41614 gene locus_tag LOCUS_19930 42849 41614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 43190 42996 gene locus_tag LOCUS_19940 43190 42996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 43095 44156 gene locus_tag LOCUS_19950 43095 44156 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130282.1 protein_id gnl|my_center|LOCUS_19950 44249 45814 gene locus_tag LOCUS_19960 44249 45814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 47099 45795 gene locus_tag LOCUS_19970 47099 45795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 47990 47220 gene locus_tag LOCUS_19980 47990 47220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 48844 48080 gene locus_tag LOCUS_19990 48844 48080 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_19990 49952 48939 gene locus_tag LOCUS_20000 49952 48939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 50542 51294 gene locus_tag LOCUS_20010 50542 51294 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_20010 51294 52370 gene locus_tag LOCUS_20020 gene fni 51294 52370 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_20020 52490 53785 gene locus_tag LOCUS_20030 52490 53785 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_20030 53911 55059 gene locus_tag LOCUS_20040 53911 55059 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_20040 55105 56148 gene locus_tag LOCUS_20050 55105 56148 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723775.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence034 1390 620 gene locus_tag LOCUS_20060 1390 620 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_20060 2739 1459 gene locus_tag LOCUS_20070 gene fabF 2739 1459 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS9 protein_id gnl|my_center|LOCUS_20070 3995 2736 gene locus_tag LOCUS_20080 gene fabF-1 3995 2736 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_20080 4245 5024 gene locus_tag LOCUS_20090 4245 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5065 6015 gene locus_tag LOCUS_20100 5065 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6873 6049 gene locus_tag LOCUS_20110 6873 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 7273 7031 gene locus_tag LOCUS_20120 7273 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 7202 8317 gene locus_tag LOCUS_20130 gene carA 7202 8317 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_20130 8314 9609 gene locus_tag LOCUS_20140 8314 9609 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969156.1 protein_id gnl|my_center|LOCUS_20140 10055 10306 gene locus_tag LOCUS_20150 10055 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 10325 13549 gene locus_tag LOCUS_20160 10325 13549 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCJ8 protein_id gnl|my_center|LOCUS_20160 13823 14713 gene locus_tag LOCUS_20170 gene dhmA1 13823 14713 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_20170 15164 14736 gene locus_tag LOCUS_20180 15164 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 15816 15277 gene locus_tag LOCUS_20190 15816 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 16298 15828 gene locus_tag LOCUS_20200 16298 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 16743 21590 gene locus_tag LOCUS_20210 16743 21590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 23118 21685 gene locus_tag LOCUS_20220 23118 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 23379 25193 gene locus_tag LOCUS_20230 23379 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 25213 26151 gene locus_tag LOCUS_20240 25213 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 26314 26778 gene locus_tag LOCUS_20250 26314 26778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 26838 29210 gene locus_tag LOCUS_20260 26838 29210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176636.1 protein_id gnl|my_center|LOCUS_20260 29386 30300 gene locus_tag LOCUS_20270 29386 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 33103 30338 gene locus_tag LOCUS_20280 33103 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 33295 34320 gene locus_tag LOCUS_20290 33295 34320 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_20290 34331 35362 gene locus_tag LOCUS_20300 34331 35362 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873588.1 protein_id gnl|my_center|LOCUS_20300 36512 37258 gene locus_tag LOCUS_20310 36512 37258 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_20310 37332 39131 gene locus_tag LOCUS_20320 37332 39131 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257979.1 protein_id gnl|my_center|LOCUS_20320 39133 40020 gene locus_tag LOCUS_20330 39133 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 40031 41887 gene locus_tag LOCUS_20340 gene sir 40031 41887 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141846.1 protein_id gnl|my_center|LOCUS_20340 42345 41770 gene locus_tag LOCUS_20350 42345 41770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 43740 42712 gene locus_tag LOCUS_20360 43740 42712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 44868 43867 gene locus_tag LOCUS_20370 44868 43867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 45230 45652 gene locus_tag LOCUS_20380 45230 45652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 46986 45664 gene locus_tag LOCUS_20390 46986 45664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_20390 49109 46983 gene locus_tag LOCUS_20400 49109 46983 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_20400 50879 49284 gene locus_tag LOCUS_20410 gene prfC 50879 49284 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_20410 51901 51026 gene locus_tag LOCUS_20420 51901 51026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_20420 52417 56037 gene locus_tag LOCUS_20430 52417 56037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence035 1147 1908 gene locus_tag LOCUS_20440 1147 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2104 4143 gene locus_tag LOCUS_20450 2104 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4140 5549 gene locus_tag LOCUS_20460 4140 5549 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_20460 5978 5586 gene locus_tag LOCUS_20470 gene arsC 5978 5586 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_20470 6180 7229 gene locus_tag LOCUS_20480 6180 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7229 8809 gene locus_tag LOCUS_20490 7229 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 8916 9125 gene locus_tag LOCUS_20500 8916 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 9278 10321 gene locus_tag LOCUS_20510 9278 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10507 10914 gene locus_tag LOCUS_20520 10507 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 11297 13825 gene locus_tag LOCUS_20530 11297 13825 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_20530 14096 19219 gene locus_tag LOCUS_20540 14096 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 19307 20140 gene locus_tag LOCUS_20550 19307 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_20550 21820 20252 gene locus_tag LOCUS_20560 21820 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 22781 21969 gene locus_tag LOCUS_20570 22781 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_20570 23750 22863 gene locus_tag LOCUS_20580 23750 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 23995 26367 gene locus_tag LOCUS_20590 23995 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 27768 26446 gene locus_tag LOCUS_20600 27768 26446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 28396 28088 gene locus_tag LOCUS_20610 28396 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 28735 28427 gene locus_tag LOCUS_20620 28735 28427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 29383 28799 gene locus_tag LOCUS_20630 29383 28799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 29805 29410 gene locus_tag LOCUS_20640 29805 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 29997 30821 gene locus_tag LOCUS_20650 29997 30821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 32084 30813 gene locus_tag LOCUS_20660 gene bcr 32084 30813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_20660 32277 32687 gene locus_tag LOCUS_20670 32277 32687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_20670 34099 32693 gene locus_tag LOCUS_20680 34099 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 34813 37290 gene locus_tag LOCUS_20690 gene thrA 34813 37290 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_20690 37405 38481 gene locus_tag LOCUS_20700 gene asd 37405 38481 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_20700 39481 38507 gene locus_tag LOCUS_20710 39481 38507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 39726 40775 gene locus_tag LOCUS_20720 39726 40775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 40853 41329 gene locus_tag LOCUS_20730 40853 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 42392 41334 gene locus_tag LOCUS_20740 42392 41334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 42584 44377 gene locus_tag LOCUS_20750 42584 44377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 44512 47037 gene locus_tag LOCUS_20760 44512 47037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 47236 48282 gene locus_tag LOCUS_20770 47236 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 48359 49960 gene locus_tag LOCUS_20780 48359 49960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 49957 52545 gene locus_tag LOCUS_20790 49957 52545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 52675 53160 gene locus_tag LOCUS_20800 52675 53160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 53222 54562 gene locus_tag LOCUS_20810 53222 54562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 54559 55011 gene locus_tag LOCUS_20820 54559 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence036 200 1939 gene locus_tag LOCUS_20830 200 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1936 3096 gene locus_tag LOCUS_20840 1936 3096 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_20840 3118 4527 gene locus_tag LOCUS_20850 3118 4527 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_20850 4520 5239 gene locus_tag LOCUS_20860 4520 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_20860 6075 5227 gene locus_tag LOCUS_20870 6075 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 7676 6546 gene locus_tag LOCUS_20880 7676 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 8135 9412 gene locus_tag LOCUS_20890 gene tyrS1 8135 9412 CDS product tyrosine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22326 protein_id gnl|my_center|LOCUS_20890 9438 10751 gene locus_tag LOCUS_20900 gene ald 9438 10751 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEI3 protein_id gnl|my_center|LOCUS_20900 11340 15257 gene locus_tag LOCUS_20910 11340 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 15350 16087 gene locus_tag LOCUS_20920 15350 16087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 16080 16292 gene locus_tag LOCUS_20930 16080 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 16322 17554 gene locus_tag LOCUS_20940 16322 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970842.1 protein_id gnl|my_center|LOCUS_20940 17594 18997 gene locus_tag LOCUS_20950 17594 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 19635 18994 gene locus_tag LOCUS_20960 gene udk 19635 18994 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_20960 19790 21793 gene locus_tag LOCUS_20970 19790 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 22606 21827 gene locus_tag LOCUS_20980 22606 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 23012 24412 gene locus_tag LOCUS_20990 gene fumC 23012 24412 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN6 protein_id gnl|my_center|LOCUS_20990 25092 24868 gene locus_tag LOCUS_21000 25092 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 25036 26745 gene locus_tag LOCUS_21010 25036 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 26751 27062 gene locus_tag LOCUS_21020 26751 27062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 27631 27095 gene locus_tag LOCUS_21030 27631 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_21030 27845 29401 gene locus_tag LOCUS_21040 27845 29401 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_21040 29412 32333 gene locus_tag LOCUS_21050 29412 32333 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_21050 32388 33251 gene locus_tag LOCUS_21060 32388 33251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 33679 33266 gene locus_tag LOCUS_21070 33679 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 36264 33676 gene locus_tag LOCUS_21080 36264 33676 CDS product exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941123.1 protein_id gnl|my_center|LOCUS_21080 36831 36280 gene locus_tag LOCUS_21090 gene pgsA 36831 36280 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46322 protein_id gnl|my_center|LOCUS_21090 38654 36981 gene locus_tag LOCUS_21100 38654 36981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 40671 39019 gene locus_tag LOCUS_21110 40671 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_21110 43793 40668 gene locus_tag LOCUS_21120 43793 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 44384 45646 gene locus_tag LOCUS_21130 44384 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 45649 46461 gene locus_tag LOCUS_21140 45649 46461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 46461 47960 gene locus_tag LOCUS_21150 46461 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 47957 49072 gene locus_tag LOCUS_21160 47957 49072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 49127 51004 gene locus_tag LOCUS_21170 49127 51004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 51001 52740 gene locus_tag LOCUS_21180 51001 52740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 52832 54820 gene locus_tag LOCUS_21190 52832 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence037 <1 838 gene locus_tag LOCUS_21200 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071226.1:RND superfamily efflux pump MFP component 835 4191 gene locus_tag LOCUS_21210 835 4191 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_21210 4295 5137 gene locus_tag LOCUS_21220 gene cysQ 4295 5137 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_21220 5256 6716 gene locus_tag LOCUS_21230 5256 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 7052 6720 gene locus_tag LOCUS_21240 7052 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 8651 7629 gene locus_tag LOCUS_21250 8651 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9763 8648 gene locus_tag LOCUS_21260 9763 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 11294 9771 gene locus_tag LOCUS_21270 11294 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 12075 11296 gene locus_tag LOCUS_21280 12075 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 12369 12127 gene locus_tag LOCUS_21290 12369 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 15050 12366 gene locus_tag LOCUS_21300 15050 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 17527 15047 gene locus_tag LOCUS_21310 17527 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 18849 17569 gene locus_tag LOCUS_21320 18849 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 19805 18846 gene locus_tag LOCUS_21330 19805 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 19932 19696 gene locus_tag LOCUS_21340 19932 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 21534 20371 gene locus_tag LOCUS_21350 21534 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 21782 22294 gene locus_tag LOCUS_21360 21782 22294 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388423.1 protein_id gnl|my_center|LOCUS_21360 22459 25656 gene locus_tag LOCUS_21370 22459 25656 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J9 protein_id gnl|my_center|LOCUS_21370 25842 28814 gene locus_tag LOCUS_21380 25842 28814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 28926 30632 gene locus_tag LOCUS_21390 28926 30632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 32161 30650 gene locus_tag LOCUS_21400 32161 30650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 33957 32158 gene locus_tag LOCUS_21410 33957 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 35021 34248 gene locus_tag LOCUS_21420 35021 34248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 36964 35213 gene locus_tag LOCUS_21430 36964 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 35337 35448 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttggggacgagaaccttggg 37144 37231 gene locus_tag LOCUS_t00200 37144 37231 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37827 37402 gene locus_tag LOCUS_21440 37827 37402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 38240 37842 gene locus_tag LOCUS_21450 38240 37842 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525197.1 protein_id gnl|my_center|LOCUS_21450 38322 38687 gene locus_tag LOCUS_21460 38322 38687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 38777 38977 gene locus_tag LOCUS_21470 38777 38977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 39086 39253 gene locus_tag LOCUS_21480 39086 39253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 39483 40556 gene locus_tag LOCUS_21490 39483 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 40572 42230 gene locus_tag LOCUS_21500 40572 42230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 43224 42331 gene locus_tag LOCUS_21510 43224 42331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 44674 43337 gene locus_tag LOCUS_21520 44674 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 45500 44703 gene locus_tag LOCUS_21530 gene epsD 45500 44703 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_21530 47821 45536 gene locus_tag LOCUS_21540 47821 45536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 48693 47821 gene locus_tag LOCUS_21550 48693 47821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 50098 48758 gene locus_tag LOCUS_21560 50098 48758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 50288 51730 gene locus_tag LOCUS_21570 50288 51730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 53434 51758 gene locus_tag LOCUS_21580 53434 51758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 53704 54120 gene locus_tag LOCUS_21590 53704 54120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 54184 55137 gene locus_tag LOCUS_21600 gene metF 54184 55137 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence038 5981 183 gene locus_tag LOCUS_21610 5981 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 6378 6145 gene locus_tag LOCUS_21620 6378 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6268 8016 gene locus_tag LOCUS_21630 6268 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 8738 8031 gene locus_tag LOCUS_21640 8738 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 11557 9170 gene locus_tag LOCUS_21650 11557 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 12114 11554 gene locus_tag LOCUS_21660 gene algU 12114 11554 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_21660 12503 13168 gene locus_tag LOCUS_21670 12503 13168 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705634.1 protein_id gnl|my_center|LOCUS_21670 13326 15251 gene locus_tag LOCUS_21680 gene fadE10 13326 15251 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63430 protein_id gnl|my_center|LOCUS_21680 15470 15676 gene locus_tag LOCUS_21690 15470 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 16397 15744 gene locus_tag LOCUS_21700 16397 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 16856 18754 gene locus_tag LOCUS_21710 gene dnaK 16856 18754 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_21710 18968 19312 gene locus_tag LOCUS_21720 gene merR 18968 19312 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_21720 20114 19347 gene locus_tag LOCUS_21730 20114 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 21327 20293 gene locus_tag LOCUS_21740 21327 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 22607 21324 gene locus_tag LOCUS_21750 22607 21324 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_21750 22742 22833 gene locus_tag LOCUS_t00210 22742 22833 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23144 25138 gene locus_tag LOCUS_21760 23144 25138 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_21760 25509 26360 gene locus_tag LOCUS_21770 25509 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_21770 27247 26795 gene locus_tag LOCUS_21780 27247 26795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 30963 27382 gene locus_tag LOCUS_21790 30963 27382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_21790 31637 30948 gene locus_tag LOCUS_21800 gene lolD1 31637 30948 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_21800 32083 31634 gene locus_tag LOCUS_21810 32083 31634 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_21810 33473 32070 gene locus_tag LOCUS_21820 33473 32070 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_21820 34788 33493 gene locus_tag LOCUS_21830 34788 33493 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_21830 36244 34886 gene locus_tag LOCUS_21840 gene adh 36244 34886 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_21840 37734 36346 gene locus_tag LOCUS_21850 gene hemN 37734 36346 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_21850 38956 37811 gene locus_tag LOCUS_21860 gene bamB 38956 37811 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P5 protein_id gnl|my_center|LOCUS_21860 40167 38977 gene locus_tag LOCUS_21870 40167 38977 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_21870 41774 40338 gene locus_tag LOCUS_21880 41774 40338 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_21880 42880 41774 gene locus_tag LOCUS_21890 42880 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_21890 44746 43232 gene locus_tag LOCUS_21900 44746 43232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 47077 44876 gene locus_tag LOCUS_21910 47077 44876 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123369.1 protein_id gnl|my_center|LOCUS_21910 49530 47623 gene locus_tag LOCUS_21920 49530 47623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 51266 49527 gene locus_tag LOCUS_21930 51266 49527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence039 1990 335 gene locus_tag LOCUS_21940 1990 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2126 4966 gene locus_tag LOCUS_21950 2126 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5051 5842 gene locus_tag LOCUS_21960 5051 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 7506 5860 gene locus_tag LOCUS_21970 7506 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 9202 7778 gene locus_tag LOCUS_21980 9202 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 10533 9226 gene locus_tag LOCUS_21990 10533 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225428.1 protein_id gnl|my_center|LOCUS_21990 14536 10547 gene locus_tag LOCUS_22000 14536 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_22000 16622 14517 gene locus_tag LOCUS_22010 16622 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_22010 16844 17293 gene locus_tag LOCUS_22020 gene ytoQ 16844 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_22020 17323 19083 gene locus_tag LOCUS_22030 17323 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 19224 20117 gene locus_tag LOCUS_22040 19224 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 20413 20853 gene locus_tag LOCUS_22050 20413 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081499.1 protein_id gnl|my_center|LOCUS_22050 20960 22648 gene locus_tag LOCUS_22060 20960 22648 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_22060 22746 23177 gene locus_tag LOCUS_22070 22746 23177 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731249.1 protein_id gnl|my_center|LOCUS_22070 23457 25643 gene locus_tag LOCUS_22080 gene katG 23457 25643 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_22080 25967 27709 gene locus_tag LOCUS_22090 25967 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_22090 28091 28474 gene locus_tag LOCUS_22100 28091 28474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 28501 29838 gene locus_tag LOCUS_22110 28501 29838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 29992 32244 gene locus_tag LOCUS_22120 29992 32244 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_22120 32277 32972 gene locus_tag LOCUS_22130 32277 32972 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_22130 32984 34384 gene locus_tag LOCUS_22140 32984 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 35674 34769 gene locus_tag LOCUS_22150 35674 34769 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204207.1 protein_id gnl|my_center|LOCUS_22150 37600 35759 gene locus_tag LOCUS_22160 37600 35759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 37847 38653 gene locus_tag LOCUS_22170 37847 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 38878 38681 gene locus_tag LOCUS_22180 38878 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 40719 38803 gene locus_tag LOCUS_22190 40719 38803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 42188 40875 gene locus_tag LOCUS_22200 42188 40875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 42877 42185 gene locus_tag LOCUS_22210 42877 42185 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_22210 43785 43054 gene locus_tag LOCUS_22220 43785 43054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 45850 44597 gene locus_tag LOCUS_22230 45850 44597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 47175 45847 gene locus_tag LOCUS_22240 47175 45847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 47440 47267 gene locus_tag LOCUS_22250 47440 47267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 47536 49212 gene locus_tag LOCUS_22260 gene yidK 47536 49212 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_22260 49265 50230 gene locus_tag LOCUS_22270 49265 50230 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_22270 50305 51243 gene locus_tag LOCUS_22280 50305 51243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 51429 51283 gene locus_tag LOCUS_22290 51429 51283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence040 3101 2739 gene locus_tag LOCUS_22300 3101 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3896 3252 gene locus_tag LOCUS_22310 3896 3252 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_22310 4350 4024 gene locus_tag LOCUS_22320 4350 4024 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_22320 4807 4580 gene locus_tag LOCUS_22330 4807 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5453 4866 gene locus_tag LOCUS_22340 5453 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6064 5552 gene locus_tag LOCUS_22350 6064 5552 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDH6 protein_id gnl|my_center|LOCUS_22350 8253 6145 gene locus_tag LOCUS_22360 8253 6145 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_22360 8748 8329 gene locus_tag LOCUS_22370 8748 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9697 8783 gene locus_tag LOCUS_22380 gene serB 9697 8783 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708549.1 protein_id gnl|my_center|LOCUS_22380 9963 11888 gene locus_tag LOCUS_22390 9963 11888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_22390 16152 12538 gene locus_tag LOCUS_22400 16152 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 16891 16511 gene locus_tag LOCUS_22410 16891 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18823 16913 gene locus_tag LOCUS_22420 gene selB 18823 16913 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_22420 19283 18837 gene locus_tag LOCUS_22430 19283 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_22430 20680 19304 gene locus_tag LOCUS_22440 20680 19304 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_22440 20864 20739 gene locus_tag LOCUS_22450 20864 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 21958 21080 gene locus_tag LOCUS_22460 21958 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 22643 22038 gene locus_tag LOCUS_22470 22643 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 25303 22640 gene locus_tag LOCUS_22480 25303 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 26416 25406 gene locus_tag LOCUS_22490 26416 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 27081 26413 gene locus_tag LOCUS_22500 27081 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 27401 27150 gene locus_tag LOCUS_22510 27401 27150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 28364 27468 gene locus_tag LOCUS_22520 28364 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22520 28921 28361 gene locus_tag LOCUS_22530 gene folA 28921 28361 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_22530 29712 28918 gene locus_tag LOCUS_22540 gene thyA 29712 28918 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_22540 30006 31877 gene locus_tag LOCUS_22550 gene sppA 30006 31877 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E7 protein_id gnl|my_center|LOCUS_22550 32904 31996 gene locus_tag LOCUS_22560 32904 31996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_22560 34483 32927 gene locus_tag LOCUS_22570 34483 32927 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_22570 35444 34542 gene locus_tag LOCUS_22580 35444 34542 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_22580 35939 35526 gene locus_tag LOCUS_22590 35939 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 36181 35972 gene locus_tag LOCUS_22600 36181 35972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 37129 36293 gene locus_tag LOCUS_22610 37129 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 37115 37267 gene locus_tag LOCUS_22620 37115 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 38172 37690 gene locus_tag LOCUS_22630 38172 37690 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_22630 39166 38180 gene locus_tag LOCUS_22640 39166 38180 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_22640 40474 39299 gene locus_tag LOCUS_22650 40474 39299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 40678 41379 gene locus_tag LOCUS_22660 40678 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_22660 41417 43579 gene locus_tag LOCUS_22670 41417 43579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 43581 44474 gene locus_tag LOCUS_22680 43581 44474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 45018 44581 gene locus_tag LOCUS_22690 45018 44581 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_22690 46324 45029 gene locus_tag LOCUS_22700 46324 45029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 47203 46463 gene locus_tag LOCUS_22710 47203 46463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 47973 47266 gene locus_tag LOCUS_22720 47973 47266 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_22720 48181 49779 gene locus_tag LOCUS_22730 48181 49779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence041 1403 2938 gene locus_tag LOCUS_22740 1403 2938 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_22740 4670 2982 gene locus_tag LOCUS_22750 4670 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5940 4648 gene locus_tag LOCUS_22760 5940 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 6518 6021 gene locus_tag LOCUS_22770 6518 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7938 6562 gene locus_tag LOCUS_22780 7938 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8130 8891 gene locus_tag LOCUS_22790 8130 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 protein_id gnl|my_center|LOCUS_22790 11114 8973 gene locus_tag LOCUS_22800 11114 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 11545 11111 gene locus_tag LOCUS_22810 11545 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 13264 11654 gene locus_tag LOCUS_22820 gene mphR 13264 11654 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_22820 13494 14720 gene locus_tag LOCUS_22830 13494 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 14743 15759 gene locus_tag LOCUS_22840 14743 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 16952 16062 gene locus_tag LOCUS_22850 16952 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 17220 18068 gene locus_tag LOCUS_22860 17220 18068 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_22860 18099 18575 gene locus_tag LOCUS_22870 18099 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 18705 19184 gene locus_tag LOCUS_22880 18705 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 19682 20089 gene locus_tag LOCUS_22890 19682 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 21584 20391 gene locus_tag LOCUS_22900 21584 20391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 23508 21850 gene locus_tag LOCUS_22910 gene groL 23508 21850 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_22910 23890 23603 gene locus_tag LOCUS_22920 gene groS 23890 23603 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBW0 protein_id gnl|my_center|LOCUS_22920 24395 25336 gene locus_tag LOCUS_22930 24395 25336 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_22930 26600 25344 gene locus_tag LOCUS_22940 26600 25344 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_22940 27931 26693 gene locus_tag LOCUS_22950 gene ribBA 27931 26693 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_22950 28195 29511 gene locus_tag LOCUS_22960 28195 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 29544 29972 gene locus_tag LOCUS_22970 29544 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 31269 29980 gene locus_tag LOCUS_22980 31269 29980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 32537 31266 gene locus_tag LOCUS_22990 32537 31266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 33143 32895 gene locus_tag LOCUS_23000 33143 32895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 33735 33304 gene locus_tag LOCUS_23010 33735 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 36935 33882 gene locus_tag LOCUS_23020 36935 33882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 37154 39547 gene locus_tag LOCUS_23030 37154 39547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 40142 39567 gene locus_tag LOCUS_23040 40142 39567 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_23040 42769 40139 gene locus_tag LOCUS_23050 42769 40139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 44940 44344 gene locus_tag LOCUS_23060 44940 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 47959 45356 gene locus_tag LOCUS_23070 47959 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 48122 50671 gene locus_tag LOCUS_23080 48122 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 <51467 50688 gene locus_tag LOCUS_23090 <51467 50688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898463.1:enoyl-CoA hydratase >Feature sequence042 789 1310 gene locus_tag LOCUS_23100 789 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_23100 1399 1584 gene locus_tag LOCUS_23110 gene rpmF 1399 1584 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_23110 1616 2659 gene locus_tag LOCUS_23120 gene plsX 1616 2659 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_23120 2705 3673 gene locus_tag LOCUS_23130 gene fabD-2 2705 3673 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_23130 3723 4466 gene locus_tag LOCUS_23140 gene fabG-2 3723 4466 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_23140 4635 4871 gene locus_tag LOCUS_23150 gene acpP 4635 4871 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD2 protein_id gnl|my_center|LOCUS_23150 5264 6517 gene locus_tag LOCUS_23160 5264 6517 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_23160 6606 7595 gene locus_tag LOCUS_23170 6606 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 7769 8203 gene locus_tag LOCUS_23180 7769 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 8292 9629 gene locus_tag LOCUS_23190 8292 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 9697 10596 gene locus_tag LOCUS_23200 9697 10596 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_23200 10600 11463 gene locus_tag LOCUS_23210 gene proC 10600 11463 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_23210 11604 12575 gene locus_tag LOCUS_23220 11604 12575 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_23220 17937 12628 gene locus_tag LOCUS_23230 17937 12628 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_23230 18068 19600 gene locus_tag LOCUS_23240 18068 19600 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_23240 19654 22446 gene locus_tag LOCUS_23250 19654 22446 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:20737..20739,aa:Sec) note codon on position 362 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23250 23615 22500 gene locus_tag LOCUS_23260 23615 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 26805 23749 gene locus_tag LOCUS_23270 26805 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 27095 30391 gene locus_tag LOCUS_23280 27095 30391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_23280 30458 30724 gene locus_tag LOCUS_23290 30458 30724 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THY7 protein_id gnl|my_center|LOCUS_23290 30721 31107 gene locus_tag LOCUS_23300 30721 31107 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_23300 32044 31214 gene locus_tag LOCUS_23310 gene deoD 32044 31214 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_23310 33814 32105 gene locus_tag LOCUS_23320 33814 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 34071 34634 gene locus_tag LOCUS_23330 34071 34634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 34781 35122 gene locus_tag LOCUS_23340 34781 35122 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C35 protein_id gnl|my_center|LOCUS_23340 36008 35274 gene locus_tag LOCUS_23350 36008 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 36778 36005 gene locus_tag LOCUS_23360 gene udp 36778 36005 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9X9 protein_id gnl|my_center|LOCUS_23360 37020 40838 gene locus_tag LOCUS_23370 gene metH 37020 40838 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_23370 40951 42735 gene locus_tag LOCUS_23380 40951 42735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 42794 43489 gene locus_tag LOCUS_23390 gene colR 42794 43489 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_23390 43523 44824 gene locus_tag LOCUS_23400 43523 44824 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268827.1 protein_id gnl|my_center|LOCUS_23400 46156 44846 gene locus_tag LOCUS_23410 46156 44846 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_23410 46586 46263 gene locus_tag LOCUS_23420 46586 46263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 46476 46985 gene locus_tag LOCUS_23430 46476 46985 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954461.1 protein_id gnl|my_center|LOCUS_23430 47253 47906 gene locus_tag LOCUS_23440 47253 47906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 47903 49069 gene locus_tag LOCUS_23450 gene ispB 47903 49069 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968861.1 protein_id gnl|my_center|LOCUS_23450 49080 49823 gene locus_tag LOCUS_23460 gene ubiE 49080 49823 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_23460 49820 51238 gene locus_tag LOCUS_23470 gene pchA 49820 51238 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104103.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence043 <1 5227 gene locus_tag LOCUS_23480 <1 5227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs 5309 5734 gene locus_tag LOCUS_23490 5309 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 6607 6933 gene locus_tag LOCUS_23500 6607 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 13423 11309 gene locus_tag LOCUS_23510 13423 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 14549 13617 gene locus_tag LOCUS_23520 14549 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 15384 14626 gene locus_tag LOCUS_23530 15384 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 15493 16656 gene locus_tag LOCUS_23540 15493 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 17361 16720 gene locus_tag LOCUS_23550 17361 16720 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_23550 17505 18473 gene locus_tag LOCUS_23560 17505 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 20745 18493 gene locus_tag LOCUS_23570 20745 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 21097 22215 gene locus_tag LOCUS_23580 21097 22215 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_23580 22331 24223 gene locus_tag LOCUS_23590 22331 24223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 24549 26411 gene locus_tag LOCUS_23600 24549 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 26444 27763 gene locus_tag LOCUS_23610 26444 27763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 27906 28694 gene locus_tag LOCUS_23620 gene kdsB 27906 28694 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_23620 28853 30514 gene locus_tag LOCUS_23630 gene pyrG 28853 30514 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT4 protein_id gnl|my_center|LOCUS_23630 30511 31434 gene locus_tag LOCUS_23640 gene kdsA 30511 31434 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61654 protein_id gnl|my_center|LOCUS_23640 31431 32420 gene locus_tag LOCUS_23650 31431 32420 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_23650 32420 32956 gene locus_tag LOCUS_23660 32420 32956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 32964 33914 gene locus_tag LOCUS_23670 gene htrB 32964 33914 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_23670 36423 33919 gene locus_tag LOCUS_23680 36423 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 37095 36649 gene locus_tag LOCUS_23690 37095 36649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 37543 38535 gene locus_tag LOCUS_23700 37543 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 39429 38683 gene locus_tag LOCUS_23710 39429 38683 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_23710 41315 39426 gene locus_tag LOCUS_23720 41315 39426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 41706 45344 gene locus_tag LOCUS_23730 41706 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 47310 45451 gene locus_tag LOCUS_23740 47310 45451 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_23740 47917 47435 gene locus_tag LOCUS_23750 47917 47435 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390805.1 protein_id gnl|my_center|LOCUS_23750 48426 48962 gene locus_tag LOCUS_23760 48426 48962 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_23760 49047 50216 gene locus_tag LOCUS_23770 49047 50216 CDS product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence044 1826 981 gene locus_tag LOCUS_23780 1826 981 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968103.1 protein_id gnl|my_center|LOCUS_23780 2554 1823 gene locus_tag LOCUS_23790 2554 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3356 2673 gene locus_tag LOCUS_23800 gene phoP 3356 2673 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_23800 5341 3353 gene locus_tag LOCUS_23810 5341 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5647 6696 gene locus_tag LOCUS_23820 5647 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6843 7799 gene locus_tag LOCUS_23830 6843 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 8907 7888 gene locus_tag LOCUS_23840 8907 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9129 9812 gene locus_tag LOCUS_23850 9129 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10144 11607 gene locus_tag LOCUS_23860 10144 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_23860 12906 11728 gene locus_tag LOCUS_23870 12906 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 15280 13238 gene locus_tag LOCUS_23880 15280 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 15549 16310 gene locus_tag LOCUS_23890 15549 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 16412 17089 gene locus_tag LOCUS_23900 16412 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 19483 17093 gene locus_tag LOCUS_23910 19483 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 20088 19480 gene locus_tag LOCUS_23920 20088 19480 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_23920 21461 20190 gene locus_tag LOCUS_23930 21461 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 23540 21588 gene locus_tag LOCUS_23940 23540 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 24757 23645 gene locus_tag LOCUS_23950 24757 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 25487 24864 gene locus_tag LOCUS_23960 25487 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 26163 25555 gene locus_tag LOCUS_23970 26163 25555 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_23970 29440 26258 gene locus_tag LOCUS_23980 29440 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 30685 29588 gene locus_tag LOCUS_23990 30685 29588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_23990 31658 30678 gene locus_tag LOCUS_24000 gene desC 31658 30678 CDS product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142860.1 protein_id gnl|my_center|LOCUS_24000 33422 31662 gene locus_tag LOCUS_24010 33422 31662 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977556.1 protein_id gnl|my_center|LOCUS_24010 34420 33422 gene locus_tag LOCUS_24020 34420 33422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228639.1 protein_id gnl|my_center|LOCUS_24020 37254 34417 gene locus_tag LOCUS_24030 37254 34417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 38845 37298 gene locus_tag LOCUS_24040 38845 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 40458 38848 gene locus_tag LOCUS_24050 40458 38848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 41549 40506 gene locus_tag LOCUS_24060 41549 40506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 47982 41539 gene locus_tag LOCUS_24070 47982 41539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 48611 48006 gene locus_tag LOCUS_24080 48611 48006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 <50542 48641 gene locus_tag LOCUS_24090 <50542 48641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545510.1:ABC transporter >Feature sequence045 1806 2891 gene locus_tag LOCUS_24100 1806 2891 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_24100 2888 4210 gene locus_tag LOCUS_24110 2888 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 4224 6440 gene locus_tag LOCUS_24120 4224 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6503 7807 gene locus_tag LOCUS_24130 6503 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7804 9807 gene locus_tag LOCUS_24140 7804 9807 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_24140 9852 10436 gene locus_tag LOCUS_24150 9852 10436 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_24150 11360 10542 gene locus_tag LOCUS_24160 11360 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 18099 11473 gene locus_tag LOCUS_24170 18099 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 19260 18430 gene locus_tag LOCUS_24180 19260 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 20855 19257 gene locus_tag LOCUS_24190 20855 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 21771 21028 gene locus_tag LOCUS_24200 21771 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 22153 21794 gene locus_tag LOCUS_24210 gene cheY-2 22153 21794 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_24210 22791 24488 gene locus_tag LOCUS_24220 22791 24488 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545469.1 protein_id gnl|my_center|LOCUS_24220 24606 25295 gene locus_tag LOCUS_24230 24606 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 25339 25845 gene locus_tag LOCUS_24240 25339 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 25891 27963 gene locus_tag LOCUS_24250 gene mcp64H-2 25891 27963 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943007.1 protein_id gnl|my_center|LOCUS_24250 28092 29993 gene locus_tag LOCUS_24260 28092 29993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 30005 30847 gene locus_tag LOCUS_24270 gene cheR2 30005 30847 CDS product chemotaxis protein methyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS61 protein_id gnl|my_center|LOCUS_24270 30840 31937 gene locus_tag LOCUS_24280 gene cheB2 30840 31937 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62637 protein_id gnl|my_center|LOCUS_24280 31787 31701 gene locus_tag LOCUS_t00220 31787 31701 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31985 32653 gene locus_tag LOCUS_24290 31985 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 34635 32728 gene locus_tag LOCUS_24300 34635 32728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 35285 34683 gene locus_tag LOCUS_24310 35285 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 36786 35410 gene locus_tag LOCUS_24320 36786 35410 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_24320 37688 37245 gene locus_tag LOCUS_24330 37688 37245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 39308 37749 gene locus_tag LOCUS_24340 39308 37749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 39556 40986 gene locus_tag LOCUS_24350 39556 40986 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_24350 40955 42094 gene locus_tag LOCUS_24360 40955 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 43509 42091 gene locus_tag LOCUS_24370 43509 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 49446 43633 gene locus_tag LOCUS_24380 49446 43633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence046 22213 7775 gene locus_tag LOCUS_24390 22213 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 23378 22215 gene locus_tag LOCUS_24400 23378 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 40595 23388 gene locus_tag LOCUS_24410 40595 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 41968 42276 gene locus_tag LOCUS_24420 41968 42276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 42312 43613 gene locus_tag LOCUS_24430 42312 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 45497 44448 gene locus_tag LOCUS_24440 45497 44448 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG7 protein_id gnl|my_center|LOCUS_24440 47334 45580 gene locus_tag LOCUS_24450 gene ilvI 47334 45580 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2I8 protein_id gnl|my_center|LOCUS_24450 47777 47331 gene locus_tag LOCUS_24460 47777 47331 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_24460 49559 47928 gene locus_tag LOCUS_24470 gene pruA 49559 47928 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence047 791 1816 gene locus_tag LOCUS_24480 791 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2863 1832 gene locus_tag LOCUS_24490 2863 1832 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_24490 4181 2853 gene locus_tag LOCUS_24500 4181 2853 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_24500 5443 4223 gene locus_tag LOCUS_24510 5443 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_24510 6787 5453 gene locus_tag LOCUS_24520 6787 5453 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_24520 7076 6822 gene locus_tag LOCUS_24530 7076 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 7737 7183 gene locus_tag LOCUS_24540 7737 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 8113 8988 gene locus_tag LOCUS_24550 8113 8988 CDS product alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_24550 9130 11055 gene locus_tag LOCUS_24560 9130 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 11520 11656 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcgacgatgatgtcgaa 12564 13181 gene locus_tag LOCUS_24570 12564 13181 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_24570 13178 15640 gene locus_tag LOCUS_24580 13178 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 16494 15631 gene locus_tag LOCUS_24590 16494 15631 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_24590 17604 16537 gene locus_tag LOCUS_24600 17604 16537 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_24600 18713 17601 gene locus_tag LOCUS_24610 18713 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_24610 19052 20194 gene locus_tag LOCUS_24620 19052 20194 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_24620 20337 22514 gene locus_tag LOCUS_24630 20337 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 23262 22588 gene locus_tag LOCUS_24640 23262 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 26603 23313 gene locus_tag LOCUS_24650 26603 23313 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_24650 27355 26687 gene locus_tag LOCUS_24660 27355 26687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 27607 29433 gene locus_tag LOCUS_24670 27607 29433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 29642 30076 gene locus_tag LOCUS_24680 29642 30076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 31767 30097 gene locus_tag LOCUS_24690 31767 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 33136 31895 gene locus_tag LOCUS_24700 33136 31895 CDS product putative mannose-6-phosphate isomerase ManA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704330.1 protein_id gnl|my_center|LOCUS_24700 34007 33129 gene locus_tag LOCUS_24710 34007 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 35279 34161 gene locus_tag LOCUS_24720 35279 34161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 37689 35830 gene locus_tag LOCUS_24730 37689 35830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 38354 37674 gene locus_tag LOCUS_24740 38354 37674 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_24740 39781 38555 gene locus_tag LOCUS_24750 39781 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 40686 39988 gene locus_tag LOCUS_24760 40686 39988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 40721 41011 gene locus_tag LOCUS_24770 40721 41011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 42514 41135 gene locus_tag LOCUS_24780 gene mtaD 42514 41135 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_24780 42700 42545 gene locus_tag LOCUS_24790 gene rpmG 42700 42545 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_24790 43009 42933 gene locus_tag LOCUS_t00230 43009 42933 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43241 43165 gene locus_tag LOCUS_t00240 43241 43165 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43541 44140 gene locus_tag LOCUS_24800 gene sodA 43541 44140 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_24800 44561 44863 gene locus_tag LOCUS_24810 44561 44863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 44978 45054 gene locus_tag LOCUS_t00250 44978 45054 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45385 45020 gene locus_tag LOCUS_24820 45385 45020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 45290 46729 gene locus_tag LOCUS_24830 gene tilS 45290 46729 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM96 protein_id gnl|my_center|LOCUS_24830 46760 48721 gene locus_tag LOCUS_24840 gene ftsH-2 46760 48721 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_24840 >Feature sequence048 2066 2902 gene locus_tag LOCUS_24850 2066 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3132 3341 gene locus_tag LOCUS_24860 gene rpsU 3132 3341 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKU0 protein_id gnl|my_center|LOCUS_24860 3513 5990 gene locus_tag LOCUS_24870 gene mutS2 3513 5990 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FQ9 protein_id gnl|my_center|LOCUS_24870 5999 7762 gene locus_tag LOCUS_24880 5999 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7883 9589 gene locus_tag LOCUS_24890 gene rpoD 7883 9589 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_24890 10621 9689 gene locus_tag LOCUS_24900 gene thrB 10621 9689 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_24900 10790 12367 gene locus_tag LOCUS_24910 10790 12367 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_24910 12550 13887 gene locus_tag LOCUS_24920 12550 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 14243 14013 gene locus_tag LOCUS_24930 14243 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 14943 14257 gene locus_tag LOCUS_24940 gene sigR 14943 14257 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_24940 14825 15118 gene locus_tag LOCUS_24950 14825 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 15049 15441 gene locus_tag LOCUS_24960 15049 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 15438 15908 gene locus_tag LOCUS_24970 15438 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 15905 16765 gene locus_tag LOCUS_24980 gene atpB 15905 16765 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_24980 16943 17260 gene locus_tag LOCUS_24990 16943 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 17396 17986 gene locus_tag LOCUS_25000 gene atpF 17396 17986 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S434 protein_id gnl|my_center|LOCUS_25000 18040 18642 gene locus_tag LOCUS_25010 gene atpH 18040 18642 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF0 protein_id gnl|my_center|LOCUS_25010 18719 20443 gene locus_tag LOCUS_25020 18719 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 20512 21384 gene locus_tag LOCUS_25030 gene atpG 20512 21384 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_25030 21449 22891 gene locus_tag LOCUS_25040 gene atpD 21449 22891 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_25040 22963 23370 gene locus_tag LOCUS_25050 gene atpC 22963 23370 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_25050 23590 24903 gene locus_tag LOCUS_25060 23590 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 25050 26774 gene locus_tag LOCUS_25070 25050 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 27278 26874 gene locus_tag LOCUS_25080 27278 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 27554 28324 gene locus_tag LOCUS_25090 gene wzm 27554 28324 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_25090 28493 30196 gene locus_tag LOCUS_25100 28493 30196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 30786 32114 gene locus_tag LOCUS_25110 30786 32114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 32450 35428 gene locus_tag LOCUS_25120 32450 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 35532 36746 gene locus_tag LOCUS_25130 gene tagH 35532 36746 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_25130 37606 36755 gene locus_tag LOCUS_25140 37606 36755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 37719 38774 gene locus_tag LOCUS_25150 37719 38774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 40573 38750 gene locus_tag LOCUS_25160 40573 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 41967 40576 gene locus_tag LOCUS_25170 41967 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 42164 43975 gene locus_tag LOCUS_25180 42164 43975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 43975 45255 gene locus_tag LOCUS_25190 43975 45255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 45339 46694 gene locus_tag LOCUS_25200 45339 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 47110 46772 gene locus_tag LOCUS_25210 47110 46772 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_25210 47550 47107 gene locus_tag LOCUS_25220 47550 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 48199 47576 gene locus_tag LOCUS_25230 48199 47576 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_25230 48308 49252 gene locus_tag LOCUS_25240 48308 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence049 2317 1079 gene locus_tag LOCUS_25250 2317 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3070 8940 gene locus_tag LOCUS_25260 3070 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9198 11114 gene locus_tag LOCUS_25270 9198 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 11111 11830 gene locus_tag LOCUS_25280 11111 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 12568 11921 gene locus_tag LOCUS_25290 12568 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 13587 12565 gene locus_tag LOCUS_25300 13587 12565 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_25300 15359 13680 gene locus_tag LOCUS_25310 15359 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 15698 16312 gene locus_tag LOCUS_25320 15698 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 16335 16685 gene locus_tag LOCUS_25330 16335 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 16791 18440 gene locus_tag LOCUS_25340 16791 18440 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_25340 18807 20210 gene locus_tag LOCUS_25350 18807 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 20223 20498 gene locus_tag LOCUS_25360 20223 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 20582 21400 gene locus_tag LOCUS_25370 20582 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 21987 21460 gene locus_tag LOCUS_25380 21987 21460 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_25380 23668 22085 gene locus_tag LOCUS_25390 gene lig2 23668 22085 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_25390 24678 23668 gene locus_tag LOCUS_25400 24678 23668 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_25400 25241 24903 gene locus_tag LOCUS_25410 25241 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 33362 25530 gene locus_tag LOCUS_25420 33362 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 33531 33989 gene locus_tag LOCUS_25430 33531 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 34296 34739 gene locus_tag LOCUS_25440 34296 34739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 34974 36212 gene locus_tag LOCUS_25450 34974 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 36219 38282 gene locus_tag LOCUS_25460 36219 38282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 38517 39875 gene locus_tag LOCUS_25470 38517 39875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 46720 39956 gene locus_tag LOCUS_25480 46720 39956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 49404 46852 gene locus_tag LOCUS_25490 49404 46852 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence050 517 317 gene locus_tag LOCUS_25500 517 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1311 808 gene locus_tag LOCUS_25510 1311 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_25510 2953 3711 gene locus_tag LOCUS_25520 2953 3711 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_25520 3731 4594 gene locus_tag LOCUS_25530 3731 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 5470 7857 gene locus_tag LOCUS_25540 5470 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 9296 8148 gene locus_tag LOCUS_25550 gene metK 9296 8148 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_25550 10114 9569 gene locus_tag LOCUS_25560 10114 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 10254 10982 gene locus_tag LOCUS_25570 10254 10982 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_25570 12056 11094 gene locus_tag LOCUS_25580 12056 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 14866 12200 gene locus_tag LOCUS_25590 14866 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_25590 14944 16833 gene locus_tag LOCUS_25600 14944 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 18568 16850 gene locus_tag LOCUS_25610 18568 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 19748 18897 gene locus_tag LOCUS_25620 19748 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 21355 19910 gene locus_tag LOCUS_25630 21355 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946629.1 protein_id gnl|my_center|LOCUS_25630 21876 21514 gene locus_tag LOCUS_25640 21876 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 22143 22625 gene locus_tag LOCUS_25650 22143 22625 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_25650 22719 23048 gene locus_tag LOCUS_25660 22719 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 23045 24163 gene locus_tag LOCUS_25670 23045 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 24244 26850 gene locus_tag LOCUS_25680 24244 26850 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222071.1 protein_id gnl|my_center|LOCUS_25680 27897 26875 gene locus_tag LOCUS_25690 gene truD 27897 26875 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_25690 28264 29349 gene locus_tag LOCUS_25700 28264 29349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_25700 29360 29914 gene locus_tag LOCUS_25710 29360 29914 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_25710 29925 31922 gene locus_tag LOCUS_25720 29925 31922 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_25720 31919 34228 gene locus_tag LOCUS_25730 31919 34228 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181435.1 protein_id gnl|my_center|LOCUS_25730 36024 34264 gene locus_tag LOCUS_25740 36024 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 36678 36064 gene locus_tag LOCUS_25750 36678 36064 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_25750 39506 36834 gene locus_tag LOCUS_25760 gene mutS 39506 36834 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_25760 40173 39856 gene locus_tag LOCUS_25770 40173 39856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 40758 40177 gene locus_tag LOCUS_25780 40758 40177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 40906 41406 gene locus_tag LOCUS_25790 40906 41406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 41417 42619 gene locus_tag LOCUS_25800 41417 42619 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_25800 42616 43521 gene locus_tag LOCUS_25810 42616 43521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 43518 44054 gene locus_tag LOCUS_25820 43518 44054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 46086 44101 gene locus_tag LOCUS_25830 46086 44101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 47372 46161 gene locus_tag LOCUS_25840 47372 46161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 <48704 47634 gene locus_tag LOCUS_25850 <48704 47634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase >Feature sequence051 1625 429 gene locus_tag LOCUS_25860 1625 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1896 3836 gene locus_tag LOCUS_25870 1896 3836 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_25870 4380 3910 gene locus_tag LOCUS_25880 4380 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 4821 4408 gene locus_tag LOCUS_25890 4821 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 7462 5087 gene locus_tag LOCUS_25900 7462 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 8656 7541 gene locus_tag LOCUS_25910 8656 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 9322 8738 gene locus_tag LOCUS_25920 9322 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 9571 9804 gene locus_tag LOCUS_25930 9571 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_25930 9823 11154 gene locus_tag LOCUS_25940 9823 11154 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921455.1 protein_id gnl|my_center|LOCUS_25940 11955 11203 gene locus_tag LOCUS_25950 11955 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 12450 12001 gene locus_tag LOCUS_25960 12450 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 13076 12447 gene locus_tag LOCUS_25970 13076 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 14558 13125 gene locus_tag LOCUS_25980 14558 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_25980 15720 14563 gene locus_tag LOCUS_25990 15720 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 18106 16277 gene locus_tag LOCUS_26000 18106 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 18635 20707 gene locus_tag LOCUS_26010 18635 20707 CDS product L-ascorbate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970858.1 protein_id gnl|my_center|LOCUS_26010 20735 20977 gene locus_tag LOCUS_26020 20735 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 21024 21620 gene locus_tag LOCUS_26030 21024 21620 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26030 21617 24721 gene locus_tag LOCUS_26040 21617 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 25040 24735 gene locus_tag LOCUS_26050 25040 24735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 27230 25179 gene locus_tag LOCUS_26060 27230 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 27446 27784 gene locus_tag LOCUS_26070 27446 27784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 27802 28896 gene locus_tag LOCUS_26080 27802 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 29219 28899 gene locus_tag LOCUS_26090 29219 28899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 29330 30424 gene locus_tag LOCUS_26100 29330 30424 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_26100 30510 31160 gene locus_tag LOCUS_26110 30510 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703633.1 protein_id gnl|my_center|LOCUS_26110 31247 31172 gene locus_tag LOCUS_t00260 31247 31172 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 31354 31279 gene locus_tag LOCUS_t00270 31354 31279 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31462 31387 gene locus_tag LOCUS_t00280 31462 31387 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 31595 31519 gene locus_tag LOCUS_t00290 31595 31519 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31701 31628 gene locus_tag LOCUS_t00300 31701 31628 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 32310 34484 gene locus_tag LOCUS_26120 32310 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 35582 34707 gene locus_tag LOCUS_26130 35582 34707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 37630 35780 gene locus_tag LOCUS_26140 37630 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 37871 39538 gene locus_tag LOCUS_26150 37871 39538 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_26150 39602 40135 gene locus_tag LOCUS_26160 39602 40135 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_26160 40237 41025 gene locus_tag LOCUS_26170 gene paaG 40237 41025 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_26170 42295 41048 gene locus_tag LOCUS_26180 42295 41048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_26180 42572 43003 gene locus_tag LOCUS_26190 42572 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 44723 43227 gene locus_tag LOCUS_26200 44723 43227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 45246 47945 gene locus_tag LOCUS_26210 45246 47945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence052 <1 1002 gene locus_tag LOCUS_26220 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GH6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1027 3408 gene locus_tag LOCUS_26230 1027 3408 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX9 protein_id gnl|my_center|LOCUS_26230 5805 3427 gene locus_tag LOCUS_26240 5805 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 6523 5936 gene locus_tag LOCUS_26250 6523 5936 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26250 7328 7648 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagacgatcacgagctcgaaatcgaagtcgatccc 9380 8163 gene locus_tag LOCUS_26260 9380 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 9737 9477 gene locus_tag LOCUS_26270 9737 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 10407 9904 gene locus_tag LOCUS_26280 10407 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 12258 10525 gene locus_tag LOCUS_26290 12258 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 12871 13626 gene locus_tag LOCUS_26300 gene dpm1 12871 13626 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_26300 13623 13943 gene locus_tag LOCUS_26310 13623 13943 CDS product lipid A biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_26310 15640 13865 gene locus_tag LOCUS_26320 15640 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 16817 15693 gene locus_tag LOCUS_26330 gene celE 16817 15693 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_26330 17467 16814 gene locus_tag LOCUS_26340 17467 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_26340 19052 17472 gene locus_tag LOCUS_26350 19052 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 20193 19216 gene locus_tag LOCUS_26360 20193 19216 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_26360 21957 20209 gene locus_tag LOCUS_26370 21957 20209 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_26370 22277 24445 gene locus_tag LOCUS_26380 22277 24445 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_26380 24774 29423 gene locus_tag LOCUS_26390 24774 29423 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_26390 29572 29898 gene locus_tag LOCUS_26400 29572 29898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 30624 29941 gene locus_tag LOCUS_26410 30624 29941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 31708 30659 gene locus_tag LOCUS_26420 gene manC 31708 30659 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_26420 35837 31797 gene locus_tag LOCUS_26430 35837 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117982.1 protein_id gnl|my_center|LOCUS_26430 36610 35876 gene locus_tag LOCUS_26440 36610 35876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 36682 38130 gene locus_tag LOCUS_26450 gene gatB 36682 38130 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_26450 38134 38889 gene locus_tag LOCUS_26460 38134 38889 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_26460 38886 39821 gene locus_tag LOCUS_26470 gene ftsX 38886 39821 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_26470 41228 40065 gene locus_tag LOCUS_26480 41228 40065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 42114 41296 gene locus_tag LOCUS_26490 42114 41296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 42843 42130 gene locus_tag LOCUS_26500 42843 42130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 43345 42854 gene locus_tag LOCUS_26510 43345 42854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 43787 43350 gene locus_tag LOCUS_26520 gene tolR 43787 43350 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_26520 44493 43804 gene locus_tag LOCUS_26530 44493 43804 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_26530 45424 44894 gene locus_tag LOCUS_26540 gene ruvC 45424 44894 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDT0 protein_id gnl|my_center|LOCUS_26540 46178 45435 gene locus_tag LOCUS_26550 46178 45435 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_26550 >Feature sequence053 1373 1068 gene locus_tag LOCUS_26560 1373 1068 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_26560 1676 3181 gene locus_tag LOCUS_26570 1676 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4386 3271 gene locus_tag LOCUS_26580 gene agxT 4386 3271 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_26580 4735 4388 gene locus_tag LOCUS_26590 gene fbp 4735 4388 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_26590 4928 6190 gene locus_tag LOCUS_26600 4928 6190 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_26600 7347 6229 gene locus_tag LOCUS_26610 7347 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 8315 7491 gene locus_tag LOCUS_26620 8315 7491 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_26620 8622 9083 gene locus_tag LOCUS_26630 8622 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 9289 10950 gene locus_tag LOCUS_26640 9289 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10979 12493 gene locus_tag LOCUS_26650 10979 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 12518 13324 gene locus_tag LOCUS_26660 12518 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 13528 15813 gene locus_tag LOCUS_26670 13528 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 18867 15841 gene locus_tag LOCUS_26680 18867 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 21009 18955 gene locus_tag LOCUS_26690 21009 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 22973 21021 gene locus_tag LOCUS_26700 22973 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 23957 22983 gene locus_tag LOCUS_26710 23957 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 24346 23954 gene locus_tag LOCUS_26720 24346 23954 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_26720 24692 26032 gene locus_tag LOCUS_26730 gene purA 24692 26032 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_26730 26104 26179 gene locus_tag LOCUS_t00310 26104 26179 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 26477 26950 gene locus_tag LOCUS_26740 26477 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 28404 27271 gene locus_tag LOCUS_26750 28404 27271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 28891 29151 gene locus_tag LOCUS_26760 28891 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 29141 29533 gene locus_tag LOCUS_26770 29141 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 29825 31039 gene locus_tag LOCUS_26780 29825 31039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 31378 31794 gene locus_tag LOCUS_26790 31378 31794 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_26790 34182 31804 gene locus_tag LOCUS_26800 34182 31804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_26800 34279 36351 gene locus_tag LOCUS_26810 34279 36351 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_26810 37441 36623 gene locus_tag LOCUS_26820 37441 36623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 38670 37441 gene locus_tag LOCUS_26830 38670 37441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 40893 38833 gene locus_tag LOCUS_26840 40893 38833 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_26840 41822 40971 gene locus_tag LOCUS_26850 41822 40971 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_26850 42978 41878 gene locus_tag LOCUS_26860 gene rfbG 42978 41878 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_26860 43050 44531 gene locus_tag LOCUS_26870 43050 44531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_26870 44528 45301 gene locus_tag LOCUS_26880 44528 45301 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_26880 >Feature sequence054 27 416 gene locus_tag LOCUS_26890 gene rplQ 27 416 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME9 protein_id gnl|my_center|LOCUS_26890 542 874 gene locus_tag LOCUS_26900 542 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1719 856 gene locus_tag LOCUS_26910 1719 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2747 1716 gene locus_tag LOCUS_26920 2747 1716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_26920 3610 2747 gene locus_tag LOCUS_26930 3610 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4530 3613 gene locus_tag LOCUS_26940 4530 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 7309 4787 gene locus_tag LOCUS_26950 7309 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 7901 7311 gene locus_tag LOCUS_26960 7901 7311 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UH72 protein_id gnl|my_center|LOCUS_26960 8154 9206 gene locus_tag LOCUS_26970 8154 9206 CDS product peptidase M35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706525.1 protein_id gnl|my_center|LOCUS_26970 9483 10316 gene locus_tag LOCUS_26980 9483 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 13125 10561 gene locus_tag LOCUS_26990 13125 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 13487 14206 gene locus_tag LOCUS_27000 13487 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14233 14799 gene locus_tag LOCUS_27010 14233 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 14930 15556 gene locus_tag LOCUS_27020 14930 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15955 15578 gene locus_tag LOCUS_27030 15955 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 16515 15991 gene locus_tag LOCUS_27040 16515 15991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 16885 16520 gene locus_tag LOCUS_27050 16885 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 17483 17124 gene locus_tag LOCUS_27060 17483 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 17952 17488 gene locus_tag LOCUS_27070 17952 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 18350 17949 gene locus_tag LOCUS_27080 18350 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 18910 18428 gene locus_tag LOCUS_27090 18910 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 19601 19161 gene locus_tag LOCUS_27100 19601 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 20025 19573 gene locus_tag LOCUS_27110 20025 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 20215 20072 gene locus_tag LOCUS_27120 20215 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 22540 20750 gene locus_tag LOCUS_27130 22540 20750 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_27130 22717 23649 gene locus_tag LOCUS_27140 22717 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 23657 24127 gene locus_tag LOCUS_27150 23657 24127 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837388.1 protein_id gnl|my_center|LOCUS_27150 24153 25022 gene locus_tag LOCUS_27160 24153 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_27160 25460 25035 gene locus_tag LOCUS_27170 25460 25035 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_27170 26025 25477 gene locus_tag LOCUS_27180 26025 25477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888534.1 protein_id gnl|my_center|LOCUS_27180 26160 27068 gene locus_tag LOCUS_27190 26160 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 29724 27328 gene locus_tag LOCUS_27200 29724 27328 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_27200 29936 31219 gene locus_tag LOCUS_27210 29936 31219 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_27210 31315 32133 gene locus_tag LOCUS_27220 gene thiG 31315 32133 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_27220 32276 32352 gene locus_tag LOCUS_t00320 32276 32352 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33985 32537 gene locus_tag LOCUS_27230 33985 32537 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552128.1 protein_id gnl|my_center|LOCUS_27230 36365 34023 gene locus_tag LOCUS_27240 36365 34023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 39834 36376 gene locus_tag LOCUS_27250 39834 36376 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 protein_id gnl|my_center|LOCUS_27250 40391 41989 gene locus_tag LOCUS_27260 40391 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 42044 45700 gene locus_tag LOCUS_27270 42044 45700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 45760 46578 gene locus_tag LOCUS_27280 45760 46578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence055 <1 535 gene locus_tag LOCUS_27290 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068725.1:RDD family protein 652 1650 gene locus_tag LOCUS_27300 652 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1966 1730 gene locus_tag LOCUS_27310 1966 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1866 2678 gene locus_tag LOCUS_27320 1866 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2680 4119 gene locus_tag LOCUS_27330 2680 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 5644 4268 gene locus_tag LOCUS_27340 5644 4268 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861820.1 protein_id gnl|my_center|LOCUS_27340 7153 5738 gene locus_tag LOCUS_27350 7153 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 8577 7444 gene locus_tag LOCUS_27360 8577 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 10061 8598 gene locus_tag LOCUS_27370 10061 8598 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_27370 10473 11774 gene locus_tag LOCUS_27380 10473 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 11891 13156 gene locus_tag LOCUS_27390 11891 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 14132 13173 gene locus_tag LOCUS_27400 14132 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 14240 16270 gene locus_tag LOCUS_27410 14240 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 18276 16261 gene locus_tag LOCUS_27420 18276 16261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 19351 18311 gene locus_tag LOCUS_27430 19351 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 20387 19455 gene locus_tag LOCUS_27440 20387 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 20873 20397 gene locus_tag LOCUS_27450 20873 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 22252 20876 gene locus_tag LOCUS_27460 22252 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 23233 22376 gene locus_tag LOCUS_27470 23233 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 23605 24630 gene locus_tag LOCUS_27480 gene pheS 23605 24630 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_27480 24710 27223 gene locus_tag LOCUS_27490 gene pheT 24710 27223 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH19 protein_id gnl|my_center|LOCUS_27490 27316 28947 gene locus_tag LOCUS_27500 27316 28947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 29894 28953 gene locus_tag LOCUS_27510 29894 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 30101 30412 gene locus_tag LOCUS_27520 30101 30412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 30688 30431 gene locus_tag LOCUS_27530 30688 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 30591 34088 gene locus_tag LOCUS_27540 30591 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 36291 34108 gene locus_tag LOCUS_27550 36291 34108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 36703 42210 gene locus_tag LOCUS_27560 36703 42210 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_27560 44239 42185 gene locus_tag LOCUS_27570 44239 42185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 45231 45638 gene locus_tag LOCUS_27580 45231 45638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 45638 45931 gene locus_tag LOCUS_27590 45638 45931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 46123 46515 gene locus_tag LOCUS_27600 46123 46515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence056 945 1226 gene locus_tag LOCUS_27610 945 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2644 1247 gene locus_tag LOCUS_27620 2644 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921106.1 protein_id gnl|my_center|LOCUS_27620 3015 2926 gene locus_tag LOCUS_t00330 3015 2926 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4347 3064 gene locus_tag LOCUS_27630 gene serS 4347 3064 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H55 protein_id gnl|my_center|LOCUS_27630 4736 5935 gene locus_tag LOCUS_27640 4736 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 5932 8112 gene locus_tag LOCUS_27650 5932 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 8147 9181 gene locus_tag LOCUS_27660 8147 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 9291 10244 gene locus_tag LOCUS_27670 9291 10244 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_27670 10237 11352 gene locus_tag LOCUS_27680 10237 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 11365 14217 gene locus_tag LOCUS_27690 11365 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 14413 15660 gene locus_tag LOCUS_27700 14413 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 16973 15732 gene locus_tag LOCUS_27710 16973 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 18250 17006 gene locus_tag LOCUS_27720 18250 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_27720 19497 18274 gene locus_tag LOCUS_27730 19497 18274 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_27730 19651 20667 gene locus_tag LOCUS_27740 gene gluQ 19651 20667 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_27740 20795 23650 gene locus_tag LOCUS_27750 gene alaS 20795 23650 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_27750 23750 24787 gene locus_tag LOCUS_27760 23750 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27760 24784 25026 gene locus_tag LOCUS_27770 24784 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 26437 25574 gene locus_tag LOCUS_27780 26437 25574 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_27780 26824 27006 gene locus_tag LOCUS_27790 26824 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 29881 27110 gene locus_tag LOCUS_27800 29881 27110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 31000 30083 gene locus_tag LOCUS_27810 31000 30083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 33446 31122 gene locus_tag LOCUS_27820 33446 31122 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_27820 34699 33443 gene locus_tag LOCUS_27830 34699 33443 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_27830 35042 36301 gene locus_tag LOCUS_27840 35042 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 36570 37160 gene locus_tag LOCUS_27850 36570 37160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120250.1 protein_id gnl|my_center|LOCUS_27850 37153 39207 gene locus_tag LOCUS_27860 37153 39207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 39201 40739 gene locus_tag LOCUS_27870 39201 40739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 40822 41736 gene locus_tag LOCUS_27880 40822 41736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 41851 43287 gene locus_tag LOCUS_27890 41851 43287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 43427 45166 gene locus_tag LOCUS_27900 43427 45166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence057 532 1878 gene locus_tag LOCUS_27910 532 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_27910 1875 3473 gene locus_tag LOCUS_27920 1875 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3470 4552 gene locus_tag LOCUS_27930 3470 4552 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_27930 4557 6938 gene locus_tag LOCUS_27940 4557 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_27940 6935 8188 gene locus_tag LOCUS_27950 6935 8188 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227759.1 protein_id gnl|my_center|LOCUS_27950 8206 8580 gene locus_tag LOCUS_27960 8206 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 8682 9137 gene locus_tag LOCUS_27970 8682 9137 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_27970 9436 11787 gene locus_tag LOCUS_27980 9436 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 12316 11798 gene locus_tag LOCUS_27990 12316 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 12528 14126 gene locus_tag LOCUS_28000 12528 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 14387 15739 gene locus_tag LOCUS_28010 14387 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 17629 15812 gene locus_tag LOCUS_28020 17629 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 21789 17782 gene locus_tag LOCUS_28030 21789 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 23378 22161 gene locus_tag LOCUS_28040 gene kbl 23378 22161 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L232 protein_id gnl|my_center|LOCUS_28040 24392 23445 gene locus_tag LOCUS_28050 24392 23445 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_28050 26187 24571 gene locus_tag LOCUS_28060 gene badA 26187 24571 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_28060 27745 26204 gene locus_tag LOCUS_28070 27745 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_28070 28335 27778 gene locus_tag LOCUS_28080 gene rfbC 28335 27778 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056309.1 protein_id gnl|my_center|LOCUS_28080 29459 28332 gene locus_tag LOCUS_28090 gene rfbB-2 29459 28332 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UA9 protein_id gnl|my_center|LOCUS_28090 29706 30527 gene locus_tag LOCUS_28100 gene uppP 29706 30527 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 protein_id gnl|my_center|LOCUS_28100 31542 32144 gene locus_tag LOCUS_28110 gene sigE 31542 32144 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW35 protein_id gnl|my_center|LOCUS_28110 32338 32892 gene locus_tag LOCUS_28120 32338 32892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 32876 34423 gene locus_tag LOCUS_28130 32876 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 34485 34886 gene locus_tag LOCUS_28140 34485 34886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 34899 35240 gene locus_tag LOCUS_28150 34899 35240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 35296 35868 gene locus_tag LOCUS_28160 35296 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 37171 35927 gene locus_tag LOCUS_28170 37171 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 37603 37271 gene locus_tag LOCUS_28180 37603 37271 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KH6 protein_id gnl|my_center|LOCUS_28180 38739 37789 gene locus_tag LOCUS_28190 38739 37789 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD65 protein_id gnl|my_center|LOCUS_28190 40167 38752 gene locus_tag LOCUS_28200 gene rimO 40167 38752 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_28200 40495 40229 gene locus_tag LOCUS_28210 40495 40229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 40611 42491 gene locus_tag LOCUS_28220 gene pepN 40611 42491 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_28220 44348 42519 gene locus_tag LOCUS_28230 gene aspS 44348 42519 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_28230 44744 45259 gene locus_tag LOCUS_28240 44744 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 46012 45302 gene locus_tag LOCUS_28250 46012 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence058 113 418 gene locus_tag LOCUS_28260 113 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 427 930 gene locus_tag LOCUS_28270 427 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2523 931 gene locus_tag LOCUS_28280 gene hutH 2523 931 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU85 protein_id gnl|my_center|LOCUS_28280 4205 2544 gene locus_tag LOCUS_28290 gene hutU 4205 2544 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV4 protein_id gnl|my_center|LOCUS_28290 4943 5962 gene locus_tag LOCUS_28300 4943 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 5998 7671 gene locus_tag LOCUS_28310 5998 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 7668 8129 gene locus_tag LOCUS_28320 7668 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 8126 9703 gene locus_tag LOCUS_28330 8126 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9753 10655 gene locus_tag LOCUS_28340 9753 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 10652 11449 gene locus_tag LOCUS_28350 10652 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 11535 11987 gene locus_tag LOCUS_28360 11535 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 12592 13053 gene locus_tag LOCUS_28370 12592 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 13050 13967 gene locus_tag LOCUS_28380 13050 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 14107 15048 gene locus_tag LOCUS_28390 14107 15048 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970642.1 protein_id gnl|my_center|LOCUS_28390 15076 15672 gene locus_tag LOCUS_28400 15076 15672 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_28400 16273 15641 gene locus_tag LOCUS_28410 16273 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 16557 16844 gene locus_tag LOCUS_28420 16557 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 17010 23069 gene locus_tag LOCUS_28430 17010 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 23070 23882 gene locus_tag LOCUS_28440 23070 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 24277 26235 gene locus_tag LOCUS_28450 24277 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 26638 27489 gene locus_tag LOCUS_28460 26638 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 27525 27671 gene locus_tag LOCUS_28470 27525 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 28069 28221 gene locus_tag LOCUS_28480 28069 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 29086 28193 gene locus_tag LOCUS_28490 29086 28193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 29866 31797 gene locus_tag LOCUS_28500 gene cmfA 29866 31797 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_28500 32897 31911 gene locus_tag LOCUS_28510 gene rlmF 32897 31911 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_28510 33425 34456 gene locus_tag LOCUS_28520 33425 34456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 35216 34518 gene locus_tag LOCUS_28530 35216 34518 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 protein_id gnl|my_center|LOCUS_28530 37315 35417 gene locus_tag LOCUS_28540 37315 35417 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203826.1 protein_id gnl|my_center|LOCUS_28540 39258 37294 gene locus_tag LOCUS_28550 39258 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 40518 39298 gene locus_tag LOCUS_28560 40518 39298 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_28560 40749 43154 gene locus_tag LOCUS_28570 40749 43154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 43698 43174 gene locus_tag LOCUS_28580 43698 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 43924 45081 gene locus_tag LOCUS_28590 43924 45081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence059 3249 2347 gene locus_tag LOCUS_28600 3249 2347 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF1 protein_id gnl|my_center|LOCUS_28600 5226 3385 gene locus_tag LOCUS_28610 5226 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 5491 6096 gene locus_tag LOCUS_28620 5491 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8099 6093 gene locus_tag LOCUS_28630 8099 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10048 8096 gene locus_tag LOCUS_28640 10048 8096 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_28640 11204 10158 gene locus_tag LOCUS_28650 gene recA 11204 10158 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_28650 11503 12207 gene locus_tag LOCUS_28660 11503 12207 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_28660 12262 12918 gene locus_tag LOCUS_28670 12262 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 13111 14109 gene locus_tag LOCUS_28680 13111 14109 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_28680 14109 15260 gene locus_tag LOCUS_28690 14109 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 15257 17461 gene locus_tag LOCUS_28700 15257 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 18007 17465 gene locus_tag LOCUS_28710 18007 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 19307 18012 gene locus_tag LOCUS_28720 19307 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 19225 19419 gene locus_tag LOCUS_28730 19225 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 19678 21372 gene locus_tag LOCUS_28740 19678 21372 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_28740 21413 22381 gene locus_tag LOCUS_28750 21413 22381 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_28750 22374 23405 gene locus_tag LOCUS_28760 22374 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 23460 24515 gene locus_tag LOCUS_28770 gene queA 23460 24515 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_28770 26351 24552 gene locus_tag LOCUS_28780 26351 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 26487 29063 gene locus_tag LOCUS_28790 26487 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 29163 29711 gene locus_tag LOCUS_28800 29163 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 29787 30134 gene locus_tag LOCUS_28810 29787 30134 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_28810 30153 31013 gene locus_tag LOCUS_28820 30153 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 31112 31603 gene locus_tag LOCUS_28830 31112 31603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 31587 32336 gene locus_tag LOCUS_28840 31587 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 34926 32479 gene locus_tag LOCUS_28850 34926 32479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 36499 35273 gene locus_tag LOCUS_28860 36499 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 36675 38297 gene locus_tag LOCUS_28870 36675 38297 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_28870 38321 39961 gene locus_tag LOCUS_28880 gene glpA 38321 39961 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZR9 protein_id gnl|my_center|LOCUS_28880 39958 40863 gene locus_tag LOCUS_28890 39958 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_28890 41782 40886 gene locus_tag LOCUS_28900 41782 40886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 42004 42603 gene locus_tag LOCUS_28910 42004 42603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 42647 43819 gene locus_tag LOCUS_28920 42647 43819 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_28920 44038 44580 gene locus_tag LOCUS_28930 44038 44580 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_28930 <45695 44778 gene locus_tag LOCUS_28940 <45695 44778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:protein kinase >Feature sequence060 139 1695 gene locus_tag LOCUS_28950 139 1695 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_28950 1987 1703 gene locus_tag LOCUS_28960 1987 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 4683 2227 gene locus_tag LOCUS_28970 4683 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28970 4793 5212 gene locus_tag LOCUS_28980 4793 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7427 6411 gene locus_tag LOCUS_28990 7427 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082503.1 protein_id gnl|my_center|LOCUS_28990 7554 8147 gene locus_tag LOCUS_29000 7554 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 9443 8199 gene locus_tag LOCUS_29010 9443 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 9693 10625 gene locus_tag LOCUS_29020 gene ldh 9693 10625 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJA1 protein_id gnl|my_center|LOCUS_29020 10772 11014 gene locus_tag LOCUS_29030 10772 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 11163 13352 gene locus_tag LOCUS_29040 11163 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 13487 13996 gene locus_tag LOCUS_29050 13487 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 14146 15450 gene locus_tag LOCUS_29060 14146 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 15667 18735 gene locus_tag LOCUS_29070 15667 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 19123 18707 gene locus_tag LOCUS_29080 19123 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 19937 19155 gene locus_tag LOCUS_29090 19937 19155 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_29090 20116 20823 gene locus_tag LOCUS_29100 20116 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 24823 20840 gene locus_tag LOCUS_29110 24823 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 25122 26177 gene locus_tag LOCUS_29120 25122 26177 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_29120 27453 26257 gene locus_tag LOCUS_29130 27453 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 28637 27759 gene locus_tag LOCUS_29140 28637 27759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 29163 28792 gene locus_tag LOCUS_29150 29163 28792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 29780 29160 gene locus_tag LOCUS_29160 29780 29160 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_29160 30217 29795 gene locus_tag LOCUS_29170 30217 29795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 30469 31443 gene locus_tag LOCUS_29180 30469 31443 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_29180 31666 32553 gene locus_tag LOCUS_29190 31666 32553 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210839.1 protein_id gnl|my_center|LOCUS_29190 34222 32528 gene locus_tag LOCUS_29200 34222 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 34779 34219 gene locus_tag LOCUS_29210 34779 34219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 34971 36680 gene locus_tag LOCUS_29220 34971 36680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 37361 37077 gene locus_tag LOCUS_29230 37361 37077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 38173 37427 gene locus_tag LOCUS_29240 38173 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 38438 39106 gene locus_tag LOCUS_29250 38438 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 39240 39887 gene locus_tag LOCUS_29260 39240 39887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 39939 40292 gene locus_tag LOCUS_29270 39939 40292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 40411 43809 gene locus_tag LOCUS_29280 40411 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 43830 44051 gene locus_tag LOCUS_29290 43830 44051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence061 2933 1038 gene locus_tag LOCUS_29300 2933 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 4395 2944 gene locus_tag LOCUS_29310 4395 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 5045 4392 gene locus_tag LOCUS_29320 5045 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5329 6480 gene locus_tag LOCUS_29330 5329 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 7567 6473 gene locus_tag LOCUS_29340 7567 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 8666 7668 gene locus_tag LOCUS_29350 8666 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 10173 8674 gene locus_tag LOCUS_29360 10173 8674 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_29360 10768 10160 gene locus_tag LOCUS_29370 10768 10160 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_29370 11043 12854 gene locus_tag LOCUS_29380 11043 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 15227 12993 gene locus_tag LOCUS_29390 15227 12993 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_29390 16771 15443 gene locus_tag LOCUS_29400 16771 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 17190 16810 gene locus_tag LOCUS_29410 17190 16810 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_29410 17350 19038 gene locus_tag LOCUS_29420 17350 19038 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_29420 19183 19419 gene locus_tag LOCUS_29430 19183 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 20391 19474 gene locus_tag LOCUS_29440 gene cysK 20391 19474 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPW5 protein_id gnl|my_center|LOCUS_29440 21348 20581 gene locus_tag LOCUS_29450 21348 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 22529 21348 gene locus_tag LOCUS_29460 22529 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 22708 24642 gene locus_tag LOCUS_29470 gene acsA 22708 24642 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_29470 24742 25170 gene locus_tag LOCUS_29480 24742 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 25530 25252 gene locus_tag LOCUS_29490 25530 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 27098 25623 gene locus_tag LOCUS_29500 27098 25623 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_29500 27251 29092 gene locus_tag LOCUS_29510 27251 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_29510 30453 29089 gene locus_tag LOCUS_29520 30453 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 32392 30503 gene locus_tag LOCUS_29530 gene pepF 32392 30503 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_29530 33649 32693 gene locus_tag LOCUS_29540 33649 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 33821 33897 gene locus_tag LOCUS_t00340 33821 33897 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34922 34203 gene locus_tag LOCUS_29550 34922 34203 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_29550 35100 36275 gene locus_tag LOCUS_29560 35100 36275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 36295 37293 gene locus_tag LOCUS_29570 gene msrP 36295 37293 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_29570 40150 37328 gene locus_tag LOCUS_29580 40150 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 41430 40159 gene locus_tag LOCUS_29590 41430 40159 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_29590 42067 41441 gene locus_tag LOCUS_29600 42067 41441 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_29600 43745 42096 gene locus_tag LOCUS_29610 43745 42096 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence062 583 1674 gene locus_tag LOCUS_29620 583 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1787 3535 gene locus_tag LOCUS_29630 gene recN 1787 3535 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_29630 3592 4200 gene locus_tag LOCUS_29640 3592 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4456 6468 gene locus_tag LOCUS_29650 4456 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 6628 7437 gene locus_tag LOCUS_29660 6628 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 7447 8772 gene locus_tag LOCUS_29670 7447 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 8812 9291 gene locus_tag LOCUS_29680 gene coaD 8812 9291 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DS2 protein_id gnl|my_center|LOCUS_29680 9314 10075 gene locus_tag LOCUS_29690 9314 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 10145 11260 gene locus_tag LOCUS_29700 10145 11260 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_29700 11262 12524 gene locus_tag LOCUS_29710 11262 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 12524 13459 gene locus_tag LOCUS_29720 gene xerD 12524 13459 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB4 protein_id gnl|my_center|LOCUS_29720 13578 14210 gene locus_tag LOCUS_29730 13578 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 14773 14189 gene locus_tag LOCUS_29740 14773 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 15482 16240 gene locus_tag LOCUS_29750 15482 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 19812 16429 gene locus_tag LOCUS_29760 gene dnaE2 19812 16429 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT5 protein_id gnl|my_center|LOCUS_29760 20392 19865 gene locus_tag LOCUS_29770 20392 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 20721 20891 gene locus_tag LOCUS_29780 20721 20891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 21124 22713 gene locus_tag LOCUS_29790 21124 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_29790 23188 25257 gene locus_tag LOCUS_29800 23188 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 25254 26306 gene locus_tag LOCUS_29810 25254 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 26309 27226 gene locus_tag LOCUS_29820 26309 27226 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947299.1 protein_id gnl|my_center|LOCUS_29820 28471 27251 gene locus_tag LOCUS_29830 28471 27251 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_29830 30514 28517 gene locus_tag LOCUS_29840 30514 28517 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_29840 30953 30675 gene locus_tag LOCUS_29850 30953 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 31348 30950 gene locus_tag LOCUS_29860 31348 30950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 32874 31345 gene locus_tag LOCUS_29870 gene comM 32874 31345 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_29870 33235 34077 gene locus_tag LOCUS_29880 33235 34077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 36324 34081 gene locus_tag LOCUS_29890 gene recD2 36324 34081 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_29890 36575 38347 gene locus_tag LOCUS_29900 36575 38347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29900 38351 39352 gene locus_tag LOCUS_29910 38351 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29910 39789 39376 gene locus_tag LOCUS_29920 39789 39376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_29920 40066 40245 gene locus_tag LOCUS_29930 40066 40245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 40681 40493 gene locus_tag LOCUS_29940 40681 40493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 41356 42027 gene locus_tag LOCUS_29950 41356 42027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence063 38 3751 gene locus_tag LOCUS_29960 38 3751 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QR6 protein_id gnl|my_center|LOCUS_29960 3867 4160 gene locus_tag LOCUS_29970 3867 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 4705 5358 gene locus_tag LOCUS_29980 4705 5358 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888197.1 protein_id gnl|my_center|LOCUS_29980 5950 8490 gene locus_tag LOCUS_29990 5950 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_29990 8537 10540 gene locus_tag LOCUS_30000 8537 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 11367 10564 gene locus_tag LOCUS_30010 11367 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 11473 12219 gene locus_tag LOCUS_30020 11473 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 12216 12995 gene locus_tag LOCUS_30030 12216 12995 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_30030 13198 14388 gene locus_tag LOCUS_30040 gene capB 13198 14388 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_30040 14381 14833 gene locus_tag LOCUS_30050 gene capC 14381 14833 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_30050 14916 16043 gene locus_tag LOCUS_30060 14916 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 16040 16954 gene locus_tag LOCUS_30070 16040 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 16965 18920 gene locus_tag LOCUS_30080 16965 18920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 20667 18952 gene locus_tag LOCUS_30090 20667 18952 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_30090 21211 20744 gene locus_tag LOCUS_30100 21211 20744 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_30100 21122 21430 gene locus_tag LOCUS_30110 21122 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 22432 23391 gene locus_tag LOCUS_30120 22432 23391 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_30120 23388 26507 gene locus_tag LOCUS_30130 23388 26507 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_30130 26545 28746 gene locus_tag LOCUS_30140 26545 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 29083 29159 gene locus_tag LOCUS_t00350 29083 29159 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29227 29303 gene locus_tag LOCUS_t00360 29227 29303 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29436 31373 gene locus_tag LOCUS_30150 gene thrS 29436 31373 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L8 protein_id gnl|my_center|LOCUS_30150 31467 31661 gene locus_tag LOCUS_30160 gene rpmI 31467 31661 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCV6 protein_id gnl|my_center|LOCUS_30160 31834 32193 gene locus_tag LOCUS_30170 gene rplT 31834 32193 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_30170 32322 32651 gene locus_tag LOCUS_30180 32322 32651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 32897 33199 gene locus_tag LOCUS_30190 32897 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 33593 35143 gene locus_tag LOCUS_30200 gene rny 33593 35143 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJJ4 protein_id gnl|my_center|LOCUS_30200 35140 35970 gene locus_tag LOCUS_30210 35140 35970 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_30210 36665 36141 gene locus_tag LOCUS_30220 36665 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 36979 36662 gene locus_tag LOCUS_30230 36979 36662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 37188 38267 gene locus_tag LOCUS_30240 gene aroC 37188 38267 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_30240 39855 38494 gene locus_tag LOCUS_30250 39855 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918600.1 protein_id gnl|my_center|LOCUS_30250 39974 41230 gene locus_tag LOCUS_30260 39974 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 42893 41322 gene locus_tag LOCUS_30270 42893 41322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence064 548 1468 gene locus_tag LOCUS_30280 gene lip 548 1468 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_30280 1500 2507 gene locus_tag LOCUS_30290 1500 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 4587 2530 gene locus_tag LOCUS_30300 4587 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 5363 4620 gene locus_tag LOCUS_30310 5363 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 5596 7554 gene locus_tag LOCUS_30320 5596 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 8583 7630 gene locus_tag LOCUS_30330 8583 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 8698 9900 gene locus_tag LOCUS_30340 8698 9900 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036857.1 protein_id gnl|my_center|LOCUS_30340 11024 9852 gene locus_tag LOCUS_30350 11024 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 12637 11024 gene locus_tag LOCUS_30360 12637 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 12804 13619 gene locus_tag LOCUS_30370 12804 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13616 14704 gene locus_tag LOCUS_30380 13616 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 15186 16940 gene locus_tag LOCUS_30390 15186 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 17890 17045 gene locus_tag LOCUS_30400 17890 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 19185 18166 gene locus_tag LOCUS_30410 19185 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 20033 19182 gene locus_tag LOCUS_30420 20033 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140506.1 protein_id gnl|my_center|LOCUS_30420 21448 20033 gene locus_tag LOCUS_30430 21448 20033 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_30430 22969 21530 gene locus_tag LOCUS_30440 22969 21530 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_30440 24543 22966 gene locus_tag LOCUS_30450 24543 22966 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_30450 25776 24589 gene locus_tag LOCUS_30460 25776 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 25893 26999 gene locus_tag LOCUS_30470 25893 26999 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_30470 27021 28115 gene locus_tag LOCUS_30480 27021 28115 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_30480 29260 28112 gene locus_tag LOCUS_30490 29260 28112 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_30490 31158 29257 gene locus_tag LOCUS_30500 31158 29257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 32342 31155 gene locus_tag LOCUS_30510 32342 31155 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_30510 32452 33726 gene locus_tag LOCUS_30520 32452 33726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 33723 36323 gene locus_tag LOCUS_30530 33723 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 36392 37174 gene locus_tag LOCUS_30540 36392 37174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 37171 37671 gene locus_tag LOCUS_30550 37171 37671 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072653.1 protein_id gnl|my_center|LOCUS_30550 37979 38347 gene locus_tag LOCUS_30560 37979 38347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 38477 39787 gene locus_tag LOCUS_30570 38477 39787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118416.1 protein_id gnl|my_center|LOCUS_30570 39946 41232 gene locus_tag LOCUS_30580 39946 41232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 41422 42720 gene locus_tag LOCUS_30590 41422 42720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence065 636 1286 gene locus_tag LOCUS_30600 636 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 1300 1650 gene locus_tag LOCUS_30610 1300 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2952 1876 gene locus_tag LOCUS_30620 2952 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3452 4861 gene locus_tag LOCUS_30630 gene gltP 3452 4861 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_30630 5897 5079 gene locus_tag LOCUS_30640 5897 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7015 6179 gene locus_tag LOCUS_30650 7015 6179 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_30650 8029 7040 gene locus_tag LOCUS_30660 8029 7040 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_30660 9035 8061 gene locus_tag LOCUS_30670 9035 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 9093 9740 gene locus_tag LOCUS_30680 9093 9740 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGK7 protein_id gnl|my_center|LOCUS_30680 9733 11511 gene locus_tag LOCUS_30690 9733 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 11549 12877 gene locus_tag LOCUS_30700 11549 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 15568 12935 gene locus_tag LOCUS_30710 gene clpB 15568 12935 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GM5 protein_id gnl|my_center|LOCUS_30710 16770 15835 gene locus_tag LOCUS_30720 16770 15835 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_30720 17021 18262 gene locus_tag LOCUS_30730 17021 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 17170 17259 gene locus_tag LOCUS_t00370 17170 17259 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19099 18791 gene locus_tag LOCUS_30740 19099 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 21071 19107 gene locus_tag LOCUS_30750 21071 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 21283 21561 gene locus_tag LOCUS_30760 21283 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 21587 22420 gene locus_tag LOCUS_30770 21587 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 22639 24075 gene locus_tag LOCUS_30780 gene fadI 22639 24075 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT59 protein_id gnl|my_center|LOCUS_30780 24134 25363 gene locus_tag LOCUS_30790 24134 25363 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_30790 26421 25384 gene locus_tag LOCUS_30800 26421 25384 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_30800 27338 26418 gene locus_tag LOCUS_30810 27338 26418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 28718 27516 gene locus_tag LOCUS_30820 28718 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105699.1 protein_id gnl|my_center|LOCUS_30820 29243 30439 gene locus_tag LOCUS_30830 29243 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 30621 33092 gene locus_tag LOCUS_30840 30621 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 34599 33196 gene locus_tag LOCUS_30850 34599 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 36387 34636 gene locus_tag LOCUS_30860 36387 34636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 38027 36396 gene locus_tag LOCUS_30870 38027 36396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 39042 38038 gene locus_tag LOCUS_30880 39042 38038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 42008 39204 gene locus_tag LOCUS_30890 42008 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 42167 42778 gene locus_tag LOCUS_30900 42167 42778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence066 1509 778 gene locus_tag LOCUS_30910 1509 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1912 1556 gene locus_tag LOCUS_30920 1912 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 4219 2114 gene locus_tag LOCUS_30930 gene cat5 4219 2114 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_30930 4914 4465 gene locus_tag LOCUS_30940 4914 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 5392 6609 gene locus_tag LOCUS_30950 5392 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 6672 8942 gene locus_tag LOCUS_30960 6672 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 8942 10645 gene locus_tag LOCUS_30970 8942 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_30970 11048 11938 gene locus_tag LOCUS_30980 11048 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 12835 12053 gene locus_tag LOCUS_30990 12835 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 13538 13023 gene locus_tag LOCUS_31000 13538 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 15531 13783 gene locus_tag LOCUS_31010 15531 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 16440 15583 gene locus_tag LOCUS_31020 16440 15583 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_31020 17173 16451 gene locus_tag LOCUS_31030 17173 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 18252 17170 gene locus_tag LOCUS_31040 18252 17170 CDS product cation ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_31040 19214 18264 gene locus_tag LOCUS_31050 gene hflK 19214 18264 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534926.1 protein_id gnl|my_center|LOCUS_31050 20112 19204 gene locus_tag LOCUS_31060 20112 19204 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_31060 22523 20109 gene locus_tag LOCUS_31070 22523 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 23847 22831 gene locus_tag LOCUS_31080 23847 22831 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143806.1 protein_id gnl|my_center|LOCUS_31080 25024 23876 gene locus_tag LOCUS_31090 25024 23876 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 protein_id gnl|my_center|LOCUS_31090 28556 25251 gene locus_tag LOCUS_31100 28556 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_31100 29687 28605 gene locus_tag LOCUS_31110 29687 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 29859 30287 gene locus_tag LOCUS_31120 29859 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 30786 30379 gene locus_tag LOCUS_31130 30786 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 30972 31304 gene locus_tag LOCUS_31140 30972 31304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 32813 31335 gene locus_tag LOCUS_31150 32813 31335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 32887 33222 gene locus_tag LOCUS_31160 32887 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 33595 33179 gene locus_tag LOCUS_31170 33595 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 33909 35075 gene locus_tag LOCUS_31180 33909 35075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 36176 35061 gene locus_tag LOCUS_31190 36176 35061 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_31190 38019 36268 gene locus_tag LOCUS_31200 38019 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 40438 38099 gene locus_tag LOCUS_31210 40438 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 41063 40671 gene locus_tag LOCUS_31220 41063 40671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 41325 41113 gene locus_tag LOCUS_31230 41325 41113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 41973 41698 gene locus_tag LOCUS_31240 41973 41698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 42665 41913 gene locus_tag LOCUS_31250 42665 41913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31250 >Feature sequence067 1081 1929 gene locus_tag LOCUS_31260 1081 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 5537 1980 gene locus_tag LOCUS_31270 5537 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 5799 8219 gene locus_tag LOCUS_31280 5799 8219 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_31280 8216 9139 gene locus_tag LOCUS_31290 8216 9139 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSJ7 protein_id gnl|my_center|LOCUS_31290 9670 9155 gene locus_tag LOCUS_31300 9670 9155 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 protein_id gnl|my_center|LOCUS_31300 9873 11051 gene locus_tag LOCUS_31310 9873 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 11401 11276 gene locus_tag LOCUS_31320 11401 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 11836 11687 gene locus_tag LOCUS_31330 11836 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 12069 12938 gene locus_tag LOCUS_31340 12069 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 12928 15573 gene locus_tag LOCUS_31350 12928 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 15928 16101 gene locus_tag LOCUS_31360 15928 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 16232 16393 gene locus_tag LOCUS_31370 16232 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 16571 16741 gene locus_tag LOCUS_31380 16571 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 17074 17247 gene locus_tag LOCUS_31390 17074 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 17507 18478 gene locus_tag LOCUS_31400 17507 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 18589 19836 gene locus_tag LOCUS_31410 18589 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 19838 20782 gene locus_tag LOCUS_31420 19838 20782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 20775 21833 gene locus_tag LOCUS_31430 20775 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 25136 21861 gene locus_tag LOCUS_31440 25136 21861 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709380.1 protein_id gnl|my_center|LOCUS_31440 27648 25177 gene locus_tag LOCUS_31450 27648 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31450 30748 27749 gene locus_tag LOCUS_31460 30748 27749 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_31460 33088 30764 gene locus_tag LOCUS_31470 33088 30764 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_31470 34359 33091 gene locus_tag LOCUS_31480 34359 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 35968 34367 gene locus_tag LOCUS_31490 35968 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 <41870 36223 gene locus_tag LOCUS_31500 <41870 36223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase >Feature sequence068 1307 2602 gene locus_tag LOCUS_31510 1307 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_31510 2583 4190 gene locus_tag LOCUS_31520 2583 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 6305 4341 gene locus_tag LOCUS_31530 6305 4341 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_31530 7292 6429 gene locus_tag LOCUS_31540 7292 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 8482 7322 gene locus_tag LOCUS_31550 8482 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 8926 9324 gene locus_tag LOCUS_31560 8926 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_31560 9786 9373 gene locus_tag LOCUS_31570 9786 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 10202 9783 gene locus_tag LOCUS_31580 10202 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_31580 11950 10343 gene locus_tag LOCUS_31590 gene betA 11950 10343 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_31590 12643 12026 gene locus_tag LOCUS_31600 12643 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 13751 12660 gene locus_tag LOCUS_31610 gene ychF 13751 12660 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_31610 15252 14128 gene locus_tag LOCUS_31620 gene wecE 15252 14128 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_31620 15520 16380 gene locus_tag LOCUS_31630 15520 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 17354 16455 gene locus_tag LOCUS_31640 17354 16455 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_31640 17434 17757 gene locus_tag LOCUS_31650 17434 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 17754 19514 gene locus_tag LOCUS_31660 gene mviN 17754 19514 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_31660 19661 20803 gene locus_tag LOCUS_31670 19661 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 21469 20828 gene locus_tag LOCUS_31680 21469 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 23537 21597 gene locus_tag LOCUS_31690 23537 21597 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269325.1 protein_id gnl|my_center|LOCUS_31690 26148 23584 gene locus_tag LOCUS_31700 gene ppc 26148 23584 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_31700 27062 26352 gene locus_tag LOCUS_31710 gene fkpA 27062 26352 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_31710 28267 27347 gene locus_tag LOCUS_31720 28267 27347 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_31720 28845 28303 gene locus_tag LOCUS_31730 28845 28303 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_31730 29033 30358 gene locus_tag LOCUS_31740 29033 30358 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 protein_id gnl|my_center|LOCUS_31740 30611 31441 gene locus_tag LOCUS_31750 30611 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_31750 31636 32067 gene locus_tag LOCUS_31760 31636 32067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 32439 32218 gene locus_tag LOCUS_31770 32439 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 33497 32436 gene locus_tag LOCUS_31780 33497 32436 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_31780 34945 33710 gene locus_tag LOCUS_31790 gene nqrF 34945 33710 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6X5 protein_id gnl|my_center|LOCUS_31790 35589 34972 gene locus_tag LOCUS_31800 gene nqrE 35589 34972 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_31800 36212 35592 gene locus_tag LOCUS_31810 gene nqrD 36212 35592 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_31810 36991 36212 gene locus_tag LOCUS_31820 gene nqrC 36991 36212 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_31820 38219 36981 gene locus_tag LOCUS_31830 gene nqrB 38219 36981 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_31830 39589 38219 gene locus_tag LOCUS_31840 gene nqrA 39589 38219 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_31840 40146 40622 gene locus_tag LOCUS_31850 40146 40622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 40679 41341 gene locus_tag LOCUS_31860 gene trmH 40679 41341 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NEV5 protein_id gnl|my_center|LOCUS_31860 >Feature sequence069 4990 5520 gene locus_tag LOCUS_31870 4990 5520 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_31870 5533 6048 gene locus_tag LOCUS_31880 5533 6048 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_31880 6058 6588 gene locus_tag LOCUS_31890 6058 6588 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_31890 6591 7223 gene locus_tag LOCUS_31900 6591 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 7244 7735 gene locus_tag LOCUS_31910 7244 7735 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 protein_id gnl|my_center|LOCUS_31910 7798 8121 gene locus_tag LOCUS_31920 7798 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 8440 13179 gene locus_tag LOCUS_31930 8440 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 13236 13427 gene locus_tag LOCUS_31940 13236 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 13575 18278 gene locus_tag LOCUS_31950 13575 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 18412 18606 gene locus_tag LOCUS_31960 18412 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 18616 18900 gene locus_tag LOCUS_31970 18616 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 18903 19982 gene locus_tag LOCUS_31980 gene ahbD 18903 19982 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_31980 19987 20973 gene locus_tag LOCUS_31990 19987 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 21071 21646 gene locus_tag LOCUS_32000 21071 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 21683 22771 gene locus_tag LOCUS_32010 21683 22771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 22898 24697 gene locus_tag LOCUS_32020 gene lepA2 22898 24697 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_32020 24694 25899 gene locus_tag LOCUS_32030 24694 25899 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_32030 26698 25925 gene locus_tag LOCUS_32040 26698 25925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 27447 26695 gene locus_tag LOCUS_32050 27447 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 27329 27544 gene locus_tag LOCUS_32060 27329 27544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 30358 27638 gene locus_tag LOCUS_32070 30358 27638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 30631 31230 gene locus_tag LOCUS_32080 30631 31230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 32702 31350 gene locus_tag LOCUS_32090 32702 31350 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_32090 34649 32826 gene locus_tag LOCUS_32100 34649 32826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 35521 34907 gene locus_tag LOCUS_32110 35521 34907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 35739 38075 gene locus_tag LOCUS_32120 35739 38075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 38455 40083 gene locus_tag LOCUS_32130 38455 40083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_32130 40167 41510 gene locus_tag LOCUS_32140 40167 41510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence070 1422 79 gene locus_tag LOCUS_32150 1422 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1947 1645 gene locus_tag LOCUS_32160 1947 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 2585 1968 gene locus_tag LOCUS_32170 2585 1968 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_32170 3794 2751 gene locus_tag LOCUS_32180 3794 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 4042 4404 gene locus_tag LOCUS_32190 4042 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 4581 5333 gene locus_tag LOCUS_32200 4581 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 6168 5359 gene locus_tag LOCUS_32210 6168 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 9388 6299 gene locus_tag LOCUS_32220 9388 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 11415 9385 gene locus_tag LOCUS_32230 11415 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 12017 11412 gene locus_tag LOCUS_32240 12017 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 13227 12019 gene locus_tag LOCUS_32250 13227 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 14923 13322 gene locus_tag LOCUS_32260 14923 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 15577 16887 gene locus_tag LOCUS_32270 15577 16887 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_32270 17666 17004 gene locus_tag LOCUS_32280 17666 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 17804 18229 gene locus_tag LOCUS_32290 17804 18229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 18427 19068 gene locus_tag LOCUS_32300 18427 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 20516 19167 gene locus_tag LOCUS_32310 20516 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 21840 20509 gene locus_tag LOCUS_32320 21840 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 22196 22861 gene locus_tag LOCUS_32330 22196 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 23161 24738 gene locus_tag LOCUS_32340 23161 24738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 25115 25894 gene locus_tag LOCUS_32350 25115 25894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 26092 27411 gene locus_tag LOCUS_32360 26092 27411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229091.1 protein_id gnl|my_center|LOCUS_32360 27546 28466 gene locus_tag LOCUS_32370 27546 28466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 31067 28500 gene locus_tag LOCUS_32380 31067 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 31697 31077 gene locus_tag LOCUS_32390 31697 31077 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_32390 32518 31757 gene locus_tag LOCUS_32400 gene hutC 32518 31757 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 protein_id gnl|my_center|LOCUS_32400 32668 33936 gene locus_tag LOCUS_32410 gene hutI 32668 33936 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV2 protein_id gnl|my_center|LOCUS_32410 34212 37016 gene locus_tag LOCUS_32420 34212 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 37032 38195 gene locus_tag LOCUS_32430 37032 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_32430 40164 38203 gene locus_tag LOCUS_32440 40164 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence071 1735 434 gene locus_tag LOCUS_32450 1735 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1734 2312 gene locus_tag LOCUS_32460 1734 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2337 4583 gene locus_tag LOCUS_32470 2337 4583 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_32470 4580 5224 gene locus_tag LOCUS_32480 4580 5224 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_32480 5481 5230 gene locus_tag LOCUS_32490 5481 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 6117 7334 gene locus_tag LOCUS_32500 6117 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 7429 7896 gene locus_tag LOCUS_32510 7429 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 8731 7955 gene locus_tag LOCUS_32520 8731 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 8930 9364 gene locus_tag LOCUS_32530 8930 9364 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_32530 9361 11283 gene locus_tag LOCUS_32540 9361 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 13818 11383 gene locus_tag LOCUS_32550 13818 11383 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_32550 14466 14170 gene locus_tag LOCUS_32560 14466 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 14353 16194 gene locus_tag LOCUS_32570 14353 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 17169 16279 gene locus_tag LOCUS_32580 17169 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 20923 17246 gene locus_tag LOCUS_32590 20923 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 23127 21295 gene locus_tag LOCUS_32600 23127 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 23950 23255 gene locus_tag LOCUS_32610 23950 23255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933017.1 protein_id gnl|my_center|LOCUS_32610 25185 23947 gene locus_tag LOCUS_32620 25185 23947 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_32620 26566 25187 gene locus_tag LOCUS_32630 26566 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 27810 26566 gene locus_tag LOCUS_32640 27810 26566 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087405.1 protein_id gnl|my_center|LOCUS_32640 29075 27807 gene locus_tag LOCUS_32650 29075 27807 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_32650 29419 30849 gene locus_tag LOCUS_32660 29419 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 30846 33104 gene locus_tag LOCUS_32670 30846 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 33307 34632 gene locus_tag LOCUS_32680 33307 34632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 34638 36818 gene locus_tag LOCUS_32690 34638 36818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 36808 38319 gene locus_tag LOCUS_32700 gene phr 36808 38319 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_32700 38336 39715 gene locus_tag LOCUS_32710 38336 39715 CDS product capsular polysaccharide biosynthesis protein CapK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence072 1752 7 gene locus_tag LOCUS_32720 1752 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2244 4784 gene locus_tag LOCUS_32730 gene leuS 2244 4784 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HB59 protein_id gnl|my_center|LOCUS_32730 5353 4709 gene locus_tag LOCUS_32740 5353 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 5876 5499 gene locus_tag LOCUS_32750 5876 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 6046 6846 gene locus_tag LOCUS_32760 6046 6846 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_32760 7171 8061 gene locus_tag LOCUS_32770 7171 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 8221 9333 gene locus_tag LOCUS_32780 gene bioB 8221 9333 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_32780 9336 10607 gene locus_tag LOCUS_32790 gene bioF 9336 10607 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_32790 10604 11275 gene locus_tag LOCUS_32800 gene bioD 10604 11275 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8T9 protein_id gnl|my_center|LOCUS_32800 13906 11711 gene locus_tag LOCUS_32810 13906 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 14047 15519 gene locus_tag LOCUS_32820 14047 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_32820 15516 16085 gene locus_tag LOCUS_32830 15516 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 18506 16137 gene locus_tag LOCUS_32840 18506 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 20136 18592 gene locus_tag LOCUS_32850 20136 18592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 21628 20549 gene locus_tag LOCUS_32860 21628 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 26171 21633 gene locus_tag LOCUS_32870 26171 21633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 27589 26252 gene locus_tag LOCUS_32880 27589 26252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 28839 27616 gene locus_tag LOCUS_32890 28839 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 29190 31223 gene locus_tag LOCUS_32900 29190 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 31220 33061 gene locus_tag LOCUS_32910 31220 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_32910 33206 34912 gene locus_tag LOCUS_32920 33206 34912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 35618 34950 gene locus_tag LOCUS_32930 gene gpmA 35618 34950 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_32930 36428 35622 gene locus_tag LOCUS_32940 36428 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_32940 36776 37483 gene locus_tag LOCUS_32950 36776 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence073 701 186 gene locus_tag LOCUS_32960 701 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 2136 1039 gene locus_tag LOCUS_32970 2136 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3329 2286 gene locus_tag LOCUS_32980 3329 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 4402 3419 gene locus_tag LOCUS_32990 4402 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 4940 4635 gene locus_tag LOCUS_33000 4940 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 5214 4951 gene locus_tag LOCUS_33010 5214 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5292 5483 gene locus_tag LOCUS_33020 5292 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 5535 7166 gene locus_tag LOCUS_33030 5535 7166 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_33030 7306 7470 gene locus_tag LOCUS_33040 7306 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 7836 8639 gene locus_tag LOCUS_33050 7836 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 8833 10560 gene locus_tag LOCUS_33060 8833 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 14031 10570 gene locus_tag LOCUS_33070 14031 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 14291 15373 gene locus_tag LOCUS_33080 14291 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 15370 16674 gene locus_tag LOCUS_33090 15370 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 16671 20555 gene locus_tag LOCUS_33100 16671 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 21096 20575 gene locus_tag LOCUS_33110 21096 20575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 21682 21152 gene locus_tag LOCUS_33120 21682 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 21946 22617 gene locus_tag LOCUS_33130 21946 22617 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_33130 22614 25025 gene locus_tag LOCUS_33140 22614 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 30268 25079 gene locus_tag LOCUS_33150 30268 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 31194 30439 gene locus_tag LOCUS_33160 31194 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 31669 33339 gene locus_tag LOCUS_33170 31669 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 35986 33386 gene locus_tag LOCUS_33180 35986 33386 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_33180 36296 37336 gene locus_tag LOCUS_33190 36296 37336 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_33190 37742 37272 gene locus_tag LOCUS_33200 37742 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 38572 37739 gene locus_tag LOCUS_33210 38572 37739 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence074 122 2860 gene locus_tag LOCUS_33220 122 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5357 2880 gene locus_tag LOCUS_33230 5357 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 6519 5503 gene locus_tag LOCUS_33240 6519 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 7395 6637 gene locus_tag LOCUS_33250 7395 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 8155 7493 gene locus_tag LOCUS_33260 8155 7493 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_33260 10852 8309 gene locus_tag LOCUS_33270 10852 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 12339 11188 gene locus_tag LOCUS_33280 gene tyrA 12339 11188 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII6 protein_id gnl|my_center|LOCUS_33280 13451 12423 gene locus_tag LOCUS_33290 13451 12423 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_33290 14474 13455 gene locus_tag LOCUS_33300 14474 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 19379 14667 gene locus_tag LOCUS_33310 19379 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 20640 19780 gene locus_tag LOCUS_33320 20640 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 23196 20770 gene locus_tag LOCUS_33330 23196 20770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_33330 23488 24297 gene locus_tag LOCUS_33340 23488 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 24540 26438 gene locus_tag LOCUS_33350 24540 26438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 26435 27802 gene locus_tag LOCUS_33360 26435 27802 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_33360 29686 27827 gene locus_tag LOCUS_33370 29686 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 29861 30487 gene locus_tag LOCUS_33380 29861 30487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 30962 30552 gene locus_tag LOCUS_33390 30962 30552 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_33390 32739 30985 gene locus_tag LOCUS_33400 32739 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33400 34177 32789 gene locus_tag LOCUS_33410 34177 32789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 34176 34322 gene locus_tag LOCUS_33420 34176 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 35122 34493 gene locus_tag LOCUS_33430 35122 34493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 36436 35261 gene locus_tag LOCUS_33440 36436 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 38341 36665 gene locus_tag LOCUS_33450 38341 36665 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence075 274 1503 gene locus_tag LOCUS_33460 274 1503 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9M8 protein_id gnl|my_center|LOCUS_33460 1646 2257 gene locus_tag LOCUS_33470 1646 2257 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_33470 2360 4852 gene locus_tag LOCUS_33480 2360 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_33480 5144 5719 gene locus_tag LOCUS_33490 5144 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 6242 8134 gene locus_tag LOCUS_33500 6242 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 11936 8157 gene locus_tag LOCUS_33510 11936 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 12883 12098 gene locus_tag LOCUS_33520 12883 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 15210 12880 gene locus_tag LOCUS_33530 15210 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 19056 15343 gene locus_tag LOCUS_33540 19056 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 19658 19053 gene locus_tag LOCUS_33550 19658 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 20067 20723 gene locus_tag LOCUS_33560 20067 20723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 20720 21298 gene locus_tag LOCUS_33570 20720 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 21468 22835 gene locus_tag LOCUS_33580 21468 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 22832 23182 gene locus_tag LOCUS_33590 22832 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 23193 23822 gene locus_tag LOCUS_33600 23193 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 25284 23839 gene locus_tag LOCUS_33610 25284 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 25646 25284 gene locus_tag LOCUS_33620 25646 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 28219 25643 gene locus_tag LOCUS_33630 28219 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 28398 29576 gene locus_tag LOCUS_33640 28398 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 29573 30742 gene locus_tag LOCUS_33650 29573 30742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 31239 30871 gene locus_tag LOCUS_33660 31239 30871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 33120 31732 gene locus_tag LOCUS_33670 33120 31732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_33670 33274 35355 gene locus_tag LOCUS_33680 33274 35355 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_33680 35548 36531 gene locus_tag LOCUS_33690 35548 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 36723 37199 gene locus_tag LOCUS_33700 36723 37199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence076 2031 859 gene locus_tag LOCUS_33710 2031 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 2222 2536 gene locus_tag LOCUS_33720 2222 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4722 2533 gene locus_tag LOCUS_33730 4722 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 5030 11122 gene locus_tag LOCUS_33740 5030 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 11159 12037 gene locus_tag LOCUS_33750 11159 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 12237 13859 gene locus_tag LOCUS_33760 12237 13859 CDS product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038380.1 protein_id gnl|my_center|LOCUS_33760 13988 15697 gene locus_tag LOCUS_33770 13988 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 18587 15723 gene locus_tag LOCUS_33780 18587 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 19150 18587 gene locus_tag LOCUS_33790 19150 18587 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_33790 19833 19228 gene locus_tag LOCUS_33800 19833 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 20461 19850 gene locus_tag LOCUS_33810 20461 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 21402 20626 gene locus_tag LOCUS_33820 21402 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 21517 22095 gene locus_tag LOCUS_33830 21517 22095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 23432 22101 gene locus_tag LOCUS_33840 23432 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 23923 23510 gene locus_tag LOCUS_33850 23923 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 24471 23920 gene locus_tag LOCUS_33860 24471 23920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 25389 24628 gene locus_tag LOCUS_33870 25389 24628 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_33870 26081 25386 gene locus_tag LOCUS_33880 26081 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 26839 27102 gene locus_tag LOCUS_33890 26839 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 27111 28328 gene locus_tag LOCUS_33900 gene fabF 27111 28328 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_33900 28340 29626 gene locus_tag LOCUS_33910 gene fabF 28340 29626 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML62 protein_id gnl|my_center|LOCUS_33910 29623 30951 gene locus_tag LOCUS_33920 29623 30951 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870211.1 protein_id gnl|my_center|LOCUS_33920 31026 32516 gene locus_tag LOCUS_33930 gene crtH 31026 32516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_33930 32555 34477 gene locus_tag LOCUS_33940 32555 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 34474 35919 gene locus_tag LOCUS_33950 34474 35919 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_33950 36096 37493 gene locus_tag LOCUS_33960 36096 37493 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707747.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence077 <1 4739 gene locus_tag LOCUS_33970 <1 4739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635825.2:nuclease 5557 5739 gene locus_tag LOCUS_33980 5557 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 6379 8139 gene locus_tag LOCUS_33990 6379 8139 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525357.1 protein_id gnl|my_center|LOCUS_33990 8444 8196 gene locus_tag LOCUS_34000 8444 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 8823 9866 gene locus_tag LOCUS_34010 8823 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 9868 10140 gene locus_tag LOCUS_34020 9868 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 10131 12515 gene locus_tag LOCUS_34030 10131 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_34030 12821 12537 gene locus_tag LOCUS_34040 12821 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 13998 12859 gene locus_tag LOCUS_34050 13998 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 14685 14044 gene locus_tag LOCUS_34060 14685 14044 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_34060 16805 14709 gene locus_tag LOCUS_34070 16805 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 17443 16820 gene locus_tag LOCUS_34080 17443 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 17706 18323 gene locus_tag LOCUS_34090 17706 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 18488 20188 gene locus_tag LOCUS_34100 18488 20188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_34100 20201 21004 gene locus_tag LOCUS_34110 20201 21004 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400412.1 protein_id gnl|my_center|LOCUS_34110 22311 21076 gene locus_tag LOCUS_34120 22311 21076 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_34120 24669 22483 gene locus_tag LOCUS_34130 24669 22483 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_34130 25926 24757 gene locus_tag LOCUS_34140 25926 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 26320 27324 gene locus_tag LOCUS_34150 26320 27324 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_34150 27409 30945 gene locus_tag LOCUS_34160 27409 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 30942 34622 gene locus_tag LOCUS_34170 30942 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 34615 36957 gene locus_tag LOCUS_34180 gene clpA 34615 36957 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence078 559 1428 gene locus_tag LOCUS_34190 559 1428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_34190 1512 1691 gene locus_tag LOCUS_34200 1512 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085171.1 protein_id gnl|my_center|LOCUS_34200 3518 1695 gene locus_tag LOCUS_34210 3518 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_34210 3694 3515 gene locus_tag LOCUS_34220 3694 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3712 4725 gene locus_tag LOCUS_34230 3712 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_34230 7995 4822 gene locus_tag LOCUS_34240 7995 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 8440 7997 gene locus_tag LOCUS_34250 8440 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 10341 8440 gene locus_tag LOCUS_34260 10341 8440 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_34260 10562 11269 gene locus_tag LOCUS_34270 10562 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 11266 12861 gene locus_tag LOCUS_34280 11266 12861 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_34280 12869 14965 gene locus_tag LOCUS_34290 gene atuF 12869 14965 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_34290 14962 15768 gene locus_tag LOCUS_34300 gene paaG 14962 15768 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_34300 15765 17576 gene locus_tag LOCUS_34310 15765 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_34310 17595 18470 gene locus_tag LOCUS_34320 17595 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 18500 19654 gene locus_tag LOCUS_34330 18500 19654 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702588.1 protein_id gnl|my_center|LOCUS_34330 19792 20805 gene locus_tag LOCUS_34340 19792 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_34340 20900 22336 gene locus_tag LOCUS_34350 20900 22336 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_34350 22345 23628 gene locus_tag LOCUS_34360 22345 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_34360 23767 24951 gene locus_tag LOCUS_34370 23767 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 26034 25021 gene locus_tag LOCUS_34380 26034 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 27236 26292 gene locus_tag LOCUS_34390 27236 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 27623 28606 gene locus_tag LOCUS_34400 gene mdh 27623 28606 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_34400 29774 28737 gene locus_tag LOCUS_34410 29774 28737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 30128 32452 gene locus_tag LOCUS_34420 30128 32452 CDS product bifunctional hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_34420 32896 32525 gene locus_tag LOCUS_34430 32896 32525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 34710 32989 gene locus_tag LOCUS_34440 34710 32989 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_34440 35062 35310 gene locus_tag LOCUS_34450 35062 35310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence079 1205 156 gene locus_tag LOCUS_34460 1205 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 2932 1202 gene locus_tag LOCUS_34470 2932 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3292 3050 gene locus_tag LOCUS_34480 3292 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3185 3688 gene locus_tag LOCUS_34490 3185 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3903 4520 gene locus_tag LOCUS_34500 3903 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4633 5328 gene locus_tag LOCUS_34510 4633 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 6390 5446 gene locus_tag LOCUS_34520 6390 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483109.1 protein_id gnl|my_center|LOCUS_34520 6597 8498 gene locus_tag LOCUS_34530 gene hflX 6597 8498 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_34530 8518 9975 gene locus_tag LOCUS_34540 8518 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 10135 10464 gene locus_tag LOCUS_34550 10135 10464 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_34550 10500 12635 gene locus_tag LOCUS_34560 10500 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 12746 13774 gene locus_tag LOCUS_34570 12746 13774 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_34570 13987 14292 gene locus_tag LOCUS_34580 13987 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 14731 14387 gene locus_tag LOCUS_34590 gene yegP 14731 14387 CDS product UPF0339 protein YegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76402 protein_id gnl|my_center|LOCUS_34590 15250 14936 gene locus_tag LOCUS_34600 15250 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 16029 15298 gene locus_tag LOCUS_34610 16029 15298 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_34610 16233 16403 gene locus_tag LOCUS_34620 16233 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 16583 17104 gene locus_tag LOCUS_34630 16583 17104 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889777.1 protein_id gnl|my_center|LOCUS_34630 17173 18942 gene locus_tag LOCUS_34640 gene aspS 17173 18942 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_34640 18946 20082 gene locus_tag LOCUS_34650 gene aroB 18946 20082 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_34650 20320 22227 gene locus_tag LOCUS_34660 20320 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 22401 22715 gene locus_tag LOCUS_34670 22401 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 22871 23887 gene locus_tag LOCUS_34680 gene ftsY 22871 23887 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_34680 23895 25028 gene locus_tag LOCUS_34690 23895 25028 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_34690 24992 25603 gene locus_tag LOCUS_34700 gene ribE 24992 25603 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK35 protein_id gnl|my_center|LOCUS_34700 25603 26586 gene locus_tag LOCUS_34710 25603 26586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 28178 26652 gene locus_tag LOCUS_34720 28178 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 28363 28905 gene locus_tag LOCUS_34730 gene hpt 28363 28905 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_34730 28905 29282 gene locus_tag LOCUS_34740 28905 29282 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082892.1 protein_id gnl|my_center|LOCUS_34740 31590 29731 gene locus_tag LOCUS_34750 31590 29731 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_34750 33094 31571 gene locus_tag LOCUS_34760 33094 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 35106 33091 gene locus_tag LOCUS_34770 35106 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141588.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence080 1144 764 gene locus_tag LOCUS_34780 gene erpA 1144 764 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX6 protein_id gnl|my_center|LOCUS_34780 3770 1338 gene locus_tag LOCUS_34790 3770 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4601 3786 gene locus_tag LOCUS_34800 gene rph 4601 3786 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_34800 5611 4694 gene locus_tag LOCUS_34810 gene murI 5611 4694 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_34810 6358 5705 gene locus_tag LOCUS_34820 6358 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 7989 6394 gene locus_tag LOCUS_34830 7989 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 8042 8575 gene locus_tag LOCUS_34840 8042 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 8561 8636 gene locus_tag LOCUS_t00380 8561 8636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9919 8951 gene locus_tag LOCUS_34850 9919 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 10232 10158 gene locus_tag LOCUS_t00390 10232 10158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10323 10248 gene locus_tag LOCUS_t00400 10323 10248 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10576 10500 gene locus_tag LOCUS_t00410 10576 10500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10689 10613 gene locus_tag LOCUS_t00420 10689 10613 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11308 11090 gene locus_tag LOCUS_34860 11308 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 13133 11454 gene locus_tag LOCUS_34870 13133 11454 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_34870 13393 13133 gene locus_tag LOCUS_34880 13393 13133 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_34880 13695 16625 gene locus_tag LOCUS_34890 13695 16625 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_34890 16622 18325 gene locus_tag LOCUS_34900 16622 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 18794 18336 gene locus_tag LOCUS_34910 18794 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 20525 18834 gene locus_tag LOCUS_34920 20525 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 21679 20522 gene locus_tag LOCUS_34930 gene degP 21679 20522 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_34930 24822 21703 gene locus_tag LOCUS_34940 24822 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 26410 25307 gene locus_tag LOCUS_34950 26410 25307 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_34950 27536 26763 gene locus_tag LOCUS_34960 27536 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 28903 27764 gene locus_tag LOCUS_34970 28903 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378843.1 protein_id gnl|my_center|LOCUS_34970 31052 29466 gene locus_tag LOCUS_34980 31052 29466 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064271.1 protein_id gnl|my_center|LOCUS_34980 31423 33063 gene locus_tag LOCUS_34990 31423 33063 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_34990 33060 33797 gene locus_tag LOCUS_35000 gene natA 33060 33797 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_35000 33797 34978 gene locus_tag LOCUS_35010 33797 34978 CDS product Na+ ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence081 987 2609 gene locus_tag LOCUS_35020 987 2609 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_35020 3302 2715 gene locus_tag LOCUS_35030 3302 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3662 3973 gene locus_tag LOCUS_35040 3662 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3994 5271 gene locus_tag LOCUS_35050 3994 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705704.1 protein_id gnl|my_center|LOCUS_35050 6362 5289 gene locus_tag LOCUS_35060 6362 5289 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120210.1 protein_id gnl|my_center|LOCUS_35060 7596 6376 gene locus_tag LOCUS_35070 gene rimK 7596 6376 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_35070 8132 7593 gene locus_tag LOCUS_35080 8132 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8244 9500 gene locus_tag LOCUS_35090 8244 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 11079 9505 gene locus_tag LOCUS_35100 11079 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 12914 11076 gene locus_tag LOCUS_35110 12914 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 14703 13237 gene locus_tag LOCUS_35120 14703 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 15760 15251 gene locus_tag LOCUS_35130 15760 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_35130 16523 15795 gene locus_tag LOCUS_35140 16523 15795 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_35140 17440 16574 gene locus_tag LOCUS_35150 17440 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_35150 17733 18482 gene locus_tag LOCUS_35160 17733 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 18638 19105 gene locus_tag LOCUS_35170 18638 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 19465 20799 gene locus_tag LOCUS_35180 19465 20799 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN3 protein_id gnl|my_center|LOCUS_35180 20814 21146 gene locus_tag LOCUS_35190 gene glnB 20814 21146 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_35190 21157 22590 gene locus_tag LOCUS_35200 21157 22590 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_35200 22734 23750 gene locus_tag LOCUS_35210 22734 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 23778 24026 gene locus_tag LOCUS_35220 23778 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 24050 26635 gene locus_tag LOCUS_35230 24050 26635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 26639 27583 gene locus_tag LOCUS_35240 26639 27583 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140194.1 protein_id gnl|my_center|LOCUS_35240 30349 27608 gene locus_tag LOCUS_35250 30349 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 30486 31964 gene locus_tag LOCUS_35260 30486 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 32343 31942 gene locus_tag LOCUS_35270 32343 31942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 32722 32522 gene locus_tag LOCUS_35280 32722 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 33006 34847 gene locus_tag LOCUS_35290 gene mmgC 33006 34847 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence082 <1 543 gene locus_tag LOCUS_35300 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970134.1:phospholipase/carboxylesterase 573 2468 gene locus_tag LOCUS_35310 573 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 2675 4393 gene locus_tag LOCUS_35320 2675 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 5968 4421 gene locus_tag LOCUS_35330 5968 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 7437 6016 gene locus_tag LOCUS_35340 7437 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_35340 8273 10885 gene locus_tag LOCUS_35350 8273 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 11075 13936 gene locus_tag LOCUS_35360 11075 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 14055 14549 gene locus_tag LOCUS_35370 14055 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 15713 14619 gene locus_tag LOCUS_35380 15713 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 15920 16534 gene locus_tag LOCUS_35390 15920 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 16711 17625 gene locus_tag LOCUS_35400 16711 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35400 19122 18907 gene locus_tag LOCUS_35410 19122 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 19442 22621 gene locus_tag LOCUS_35420 19442 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 22784 24853 gene locus_tag LOCUS_35430 22784 24853 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_35430 26035 24884 gene locus_tag LOCUS_35440 26035 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 26302 26919 gene locus_tag LOCUS_35450 26302 26919 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_35450 26919 28013 gene locus_tag LOCUS_35460 26919 28013 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 protein_id gnl|my_center|LOCUS_35460 28202 31480 gene locus_tag LOCUS_35470 28202 31480 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919622.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence083 868 3993 gene locus_tag LOCUS_35480 868 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3990 5648 gene locus_tag LOCUS_35490 3990 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 7468 5696 gene locus_tag LOCUS_35500 7468 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 9558 7465 gene locus_tag LOCUS_35510 9558 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 10695 9805 gene locus_tag LOCUS_35520 10695 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 11045 12865 gene locus_tag LOCUS_35530 11045 12865 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_35530 12862 14556 gene locus_tag LOCUS_35540 12862 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 16943 14520 gene locus_tag LOCUS_35550 16943 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 17199 17456 gene locus_tag LOCUS_35560 17199 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 17835 20240 gene locus_tag LOCUS_35570 17835 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 22521 20377 gene locus_tag LOCUS_35580 22521 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 27340 23057 gene locus_tag LOCUS_35590 27340 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 27981 27436 gene locus_tag LOCUS_35600 27981 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 28810 28262 gene locus_tag LOCUS_35610 28810 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 29427 31619 gene locus_tag LOCUS_35620 29427 31619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 33933 31654 gene locus_tag LOCUS_35630 33933 31654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence084 473 255 gene locus_tag LOCUS_35640 473 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 1605 364 gene locus_tag LOCUS_35650 1605 364 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_35650 2367 1666 gene locus_tag LOCUS_35660 2367 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3318 2608 gene locus_tag LOCUS_35670 gene folK 3318 2608 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_35670 3363 4121 gene locus_tag LOCUS_35680 3363 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4164 5288 gene locus_tag LOCUS_35690 gene tgt 4164 5288 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_35690 5505 5825 gene locus_tag LOCUS_35700 5505 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 5828 7396 gene locus_tag LOCUS_35710 gene secD 5828 7396 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_35710 7429 8646 gene locus_tag LOCUS_35720 7429 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 9792 8797 gene locus_tag LOCUS_35730 9792 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 10244 9816 gene locus_tag LOCUS_35740 10244 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 11095 10241 gene locus_tag LOCUS_35750 11095 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 11978 11190 gene locus_tag LOCUS_35760 11978 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 12232 14085 gene locus_tag LOCUS_35770 gene argS 12232 14085 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_35770 14129 15058 gene locus_tag LOCUS_35780 14129 15058 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_35780 16783 15857 gene locus_tag LOCUS_35790 16783 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_35790 17103 16780 gene locus_tag LOCUS_35800 17103 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 17570 17118 gene locus_tag LOCUS_35810 17570 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 18036 17548 gene locus_tag LOCUS_35820 18036 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680156.1 protein_id gnl|my_center|LOCUS_35820 20729 18123 gene locus_tag LOCUS_35830 20729 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 21730 20726 gene locus_tag LOCUS_35840 21730 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 23169 21718 gene locus_tag LOCUS_35850 23169 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 23523 23173 gene locus_tag LOCUS_35860 23523 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 24896 23670 gene locus_tag LOCUS_35870 24896 23670 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_35870 26871 24928 gene locus_tag LOCUS_35880 26871 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 27397 26918 gene locus_tag LOCUS_35890 27397 26918 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A638 protein_id gnl|my_center|LOCUS_35890 28019 27417 gene locus_tag LOCUS_35900 28019 27417 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_35900 28331 29788 gene locus_tag LOCUS_35910 28331 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_35910 29822 31942 gene locus_tag LOCUS_35920 29822 31942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 33728 32346 gene locus_tag LOCUS_35930 33728 32346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence085 2970 2254 gene locus_tag LOCUS_35940 2970 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4227 3238 gene locus_tag LOCUS_35950 4227 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4687 6159 gene locus_tag LOCUS_35960 4687 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 6159 6845 gene locus_tag LOCUS_35970 6159 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 6842 8083 gene locus_tag LOCUS_35980 6842 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 8165 9574 gene locus_tag LOCUS_35990 8165 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 9571 10407 gene locus_tag LOCUS_36000 9571 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 10422 11714 gene locus_tag LOCUS_36010 10422 11714 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_36010 11857 12336 gene locus_tag LOCUS_36020 11857 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 12299 12856 gene locus_tag LOCUS_36030 12299 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36030 12996 15323 gene locus_tag LOCUS_36040 12996 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 16563 15409 gene locus_tag LOCUS_36050 16563 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 17142 16639 gene locus_tag LOCUS_36060 17142 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 17759 17139 gene locus_tag LOCUS_36070 gene rpoE 17759 17139 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_36070 17970 19040 gene locus_tag LOCUS_36080 17970 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36080 18929 20335 gene locus_tag LOCUS_36090 18929 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36090 21941 20475 gene locus_tag LOCUS_36100 21941 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 23484 22108 gene locus_tag LOCUS_36110 23484 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_36110 24995 23568 gene locus_tag LOCUS_36120 24995 23568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_36120 25598 25005 gene locus_tag LOCUS_36130 25598 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 25674 26456 gene locus_tag LOCUS_36140 25674 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_36140 27181 26483 gene locus_tag LOCUS_36150 27181 26483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 27729 27271 gene locus_tag LOCUS_36160 27729 27271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 27851 28030 gene locus_tag LOCUS_36170 27851 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 28371 27952 gene locus_tag LOCUS_36180 28371 27952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 <34644 28610 gene locus_tag LOCUS_36190 <34644 28610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs >Feature sequence086 3345 4280 gene locus_tag LOCUS_36200 3345 4280 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_36200 5155 4250 gene locus_tag LOCUS_36210 5155 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_36210 6103 5159 gene locus_tag LOCUS_36220 gene hemF 6103 5159 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_36220 7623 6193 gene locus_tag LOCUS_36230 gene hemG 7623 6193 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140945.1 protein_id gnl|my_center|LOCUS_36230 9900 7774 gene locus_tag LOCUS_36240 9900 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 12857 9897 gene locus_tag LOCUS_36250 12857 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 14023 12854 gene locus_tag LOCUS_36260 14023 12854 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 protein_id gnl|my_center|LOCUS_36260 14172 16778 gene locus_tag LOCUS_36270 14172 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 16833 17999 gene locus_tag LOCUS_36280 16833 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 19437 18049 gene locus_tag LOCUS_36290 19437 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 23308 19568 gene locus_tag LOCUS_36300 23308 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 24593 23694 gene locus_tag LOCUS_36310 24593 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 25367 24900 gene locus_tag LOCUS_36320 25367 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 27277 25532 gene locus_tag LOCUS_36330 27277 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 27429 28727 gene locus_tag LOCUS_36340 27429 28727 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_36340 28741 29748 gene locus_tag LOCUS_36350 28741 29748 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_36350 29745 30737 gene locus_tag LOCUS_36360 29745 30737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_36360 30759 31583 gene locus_tag LOCUS_36370 30759 31583 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_36370 31773 33458 gene locus_tag LOCUS_36380 31773 33458 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence087 <1 557 gene locus_tag LOCUS_36390 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256663.1:xanthine and Co dehydrogenase maturation factor 1656 787 gene locus_tag LOCUS_36400 1656 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 2755 2129 gene locus_tag LOCUS_36410 2755 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_36410 4956 2752 gene locus_tag LOCUS_36420 4956 2752 CDS product oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_36420 5443 4949 gene locus_tag LOCUS_36430 5443 4949 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 protein_id gnl|my_center|LOCUS_36430 6054 5539 gene locus_tag LOCUS_36440 6054 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 7218 6286 gene locus_tag LOCUS_36450 7218 6286 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_36450 7992 7495 gene locus_tag LOCUS_36460 7992 7495 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537307.1 protein_id gnl|my_center|LOCUS_36460 8399 7989 gene locus_tag LOCUS_36470 8399 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233435.2 protein_id gnl|my_center|LOCUS_36470 8519 9550 gene locus_tag LOCUS_36480 gene ftrA 8519 9550 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921196.1 protein_id gnl|my_center|LOCUS_36480 9599 9997 gene locus_tag LOCUS_36490 9599 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 10318 10016 gene locus_tag LOCUS_36500 10318 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_36500 11227 10442 gene locus_tag LOCUS_36510 11227 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 12108 11224 gene locus_tag LOCUS_36520 12108 11224 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812234.1 protein_id gnl|my_center|LOCUS_36520 12250 14343 gene locus_tag LOCUS_36530 12250 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 15112 14360 gene locus_tag LOCUS_36540 15112 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 19083 15124 gene locus_tag LOCUS_36550 19083 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 21032 19185 gene locus_tag LOCUS_36560 21032 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_36560 21150 22019 gene locus_tag LOCUS_36570 21150 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 23104 22031 gene locus_tag LOCUS_36580 23104 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 23682 23137 gene locus_tag LOCUS_36590 23682 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 24057 24281 gene locus_tag LOCUS_36600 24057 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 24474 25652 gene locus_tag LOCUS_36610 24474 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 25681 26349 gene locus_tag LOCUS_36620 25681 26349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 26346 27212 gene locus_tag LOCUS_36630 gene modA 26346 27212 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_36630 27217 27894 gene locus_tag LOCUS_36640 gene modB 27217 27894 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038307.1 protein_id gnl|my_center|LOCUS_36640 27891 28973 gene locus_tag LOCUS_36650 gene modC 27891 28973 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_36650 29146 30885 gene locus_tag LOCUS_36660 29146 30885 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_36660 32654 30987 gene locus_tag LOCUS_36670 32654 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence088 2397 1885 gene locus_tag LOCUS_36680 2397 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 3253 2441 gene locus_tag LOCUS_36690 3253 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4184 3438 gene locus_tag LOCUS_36700 4184 3438 CDS product oxidoreductase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524799.1 protein_id gnl|my_center|LOCUS_36700 4903 4355 gene locus_tag LOCUS_36710 4903 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 5108 7231 gene locus_tag LOCUS_36720 5108 7231 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_36720 7228 10506 gene locus_tag LOCUS_36730 gene lacZ 7228 10506 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_36730 10612 11775 gene locus_tag LOCUS_36740 10612 11775 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886844.1 protein_id gnl|my_center|LOCUS_36740 11924 13381 gene locus_tag LOCUS_36750 11924 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 14980 13799 gene locus_tag LOCUS_36760 14980 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 27587 14970 gene locus_tag LOCUS_36770 27587 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence089 1061 3796 gene locus_tag LOCUS_36780 1061 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 3971 4600 gene locus_tag LOCUS_36790 3971 4600 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_36790 6851 5145 gene locus_tag LOCUS_36800 6851 5145 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_36800 7319 9262 gene locus_tag LOCUS_36810 7319 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 9276 12638 gene locus_tag LOCUS_36820 9276 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 13314 12646 gene locus_tag LOCUS_36830 13314 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 14048 13365 gene locus_tag LOCUS_36840 14048 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 15661 14165 gene locus_tag LOCUS_36850 15661 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 16407 15775 gene locus_tag LOCUS_36860 16407 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 16616 17395 gene locus_tag LOCUS_36870 16616 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 17679 18182 gene locus_tag LOCUS_36880 17679 18182 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_36880 19081 18326 gene locus_tag LOCUS_36890 19081 18326 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 protein_id gnl|my_center|LOCUS_36890 19860 19243 gene locus_tag LOCUS_36900 19860 19243 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_36900 19989 20816 gene locus_tag LOCUS_36910 19989 20816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 20910 20986 gene locus_tag LOCUS_t00430 20910 20986 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21672 25103 gene locus_tag LOCUS_36920 21672 25103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_36920 25883 25119 gene locus_tag LOCUS_36930 25883 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 25999 27063 gene locus_tag LOCUS_36940 25999 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 27928 27617 gene locus_tag LOCUS_36950 27928 27617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 29407 28070 gene locus_tag LOCUS_36960 29407 28070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 29801 29553 gene locus_tag LOCUS_36970 29801 29553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 30320 30395 gene locus_tag LOCUS_t00440 30320 30395 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30949 30464 gene locus_tag LOCUS_36980 30949 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 31087 31917 gene locus_tag LOCUS_36990 31087 31917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 32131 33678 gene locus_tag LOCUS_37000 gene purH 32131 33678 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA6 protein_id gnl|my_center|LOCUS_37000 >Feature sequence090 2320 1706 gene locus_tag LOCUS_37010 2320 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37010 3984 2317 gene locus_tag LOCUS_37020 3984 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 4603 4007 gene locus_tag LOCUS_37030 4603 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4484 4750 gene locus_tag LOCUS_37040 4484 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 6164 4926 gene locus_tag LOCUS_37050 6164 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 7077 6247 gene locus_tag LOCUS_37060 7077 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 7439 8947 gene locus_tag LOCUS_37070 7439 8947 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 protein_id gnl|my_center|LOCUS_37070 9085 10443 gene locus_tag LOCUS_37080 gene dctD 9085 10443 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_37080 10482 11315 gene locus_tag LOCUS_37090 10482 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_37090 12311 11328 gene locus_tag LOCUS_37100 12311 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 12477 14480 gene locus_tag LOCUS_37110 gene uvrB 12477 14480 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837R9 protein_id gnl|my_center|LOCUS_37110 14508 16379 gene locus_tag LOCUS_37120 gene uvrC 14508 16379 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_37120 16517 17959 gene locus_tag LOCUS_37130 16517 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 18422 19348 gene locus_tag LOCUS_37140 gene ykfA 18422 19348 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_37140 19408 20184 gene locus_tag LOCUS_37150 19408 20184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 20277 21077 gene locus_tag LOCUS_37160 gene scpA 20277 21077 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIP8 protein_id gnl|my_center|LOCUS_37160 21074 22015 gene locus_tag LOCUS_37170 21074 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 22012 23031 gene locus_tag LOCUS_37180 22012 23031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 23028 23759 gene locus_tag LOCUS_37190 gene cmk 23028 23759 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_37190 23752 24954 gene locus_tag LOCUS_37200 gene queG 23752 24954 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E0 protein_id gnl|my_center|LOCUS_37200 25221 27107 gene locus_tag LOCUS_37210 gene rpsA 25221 27107 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_37210 27181 27474 gene locus_tag LOCUS_37220 gene ihfB-2 27181 27474 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_37220 27655 28227 gene locus_tag LOCUS_37230 27655 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 28224 28418 gene locus_tag LOCUS_37240 28224 28418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 28480 29628 gene locus_tag LOCUS_37250 gene lpxB 28480 29628 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_37250 29625 31631 gene locus_tag LOCUS_37260 29625 31631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_37260 31628 32512 gene locus_tag LOCUS_37270 31628 32512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_37270 32517 33230 gene locus_tag LOCUS_37280 gene gmk 32517 33230 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60551 protein_id gnl|my_center|LOCUS_37280 33318 33563 gene locus_tag LOCUS_37290 33318 33563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence091 784 2388 gene locus_tag LOCUS_37300 784 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4300 2408 gene locus_tag LOCUS_37310 4300 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 5034 4291 gene locus_tag LOCUS_37320 gene phnC1 5034 4291 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_37320 6080 5031 gene locus_tag LOCUS_37330 gene phnD 6080 5031 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_37330 7151 6165 gene locus_tag LOCUS_37340 gene selD 7151 6165 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_37340 7646 7981 gene locus_tag LOCUS_37350 7646 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 7981 8259 gene locus_tag LOCUS_37360 7981 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 8259 8624 gene locus_tag LOCUS_37370 8259 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 8764 11457 gene locus_tag LOCUS_37380 gene aceE 8764 11457 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_37380 11553 12863 gene locus_tag LOCUS_37390 gene aceF 11553 12863 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ11 protein_id gnl|my_center|LOCUS_37390 12875 14695 gene locus_tag LOCUS_37400 gene lpdA 12875 14695 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC3 protein_id gnl|my_center|LOCUS_37400 15950 14982 gene locus_tag LOCUS_37410 15950 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 16282 16210 gene locus_tag LOCUS_t00450 16282 16210 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16388 16314 gene locus_tag LOCUS_t00460 16388 16314 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17830 16397 gene locus_tag LOCUS_37420 17830 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 19118 18120 gene locus_tag LOCUS_37430 19118 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 20609 19263 gene locus_tag LOCUS_37440 20609 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 20496 20927 gene locus_tag LOCUS_37450 20496 20927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 21616 20864 gene locus_tag LOCUS_37460 21616 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 21938 24178 gene locus_tag LOCUS_37470 gene fadE 21938 24178 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_37470 24328 26073 gene locus_tag LOCUS_37480 24328 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 26172 26834 gene locus_tag LOCUS_37490 26172 26834 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_37490 26978 27916 gene locus_tag LOCUS_37500 26978 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 29109 27922 gene locus_tag LOCUS_37510 gene rsgA 29109 27922 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A60 protein_id gnl|my_center|LOCUS_37510 30214 29432 gene locus_tag LOCUS_37520 30214 29432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 31179 30247 gene locus_tag LOCUS_37530 31179 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 <33237 31274 gene locus_tag LOCUS_37540 <33237 31274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114679.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence092 4201 2111 gene locus_tag LOCUS_37550 4201 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 6524 4218 gene locus_tag LOCUS_37560 6524 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 7689 6847 gene locus_tag LOCUS_37570 gene folE2 7689 6847 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW8 protein_id gnl|my_center|LOCUS_37570 8239 8054 gene locus_tag LOCUS_37580 8239 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 8218 10824 gene locus_tag LOCUS_37590 8218 10824 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_37590 10986 11714 gene locus_tag LOCUS_37600 10986 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 12557 11823 gene locus_tag LOCUS_37610 12557 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 12949 17130 gene locus_tag LOCUS_37620 12949 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 18454 17252 gene locus_tag LOCUS_37630 18454 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_37630 19070 18579 gene locus_tag LOCUS_37640 gene purE 19070 18579 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_37640 20471 19221 gene locus_tag LOCUS_37650 20471 19221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_37650 20713 21420 gene locus_tag LOCUS_37660 20713 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040262.1 protein_id gnl|my_center|LOCUS_37660 23397 21508 gene locus_tag LOCUS_37670 23397 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 24149 23643 gene locus_tag LOCUS_37680 24149 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 24381 26156 gene locus_tag LOCUS_37690 24381 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 26160 26945 gene locus_tag LOCUS_37700 26160 26945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_37700 26942 28171 gene locus_tag LOCUS_37710 26942 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 28261 29661 gene locus_tag LOCUS_37720 28261 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_37720 30347 29685 gene locus_tag LOCUS_37730 30347 29685 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_37730 31144 32100 gene locus_tag LOCUS_37740 31144 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 32163 32918 gene locus_tag LOCUS_37750 32163 32918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 >Feature sequence093 24 473 gene locus_tag LOCUS_37760 24 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 559 1416 gene locus_tag LOCUS_37770 559 1416 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_37770 1466 2521 gene locus_tag LOCUS_37780 1466 2521 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_37780 2868 5399 gene locus_tag LOCUS_37790 2868 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 5646 6224 gene locus_tag LOCUS_37800 5646 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 6221 7486 gene locus_tag LOCUS_37810 6221 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 7624 8574 gene locus_tag LOCUS_37820 7624 8574 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_37820 13284 8641 gene locus_tag LOCUS_37830 13284 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 15411 13558 gene locus_tag LOCUS_37840 15411 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 15910 15713 gene locus_tag LOCUS_37850 15910 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 16510 15998 gene locus_tag LOCUS_37860 16510 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 18802 17012 gene locus_tag LOCUS_37870 18802 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 21115 18974 gene locus_tag LOCUS_37880 21115 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 21495 22391 gene locus_tag LOCUS_37890 21495 22391 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_37890 22652 24502 gene locus_tag LOCUS_37900 22652 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 26156 24387 gene locus_tag LOCUS_37910 26156 24387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 26396 27742 gene locus_tag LOCUS_37920 26396 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 27847 28482 gene locus_tag LOCUS_37930 27847 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 28482 29486 gene locus_tag LOCUS_37940 28482 29486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 29588 32524 gene locus_tag LOCUS_37950 29588 32524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 >Feature sequence094 1690 2889 gene locus_tag LOCUS_37960 1690 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 3868 2900 gene locus_tag LOCUS_37970 gene nei 3868 2900 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LZ7 protein_id gnl|my_center|LOCUS_37970 3855 6116 gene locus_tag LOCUS_37980 3855 6116 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_37980 6124 8829 gene locus_tag LOCUS_37990 gene pbpY 6124 8829 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640352.1 protein_id gnl|my_center|LOCUS_37990 9374 9943 gene locus_tag LOCUS_38000 9374 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 10031 10696 gene locus_tag LOCUS_38010 10031 10696 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_38010 10686 11861 gene locus_tag LOCUS_38020 10686 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 11905 13029 gene locus_tag LOCUS_38030 11905 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 13279 14169 gene locus_tag LOCUS_38040 13279 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 14187 14864 gene locus_tag LOCUS_38050 14187 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 19620 14998 gene locus_tag LOCUS_38060 19620 14998 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386827.1 protein_id gnl|my_center|LOCUS_38060 19904 19626 gene locus_tag LOCUS_38070 19904 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 20185 21849 gene locus_tag LOCUS_38080 20185 21849 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_38080 22020 22511 gene locus_tag LOCUS_38090 22020 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 25710 22543 gene locus_tag LOCUS_38100 25710 22543 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_38100 26915 25707 gene locus_tag LOCUS_38110 26915 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 27293 28132 gene locus_tag LOCUS_38120 27293 28132 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_38120 28147 29109 gene locus_tag LOCUS_38130 gene glsA 28147 29109 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WD71 protein_id gnl|my_center|LOCUS_38130 29289 31367 gene locus_tag LOCUS_38140 29289 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 31886 31419 gene locus_tag LOCUS_38150 31886 31419 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_38150 32072 31988 gene locus_tag LOCUS_t00470 32072 31988 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32241 32155 gene locus_tag LOCUS_t00480 32241 32155 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 32412 32338 gene locus_tag LOCUS_t00490 32412 32338 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 3022 2408 gene locus_tag LOCUS_38160 3022 2408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_38160 4290 3022 gene locus_tag LOCUS_38170 4290 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4742 6436 gene locus_tag LOCUS_38180 4742 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 6921 8600 gene locus_tag LOCUS_38190 6921 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 8750 11047 gene locus_tag LOCUS_38200 8750 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 11181 11723 gene locus_tag LOCUS_38210 11181 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 11757 12329 gene locus_tag LOCUS_38220 11757 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 12317 12997 gene locus_tag LOCUS_38230 12317 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 14114 13002 gene locus_tag LOCUS_38240 14114 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640655.1 protein_id gnl|my_center|LOCUS_38240 14302 14487 gene locus_tag LOCUS_38250 14302 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 15197 14502 gene locus_tag LOCUS_38260 15197 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 15957 16541 gene locus_tag LOCUS_38270 15957 16541 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_38270 16538 16987 gene locus_tag LOCUS_38280 16538 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 19057 17987 gene locus_tag LOCUS_38290 19057 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 19376 21313 gene locus_tag LOCUS_38300 19376 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 21469 22089 gene locus_tag LOCUS_38310 21469 22089 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_38310 23120 22086 gene locus_tag LOCUS_38320 23120 22086 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_38320 24079 23201 gene locus_tag LOCUS_38330 gene ubiG 24079 23201 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_38330 25592 24117 gene locus_tag LOCUS_38340 25592 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 26794 25589 gene locus_tag LOCUS_38350 26794 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 27948 26791 gene locus_tag LOCUS_38360 27948 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 29198 27945 gene locus_tag LOCUS_38370 29198 27945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 29387 30535 gene locus_tag LOCUS_38380 29387 30535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence096 567 1319 gene locus_tag LOCUS_38390 567 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1741 1274 gene locus_tag LOCUS_38400 1741 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3767 1965 gene locus_tag LOCUS_38410 3767 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 5229 4735 gene locus_tag LOCUS_38420 5229 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_38420 6204 5320 gene locus_tag LOCUS_38430 6204 5320 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_38430 7345 6320 gene locus_tag LOCUS_38440 gene oruR 7345 6320 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_38440 8856 7426 gene locus_tag LOCUS_38450 gene rtcB 8856 7426 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ME60 protein_id gnl|my_center|LOCUS_38450 8746 9069 gene locus_tag LOCUS_38460 8746 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 9551 13693 gene locus_tag LOCUS_38470 9551 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 13893 15929 gene locus_tag LOCUS_38480 13893 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 16141 16872 gene locus_tag LOCUS_38490 gene ABC-SBP 16141 16872 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976383.1 protein_id gnl|my_center|LOCUS_38490 16902 17810 gene locus_tag LOCUS_38500 16902 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 17887 18756 gene locus_tag LOCUS_38510 17887 18756 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_38510 19579 18812 gene locus_tag LOCUS_38520 19579 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 20341 19673 gene locus_tag LOCUS_38530 20341 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 21014 20334 gene locus_tag LOCUS_38540 21014 20334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 21454 21233 gene locus_tag LOCUS_38550 21454 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 23537 21660 gene locus_tag LOCUS_38560 23537 21660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 23691 24140 gene locus_tag LOCUS_38570 23691 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 25325 24126 gene locus_tag LOCUS_38580 25325 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 27529 25343 gene locus_tag LOCUS_38590 27529 25343 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_38590 27904 28086 gene locus_tag LOCUS_38600 27904 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 28415 28176 gene locus_tag LOCUS_38610 28415 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 28380 30416 gene locus_tag LOCUS_38620 28380 30416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence097 507 3212 gene locus_tag LOCUS_38630 507 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 3415 6396 gene locus_tag LOCUS_38640 3415 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 6499 8700 gene locus_tag LOCUS_38650 6499 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 9171 8716 gene locus_tag LOCUS_38660 9171 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 10305 9340 gene locus_tag LOCUS_38670 10305 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 11115 10357 gene locus_tag LOCUS_38680 11115 10357 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_38680 11312 13729 gene locus_tag LOCUS_38690 11312 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 14706 13732 gene locus_tag LOCUS_38700 gene tdcB 14706 13732 CDS product L-threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW6 protein_id gnl|my_center|LOCUS_38700 15865 14810 gene locus_tag LOCUS_38710 gene ilvC 15865 14810 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC26 protein_id gnl|my_center|LOCUS_38710 15734 15657 gene locus_tag LOCUS_t00500 15734 15657 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15920 16084 gene locus_tag LOCUS_38720 15920 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 16749 16183 gene locus_tag LOCUS_38730 gene ilvH 16749 16183 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173280.1 protein_id gnl|my_center|LOCUS_38730 18491 16779 gene locus_tag LOCUS_38740 18491 16779 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC24 protein_id gnl|my_center|LOCUS_38740 19554 18589 gene locus_tag LOCUS_38750 19554 18589 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_38750 21302 19638 gene locus_tag LOCUS_38760 gene ilvD 21302 19638 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51785 protein_id gnl|my_center|LOCUS_38760 22222 23196 gene locus_tag LOCUS_38770 22222 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 23416 24765 gene locus_tag LOCUS_38780 23416 24765 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_38780 24774 26381 gene locus_tag LOCUS_38790 24774 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 26599 29181 gene locus_tag LOCUS_38800 gene lon 26599 29181 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJA3 protein_id gnl|my_center|LOCUS_38800 30099 29296 gene locus_tag LOCUS_38810 30099 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 30756 30845 gene locus_tag LOCUS_t00510 30756 30845 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30875 30962 gene locus_tag LOCUS_t00520 30875 30962 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30991 31081 gene locus_tag LOCUS_t00530 30991 31081 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31105 31192 gene locus_tag LOCUS_t00540 31105 31192 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 <1 2114 gene locus_tag LOCUS_38820 <1 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969213.1:relaxase 3853 5970 gene locus_tag LOCUS_38830 3853 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 6102 10766 gene locus_tag LOCUS_38840 6102 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 11971 11084 gene locus_tag LOCUS_38850 11971 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 12368 12060 gene locus_tag LOCUS_38860 12368 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 13129 12365 gene locus_tag LOCUS_38870 13129 12365 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005741073.1 protein_id gnl|my_center|LOCUS_38870 14618 13119 gene locus_tag LOCUS_38880 14618 13119 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030889.1 protein_id gnl|my_center|LOCUS_38880 15087 14800 gene locus_tag LOCUS_38890 15087 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 15572 15084 gene locus_tag LOCUS_38900 15572 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 16504 15575 gene locus_tag LOCUS_38910 16504 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704432.1 protein_id gnl|my_center|LOCUS_38910 17632 16724 gene locus_tag LOCUS_38920 17632 16724 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_38920 17867 20605 gene locus_tag LOCUS_38930 17867 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 20698 22047 gene locus_tag LOCUS_38940 20698 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763971.1 protein_id gnl|my_center|LOCUS_38940 22044 27428 gene locus_tag LOCUS_38950 22044 27428 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103522.1 protein_id gnl|my_center|LOCUS_38950 27561 27917 gene locus_tag LOCUS_38960 27561 27917 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_38960 27932 30550 gene locus_tag LOCUS_38970 27932 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_38970 >Feature sequence099 311 3181 gene locus_tag LOCUS_38980 311 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4841 3153 gene locus_tag LOCUS_38990 4841 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 5213 7750 gene locus_tag LOCUS_39000 5213 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 9690 7930 gene locus_tag LOCUS_39010 9690 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 11259 9862 gene locus_tag LOCUS_39020 11259 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 11440 12225 gene locus_tag LOCUS_39030 11440 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 12215 13306 gene locus_tag LOCUS_39040 12215 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 16328 13419 gene locus_tag LOCUS_39050 16328 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_39050 18206 17094 gene locus_tag LOCUS_39060 gene srkA 18206 17094 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F359 protein_id gnl|my_center|LOCUS_39060 18296 18793 gene locus_tag LOCUS_39070 18296 18793 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 protein_id gnl|my_center|LOCUS_39070 18790 21060 gene locus_tag LOCUS_39080 18790 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 22731 21085 gene locus_tag LOCUS_39090 22731 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 24523 22793 gene locus_tag LOCUS_39100 24523 22793 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_39100 24685 25890 gene locus_tag LOCUS_39110 24685 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 26740 25991 gene locus_tag LOCUS_39120 26740 25991 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_39120 27243 26728 gene locus_tag LOCUS_39130 gene aroK 27243 26728 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL5 protein_id gnl|my_center|LOCUS_39130 27387 27256 gene locus_tag LOCUS_39140 27387 27256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 28829 27384 gene locus_tag LOCUS_39150 28829 27384 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_39150 29578 28826 gene locus_tag LOCUS_39160 gene thiE 29578 28826 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI8 protein_id gnl|my_center|LOCUS_39160 30980 29598 gene locus_tag LOCUS_39170 gene accC 30980 29598 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_39170 >Feature sequence100 13 189 gene locus_tag LOCUS_39180 13 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 247 420 gene locus_tag LOCUS_39190 247 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 475 654 gene locus_tag LOCUS_39200 475 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 716 889 gene locus_tag LOCUS_39210 716 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 953 1132 gene locus_tag LOCUS_39220 953 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1457 2275 gene locus_tag LOCUS_39230 1457 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 2288 3211 gene locus_tag LOCUS_39240 2288 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 3208 4293 gene locus_tag LOCUS_39250 3208 4293 CDS product lantibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 protein_id gnl|my_center|LOCUS_39250 4290 4979 gene locus_tag LOCUS_39260 4290 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 4976 7204 gene locus_tag LOCUS_39270 4976 7204 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_39270 7580 9859 gene locus_tag LOCUS_39280 7580 9859 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_39280 9955 10740 gene locus_tag LOCUS_39290 9955 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 10746 11672 gene locus_tag LOCUS_39300 10746 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 11745 14159 gene locus_tag LOCUS_39310 11745 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_39310 14396 15388 gene locus_tag LOCUS_39320 14396 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 15421 16005 gene locus_tag LOCUS_39330 15421 16005 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_39330 16002 18662 gene locus_tag LOCUS_39340 16002 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 19631 18678 gene locus_tag LOCUS_39350 19631 18678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 20793 20296 gene locus_tag LOCUS_39360 20793 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 21446 20790 gene locus_tag LOCUS_39370 21446 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 23957 21858 gene locus_tag LOCUS_39380 23957 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 24645 25793 gene locus_tag LOCUS_39390 24645 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 25798 26754 gene locus_tag LOCUS_39400 25798 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 26762 29497 gene locus_tag LOCUS_39410 26762 29497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 29576 29698 gene locus_tag LOCUS_39420 29576 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 29757 29945 gene locus_tag LOCUS_39430 29757 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 30004 30183 gene locus_tag LOCUS_39440 30004 30183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 30313 30489 gene locus_tag LOCUS_39450 30313 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 >Feature sequence101 2019 493 gene locus_tag LOCUS_39460 2019 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 2968 2192 gene locus_tag LOCUS_39470 2968 2192 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_39470 3904 3062 gene locus_tag LOCUS_39480 3904 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_39480 6032 4068 gene locus_tag LOCUS_39490 6032 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 6414 10526 gene locus_tag LOCUS_39500 6414 10526 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_39500 11222 10638 gene locus_tag LOCUS_39510 11222 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 15955 11564 gene locus_tag LOCUS_39520 15955 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 17070 15955 gene locus_tag LOCUS_39530 17070 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 17922 17233 gene locus_tag LOCUS_39540 17922 17233 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143625.1 protein_id gnl|my_center|LOCUS_39540 18136 20073 gene locus_tag LOCUS_39550 18136 20073 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887989.1 protein_id gnl|my_center|LOCUS_39550 20070 22598 gene locus_tag LOCUS_39560 20070 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 23325 22633 gene locus_tag LOCUS_39570 gene lpxH 23325 22633 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_39570 24412 23330 gene locus_tag LOCUS_39580 24412 23330 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T733 protein_id gnl|my_center|LOCUS_39580 25926 24592 gene locus_tag LOCUS_39590 25926 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 27916 26120 gene locus_tag LOCUS_39600 27916 26120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 28529 27972 gene locus_tag LOCUS_39610 28529 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 <30552 28560 gene locus_tag LOCUS_39620 <30552 28560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:pilus modification protein PilQ >Feature sequence102 2569 1796 gene locus_tag LOCUS_39630 2569 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 5300 2571 gene locus_tag LOCUS_39640 5300 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 5638 6603 gene locus_tag LOCUS_39650 5638 6603 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475776.1 protein_id gnl|my_center|LOCUS_39650 7014 6634 gene locus_tag LOCUS_39660 7014 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 8427 7240 gene locus_tag LOCUS_39670 gene solA 8427 7240 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLS3 protein_id gnl|my_center|LOCUS_39670 9762 8536 gene locus_tag LOCUS_39680 9762 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 10101 10712 gene locus_tag LOCUS_39690 10101 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 11797 10811 gene locus_tag LOCUS_39700 11797 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 14414 11907 gene locus_tag LOCUS_39710 14414 11907 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_39710 14577 15488 gene locus_tag LOCUS_39720 gene exo 14577 15488 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_39720 15562 17082 gene locus_tag LOCUS_39730 15562 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 17079 19013 gene locus_tag LOCUS_39740 17079 19013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 19289 20092 gene locus_tag LOCUS_39750 19289 20092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 20227 21423 gene locus_tag LOCUS_39760 gene thlA 20227 21423 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AR0 protein_id gnl|my_center|LOCUS_39760 21420 22250 gene locus_tag LOCUS_39770 21420 22250 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701927.1 protein_id gnl|my_center|LOCUS_39770 22290 23069 gene locus_tag LOCUS_39780 22290 23069 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_39780 23715 23167 gene locus_tag LOCUS_39790 gene resA 23715 23167 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_39790 23947 25386 gene locus_tag LOCUS_39800 23947 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 25511 25586 gene locus_tag LOCUS_t00550 25511 25586 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25859 27085 gene locus_tag LOCUS_39810 25859 27085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 27707 27237 gene locus_tag LOCUS_39820 27707 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_39820 28726 27776 gene locus_tag LOCUS_39830 28726 27776 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_39830 <30368 28778 gene locus_tag LOCUS_39840 <30368 28778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404701.1:dehydrogenase >Feature sequence103 <1 2725 gene locus_tag LOCUS_39850 <1 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 3681 2959 gene locus_tag LOCUS_39860 3681 2959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_39860 6735 3685 gene locus_tag LOCUS_39870 6735 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 6952 9288 gene locus_tag LOCUS_39880 6952 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_39880 9444 10943 gene locus_tag LOCUS_39890 9444 10943 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_39890 11302 11523 gene locus_tag LOCUS_39900 11302 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 11771 11989 gene locus_tag LOCUS_39910 11771 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 12250 12759 gene locus_tag LOCUS_39920 12250 12759 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_39920 13878 12784 gene locus_tag LOCUS_39930 13878 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 14528 13878 gene locus_tag LOCUS_39940 14528 13878 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_39940 16988 15420 gene locus_tag LOCUS_39950 gene rsr 16988 15420 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_39950 18569 17280 gene locus_tag LOCUS_39960 gene amaA 18569 17280 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_39960 19002 20168 gene locus_tag LOCUS_39970 19002 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 20403 23594 gene locus_tag LOCUS_39980 20403 23594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 23687 24454 gene locus_tag LOCUS_39990 23687 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 26210 24558 gene locus_tag LOCUS_40000 gene fhs 26210 24558 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXY2 protein_id gnl|my_center|LOCUS_40000 26472 27896 gene locus_tag LOCUS_40010 gene rtcB 26472 27896 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_40010 27896 28222 gene locus_tag LOCUS_40020 27896 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 28398 28730 gene locus_tag LOCUS_40030 28398 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 29438 29512 gene locus_tag LOCUS_t00560 29438 29512 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29641 29715 gene locus_tag LOCUS_t00570 29641 29715 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29745 29815 gene locus_tag LOCUS_t00580 29745 29815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29848 29922 gene locus_tag LOCUS_t00590 29848 29922 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29930 30004 gene locus_tag LOCUS_t00600 29930 30004 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30013 30089 gene locus_tag LOCUS_t00610 30013 30089 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30123 30199 gene locus_tag LOCUS_t00620 30123 30199 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 556 2019 gene locus_tag LOCUS_40040 556 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 2115 2188 gene locus_tag LOCUS_t00630 2115 2188 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2236 2991 gene locus_tag LOCUS_40050 2236 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3002 3694 gene locus_tag LOCUS_40060 gene yggS 3002 3694 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_40060 3785 4285 gene locus_tag LOCUS_40070 3785 4285 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_40070 4317 4601 gene locus_tag LOCUS_40080 4317 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4635 5315 gene locus_tag LOCUS_40090 4635 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66416 protein_id gnl|my_center|LOCUS_40090 5409 7115 gene locus_tag LOCUS_40100 5409 7115 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_40100 7947 7168 gene locus_tag LOCUS_40110 gene parA 7947 7168 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_40110 8620 8000 gene locus_tag LOCUS_40120 8620 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 9735 8617 gene locus_tag LOCUS_40130 gene metX 9735 8617 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW8 protein_id gnl|my_center|LOCUS_40130 9995 9732 gene locus_tag LOCUS_40140 9995 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 10172 11389 gene locus_tag LOCUS_40150 10172 11389 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_40150 11386 12738 gene locus_tag LOCUS_40160 gene leuC 11386 12738 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_40160 12738 13349 gene locus_tag LOCUS_40170 gene leuD 12738 13349 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F7 protein_id gnl|my_center|LOCUS_40170 13346 14491 gene locus_tag LOCUS_40180 13346 14491 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_40180 14522 15415 gene locus_tag LOCUS_40190 14522 15415 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_40190 17992 15431 gene locus_tag LOCUS_40200 gene hrpB 17992 15431 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_40200 18136 19233 gene locus_tag LOCUS_40210 18136 19233 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_40210 20155 19259 gene locus_tag LOCUS_40220 20155 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_40220 21232 20177 gene locus_tag LOCUS_40230 gene ruvB 21232 20177 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA2 protein_id gnl|my_center|LOCUS_40230 21851 21258 gene locus_tag LOCUS_40240 gene ruvA 21851 21258 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_40240 23860 21923 gene locus_tag LOCUS_40250 23860 21923 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_40250 24239 25666 gene locus_tag LOCUS_40260 24239 25666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 25786 26811 gene locus_tag LOCUS_40270 gene mreB-1 25786 26811 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_40270 26898 27740 gene locus_tag LOCUS_40280 gene mreC 26898 27740 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_40280 27733 28254 gene locus_tag LOCUS_40290 27733 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence105 371 1942 gene locus_tag LOCUS_40300 371 1942 CDS product RND efflux system, hypothetical protein, NodT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545821.1 protein_id gnl|my_center|LOCUS_40300 1935 3182 gene locus_tag LOCUS_40310 1935 3182 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545350.1 protein_id gnl|my_center|LOCUS_40310 3179 3913 gene locus_tag LOCUS_40320 3179 3913 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_40320 3913 5124 gene locus_tag LOCUS_40330 3913 5124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_40330 6388 5390 gene locus_tag LOCUS_40340 6388 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 8406 6640 gene locus_tag LOCUS_40350 8406 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 17711 8424 gene locus_tag LOCUS_40360 17711 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 18178 20163 gene locus_tag LOCUS_40370 18178 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 20351 21343 gene locus_tag LOCUS_40380 20351 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 24146 21381 gene locus_tag LOCUS_40390 24146 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 24093 24308 gene locus_tag LOCUS_40400 24093 24308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 24862 24275 gene locus_tag LOCUS_40410 24862 24275 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_40410 25143 25913 gene locus_tag LOCUS_40420 25143 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 27109 26006 gene locus_tag LOCUS_40430 27109 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 28647 27346 gene locus_tag LOCUS_40440 28647 27346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 >Feature sequence106 279 73 gene locus_tag LOCUS_40450 279 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 167 493 gene locus_tag LOCUS_40460 167 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 899 510 gene locus_tag LOCUS_40470 899 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_40470 1416 979 gene locus_tag LOCUS_40480 1416 979 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_40480 1803 2870 gene locus_tag LOCUS_40490 1803 2870 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_40490 2867 3781 gene locus_tag LOCUS_40500 2867 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 4687 3803 gene locus_tag LOCUS_40510 4687 3803 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_40510 4899 4684 gene locus_tag LOCUS_40520 4899 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 5371 4910 gene locus_tag LOCUS_40530 5371 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 7210 5471 gene locus_tag LOCUS_40540 7210 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 8160 7360 gene locus_tag LOCUS_40550 gene thiD 8160 7360 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 protein_id gnl|my_center|LOCUS_40550 8966 8157 gene locus_tag LOCUS_40560 gene lgt 8966 8157 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60970 protein_id gnl|my_center|LOCUS_40560 10185 9202 gene locus_tag LOCUS_40570 10185 9202 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_40570 13476 10738 gene locus_tag LOCUS_40580 13476 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 14107 13499 gene locus_tag LOCUS_40590 14107 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 14311 15273 gene locus_tag LOCUS_40600 14311 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 15612 15310 gene locus_tag LOCUS_40610 15612 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 16320 15616 gene locus_tag LOCUS_40620 16320 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 16413 16610 gene locus_tag LOCUS_40630 16413 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 16747 18369 gene locus_tag LOCUS_40640 16747 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918952.1 protein_id gnl|my_center|LOCUS_40640 18460 21024 gene locus_tag LOCUS_40650 gene hepA 18460 21024 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_40650 24711 21271 gene locus_tag LOCUS_40660 gene pyc 24711 21271 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KWU4 protein_id gnl|my_center|LOCUS_40660 25011 27731 gene locus_tag LOCUS_40670 25011 27731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence107 41 955 gene locus_tag LOCUS_40680 41 955 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_40680 955 1674 gene locus_tag LOCUS_40690 955 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1671 3077 gene locus_tag LOCUS_40700 gene glmM 1671 3077 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW62 protein_id gnl|my_center|LOCUS_40700 3228 3986 gene locus_tag LOCUS_40710 gene pdxJ 3228 3986 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_40710 4170 6956 gene locus_tag LOCUS_40720 4170 6956 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_40720 12466 6983 gene locus_tag LOCUS_40730 12466 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 12980 12768 gene locus_tag LOCUS_40740 12980 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 14448 13051 gene locus_tag LOCUS_40750 14448 13051 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_40750 15977 17458 gene locus_tag LOCUS_40760 15977 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 17455 18429 gene locus_tag LOCUS_40770 17455 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 18426 19049 gene locus_tag LOCUS_40780 gene hisG2 18426 19049 CDS product ATP phosphoribosyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60836 protein_id gnl|my_center|LOCUS_40780 19106 20413 gene locus_tag LOCUS_40790 gene hisD 19106 20413 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHM2 protein_id gnl|my_center|LOCUS_40790 20410 21504 gene locus_tag LOCUS_40800 gene hisC 20410 21504 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRM7 protein_id gnl|my_center|LOCUS_40800 21501 22115 gene locus_tag LOCUS_40810 gene hisB 21501 22115 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEK7 protein_id gnl|my_center|LOCUS_40810 22112 22789 gene locus_tag LOCUS_40820 gene hisH 22112 22789 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_40820 22767 23555 gene locus_tag LOCUS_40830 gene hisA 22767 23555 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBG8 protein_id gnl|my_center|LOCUS_40830 23552 24358 gene locus_tag LOCUS_40840 gene hisF 23552 24358 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2T7 protein_id gnl|my_center|LOCUS_40840 24370 25053 gene locus_tag LOCUS_40850 gene hisI 24370 25053 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC9 protein_id gnl|my_center|LOCUS_40850 25050 26537 gene locus_tag LOCUS_40860 gene trpE 25050 26537 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_40860 26534 27190 gene locus_tag LOCUS_40870 26534 27190 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_40870 27204 28232 gene locus_tag LOCUS_40880 gene trpD 27204 28232 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_40880 >Feature sequence108 2119 377 gene locus_tag LOCUS_40890 2119 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 3462 2614 gene locus_tag LOCUS_40900 3462 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 6066 3658 gene locus_tag LOCUS_40910 6066 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_40910 6305 6802 gene locus_tag LOCUS_40920 6305 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 7999 6983 gene locus_tag LOCUS_40930 7999 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40930 8946 7996 gene locus_tag LOCUS_40940 8946 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40940 9842 8961 gene locus_tag LOCUS_40950 9842 8961 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_40950 11529 9802 gene locus_tag LOCUS_40960 11529 9802 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_40960 12498 11620 gene locus_tag LOCUS_40970 12498 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 12959 12495 gene locus_tag LOCUS_40980 12959 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 14173 12986 gene locus_tag LOCUS_40990 14173 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_40990 14696 14226 gene locus_tag LOCUS_41000 gene gcvH 14696 14226 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_41000 15964 14696 gene locus_tag LOCUS_41010 gene iscS 15964 14696 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_41010 17232 15961 gene locus_tag LOCUS_41020 17232 15961 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_41020 17890 17390 gene locus_tag LOCUS_41030 17890 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 19058 23716 gene locus_tag LOCUS_41040 19058 23716 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_41040 23959 24774 gene locus_tag LOCUS_41050 23959 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 24925 25554 gene locus_tag LOCUS_41060 24925 25554 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_41060 <27948 25561 gene locus_tag LOCUS_41070 <27948 25561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine protein kinase >Feature sequence109 2653 575 gene locus_tag LOCUS_41080 2653 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 2597 2767 gene locus_tag LOCUS_41090 2597 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 4737 2821 gene locus_tag LOCUS_41100 4737 2821 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_41100 4938 6068 gene locus_tag LOCUS_41110 4938 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 6065 7450 gene locus_tag LOCUS_41120 6065 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 8378 7473 gene locus_tag LOCUS_41130 8378 7473 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_41130 10565 8412 gene locus_tag LOCUS_41140 10565 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 11633 10569 gene locus_tag LOCUS_41150 11633 10569 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_41150 11815 12822 gene locus_tag LOCUS_41160 gene rnz 11815 12822 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXP0 protein_id gnl|my_center|LOCUS_41160 12965 13933 gene locus_tag LOCUS_41170 12965 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 14122 14724 gene locus_tag LOCUS_41180 14122 14724 CDS product putative alternative RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705660.1 protein_id gnl|my_center|LOCUS_41180 14721 15107 gene locus_tag LOCUS_41190 14721 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 17046 15115 gene locus_tag LOCUS_41200 17046 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 17420 17701 gene locus_tag LOCUS_41210 17420 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 18764 17778 gene locus_tag LOCUS_41220 18764 17778 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_41220 19233 19415 gene locus_tag LOCUS_41230 19233 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 19666 22455 gene locus_tag LOCUS_41240 19666 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 22553 23956 gene locus_tag LOCUS_41250 22553 23956 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920522.1 protein_id gnl|my_center|LOCUS_41250 24084 25166 gene locus_tag LOCUS_41260 24084 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 25236 26540 gene locus_tag LOCUS_41270 25236 26540 CDS product polysaccharide biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973111.1 protein_id gnl|my_center|LOCUS_41270 >Feature sequence110 <1 817 gene locus_tag LOCUS_41280 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121306.1:RNA-binding protein 841 2628 gene locus_tag LOCUS_41290 841 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 2921 3592 gene locus_tag LOCUS_41300 2921 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 3880 5586 gene locus_tag LOCUS_41310 3880 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 6405 5623 gene locus_tag LOCUS_41320 6405 5623 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_41320 6743 6402 gene locus_tag LOCUS_41330 6743 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 6742 8979 gene locus_tag LOCUS_41340 6742 8979 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_41340 9117 9755 gene locus_tag LOCUS_41350 9117 9755 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_except (pos:9357..9359,aa:Sec) note codon on position 81 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_41350 10604 9948 gene locus_tag LOCUS_41360 10604 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 10822 10601 gene locus_tag LOCUS_41370 10822 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 12467 11028 gene locus_tag LOCUS_41380 12467 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 13297 12524 gene locus_tag LOCUS_41390 13297 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 14592 13837 gene locus_tag LOCUS_41400 14592 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 17558 14973 gene locus_tag LOCUS_41410 17558 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41410 18221 20287 gene locus_tag LOCUS_41420 18221 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 21081 20536 gene locus_tag LOCUS_41430 21081 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 21674 21078 gene locus_tag LOCUS_41440 gene sigW 21674 21078 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYY2 protein_id gnl|my_center|LOCUS_41440 22003 21671 gene locus_tag LOCUS_41450 22003 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 23940 22345 gene locus_tag LOCUS_41460 23940 22345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 24230 24862 gene locus_tag LOCUS_41470 24230 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_41470 24859 25407 gene locus_tag LOCUS_41480 gene kptA 24859 25407 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_41480 26186 25434 gene locus_tag LOCUS_41490 26186 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 27869 26262 gene locus_tag LOCUS_41500 27869 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence111 136 1782 gene locus_tag LOCUS_41510 136 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 1793 2737 gene locus_tag LOCUS_41520 gene fmt 1793 2737 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_41520 2926 4248 gene locus_tag LOCUS_41530 2926 4248 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK22 protein_id gnl|my_center|LOCUS_41530 4787 5065 gene locus_tag LOCUS_41540 gene hlpA 4787 5065 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284639.1 protein_id gnl|my_center|LOCUS_41540 5235 5936 gene locus_tag LOCUS_41550 5235 5936 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_41550 6026 6496 gene locus_tag LOCUS_41560 gene moaC 6026 6496 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_41560 6493 7686 gene locus_tag LOCUS_41570 6493 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_41570 7696 8148 gene locus_tag LOCUS_41580 7696 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 8364 9440 gene locus_tag LOCUS_41590 8364 9440 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_41590 9568 11151 gene locus_tag LOCUS_41600 gene serA 9568 11151 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35136 protein_id gnl|my_center|LOCUS_41600 11383 12141 gene locus_tag LOCUS_41610 11383 12141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_41610 12156 14519 gene locus_tag LOCUS_41620 12156 14519 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_41620 14573 15796 gene locus_tag LOCUS_41630 14573 15796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_41630 15870 17003 gene locus_tag LOCUS_41640 15870 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 20208 17005 gene locus_tag LOCUS_41650 20208 17005 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_41650 21346 20210 gene locus_tag LOCUS_41660 21346 20210 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184876.1 protein_id gnl|my_center|LOCUS_41660 22866 21343 gene locus_tag LOCUS_41670 22866 21343 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_41670 23528 22863 gene locus_tag LOCUS_41680 23528 22863 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126376.1 protein_id gnl|my_center|LOCUS_41680 23763 26099 gene locus_tag LOCUS_41690 23763 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 26710 26207 gene locus_tag LOCUS_41700 26710 26207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 27446 26853 gene locus_tag LOCUS_41710 27446 26853 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence112 3163 3318 gene locus_tag LOCUS_41720 3163 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 5606 3663 gene locus_tag LOCUS_41730 5606 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 7367 5784 gene locus_tag LOCUS_41740 7367 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 8386 7499 gene locus_tag LOCUS_41750 gene surE 8386 7499 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2B0 protein_id gnl|my_center|LOCUS_41750 9886 8582 gene locus_tag LOCUS_41760 9886 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 10011 10961 gene locus_tag LOCUS_41770 10011 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 12209 11352 gene locus_tag LOCUS_41780 12209 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 12616 12440 gene locus_tag LOCUS_41790 12616 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 12977 12771 gene locus_tag LOCUS_41800 12977 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 13140 13859 gene locus_tag LOCUS_41810 13140 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 13958 14641 gene locus_tag LOCUS_41820 13958 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 15373 14651 gene locus_tag LOCUS_41830 15373 14651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_41830 15551 16429 gene locus_tag LOCUS_41840 15551 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 16572 17636 gene locus_tag LOCUS_41850 16572 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 17732 18610 gene locus_tag LOCUS_41860 17732 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 18635 19159 gene locus_tag LOCUS_41870 18635 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 19303 19809 gene locus_tag LOCUS_41880 19303 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 19831 20397 gene locus_tag LOCUS_41890 19831 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 22518 20425 gene locus_tag LOCUS_41900 22518 20425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 23000 22806 gene locus_tag LOCUS_41910 23000 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 25866 23332 gene locus_tag LOCUS_41920 25866 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 26456 25863 gene locus_tag LOCUS_41930 26456 25863 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_41930 >Feature sequence113 5258 3762 gene locus_tag LOCUS_41940 5258 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 6125 5490 gene locus_tag LOCUS_41950 6125 5490 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_41950 7075 6194 gene locus_tag LOCUS_41960 7075 6194 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_41960 7253 8155 gene locus_tag LOCUS_41970 7253 8155 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097179.1 protein_id gnl|my_center|LOCUS_41970 11552 8184 gene locus_tag LOCUS_41980 11552 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 14683 11687 gene locus_tag LOCUS_41990 14683 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41990 15087 14680 gene locus_tag LOCUS_42000 15087 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42000 17487 15274 gene locus_tag LOCUS_42010 17487 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42010 20663 17523 gene locus_tag LOCUS_42020 20663 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 20960 21940 gene locus_tag LOCUS_42030 20960 21940 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_42030 22260 23666 gene locus_tag LOCUS_42040 gene fleR 22260 23666 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_42040 25641 23734 gene locus_tag LOCUS_42050 25641 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 <27444 25734 gene locus_tag LOCUS_42060 <27444 25734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941041.1:two-component sensor histidine kinase >Feature sequence114 694 1326 gene locus_tag LOCUS_42070 694 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 2117 1341 gene locus_tag LOCUS_42080 2117 1341 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_42080 2460 2200 gene locus_tag LOCUS_42090 2460 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 3278 2535 gene locus_tag LOCUS_42100 3278 2535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_42100 4245 3331 gene locus_tag LOCUS_42110 gene prmC 4245 3331 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QE9 protein_id gnl|my_center|LOCUS_42110 4511 7303 gene locus_tag LOCUS_42120 4511 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 7362 8744 gene locus_tag LOCUS_42130 gene pilR 7362 8744 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_42130 9517 8753 gene locus_tag LOCUS_42140 9517 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_42140 9760 9554 gene locus_tag LOCUS_42150 9760 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 10063 10692 gene locus_tag LOCUS_42160 10063 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 11027 10767 gene locus_tag LOCUS_42170 11027 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 11167 11457 gene locus_tag LOCUS_42180 11167 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 11481 12575 gene locus_tag LOCUS_42190 gene rlmN 11481 12575 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_42190 13302 12589 gene locus_tag LOCUS_42200 13302 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_42200 14408 13302 gene locus_tag LOCUS_42210 gene clpX 14408 13302 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNN1 protein_id gnl|my_center|LOCUS_42210 14534 15520 gene locus_tag LOCUS_42220 14534 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 15615 17504 gene locus_tag LOCUS_42230 15615 17504 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_42230 17494 18300 gene locus_tag LOCUS_42240 17494 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 19117 18311 gene locus_tag LOCUS_42250 19117 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 20397 19114 gene locus_tag LOCUS_42260 20397 19114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028868.1 protein_id gnl|my_center|LOCUS_42260 22002 20422 gene locus_tag LOCUS_42270 gene glyQS 22002 20422 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_42270 23027 22488 gene locus_tag LOCUS_42280 23027 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 24658 23705 gene locus_tag LOCUS_42290 24658 23705 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_42290 24793 25707 gene locus_tag LOCUS_42300 24793 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 >Feature sequence115 839 4471 gene locus_tag LOCUS_42310 839 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 4874 4536 gene locus_tag LOCUS_42320 4874 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 5390 4935 gene locus_tag LOCUS_42330 5390 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 6079 5387 gene locus_tag LOCUS_42340 6079 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 7415 6096 gene locus_tag LOCUS_42350 7415 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 7913 7446 gene locus_tag LOCUS_42360 7913 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 8514 8056 gene locus_tag LOCUS_42370 8514 8056 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_42370 9134 8514 gene locus_tag LOCUS_42380 9134 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 9772 9368 gene locus_tag LOCUS_42390 9772 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 10017 10370 gene locus_tag LOCUS_42400 10017 10370 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 protein_id gnl|my_center|LOCUS_42400 10370 13051 gene locus_tag LOCUS_42410 10370 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_42410 13144 13431 gene locus_tag LOCUS_42420 13144 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 14030 13680 gene locus_tag LOCUS_42430 14030 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 14332 14027 gene locus_tag LOCUS_42440 14332 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 14622 14329 gene locus_tag LOCUS_42450 14622 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 14912 14619 gene locus_tag LOCUS_42460 14912 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 15527 14946 gene locus_tag LOCUS_42470 15527 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 16055 15612 gene locus_tag LOCUS_42480 16055 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 16204 16743 gene locus_tag LOCUS_42490 16204 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 19117 16697 gene locus_tag LOCUS_42500 19117 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 19296 21527 gene locus_tag LOCUS_42510 19296 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 22096 21524 gene locus_tag LOCUS_42520 22096 21524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 22600 22118 gene locus_tag LOCUS_42530 22600 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 22899 22600 gene locus_tag LOCUS_42540 22899 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 23378 22956 gene locus_tag LOCUS_42550 23378 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090099.1 protein_id gnl|my_center|LOCUS_42550 24116 23436 gene locus_tag LOCUS_42560 24116 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_42560 25083 24148 gene locus_tag LOCUS_42570 25083 24148 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 protein_id gnl|my_center|LOCUS_42570 25343 26284 gene locus_tag LOCUS_42580 25343 26284 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence116 1491 559 gene locus_tag LOCUS_42590 1491 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42590 2506 1523 gene locus_tag LOCUS_42600 2506 1523 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_42600 2811 3749 gene locus_tag LOCUS_42610 2811 3749 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_42610 4226 3792 gene locus_tag LOCUS_42620 gene fur 4226 3792 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_42620 4958 4359 gene locus_tag LOCUS_42630 4958 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_42630 6115 5150 gene locus_tag LOCUS_42640 6115 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 6525 6229 gene locus_tag LOCUS_42650 6525 6229 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_42650 10037 6834 gene locus_tag LOCUS_42660 10037 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_42660 13450 10034 gene locus_tag LOCUS_42670 13450 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_42670 14066 13503 gene locus_tag LOCUS_42680 14066 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 14217 15095 gene locus_tag LOCUS_42690 14217 15095 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_42690 15102 15941 gene locus_tag LOCUS_42700 gene apaH 15102 15941 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_42700 17979 16042 gene locus_tag LOCUS_42710 17979 16042 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_42710 18201 19361 gene locus_tag LOCUS_42720 gene galK 18201 19361 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLP4 protein_id gnl|my_center|LOCUS_42720 19633 20367 gene locus_tag LOCUS_42730 19633 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 20516 21931 gene locus_tag LOCUS_42740 20516 21931 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_42740 21994 23505 gene locus_tag LOCUS_42750 21994 23505 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_42750 23525 24397 gene locus_tag LOCUS_42760 gene psd 23525 24397 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2C0 protein_id gnl|my_center|LOCUS_42760 26021 24432 gene locus_tag LOCUS_42770 26021 24432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_42770 >Feature sequence117 <1 2820 gene locus_tag LOCUS_42780 <1 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038044.1:two-component system sensor histidine kinase/response regulator 2817 3758 gene locus_tag LOCUS_42790 2817 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 4026 4646 gene locus_tag LOCUS_42800 4026 4646 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_42800 4643 6271 gene locus_tag LOCUS_42810 4643 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 6268 8637 gene locus_tag LOCUS_42820 6268 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 10125 8695 gene locus_tag LOCUS_42830 10125 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 12044 10170 gene locus_tag LOCUS_42840 12044 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 13072 12062 gene locus_tag LOCUS_42850 13072 12062 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_42850 13423 14766 gene locus_tag LOCUS_42860 13423 14766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 15958 14771 gene locus_tag LOCUS_42870 15958 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 16231 17316 gene locus_tag LOCUS_42880 16231 17316 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_42880 17313 19136 gene locus_tag LOCUS_42890 17313 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 19867 19565 gene locus_tag LOCUS_42900 19867 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 20101 19877 gene locus_tag LOCUS_42910 20101 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 21364 20156 gene locus_tag LOCUS_42920 gene metB 21364 20156 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_42920 22045 21623 gene locus_tag LOCUS_42930 22045 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 22233 22442 gene locus_tag LOCUS_42940 22233 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_42940 22603 26379 gene locus_tag LOCUS_42950 22603 26379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 >Feature sequence118 622 1089 gene locus_tag LOCUS_42960 622 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 1165 1863 gene locus_tag LOCUS_42970 1165 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 3559 1904 gene locus_tag LOCUS_42980 3559 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 3711 4181 gene locus_tag LOCUS_42990 3711 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 4181 4486 gene locus_tag LOCUS_43000 4181 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 6316 4487 gene locus_tag LOCUS_43010 gene edd 6316 4487 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_43010 6507 7124 gene locus_tag LOCUS_43020 6507 7124 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695341.1 protein_id gnl|my_center|LOCUS_43020 7264 8736 gene locus_tag LOCUS_43030 gene zwf 7264 8736 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_43030 8800 9531 gene locus_tag LOCUS_43040 gene pgl 8800 9531 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_43040 9546 10400 gene locus_tag LOCUS_43050 9546 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 10472 11818 gene locus_tag LOCUS_43060 gene ndh 10472 11818 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_43060 12294 11932 gene locus_tag LOCUS_43070 12294 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 12187 12570 gene locus_tag LOCUS_43080 12187 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 12693 13385 gene locus_tag LOCUS_43090 12693 13385 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_43090 13407 14819 gene locus_tag LOCUS_43100 13407 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 16901 14916 gene locus_tag LOCUS_43110 16901 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 17217 18440 gene locus_tag LOCUS_43120 17217 18440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 18945 18457 gene locus_tag LOCUS_43130 18945 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 19952 19077 gene locus_tag LOCUS_43140 19952 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_43140 20599 19949 gene locus_tag LOCUS_43150 20599 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 21947 20685 gene locus_tag LOCUS_43160 21947 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 23789 22053 gene locus_tag LOCUS_43170 23789 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence119 1236 403 gene locus_tag LOCUS_43180 gene phnC 1236 403 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB5 protein_id gnl|my_center|LOCUS_43180 2621 1236 gene locus_tag LOCUS_43190 2621 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 5310 2788 gene locus_tag LOCUS_43200 5310 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 5742 6401 gene locus_tag LOCUS_43210 5742 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 6486 8069 gene locus_tag LOCUS_43220 6486 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 9421 8162 gene locus_tag LOCUS_43230 9421 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_43230 11600 9570 gene locus_tag LOCUS_43240 11600 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_43240 11869 12702 gene locus_tag LOCUS_43250 11869 12702 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_43250 12713 13915 gene locus_tag LOCUS_43260 12713 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_43260 15936 14026 gene locus_tag LOCUS_43270 15936 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 17654 15939 gene locus_tag LOCUS_43280 17654 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 18235 17651 gene locus_tag LOCUS_43290 18235 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 19827 18232 gene locus_tag LOCUS_43300 19827 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 20852 19863 gene locus_tag LOCUS_43310 20852 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 23071 20852 gene locus_tag LOCUS_43320 23071 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 24105 23068 gene locus_tag LOCUS_43330 24105 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 24656 25549 gene locus_tag LOCUS_43340 24656 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence120 2959 1346 gene locus_tag LOCUS_43350 2959 1346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920443.1 protein_id gnl|my_center|LOCUS_43350 3519 3863 gene locus_tag LOCUS_43360 3519 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 4826 3996 gene locus_tag LOCUS_43370 4826 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 5084 5398 gene locus_tag LOCUS_43380 5084 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43380 5374 6285 gene locus_tag LOCUS_43390 5374 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43390 6415 8619 gene locus_tag LOCUS_43400 6415 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 8811 10004 gene locus_tag LOCUS_43410 8811 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 10001 12325 gene locus_tag LOCUS_43420 10001 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 12332 14947 gene locus_tag LOCUS_43430 12332 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 14960 16774 gene locus_tag LOCUS_43440 14960 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 16771 18762 gene locus_tag LOCUS_43450 16771 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 19966 18995 gene locus_tag LOCUS_43460 19966 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 21516 20110 gene locus_tag LOCUS_43470 21516 20110 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_43470 22400 21513 gene locus_tag LOCUS_43480 22400 21513 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539567.1 protein_id gnl|my_center|LOCUS_43480 22621 25581 gene locus_tag LOCUS_43490 22621 25581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence121 788 108 gene locus_tag LOCUS_43500 788 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 1588 785 gene locus_tag LOCUS_43510 1588 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 3234 1846 gene locus_tag LOCUS_43520 3234 1846 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_43520 3644 3985 gene locus_tag LOCUS_43530 3644 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_43530 4083 6854 gene locus_tag LOCUS_43540 4083 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 8034 6979 gene locus_tag LOCUS_43550 8034 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 8263 11766 gene locus_tag LOCUS_43560 8263 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 11799 15356 gene locus_tag LOCUS_43570 11799 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 15427 16095 gene locus_tag LOCUS_43580 15427 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 17454 16204 gene locus_tag LOCUS_43590 17454 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 17549 17851 gene locus_tag LOCUS_43600 17549 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 17848 19065 gene locus_tag LOCUS_43610 17848 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43610 18972 19190 gene locus_tag LOCUS_43620 18972 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43620 19476 19234 gene locus_tag LOCUS_43630 19476 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 19379 22729 gene locus_tag LOCUS_43640 19379 22729 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_43640 >Feature sequence122 <1 10090 gene locus_tag LOCUS_43650 <1 10090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205578.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase 10225 15129 gene locus_tag LOCUS_43660 10225 15129 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973246.1 protein_id gnl|my_center|LOCUS_43660 15268 24867 gene locus_tag LOCUS_43670 15268 24867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence123 112 609 gene locus_tag LOCUS_43680 112 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346868.1 protein_id gnl|my_center|LOCUS_43680 630 1604 gene locus_tag LOCUS_43690 gene tnpA 630 1604 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213218.1 protein_id gnl|my_center|LOCUS_43690 2819 1860 gene locus_tag LOCUS_43700 2819 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 4255 3041 gene locus_tag LOCUS_43710 4255 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 4920 6023 gene locus_tag LOCUS_43720 4920 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 7253 6204 gene locus_tag LOCUS_43730 7253 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 7708 8100 gene locus_tag LOCUS_43740 7708 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 9283 8198 gene locus_tag LOCUS_43750 9283 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 9544 10221 gene locus_tag LOCUS_43760 9544 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 10918 10235 gene locus_tag LOCUS_43770 10918 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_43770 10875 11054 gene locus_tag LOCUS_43780 10875 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 12372 11047 gene locus_tag LOCUS_43790 gene gcdH 12372 11047 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402902.1 protein_id gnl|my_center|LOCUS_43790 12919 13593 gene locus_tag LOCUS_43800 12919 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 13662 13904 gene locus_tag LOCUS_43810 13662 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 14090 15613 gene locus_tag LOCUS_43820 14090 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 16134 16424 gene locus_tag LOCUS_43830 16134 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 16576 17904 gene locus_tag LOCUS_43840 16576 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 19587 17965 gene locus_tag LOCUS_43850 19587 17965 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_43850 19681 19893 gene locus_tag LOCUS_43860 19681 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 19998 20573 gene locus_tag LOCUS_43870 19998 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 22275 20578 gene locus_tag LOCUS_43880 22275 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_43880 23120 22380 gene locus_tag LOCUS_43890 23120 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 23300 23797 gene locus_tag LOCUS_43900 23300 23797 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192835.1 protein_id gnl|my_center|LOCUS_43900 23790 24545 gene locus_tag LOCUS_43910 23790 24545 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_43910 >Feature sequence124 1630 1166 gene locus_tag LOCUS_43920 1630 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5470 1661 gene locus_tag LOCUS_43930 5470 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 18369 5467 gene locus_tag LOCUS_43940 18369 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 18511 18936 gene locus_tag LOCUS_43950 18511 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 19090 19305 gene locus_tag LOCUS_43960 19090 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 20512 19601 gene locus_tag LOCUS_43970 20512 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 22288 21965 gene locus_tag LOCUS_43980 22288 21965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 23046 22285 gene locus_tag LOCUS_43990 23046 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 24536 23043 gene locus_tag LOCUS_44000 24536 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence125 <1 2100 gene locus_tag LOCUS_44010 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_296368.1:CheA-related protein 2097 2555 gene locus_tag LOCUS_44020 2097 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 2555 3115 gene locus_tag LOCUS_44030 2555 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 3112 3915 gene locus_tag LOCUS_44040 3112 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 3915 4871 gene locus_tag LOCUS_44050 3915 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 7077 4993 gene locus_tag LOCUS_44060 7077 4993 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_44060 7399 7097 gene locus_tag LOCUS_44070 7399 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 7656 8675 gene locus_tag LOCUS_44080 7656 8675 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_44080 8675 9415 gene locus_tag LOCUS_44090 8675 9415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_44090 9422 11014 gene locus_tag LOCUS_44100 9422 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_44100 11017 12426 gene locus_tag LOCUS_44110 11017 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 13521 12643 gene locus_tag LOCUS_44120 13521 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 13523 13870 gene locus_tag LOCUS_44130 13523 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 18150 13813 gene locus_tag LOCUS_44140 18150 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 20391 18628 gene locus_tag LOCUS_44150 20391 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 20704 21468 gene locus_tag LOCUS_44160 gene nodW 20704 21468 CDS product nodulation protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15940 protein_id gnl|my_center|LOCUS_44160 21909 21586 gene locus_tag LOCUS_44170 21909 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 22690 21974 gene locus_tag LOCUS_44180 22690 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 22968 24164 gene locus_tag LOCUS_44190 22968 24164 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_44190 24440 24341 gene locus_tag LOCUS_t00640 24440 24341 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 303 554 gene locus_tag LOCUS_44200 303 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 2386 539 gene locus_tag LOCUS_44210 2386 539 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_44210 3612 2383 gene locus_tag LOCUS_44220 3612 2383 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_44220 4383 3634 gene locus_tag LOCUS_44230 4383 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 4751 6703 gene locus_tag LOCUS_44240 4751 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 6759 8657 gene locus_tag LOCUS_44250 6759 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 8679 9830 gene locus_tag LOCUS_44260 8679 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 10059 11078 gene locus_tag LOCUS_44270 10059 11078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_44270 11075 11827 gene locus_tag LOCUS_44280 11075 11827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_44280 11838 13871 gene locus_tag LOCUS_44290 11838 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 13868 15040 gene locus_tag LOCUS_44300 13868 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 15718 16866 gene locus_tag LOCUS_44310 15718 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 17797 16916 gene locus_tag LOCUS_44320 17797 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 18960 17797 gene locus_tag LOCUS_44330 18960 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 20723 18975 gene locus_tag LOCUS_44340 20723 18975 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_44340 20920 21294 gene locus_tag LOCUS_44350 20920 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 21457 23139 gene locus_tag LOCUS_44360 21457 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 <24311 23223 gene locus_tag LOCUS_44370 <24311 23223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030528.1:protease >Feature sequence127 3896 1047 gene locus_tag LOCUS_44380 3896 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 4016 4441 gene locus_tag LOCUS_44390 gene apaG 4016 4441 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_44390 6028 4502 gene locus_tag LOCUS_44400 gene rtcB 6028 4502 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULP9 protein_id gnl|my_center|LOCUS_44400 6619 7353 gene locus_tag LOCUS_44410 6619 7353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972333.1 protein_id gnl|my_center|LOCUS_44410 7415 8050 gene locus_tag LOCUS_44420 gene pmtA 7415 8050 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_44420 8084 8785 gene locus_tag LOCUS_44430 8084 8785 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_44430 8884 11931 gene locus_tag LOCUS_44440 8884 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_44440 12134 13132 gene locus_tag LOCUS_44450 12134 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 13129 16020 gene locus_tag LOCUS_44460 13129 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 16296 18176 gene locus_tag LOCUS_44470 16296 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 18464 18388 gene locus_tag LOCUS_t00650 18464 18388 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21117 18595 gene locus_tag LOCUS_44480 21117 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 22446 21124 gene locus_tag LOCUS_44490 22446 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 >Feature sequence128 527 1063 gene locus_tag LOCUS_44500 527 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 1051 2091 gene locus_tag LOCUS_44510 1051 2091 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918898.1 protein_id gnl|my_center|LOCUS_44510 2088 4241 gene locus_tag LOCUS_44520 2088 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 4725 4291 gene locus_tag LOCUS_44530 4725 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 5542 4736 gene locus_tag LOCUS_44540 5542 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 5849 5607 gene locus_tag LOCUS_44550 5849 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 6663 6016 gene locus_tag LOCUS_44560 6663 6016 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_44560 7133 6774 gene locus_tag LOCUS_44570 7133 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 7833 7138 gene locus_tag LOCUS_44580 7833 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 8202 7855 gene locus_tag LOCUS_44590 8202 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 9941 9006 gene locus_tag LOCUS_44600 9941 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 12866 10182 gene locus_tag LOCUS_44610 12866 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 13607 12873 gene locus_tag LOCUS_44620 13607 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_44620 14217 13684 gene locus_tag LOCUS_44630 14217 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 15099 14257 gene locus_tag LOCUS_44640 15099 14257 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_44640 16179 15391 gene locus_tag LOCUS_44650 16179 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 17227 16172 gene locus_tag LOCUS_44660 17227 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 17790 17224 gene locus_tag LOCUS_44670 17790 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 18050 17787 gene locus_tag LOCUS_44680 18050 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 18450 20066 gene locus_tag LOCUS_44690 18450 20066 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_44690 20130 20591 gene locus_tag LOCUS_44700 20130 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_44700 20713 21267 gene locus_tag LOCUS_44710 20713 21267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 21755 23302 gene locus_tag LOCUS_44720 21755 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence129 3083 3988 gene locus_tag LOCUS_44730 3083 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 3985 4755 gene locus_tag LOCUS_44740 gene cobB1 3985 4755 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_44740 6734 4746 gene locus_tag LOCUS_44750 6734 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 7004 9064 gene locus_tag LOCUS_44760 7004 9064 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_44760 10163 9162 gene locus_tag LOCUS_44770 10163 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_44770 10919 12652 gene locus_tag LOCUS_44780 10919 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 13197 12595 gene locus_tag LOCUS_44790 13197 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 14138 13194 gene locus_tag LOCUS_44800 14138 13194 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_44800 14148 15587 gene locus_tag LOCUS_44810 14148 15587 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMG8 protein_id gnl|my_center|LOCUS_44810 15600 16352 gene locus_tag LOCUS_44820 15600 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 16468 17451 gene locus_tag LOCUS_44830 gene glyQ 16468 17451 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94616 protein_id gnl|my_center|LOCUS_44830 17444 19591 gene locus_tag LOCUS_44840 gene glyS 17444 19591 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM7 protein_id gnl|my_center|LOCUS_44840 19558 21564 gene locus_tag LOCUS_44850 gene mutL 19558 21564 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R59 protein_id gnl|my_center|LOCUS_44850 >Feature sequence130 104 1240 gene locus_tag LOCUS_44860 104 1240 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_44860 2601 1237 gene locus_tag LOCUS_44870 2601 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5207 2598 gene locus_tag LOCUS_44880 5207 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 6613 5204 gene locus_tag LOCUS_44890 gene fadD 6613 5204 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_44890 6849 7817 gene locus_tag LOCUS_44900 6849 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 8199 7852 gene locus_tag LOCUS_44910 gene ytxJ 8199 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39914 protein_id gnl|my_center|LOCUS_44910 8492 9130 gene locus_tag LOCUS_44920 8492 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 9318 11924 gene locus_tag LOCUS_44930 9318 11924 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_44930 12372 12935 gene locus_tag LOCUS_44940 gene infC 12372 12935 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_44940 13851 13036 gene locus_tag LOCUS_44950 13851 13036 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_44950 15829 13865 gene locus_tag LOCUS_44960 gene metG 15829 13865 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF2 protein_id gnl|my_center|LOCUS_44960 16831 15941 gene locus_tag LOCUS_44970 16831 15941 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_44970 17867 16989 gene locus_tag LOCUS_44980 17867 16989 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAJ7 protein_id gnl|my_center|LOCUS_44980 18099 19013 gene locus_tag LOCUS_44990 18099 19013 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_44990 19311 21038 gene locus_tag LOCUS_45000 19311 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 21095 22897 gene locus_tag LOCUS_45010 21095 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 >Feature sequence131 1177 1812 gene locus_tag LOCUS_45020 1177 1812 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_45020 1852 4641 gene locus_tag LOCUS_45030 1852 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 5186 5869 gene locus_tag LOCUS_45040 5186 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 9290 5931 gene locus_tag LOCUS_45050 9290 5931 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037971.1 protein_id gnl|my_center|LOCUS_45050 9691 14316 gene locus_tag LOCUS_45060 9691 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 17617 14390 gene locus_tag LOCUS_45070 17617 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 18825 20786 gene locus_tag LOCUS_45080 gene mdlC 18825 20786 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_102164.2 protein_id gnl|my_center|LOCUS_45080 20859 22466 gene locus_tag LOCUS_45090 20859 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 23202 22621 gene locus_tag LOCUS_45100 23202 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence132 1426 194 gene locus_tag LOCUS_45110 1426 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 1995 1423 gene locus_tag LOCUS_45120 1995 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45120 4552 1976 gene locus_tag LOCUS_45130 4552 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 5007 4552 gene locus_tag LOCUS_45140 5007 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 5345 5004 gene locus_tag LOCUS_45150 5345 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 6882 5347 gene locus_tag LOCUS_45160 6882 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 7604 6879 gene locus_tag LOCUS_45170 7604 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 9362 8883 gene locus_tag LOCUS_45180 9362 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 10567 9362 gene locus_tag LOCUS_45190 10567 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 11300 10569 gene locus_tag LOCUS_45200 11300 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 12349 11528 gene locus_tag LOCUS_45210 12349 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 12963 12349 gene locus_tag LOCUS_45220 12963 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 13532 16507 gene locus_tag LOCUS_45230 13532 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 16685 18034 gene locus_tag LOCUS_45240 gene gdhA 16685 18034 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY71 protein_id gnl|my_center|LOCUS_45240 18179 18457 gene locus_tag LOCUS_45250 18179 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 18558 19010 gene locus_tag LOCUS_45260 18558 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 22063 19319 gene locus_tag LOCUS_45270 22063 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence133 1468 404 gene locus_tag LOCUS_45280 1468 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 3199 3825 gene locus_tag LOCUS_45290 3199 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 3822 4487 gene locus_tag LOCUS_45300 3822 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 4722 5546 gene locus_tag LOCUS_45310 4722 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 6977 5571 gene locus_tag LOCUS_45320 6977 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 8779 6959 gene locus_tag LOCUS_45330 8779 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 9217 11880 gene locus_tag LOCUS_45340 9217 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 11944 14613 gene locus_tag LOCUS_45350 11944 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 14694 16298 gene locus_tag LOCUS_45360 14694 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 16300 16959 gene locus_tag LOCUS_45370 16300 16959 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_45370 19644 17014 gene locus_tag LOCUS_45380 19644 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 19931 20518 gene locus_tag LOCUS_45390 19931 20518 CDS product putative resolvase/invertase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700708.1 protein_id gnl|my_center|LOCUS_45390 20743 22629 gene locus_tag LOCUS_45400 20743 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence134 588 223 gene locus_tag LOCUS_45410 588 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 909 1790 gene locus_tag LOCUS_45420 909 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 4288 1967 gene locus_tag LOCUS_45430 4288 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 5605 4622 gene locus_tag LOCUS_45440 gene xerD 5605 4622 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5V0 protein_id gnl|my_center|LOCUS_45440 5832 8294 gene locus_tag LOCUS_45450 5832 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_45450 8408 9586 gene locus_tag LOCUS_45460 8408 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 10809 10357 gene locus_tag LOCUS_45470 10809 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 11455 10793 gene locus_tag LOCUS_45480 11455 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 11918 13054 gene locus_tag LOCUS_45490 11918 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 13129 14187 gene locus_tag LOCUS_45500 13129 14187 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_45500 14273 15322 gene locus_tag LOCUS_45510 14273 15322 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870414.1 protein_id gnl|my_center|LOCUS_45510 15606 16229 gene locus_tag LOCUS_45520 15606 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 16272 16571 gene locus_tag LOCUS_45530 16272 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 16610 18100 gene locus_tag LOCUS_45540 16610 18100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 20890 18119 gene locus_tag LOCUS_45550 20890 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 20962 21044 gene locus_tag LOCUS_t00660 20962 21044 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21115 21199 gene locus_tag LOCUS_t00670 21115 21199 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 2666 957 gene locus_tag LOCUS_45560 2666 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_45560 2948 3376 gene locus_tag LOCUS_45570 2948 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 4882 3431 gene locus_tag LOCUS_45580 4882 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 6239 4884 gene locus_tag LOCUS_45590 6239 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225428.1 protein_id gnl|my_center|LOCUS_45590 6667 6401 gene locus_tag LOCUS_45600 6667 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 7030 6743 gene locus_tag LOCUS_45610 7030 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 8193 7174 gene locus_tag LOCUS_45620 8193 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 9777 8236 gene locus_tag LOCUS_45630 9777 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 11148 10015 gene locus_tag LOCUS_45640 11148 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 13121 11187 gene locus_tag LOCUS_45650 13121 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 14585 13155 gene locus_tag LOCUS_45660 14585 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 15550 14582 gene locus_tag LOCUS_45670 gene moxR 15550 14582 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_45670 17644 15734 gene locus_tag LOCUS_45680 17644 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 18570 17641 gene locus_tag LOCUS_45690 18570 17641 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_45690 18943 18602 gene locus_tag LOCUS_45700 18943 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 19475 18999 gene locus_tag LOCUS_45710 19475 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 19900 21123 gene locus_tag LOCUS_45720 19900 21123 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_45720 21123 22106 gene locus_tag LOCUS_45730 21123 22106 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_45730 >Feature sequence136 1367 3325 gene locus_tag LOCUS_45740 1367 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 3819 3337 gene locus_tag LOCUS_45750 3819 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 4177 4752 gene locus_tag LOCUS_45760 4177 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 4839 5498 gene locus_tag LOCUS_45770 4839 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5707 6594 gene locus_tag LOCUS_45780 5707 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_45780 7345 6689 gene locus_tag LOCUS_45790 7345 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 7557 7342 gene locus_tag LOCUS_45800 7557 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 7916 7521 gene locus_tag LOCUS_45810 7916 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 9446 7950 gene locus_tag LOCUS_45820 9446 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 9942 9565 gene locus_tag LOCUS_45830 9942 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 10980 10075 gene locus_tag LOCUS_45840 10980 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 11208 11639 gene locus_tag LOCUS_45850 11208 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 11726 12595 gene locus_tag LOCUS_45860 11726 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 15361 12683 gene locus_tag LOCUS_45870 gene valS 15361 12683 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF0 protein_id gnl|my_center|LOCUS_45870 15853 15521 gene locus_tag LOCUS_45880 15853 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669387.1 protein_id gnl|my_center|LOCUS_45880 16184 16843 gene locus_tag LOCUS_45890 gene upp 16184 16843 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_45890 16847 18079 gene locus_tag LOCUS_45900 16847 18079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 18159 19106 gene locus_tag LOCUS_45910 18159 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 19448 20029 gene locus_tag LOCUS_45920 19448 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 20166 20570 gene locus_tag LOCUS_45930 20166 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 20689 20922 gene locus_tag LOCUS_45940 20689 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 21305 20919 gene locus_tag LOCUS_45950 21305 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 >Feature sequence137 1077 1541 gene locus_tag LOCUS_45960 1077 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 2376 1597 gene locus_tag LOCUS_45970 2376 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 3413 2616 gene locus_tag LOCUS_45980 3413 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 3888 5399 gene locus_tag LOCUS_45990 3888 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 5739 5467 gene locus_tag LOCUS_46000 5739 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 5911 6084 gene locus_tag LOCUS_46010 5911 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 7230 6124 gene locus_tag LOCUS_46020 7230 6124 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_46020 7422 9086 gene locus_tag LOCUS_46030 7422 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 9165 10973 gene locus_tag LOCUS_46040 9165 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 11076 11771 gene locus_tag LOCUS_46050 gene qseB 11076 11771 CDS product transcriptional regulatory protein QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52076 protein_id gnl|my_center|LOCUS_46050 11768 13018 gene locus_tag LOCUS_46060 11768 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 13578 13045 gene locus_tag LOCUS_46070 13578 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 16707 13981 gene locus_tag LOCUS_46080 16707 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 17388 18359 gene locus_tag LOCUS_46090 17388 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 20127 18769 gene locus_tag LOCUS_46100 20127 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 20647 21459 gene locus_tag LOCUS_46110 20647 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence138 <1 2520 gene locus_tag LOCUS_46120 <1 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWB8:nuclease SbcCD subunit C 2605 3564 gene locus_tag LOCUS_46130 2605 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 3933 5261 gene locus_tag LOCUS_46140 3933 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 5399 5181 gene locus_tag LOCUS_46150 5399 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 5355 6131 gene locus_tag LOCUS_46160 5355 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 6128 7459 gene locus_tag LOCUS_46170 6128 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 8818 7466 gene locus_tag LOCUS_46180 8818 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_46180 9564 8878 gene locus_tag LOCUS_46190 9564 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 11193 9706 gene locus_tag LOCUS_46200 11193 9706 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_46200 11424 15182 gene locus_tag LOCUS_46210 gene smc 11424 15182 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCY0 protein_id gnl|my_center|LOCUS_46210 15217 16233 gene locus_tag LOCUS_46220 gene ansA 15217 16233 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_46220 16536 16832 gene locus_tag LOCUS_46230 16536 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 18080 17109 gene locus_tag LOCUS_46240 18080 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 19085 18288 gene locus_tag LOCUS_46250 gene trpA 19085 18288 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_46250 20389 19082 gene locus_tag LOCUS_46260 gene trpB1 20389 19082 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_46260 21098 20364 gene locus_tag LOCUS_46270 gene trpF 21098 20364 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_46270 21913 21095 gene locus_tag LOCUS_46280 gene trpC 21913 21095 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT7 protein_id gnl|my_center|LOCUS_46280 >Feature sequence139 <1 921 gene locus_tag LOCUS_46290 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter 1093 1926 gene locus_tag LOCUS_46300 1093 1926 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_46300 1929 2585 gene locus_tag LOCUS_46310 1929 2585 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933742.1 protein_id gnl|my_center|LOCUS_46310 2600 4075 gene locus_tag LOCUS_46320 2600 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 5312 4092 gene locus_tag LOCUS_46330 5312 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 5840 6562 gene locus_tag LOCUS_46340 5840 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 7367 6597 gene locus_tag LOCUS_46350 7367 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 9224 7605 gene locus_tag LOCUS_46360 9224 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 9360 9893 gene locus_tag LOCUS_46370 9360 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 9890 10666 gene locus_tag LOCUS_46380 gene tatC 9890 10666 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_46380 10901 14893 gene locus_tag LOCUS_46390 10901 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 15946 15518 gene locus_tag LOCUS_46400 gene speH 15946 15518 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC3 protein_id gnl|my_center|LOCUS_46400 16700 15975 gene locus_tag LOCUS_46410 16700 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_46410 17138 16728 gene locus_tag LOCUS_46420 17138 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 17666 17268 gene locus_tag LOCUS_46430 17666 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 18730 17714 gene locus_tag LOCUS_46440 gene kch 18730 17714 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_46440 19656 18796 gene locus_tag LOCUS_46450 19656 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 20419 19667 gene locus_tag LOCUS_46460 20419 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 20967 20416 gene locus_tag LOCUS_46470 20967 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence140 1886 2104 gene locus_tag LOCUS_46480 1886 2104 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_46480 2305 2925 gene locus_tag LOCUS_46490 2305 2925 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_46490 3130 4041 gene locus_tag LOCUS_46500 gene paaH 3130 4041 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_46500 4130 4387 gene locus_tag LOCUS_46510 4130 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225913.1 protein_id gnl|my_center|LOCUS_46510 4421 5617 gene locus_tag LOCUS_46520 4421 5617 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225912.1 protein_id gnl|my_center|LOCUS_46520 5620 6708 gene locus_tag LOCUS_46530 5620 6708 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225911.1 protein_id gnl|my_center|LOCUS_46530 6858 8417 gene locus_tag LOCUS_46540 6858 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 8474 9910 gene locus_tag LOCUS_46550 8474 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_46550 9956 12394 gene locus_tag LOCUS_46560 9956 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_46560 12437 13255 gene locus_tag LOCUS_46570 12437 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043753.1 protein_id gnl|my_center|LOCUS_46570 14908 13259 gene locus_tag LOCUS_46580 14908 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 14955 17165 gene locus_tag LOCUS_46590 14955 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 18745 17213 gene locus_tag LOCUS_46600 18745 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 19810 19082 gene locus_tag LOCUS_46610 19810 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 20056 19913 gene locus_tag LOCUS_46620 20056 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 21180 20365 gene locus_tag LOCUS_46630 21180 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence141 <1 1404 gene locus_tag LOCUS_46640 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867911.1:uracil permease 2036 1422 gene locus_tag LOCUS_46650 2036 1422 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_46650 5356 2033 gene locus_tag LOCUS_46660 5356 2033 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_46660 5685 5963 gene locus_tag LOCUS_46670 5685 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 6347 6901 gene locus_tag LOCUS_46680 6347 6901 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_46680 8066 6975 gene locus_tag LOCUS_46690 8066 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 9078 8206 gene locus_tag LOCUS_46700 gene suhB 9078 8206 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_46700 10379 9078 gene locus_tag LOCUS_46710 gene pyrC 10379 9078 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_46710 11329 10376 gene locus_tag LOCUS_46720 gene pyrB 11329 10376 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_46720 11921 11331 gene locus_tag LOCUS_46730 gene pyrR 11921 11331 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVB9 protein_id gnl|my_center|LOCUS_46730 12134 12718 gene locus_tag LOCUS_46740 12134 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 12718 13350 gene locus_tag LOCUS_46750 12718 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 14808 13414 gene locus_tag LOCUS_46760 14808 13414 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_46760 16249 14846 gene locus_tag LOCUS_46770 gene allB 16249 14846 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKU5 protein_id gnl|my_center|LOCUS_46770 18399 16246 gene locus_tag LOCUS_46780 18399 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 21239 18396 gene locus_tag LOCUS_46790 21239 18396 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence142 2070 22 gene locus_tag LOCUS_46800 2070 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 2096 2395 gene locus_tag LOCUS_46810 2096 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 2395 3474 gene locus_tag LOCUS_46820 2395 3474 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_46820 5280 3532 gene locus_tag LOCUS_46830 5280 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 6272 5397 gene locus_tag LOCUS_46840 6272 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 6674 6279 gene locus_tag LOCUS_46850 6674 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 8934 6709 gene locus_tag LOCUS_46860 8934 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 9197 10321 gene locus_tag LOCUS_46870 9197 10321 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGN4 protein_id gnl|my_center|LOCUS_46870 10371 11582 gene locus_tag LOCUS_46880 10371 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 11787 14897 gene locus_tag LOCUS_46890 11787 14897 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_46890 14897 16225 gene locus_tag LOCUS_46900 14897 16225 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_46900 16426 20529 gene locus_tag LOCUS_46910 16426 20529 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_46910 21092 20562 gene locus_tag LOCUS_46920 21092 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 >Feature sequence143 1608 3308 gene locus_tag LOCUS_46930 1608 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 4160 3333 gene locus_tag LOCUS_46940 4160 3333 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_46940 4397 5611 gene locus_tag LOCUS_46950 4397 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_46950 7135 5615 gene locus_tag LOCUS_46960 7135 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 7635 7309 gene locus_tag LOCUS_46970 7635 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 8549 8091 gene locus_tag LOCUS_46980 8549 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 10242 8569 gene locus_tag LOCUS_46990 10242 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 10949 10431 gene locus_tag LOCUS_47000 10949 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 11350 10946 gene locus_tag LOCUS_47010 11350 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 13456 11594 gene locus_tag LOCUS_47020 13456 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 16486 13619 gene locus_tag LOCUS_47030 16486 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 16991 16488 gene locus_tag LOCUS_47040 16991 16488 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_47040 17983 17147 gene locus_tag LOCUS_47050 17983 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 19068 18091 gene locus_tag LOCUS_47060 19068 18091 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228002.1 protein_id gnl|my_center|LOCUS_47060 19229 19684 gene locus_tag LOCUS_47070 19229 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 20643 20299 gene locus_tag LOCUS_47080 20643 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 20936 20748 gene locus_tag LOCUS_47090 20936 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 >Feature sequence144 635 369 gene locus_tag LOCUS_47100 635 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1374 622 gene locus_tag LOCUS_47110 1374 622 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_47110 1910 2410 gene locus_tag LOCUS_47120 1910 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 2954 2685 gene locus_tag LOCUS_47130 2954 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 3187 4137 gene locus_tag LOCUS_47140 gene catE 3187 4137 CDS product catechol-2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54721 protein_id gnl|my_center|LOCUS_47140 4367 5002 gene locus_tag LOCUS_47150 4367 5002 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_47150 5010 7595 gene locus_tag LOCUS_47160 5010 7595 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_47160 8517 7570 gene locus_tag LOCUS_47170 8517 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 10098 8647 gene locus_tag LOCUS_47180 10098 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_47180 10899 10120 gene locus_tag LOCUS_47190 10899 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 11809 11030 gene locus_tag LOCUS_47200 11809 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 12107 12706 gene locus_tag LOCUS_47210 12107 12706 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 protein_id gnl|my_center|LOCUS_47210 12718 16425 gene locus_tag LOCUS_47220 12718 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_47220 16445 17356 gene locus_tag LOCUS_47230 16445 17356 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_47230 18469 17360 gene locus_tag LOCUS_47240 18469 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702631.1 protein_id gnl|my_center|LOCUS_47240 19536 18478 gene locus_tag LOCUS_47250 19536 18478 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_47250 20012 19641 gene locus_tag LOCUS_47260 20012 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 <20892 20053 gene locus_tag LOCUS_47270 <20892 20053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877095.1:serine/threonine protein kinase >Feature sequence145 1549 1244 gene locus_tag LOCUS_47280 1549 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 1881 4100 gene locus_tag LOCUS_47290 gene icd 1881 4100 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_47290 4240 5175 gene locus_tag LOCUS_47300 4240 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122551.1 protein_id gnl|my_center|LOCUS_47300 6765 5269 gene locus_tag LOCUS_47310 6765 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 8242 7007 gene locus_tag LOCUS_47320 8242 7007 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_47320 9562 8333 gene locus_tag LOCUS_47330 9562 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_47330 10700 9591 gene locus_tag LOCUS_47340 10700 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 10921 11166 gene locus_tag LOCUS_47350 10921 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 13677 11230 gene locus_tag LOCUS_47360 13677 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 14288 13674 gene locus_tag LOCUS_47370 14288 13674 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_47370 15267 14734 gene locus_tag LOCUS_47380 15267 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 15613 16857 gene locus_tag LOCUS_47390 15613 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 16860 18179 gene locus_tag LOCUS_47400 16860 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 >Feature sequence146 1548 2222 gene locus_tag LOCUS_47410 1548 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 3674 2244 gene locus_tag LOCUS_47420 3674 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 4506 3682 gene locus_tag LOCUS_47430 4506 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 6542 4890 gene locus_tag LOCUS_47440 6542 4890 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_47440 7321 6662 gene locus_tag LOCUS_47450 7321 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 10109 7455 gene locus_tag LOCUS_47460 10109 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 10720 10112 gene locus_tag LOCUS_47470 10720 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 11122 11430 gene locus_tag LOCUS_47480 11122 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 11837 12538 gene locus_tag LOCUS_47490 11837 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 12664 14751 gene locus_tag LOCUS_47500 12664 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 15018 17408 gene locus_tag LOCUS_47510 15018 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_47510 17405 19210 gene locus_tag LOCUS_47520 17405 19210 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 protein_id gnl|my_center|LOCUS_47520 20324 19629 gene locus_tag LOCUS_47530 20324 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 >Feature sequence147 <1 659 gene locus_tag LOCUS_47540 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54531:leucine dehydrogenase 1343 2641 gene locus_tag LOCUS_47550 gene mntH 1343 2641 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_47550 3180 2614 gene locus_tag LOCUS_47560 3180 2614 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 protein_id gnl|my_center|LOCUS_47560 4451 3177 gene locus_tag LOCUS_47570 4451 3177 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_47570 5295 4594 gene locus_tag LOCUS_47580 5295 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 6401 5310 gene locus_tag LOCUS_47590 6401 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_47590 6575 7606 gene locus_tag LOCUS_47600 6575 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 8966 7713 gene locus_tag LOCUS_47610 gene coaBC 8966 7713 CDS product peptidase ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_47610 12530 9060 gene locus_tag LOCUS_47620 12530 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 14623 12794 gene locus_tag LOCUS_47630 14623 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 14990 16273 gene locus_tag LOCUS_47640 14990 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 16643 16281 gene locus_tag LOCUS_47650 16643 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 17155 18987 gene locus_tag LOCUS_47660 17155 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 >Feature sequence148 1669 161 gene locus_tag LOCUS_47670 1669 161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369856.1 protein_id gnl|my_center|LOCUS_47670 2250 2174 gene locus_tag LOCUS_t00680 2250 2174 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2669 3802 gene locus_tag LOCUS_47680 2669 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 4776 3913 gene locus_tag LOCUS_47690 gene prpC 4776 3913 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_47690 5459 4776 gene locus_tag LOCUS_47700 5459 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 6594 5563 gene locus_tag LOCUS_47710 6594 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 7548 6607 gene locus_tag LOCUS_47720 gene rodZ 7548 6607 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII0 protein_id gnl|my_center|LOCUS_47720 8736 7873 gene locus_tag LOCUS_47730 8736 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 8883 10994 gene locus_tag LOCUS_47740 gene greA 8883 10994 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7G4 protein_id gnl|my_center|LOCUS_47740 11162 11518 gene locus_tag LOCUS_47750 11162 11518 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_47750 11518 12816 gene locus_tag LOCUS_47760 11518 12816 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_47760 13554 12898 gene locus_tag LOCUS_47770 13554 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 13824 16070 gene locus_tag LOCUS_47780 13824 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 17402 16347 gene locus_tag LOCUS_47790 17402 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 18617 17643 gene locus_tag LOCUS_47800 18617 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_47800 19188 18691 gene locus_tag LOCUS_47810 19188 18691 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_47810 >Feature sequence149 <1 3588 gene locus_tag LOCUS_47820 <1 3588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108517.1:hybrid sensor histidine kinase/response regulator 5257 3605 gene locus_tag LOCUS_47830 5257 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 10348 5528 gene locus_tag LOCUS_47840 10348 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 11116 14283 gene locus_tag LOCUS_47850 11116 14283 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_47850 14411 15979 gene locus_tag LOCUS_47860 14411 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 15976 19128 gene locus_tag LOCUS_47870 15976 19128 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_47870 19234 20160 gene locus_tag LOCUS_47880 19234 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_47880 >Feature sequence150 289 2994 gene locus_tag LOCUS_47890 gene topA 289 2994 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV5 protein_id gnl|my_center|LOCUS_47890 3237 4139 gene locus_tag LOCUS_47900 3237 4139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402933.1 protein_id gnl|my_center|LOCUS_47900 4141 6942 gene locus_tag LOCUS_47910 4141 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 6942 7706 gene locus_tag LOCUS_47920 6942 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 7716 8846 gene locus_tag LOCUS_47930 gene mexH 7716 8846 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_47930 8847 11849 gene locus_tag LOCUS_47940 8847 11849 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_47940 11846 15724 gene locus_tag LOCUS_47950 11846 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 17233 15773 gene locus_tag LOCUS_47960 17233 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 18069 17251 gene locus_tag LOCUS_47970 18069 17251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_47970 18826 18077 gene locus_tag LOCUS_47980 18826 18077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_47980 19791 18913 gene locus_tag LOCUS_47990 19791 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 >Feature sequence151 252 168 gene locus_tag LOCUS_t00690 252 168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 571 496 gene locus_tag LOCUS_t00700 571 496 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 876 652 gene locus_tag LOCUS_48000 gene thiS 876 652 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051161.1 protein_id gnl|my_center|LOCUS_48000 1567 923 gene locus_tag LOCUS_48010 1567 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 2449 1772 gene locus_tag LOCUS_48020 2449 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 3264 2446 gene locus_tag LOCUS_48030 gene coaX 3264 2446 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPV1 protein_id gnl|my_center|LOCUS_48030 4065 3280 gene locus_tag LOCUS_48040 4065 3280 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458952.1 protein_id gnl|my_center|LOCUS_48040 5074 4148 gene locus_tag LOCUS_48050 5074 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 8559 5221 gene locus_tag LOCUS_48060 gene mcm 8559 5221 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_48060 8740 8597 gene locus_tag LOCUS_48070 8740 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 9997 8855 gene locus_tag LOCUS_48080 9997 8855 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_48080 11150 10008 gene locus_tag LOCUS_48090 11150 10008 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_48090 11541 12560 gene locus_tag LOCUS_48100 11541 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 12557 13267 gene locus_tag LOCUS_48110 12557 13267 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_48110 13535 14440 gene locus_tag LOCUS_48120 gene desC 13535 14440 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_48120 15057 14476 gene locus_tag LOCUS_48130 15057 14476 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_48130 15575 16672 gene locus_tag LOCUS_48140 15575 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 16669 17706 gene locus_tag LOCUS_48150 16669 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence152 712 1689 gene locus_tag LOCUS_48160 712 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 4514 2010 gene locus_tag LOCUS_48170 4514 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 6141 4924 gene locus_tag LOCUS_48180 6141 4924 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227368.1 protein_id gnl|my_center|LOCUS_48180 7548 6388 gene locus_tag LOCUS_48190 7548 6388 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227369.1 protein_id gnl|my_center|LOCUS_48190 7865 8842 gene locus_tag LOCUS_48200 7865 8842 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_48200 8839 9687 gene locus_tag LOCUS_48210 8839 9687 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_48210 9721 10938 gene locus_tag LOCUS_48220 9721 10938 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_48220 12738 10987 gene locus_tag LOCUS_48230 12738 10987 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_48230 13156 14496 gene locus_tag LOCUS_48240 13156 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 15730 14624 gene locus_tag LOCUS_48250 15730 14624 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_48250 15908 17395 gene locus_tag LOCUS_48260 15908 17395 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_48260 17594 18367 gene locus_tag LOCUS_48270 17594 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 18800 18399 gene locus_tag LOCUS_48280 18800 18399 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014298.1 protein_id gnl|my_center|LOCUS_48280 19197 19709 gene locus_tag LOCUS_48290 19197 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 >Feature sequence153 142 534 gene locus_tag LOCUS_48300 142 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 531 845 gene locus_tag LOCUS_48310 531 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 1797 916 gene locus_tag LOCUS_48320 1797 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 2024 1794 gene locus_tag LOCUS_48330 2024 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 4363 2135 gene locus_tag LOCUS_48340 4363 2135 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_48340 4644 5000 gene locus_tag LOCUS_48350 4644 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 5013 7583 gene locus_tag LOCUS_48360 5013 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 7583 8752 gene locus_tag LOCUS_48370 7583 8752 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 protein_id gnl|my_center|LOCUS_48370 8749 11865 gene locus_tag LOCUS_48380 8749 11865 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881459.1 protein_id gnl|my_center|LOCUS_48380 11920 12513 gene locus_tag LOCUS_48390 11920 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 12556 13260 gene locus_tag LOCUS_48400 12556 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 13312 13491 gene locus_tag LOCUS_48410 13312 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 14713 13820 gene locus_tag LOCUS_48420 14713 13820 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767788.1 protein_id gnl|my_center|LOCUS_48420 15705 14830 gene locus_tag LOCUS_48430 15705 14830 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403210.1 protein_id gnl|my_center|LOCUS_48430 16178 15705 gene locus_tag LOCUS_48440 16178 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48440 16994 16281 gene locus_tag LOCUS_48450 16994 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48450 18349 16994 gene locus_tag LOCUS_48460 18349 16994 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_48460 <19838 18458 gene locus_tag LOCUS_48470 <19838 18458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000606001.1:choline transporter >Feature sequence154 1562 27 gene locus_tag LOCUS_48480 1562 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 2826 1699 gene locus_tag LOCUS_48490 2826 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 3259 2900 gene locus_tag LOCUS_48500 3259 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 5089 3353 gene locus_tag LOCUS_48510 5089 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 9203 5319 gene locus_tag LOCUS_48520 9203 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 10392 9436 gene locus_tag LOCUS_48530 10392 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 11737 12465 gene locus_tag LOCUS_48540 gene cinA 11737 12465 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_48540 12545 13183 gene locus_tag LOCUS_48550 12545 13183 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_48550 14946 13255 gene locus_tag LOCUS_48560 14946 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 15209 17227 gene locus_tag LOCUS_48570 gene nadE 15209 17227 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_48570 18217 17324 gene locus_tag LOCUS_48580 gene purC 18217 17324 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_48580 >Feature sequence155 1945 503 gene locus_tag LOCUS_48590 1945 503 CDS product putative Na(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57007 protein_id gnl|my_center|LOCUS_48590 3030 1942 gene locus_tag LOCUS_48600 3030 1942 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089883.1 protein_id gnl|my_center|LOCUS_48600 4370 3717 gene locus_tag LOCUS_48610 4370 3717 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_48610 4589 5074 gene locus_tag LOCUS_48620 4589 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 5512 6558 gene locus_tag LOCUS_48630 gene nadA 5512 6558 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S63 protein_id gnl|my_center|LOCUS_48630 6555 8213 gene locus_tag LOCUS_48640 gene nadB 6555 8213 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R32 protein_id gnl|my_center|LOCUS_48640 8213 9175 gene locus_tag LOCUS_48650 8213 9175 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_48650 9343 9801 gene locus_tag LOCUS_48660 9343 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48660 9877 10020 gene locus_tag LOCUS_48670 9877 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 11446 10055 gene locus_tag LOCUS_48680 11446 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 14270 11475 gene locus_tag LOCUS_48690 14270 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 15070 14468 gene locus_tag LOCUS_48700 15070 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 17887 15209 gene locus_tag LOCUS_48710 17887 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_48710 18207 17884 gene locus_tag LOCUS_48720 18207 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 >Feature sequence156 2647 2973 gene locus_tag LOCUS_48730 2647 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 3141 5420 gene locus_tag LOCUS_48740 3141 5420 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_48740 5423 5956 gene locus_tag LOCUS_48750 5423 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 6108 7235 gene locus_tag LOCUS_48760 gene rp630 6108 7235 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_48760 7348 8385 gene locus_tag LOCUS_48770 7348 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981374.1 protein_id gnl|my_center|LOCUS_48770 9050 8427 gene locus_tag LOCUS_48780 9050 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013465.1 protein_id gnl|my_center|LOCUS_48780 9799 9047 gene locus_tag LOCUS_48790 9799 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 12984 9910 gene locus_tag LOCUS_48800 12984 9910 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_48800 14120 12981 gene locus_tag LOCUS_48810 14120 12981 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_48810 16587 14179 gene locus_tag LOCUS_48820 16587 14179 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_48820 >Feature sequence157 1299 859 gene locus_tag LOCUS_48830 1299 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 1884 1468 gene locus_tag LOCUS_48840 1884 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 2694 1975 gene locus_tag LOCUS_48850 2694 1975 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR95 protein_id gnl|my_center|LOCUS_48850 2945 4537 gene locus_tag LOCUS_48860 2945 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 4534 6027 gene locus_tag LOCUS_48870 4534 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 6143 7333 gene locus_tag LOCUS_48880 6143 7333 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_48880 8776 7451 gene locus_tag LOCUS_48890 8776 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 11388 8863 gene locus_tag LOCUS_48900 11388 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_48900 13097 11535 gene locus_tag LOCUS_48910 13097 11535 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_48910 13266 14207 gene locus_tag LOCUS_48920 13266 14207 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_48920 14249 16153 gene locus_tag LOCUS_48930 14249 16153 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_48930 17504 16266 gene locus_tag LOCUS_48940 17504 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 18208 17582 gene locus_tag LOCUS_48950 18208 17582 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_48950 >Feature sequence158 3521 1008 gene locus_tag LOCUS_48960 3521 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 4689 3811 gene locus_tag LOCUS_48970 4689 3811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_48970 4843 5613 gene locus_tag LOCUS_48980 4843 5613 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_48980 6862 6104 gene locus_tag LOCUS_48990 6862 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 7036 8019 gene locus_tag LOCUS_49000 7036 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 9646 8132 gene locus_tag LOCUS_49010 9646 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 10751 9714 gene locus_tag LOCUS_49020 10751 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 14152 10796 gene locus_tag LOCUS_49030 14152 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 14463 14161 gene locus_tag LOCUS_49040 14463 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 16628 14463 gene locus_tag LOCUS_49050 16628 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 17240 16659 gene locus_tag LOCUS_49060 17240 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence159 3300 4073 gene locus_tag LOCUS_49070 3300 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 5600 4083 gene locus_tag LOCUS_49080 5600 4083 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_49080 6541 5597 gene locus_tag LOCUS_49090 gene trxB 6541 5597 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_49090 6893 7408 gene locus_tag LOCUS_49100 6893 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 8750 7416 gene locus_tag LOCUS_49110 8750 7416 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 protein_id gnl|my_center|LOCUS_49110 8885 9430 gene locus_tag LOCUS_49120 8885 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 9486 10241 gene locus_tag LOCUS_49130 9486 10241 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_49130 10741 12306 gene locus_tag LOCUS_49140 10741 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 12371 15721 gene locus_tag LOCUS_49150 12371 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 15833 16243 gene locus_tag LOCUS_49160 15833 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 16387 16668 gene locus_tag LOCUS_49170 16387 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 <18406 16705 gene locus_tag LOCUS_49180 <18406 16705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence160 2164 821 gene locus_tag LOCUS_49190 gene miaB 2164 821 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW81 protein_id gnl|my_center|LOCUS_49190 3014 2169 gene locus_tag LOCUS_49200 3014 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 4796 3030 gene locus_tag LOCUS_49210 gene ptsI 4796 3030 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_49210 5071 4802 gene locus_tag LOCUS_49220 gene ptsH 5071 4802 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65877 protein_id gnl|my_center|LOCUS_49220 5598 5167 gene locus_tag LOCUS_49230 5598 5167 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_49230 6755 5820 gene locus_tag LOCUS_49240 6755 5820 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_49240 7683 6733 gene locus_tag LOCUS_49250 gene hprK 7683 6733 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_49250 8141 7683 gene locus_tag LOCUS_49260 gene ptsN 8141 7683 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_49260 8720 8172 gene locus_tag LOCUS_49270 8720 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_49270 10558 8741 gene locus_tag LOCUS_49280 10558 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 11375 10647 gene locus_tag LOCUS_49290 11375 10647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_49290 13521 11398 gene locus_tag LOCUS_49300 13521 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 15316 13613 gene locus_tag LOCUS_49310 gene recJ 15316 13613 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_49310 16287 15328 gene locus_tag LOCUS_49320 gene accA 16287 15328 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_49320 <17742 16365 gene locus_tag LOCUS_49330 <17742 16365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9UNY9:primosomal protein N' >Feature sequence161 323 685 gene locus_tag LOCUS_49340 323 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 1601 687 gene locus_tag LOCUS_49350 1601 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 2100 2492 gene locus_tag LOCUS_49360 2100 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 4141 3080 gene locus_tag LOCUS_49370 4141 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 5330 4755 gene locus_tag LOCUS_49380 5330 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 5985 5344 gene locus_tag LOCUS_49390 5985 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 7091 6411 gene locus_tag LOCUS_49400 7091 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 protein_id gnl|my_center|LOCUS_49400 7828 7190 gene locus_tag LOCUS_49410 7828 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 13003 7835 gene locus_tag LOCUS_49420 13003 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 13641 13177 gene locus_tag LOCUS_49430 13641 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 16271 13638 gene locus_tag LOCUS_49440 16271 13638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029781.1 protein_id gnl|my_center|LOCUS_49440 17618 16707 gene locus_tag LOCUS_49450 17618 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 >Feature sequence162 2 1258 gene locus_tag LOCUS_49460 2 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 3420 1267 gene locus_tag LOCUS_49470 3420 1267 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_49470 3896 3417 gene locus_tag LOCUS_49480 3896 3417 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_49480 4522 3908 gene locus_tag LOCUS_49490 4522 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 protein_id gnl|my_center|LOCUS_49490 6941 4632 gene locus_tag LOCUS_49500 6941 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 7273 8676 gene locus_tag LOCUS_49510 7273 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 8845 9681 gene locus_tag LOCUS_49520 8845 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_49520 9779 10819 gene locus_tag LOCUS_49530 9779 10819 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104160.1 protein_id gnl|my_center|LOCUS_49530 10851 11657 gene locus_tag LOCUS_49540 10851 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_49540 12877 11678 gene locus_tag LOCUS_49550 12877 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_49550 14294 12912 gene locus_tag LOCUS_49560 14294 12912 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919101.1 protein_id gnl|my_center|LOCUS_49560 14914 14342 gene locus_tag LOCUS_49570 14914 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 15140 14898 gene locus_tag LOCUS_49580 15140 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 15818 15240 gene locus_tag LOCUS_49590 15818 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 15975 16493 gene locus_tag LOCUS_49600 15975 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 16490 17122 gene locus_tag LOCUS_49610 16490 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 >Feature sequence163 1249 800 gene locus_tag LOCUS_49620 1249 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 1788 1330 gene locus_tag LOCUS_49630 1788 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 4417 1859 gene locus_tag LOCUS_49640 4417 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 4647 7418 gene locus_tag LOCUS_49650 4647 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 7512 8108 gene locus_tag LOCUS_49660 7512 8108 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_49660 12248 8124 gene locus_tag LOCUS_49670 12248 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 14743 13412 gene locus_tag LOCUS_49680 14743 13412 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49680 15291 14953 gene locus_tag LOCUS_49690 15291 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 15193 17367 gene locus_tag LOCUS_49700 15193 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 >Feature sequence164 1753 464 gene locus_tag LOCUS_49710 1753 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 3219 1780 gene locus_tag LOCUS_49720 3219 1780 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_49720 5432 3216 gene locus_tag LOCUS_49730 5432 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 5528 6820 gene locus_tag LOCUS_49740 5528 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_49740 6943 10146 gene locus_tag LOCUS_49750 6943 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 10544 14053 gene locus_tag LOCUS_49760 10544 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 14101 14778 gene locus_tag LOCUS_49770 14101 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 14775 15242 gene locus_tag LOCUS_49780 14775 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 <16884 15804 gene locus_tag LOCUS_49790 <16884 15804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 >Feature sequence165 1475 306 gene locus_tag LOCUS_49800 1475 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 2272 1736 gene locus_tag LOCUS_49810 2272 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 4285 2345 gene locus_tag LOCUS_49820 4285 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 7820 4674 gene locus_tag LOCUS_49830 7820 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 8301 7849 gene locus_tag LOCUS_49840 8301 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 9695 8322 gene locus_tag LOCUS_49850 gene pilR 9695 8322 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_49850 11656 9692 gene locus_tag LOCUS_49860 gene pilS 11656 9692 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_49860 13033 11828 gene locus_tag LOCUS_49870 gene pilC 13033 11828 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_49870 14149 13037 gene locus_tag LOCUS_49880 gene pilT-4 14149 13037 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_49880 14413 16299 gene locus_tag LOCUS_49890 14413 16299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_49890 16714 16424 gene locus_tag LOCUS_49900 16714 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 >Feature sequence166 2337 262 gene locus_tag LOCUS_49910 gene fusA2 2337 262 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_49910 2923 2453 gene locus_tag LOCUS_49920 gene rpsG 2923 2453 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7U8 protein_id gnl|my_center|LOCUS_49920 3339 2965 gene locus_tag LOCUS_49930 gene rpsL 3339 2965 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_49930 3780 4142 gene locus_tag LOCUS_49940 3780 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 8429 4254 gene locus_tag LOCUS_49950 gene rpoC 8429 4254 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_49950 12713 8460 gene locus_tag LOCUS_49960 gene rpoB 12713 8460 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y6 protein_id gnl|my_center|LOCUS_49960 13021 12710 gene locus_tag LOCUS_49970 13021 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 13508 13131 gene locus_tag LOCUS_49980 gene rplL 13508 13131 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_49980 14154 13636 gene locus_tag LOCUS_49990 gene rplJ 14154 13636 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88YW8 protein_id gnl|my_center|LOCUS_49990 14860 14159 gene locus_tag LOCUS_50000 gene rplA 14860 14159 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN6 protein_id gnl|my_center|LOCUS_50000 15301 14876 gene locus_tag LOCUS_50010 gene rplK 15301 14876 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EG5 protein_id gnl|my_center|LOCUS_50010 15907 15368 gene locus_tag LOCUS_50020 gene nusG 15907 15368 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_50020 16113 15907 gene locus_tag LOCUS_50030 16113 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 16214 16139 gene locus_tag LOCUS_t00710 16214 16139 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 184 1530 gene locus_tag LOCUS_50040 184 1530 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_50040 1569 2753 gene locus_tag LOCUS_50050 gene rsgA 1569 2753 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNT5 protein_id gnl|my_center|LOCUS_50050 2767 4137 gene locus_tag LOCUS_50060 2767 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 4163 4453 gene locus_tag LOCUS_50070 4163 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 4368 7322 gene locus_tag LOCUS_50080 4368 7322 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_50080 8698 7409 gene locus_tag LOCUS_50090 8698 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 9258 11567 gene locus_tag LOCUS_50100 9258 11567 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_50100 11564 14014 gene locus_tag LOCUS_50110 11564 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 14011 14547 gene locus_tag LOCUS_50120 14011 14547 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT56 protein_id gnl|my_center|LOCUS_50120 15577 14525 gene locus_tag LOCUS_50130 15577 14525 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_50130 >Feature sequence168 2456 2686 gene locus_tag LOCUS_50140 2456 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 3761 2778 gene locus_tag LOCUS_50150 gene lipA 3761 2778 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 protein_id gnl|my_center|LOCUS_50150 4841 3936 gene locus_tag LOCUS_50160 gene uppS 4841 3936 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_50160 5295 6398 gene locus_tag LOCUS_50170 5295 6398 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_50170 6408 6830 gene locus_tag LOCUS_50180 gene fxsA 6408 6830 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_50180 7551 6856 gene locus_tag LOCUS_50190 7551 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 9970 7724 gene locus_tag LOCUS_50200 9970 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 10129 11535 gene locus_tag LOCUS_50210 gene cca 10129 11535 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_50210 12651 11542 gene locus_tag LOCUS_50220 12651 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 15132 12907 gene locus_tag LOCUS_50230 15132 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_50230 16227 15136 gene locus_tag LOCUS_50240 gene ansA 16227 15136 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_50240 >Feature sequence169 1376 210 gene locus_tag LOCUS_50250 1376 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_50250 1694 1506 gene locus_tag LOCUS_50260 1694 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 1675 3768 gene locus_tag LOCUS_50270 1675 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 3932 4339 gene locus_tag LOCUS_50280 3932 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 4527 6125 gene locus_tag LOCUS_50290 4527 6125 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122586.1 protein_id gnl|my_center|LOCUS_50290 6346 8274 gene locus_tag LOCUS_50300 6346 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 8363 10348 gene locus_tag LOCUS_50310 8363 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 11012 12199 gene locus_tag LOCUS_50320 gene pilT-1 11012 12199 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_50320 12192 12704 gene locus_tag LOCUS_50330 12192 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 13808 12807 gene locus_tag LOCUS_50340 13808 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 14094 15542 gene locus_tag LOCUS_50350 gene mpl 14094 15542 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_50350 >Feature sequence170 2921 477 gene locus_tag LOCUS_50360 2921 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 3110 5800 gene locus_tag LOCUS_50370 3110 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 5810 7237 gene locus_tag LOCUS_50380 5810 7237 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_50380 7234 8958 gene locus_tag LOCUS_50390 7234 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_50390 9033 10313 gene locus_tag LOCUS_50400 9033 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_50400 10501 11961 gene locus_tag LOCUS_50410 10501 11961 CDS product myeloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143588.1 protein_id gnl|my_center|LOCUS_50410 13343 11943 gene locus_tag LOCUS_50420 13343 11943 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066453.1 protein_id gnl|my_center|LOCUS_50420 14004 13489 gene locus_tag LOCUS_50430 gene ppiB 14004 13489 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_50430 14787 14209 gene locus_tag LOCUS_50440 14787 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 15603 14818 gene locus_tag LOCUS_50450 gene soj 15603 14818 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_50450 <16175 15630 gene locus_tag LOCUS_50460 <16175 15630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090949.1:ABC transporter ATP-binding protein >Feature sequence171 507 1649 gene locus_tag LOCUS_50470 507 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_50470 4656 1654 gene locus_tag LOCUS_50480 4656 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 8695 4631 gene locus_tag LOCUS_50490 8695 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 9648 8683 gene locus_tag LOCUS_50500 gene nadK 9648 8683 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_50500 10421 9645 gene locus_tag LOCUS_50510 10421 9645 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_50510 11416 10460 gene locus_tag LOCUS_50520 11416 10460 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_50520 12710 11406 gene locus_tag LOCUS_50530 12710 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 12841 14163 gene locus_tag LOCUS_50540 12841 14163 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_50540 14160 14699 gene locus_tag LOCUS_50550 14160 14699 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_50550 >Feature sequence172 682 1152 gene locus_tag LOCUS_50560 682 1152 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_50560 1261 2934 gene locus_tag LOCUS_50570 1261 2934 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_50570 5958 2944 gene locus_tag LOCUS_50580 5958 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 9659 6165 gene locus_tag LOCUS_50590 9659 6165 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_50590 10016 11395 gene locus_tag LOCUS_50600 10016 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 11838 12863 gene locus_tag LOCUS_50610 11838 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 13030 13515 gene locus_tag LOCUS_50620 13030 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 >Feature sequence173 597 1298 gene locus_tag LOCUS_50630 597 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 1285 2142 gene locus_tag LOCUS_50640 1285 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 4081 2549 gene locus_tag LOCUS_50650 4081 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 5130 4372 gene locus_tag LOCUS_50660 5130 4372 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_50660 7037 5130 gene locus_tag LOCUS_50670 gene sdhA 7037 5130 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_50670 7725 7048 gene locus_tag LOCUS_50680 7725 7048 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_50680 9297 7876 gene locus_tag LOCUS_50690 9297 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 10526 9294 gene locus_tag LOCUS_50700 10526 9294 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_50700 10687 13095 gene locus_tag LOCUS_50710 10687 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 13725 13099 gene locus_tag LOCUS_50720 13725 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 13900 15504 gene locus_tag LOCUS_50730 13900 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 >Feature sequence174 148 2616 gene locus_tag LOCUS_50740 148 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 2723 3265 gene locus_tag LOCUS_50750 2723 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50750 3287 3505 gene locus_tag LOCUS_50760 3287 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50760 3502 6183 gene locus_tag LOCUS_50770 3502 6183 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_50770 7379 6267 gene locus_tag LOCUS_50780 gene ald 7379 6267 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_50780 7936 7391 gene locus_tag LOCUS_50790 7936 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 7818 8051 gene locus_tag LOCUS_50800 7818 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 8197 8122 gene locus_tag LOCUS_t00720 8197 8122 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9453 8371 gene locus_tag LOCUS_50810 9453 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 9721 11001 gene locus_tag LOCUS_50820 9721 11001 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064899.1 protein_id gnl|my_center|LOCUS_50820 12302 11055 gene locus_tag LOCUS_50830 12302 11055 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_50830 13306 12356 gene locus_tag LOCUS_50840 gene dmt 13306 12356 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_50840 14991 13465 gene locus_tag LOCUS_50850 14991 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 <15636 15013 gene locus_tag LOCUS_50860 <15636 15013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204013.1:uracil-DNA glycosylase >Feature sequence175 261 623 gene locus_tag LOCUS_50870 261 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 786 2477 gene locus_tag LOCUS_50880 786 2477 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_50880 2528 2752 gene locus_tag LOCUS_50890 gene mbtH 2528 2752 CDS product MbtH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224966.1 protein_id gnl|my_center|LOCUS_50890 2940 4073 gene locus_tag LOCUS_50900 2940 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 4070 5293 gene locus_tag LOCUS_50910 4070 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 6149 5277 gene locus_tag LOCUS_50920 6149 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 6433 7875 gene locus_tag LOCUS_50930 6433 7875 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_50930 9196 7844 gene locus_tag LOCUS_50940 9196 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 11239 9254 gene locus_tag LOCUS_50950 11239 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 11570 13153 gene locus_tag LOCUS_50960 11570 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 14813 13983 gene locus_tag LOCUS_50970 14813 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 >Feature sequence176 73 1608 gene locus_tag LOCUS_50980 73 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 1642 2007 gene locus_tag LOCUS_50990 1642 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 2863 3759 gene locus_tag LOCUS_51000 2863 3759 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_51000 3821 4021 gene locus_tag LOCUS_51010 3821 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 4583 5152 gene locus_tag LOCUS_51020 4583 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 5351 6514 gene locus_tag LOCUS_51030 5351 6514 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259425.1 protein_id gnl|my_center|LOCUS_51030 6525 8237 gene locus_tag LOCUS_51040 6525 8237 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259426.1 protein_id gnl|my_center|LOCUS_51040 8315 8701 gene locus_tag LOCUS_51050 8315 8701 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257642.1 protein_id gnl|my_center|LOCUS_51050 8726 9925 gene locus_tag LOCUS_51060 8726 9925 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_51060 9979 10455 gene locus_tag LOCUS_51070 9979 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086947.1 protein_id gnl|my_center|LOCUS_51070 10605 13064 gene locus_tag LOCUS_51080 10605 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_51080 13093 14013 gene locus_tag LOCUS_51090 13093 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 14726 14043 gene locus_tag LOCUS_51100 14726 14043 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_51100 >Feature sequence177 1250 258 gene locus_tag LOCUS_51110 gene rpoA 1250 258 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_51110 1903 1274 gene locus_tag LOCUS_51120 1903 1274 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_51120 2478 2077 gene locus_tag LOCUS_51130 gene rpsK 2478 2077 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF3 protein_id gnl|my_center|LOCUS_51130 2869 2489 gene locus_tag LOCUS_51140 gene rpsM 2869 2489 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_51140 3242 3015 gene locus_tag LOCUS_51150 gene infA1 3242 3015 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_51150 4076 3258 gene locus_tag LOCUS_51160 4076 3258 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_51160 4651 4073 gene locus_tag LOCUS_51170 gene adk 4651 4073 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U880 protein_id gnl|my_center|LOCUS_51170 6017 4638 gene locus_tag LOCUS_51180 gene secY 6017 4638 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_51180 6451 6014 gene locus_tag LOCUS_51190 gene rplO 6451 6014 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN9 protein_id gnl|my_center|LOCUS_51190 6648 6457 gene locus_tag LOCUS_51200 gene rpmD 6648 6457 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS10 protein_id gnl|my_center|LOCUS_51200 7199 6687 gene locus_tag LOCUS_51210 gene rpsE 7199 6687 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_51210 7660 7274 gene locus_tag LOCUS_51220 gene rplR 7660 7274 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E9 protein_id gnl|my_center|LOCUS_51220 8235 7693 gene locus_tag LOCUS_51230 gene rplF 8235 7693 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR2 protein_id gnl|my_center|LOCUS_51230 8640 8248 gene locus_tag LOCUS_51240 gene rpsH 8640 8248 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ6 protein_id gnl|my_center|LOCUS_51240 9274 8711 gene locus_tag LOCUS_51250 gene rplE 9274 8711 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG8 protein_id gnl|my_center|LOCUS_51250 9632 9297 gene locus_tag LOCUS_51260 gene rplX 9632 9297 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ8 protein_id gnl|my_center|LOCUS_51260 10035 9667 gene locus_tag LOCUS_51270 gene rplN 10035 9667 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W5 protein_id gnl|my_center|LOCUS_51270 10323 10051 gene locus_tag LOCUS_51280 gene rpsQ 10323 10051 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_51280 10535 10344 gene locus_tag LOCUS_51290 gene rpmC 10535 10344 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W7 protein_id gnl|my_center|LOCUS_51290 10965 10546 gene locus_tag LOCUS_51300 gene rplP 10965 10546 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14577 protein_id gnl|my_center|LOCUS_51300 11628 10981 gene locus_tag LOCUS_51310 gene rpsC 11628 10981 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_51310 11996 11631 gene locus_tag LOCUS_51320 gene rplV 11996 11631 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJA7 protein_id gnl|my_center|LOCUS_51320 12284 12000 gene locus_tag LOCUS_51330 gene rpsS 12284 12000 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_51330 13132 12299 gene locus_tag LOCUS_51340 gene rplB 13132 12299 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_51340 13459 13169 gene locus_tag LOCUS_51350 gene rplW 13459 13169 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_51350 14079 13456 gene locus_tag LOCUS_51360 gene rplD 14079 13456 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J41 protein_id gnl|my_center|LOCUS_51360 14723 14094 gene locus_tag LOCUS_51370 gene rplC 14723 14094 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60454 protein_id gnl|my_center|LOCUS_51370 15051 14743 gene locus_tag LOCUS_51380 gene rpsJ 15051 14743 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J83 protein_id gnl|my_center|LOCUS_51380 >Feature sequence178 1291 488 gene locus_tag LOCUS_51390 1291 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 3144 1291 gene locus_tag LOCUS_51400 3144 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_51400 6587 3141 gene locus_tag LOCUS_51410 6587 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083688.1 protein_id gnl|my_center|LOCUS_51410 10649 6606 gene locus_tag LOCUS_51420 10649 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083687.1 protein_id gnl|my_center|LOCUS_51420 13895 10701 gene locus_tag LOCUS_51430 13895 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083686.1 protein_id gnl|my_center|LOCUS_51430 >Feature sequence179 738 262 gene locus_tag LOCUS_51440 gene rimP 738 262 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X299 protein_id gnl|my_center|LOCUS_51440 1965 1021 gene locus_tag LOCUS_51450 1965 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_51450 2772 2071 gene locus_tag LOCUS_51460 gene rnc 2772 2071 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX1 protein_id gnl|my_center|LOCUS_51460 3306 3064 gene locus_tag LOCUS_51470 3306 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 3241 4464 gene locus_tag LOCUS_51480 3241 4464 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_51480 4461 5903 gene locus_tag LOCUS_51490 4461 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702860.1 protein_id gnl|my_center|LOCUS_51490 6196 9486 gene locus_tag LOCUS_51500 6196 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 9593 10618 gene locus_tag LOCUS_51510 9593 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 11169 10690 gene locus_tag LOCUS_51520 11169 10690 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_51520 12060 11206 gene locus_tag LOCUS_51530 12060 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 12262 12651 gene locus_tag LOCUS_51540 12262 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 14102 13149 gene locus_tag LOCUS_51550 14102 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 >Feature sequence180 1551 2189 gene locus_tag LOCUS_51560 1551 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_51560 2186 2650 gene locus_tag LOCUS_51570 2186 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 3555 2659 gene locus_tag LOCUS_51580 3555 2659 CDS product dinitrogenase reductase activating glycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_51580 3448 3654 gene locus_tag LOCUS_51590 3448 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 3754 4065 gene locus_tag LOCUS_51600 3754 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 9481 4118 gene locus_tag LOCUS_51610 9481 4118 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_51610 9951 9628 gene locus_tag LOCUS_51620 9951 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 10466 10068 gene locus_tag LOCUS_51630 10466 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 11099 12859 gene locus_tag LOCUS_51640 11099 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 12987 13868 gene locus_tag LOCUS_51650 12987 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 >Feature sequence181 5169 3541 gene locus_tag LOCUS_51660 5169 3541 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_51660 5688 9443 gene locus_tag LOCUS_51670 5688 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 9735 10814 gene locus_tag LOCUS_51680 9735 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 12261 10942 gene locus_tag LOCUS_51690 12261 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 14223 12613 gene locus_tag LOCUS_51700 14223 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 >Feature sequence182 830 2626 gene locus_tag LOCUS_51710 830 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_51710 2710 4227 gene locus_tag LOCUS_51720 2710 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_51720 4426 5103 gene locus_tag LOCUS_51730 4426 5103 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_51730 5081 6766 gene locus_tag LOCUS_51740 5081 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 6839 7198 gene locus_tag LOCUS_51750 6839 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 7356 7520 gene locus_tag LOCUS_51760 7356 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 9065 7575 gene locus_tag LOCUS_51770 9065 7575 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 protein_id gnl|my_center|LOCUS_51770 9421 9098 gene locus_tag LOCUS_51780 9421 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 9676 12093 gene locus_tag LOCUS_51790 9676 12093 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_51790 12090 12596 gene locus_tag LOCUS_51800 12090 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 13826 12615 gene locus_tag LOCUS_51810 13826 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 14722 13841 gene locus_tag LOCUS_51820 14722 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 >Feature sequence183 781 2361 gene locus_tag LOCUS_51830 781 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 2358 3866 gene locus_tag LOCUS_51840 2358 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 4597 3908 gene locus_tag LOCUS_51850 4597 3908 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_51850 4931 7333 gene locus_tag LOCUS_51860 4931 7333 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_51860 8851 7397 gene locus_tag LOCUS_51870 gene hisS 8851 7397 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWD2 protein_id gnl|my_center|LOCUS_51870 9040 10020 gene locus_tag LOCUS_51880 9040 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 10020 11837 gene locus_tag LOCUS_51890 10020 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 >Feature sequence184 2522 1521 gene locus_tag LOCUS_51900 2522 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 3173 2616 gene locus_tag LOCUS_51910 3173 2616 CDS product acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 protein_id gnl|my_center|LOCUS_51910 4927 3359 gene locus_tag LOCUS_51920 4927 3359 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_51920 6099 4939 gene locus_tag LOCUS_51930 gene menC 6099 4939 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4D0 protein_id gnl|my_center|LOCUS_51930 6402 7295 gene locus_tag LOCUS_51940 6402 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 7297 8469 gene locus_tag LOCUS_51950 7297 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 8658 10739 gene locus_tag LOCUS_51960 8658 10739 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_51960 10739 12964 gene locus_tag LOCUS_51970 10739 12964 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_51970 12999 13976 gene locus_tag LOCUS_51980 12999 13976 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_51980 >Feature sequence185 536 1609 gene locus_tag LOCUS_51990 gene ldh 536 1609 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_51990 3574 1727 gene locus_tag LOCUS_52000 3574 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 4792 3830 gene locus_tag LOCUS_52010 4792 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703674.1 protein_id gnl|my_center|LOCUS_52010 5453 4830 gene locus_tag LOCUS_52020 5453 4830 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_52020 5987 6880 gene locus_tag LOCUS_52030 5987 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 7260 8150 gene locus_tag LOCUS_52040 7260 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52040 8154 9962 gene locus_tag LOCUS_52050 8154 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52050 10022 10855 gene locus_tag LOCUS_52060 10022 10855 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_52060 10907 12052 gene locus_tag LOCUS_52070 gene rnd 10907 12052 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_52070 12571 12026 gene locus_tag LOCUS_52080 12571 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 13402 12605 gene locus_tag LOCUS_52090 13402 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 14339 13545 gene locus_tag LOCUS_52100 14339 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 >Feature sequence186 2227 107 gene locus_tag LOCUS_52110 2227 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 3717 2230 gene locus_tag LOCUS_52120 3717 2230 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_52120 3889 4908 gene locus_tag LOCUS_52130 3889 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 5666 4980 gene locus_tag LOCUS_52140 5666 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 6799 5708 gene locus_tag LOCUS_52150 6799 5708 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_52150 11124 7261 gene locus_tag LOCUS_52160 gene dnaE 11124 7261 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I799 protein_id gnl|my_center|LOCUS_52160 12003 11290 gene locus_tag LOCUS_52170 12003 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 12740 12189 gene locus_tag LOCUS_52180 12740 12189 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_52180 <14403 12824 gene locus_tag LOCUS_52190 <14403 12824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63RA8:protein TolB >Feature sequence187 992 54 gene locus_tag LOCUS_52200 992 54 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_52200 1909 1106 gene locus_tag LOCUS_52210 1909 1106 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_52210 3010 1970 gene locus_tag LOCUS_52220 3010 1970 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_52220 3404 3934 gene locus_tag LOCUS_52230 3404 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 4648 4010 gene locus_tag LOCUS_52240 4648 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 7884 4645 gene locus_tag LOCUS_52250 7884 4645 CDS product drug-resistance cell envelope-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531375.1 protein_id gnl|my_center|LOCUS_52250 9086 7881 gene locus_tag LOCUS_52260 9086 7881 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_52260 11350 9083 gene locus_tag LOCUS_52270 11350 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 13118 11661 gene locus_tag LOCUS_52280 13118 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 13558 13124 gene locus_tag LOCUS_52290 13558 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 13990 13574 gene locus_tag LOCUS_52300 13990 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 >Feature sequence188 6627 4348 gene locus_tag LOCUS_52310 6627 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 6780 7496 gene locus_tag LOCUS_52320 6780 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_52320 10765 7499 gene locus_tag LOCUS_52330 10765 7499 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_52330 11360 12784 gene locus_tag LOCUS_52340 11360 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 >Feature sequence189 2119 1751 gene locus_tag LOCUS_52350 2119 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 2389 2222 gene locus_tag LOCUS_52360 2389 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 2989 2660 gene locus_tag LOCUS_52370 2989 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 3322 5772 gene locus_tag LOCUS_52380 3322 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 6981 6130 gene locus_tag LOCUS_52390 6981 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 11152 8135 gene locus_tag LOCUS_52400 11152 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 12706 11300 gene locus_tag LOCUS_52410 12706 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 13146 12880 gene locus_tag LOCUS_52420 13146 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 13579 13202 gene locus_tag LOCUS_52430 13579 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 >Feature sequence190 <1 1094 gene locus_tag LOCUS_52440 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941105.1:twitching motility protein PilT 1109 2206 gene locus_tag LOCUS_52450 gene pilT-3 1109 2206 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_52450 2364 4040 gene locus_tag LOCUS_52460 2364 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 4480 7146 gene locus_tag LOCUS_52470 4480 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 7169 8485 gene locus_tag LOCUS_52480 7169 8485 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_52480 10658 8985 gene locus_tag LOCUS_52490 10658 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 10862 13189 gene locus_tag LOCUS_52500 10862 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 >Feature sequence191 3571 818 gene locus_tag LOCUS_52510 3571 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 3764 6337 gene locus_tag LOCUS_52520 3764 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 7875 8729 gene locus_tag LOCUS_52530 gene dapF 7875 8729 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_52530 8825 10801 gene locus_tag LOCUS_52540 8825 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 10798 13080 gene locus_tag LOCUS_52550 10798 13080 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_52550 >Feature sequence192 3 539 gene locus_tag LOCUS_52560 3 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 541 1008 gene locus_tag LOCUS_52570 541 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 2476 1022 gene locus_tag LOCUS_52580 2476 1022 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_52580 3866 2511 gene locus_tag LOCUS_52590 3866 2511 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_52590 4432 6840 gene locus_tag LOCUS_52600 4432 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 7873 6986 gene locus_tag LOCUS_52610 7873 6986 CDS product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 protein_id gnl|my_center|LOCUS_52610 10653 7870 gene locus_tag LOCUS_52620 10653 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 10765 11328 gene locus_tag LOCUS_52630 10765 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 11490 11681 gene locus_tag LOCUS_52640 11490 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 11863 12420 gene locus_tag LOCUS_52650 11863 12420 CDS product DUF4920 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403439.1 protein_id gnl|my_center|LOCUS_52650 12923 12444 gene locus_tag LOCUS_52660 12923 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 <13817 13018 gene locus_tag LOCUS_52670 <13817 13018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057215.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence193 1093 221 gene locus_tag LOCUS_52680 1093 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121246.1 protein_id gnl|my_center|LOCUS_52680 2076 1105 gene locus_tag LOCUS_52690 2076 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_52690 5684 2244 gene locus_tag LOCUS_52700 5684 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 8757 5884 gene locus_tag LOCUS_52710 8757 5884 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_52710 8964 10805 gene locus_tag LOCUS_52720 8964 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 10922 11482 gene locus_tag LOCUS_52730 10922 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_52730 11544 12833 gene locus_tag LOCUS_52740 11544 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 >Feature sequence194 <1 1261 gene locus_tag LOCUS_52750 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EZP1:polyamine aminopropyltransferase 1 1326 3026 gene locus_tag LOCUS_52760 1326 3026 CDS product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_52760 3023 4120 gene locus_tag LOCUS_52770 3023 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842007.1 protein_id gnl|my_center|LOCUS_52770 4416 8168 gene locus_tag LOCUS_52780 4416 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 <13723 8165 gene locus_tag LOCUS_52790 <13723 8165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972438.1:outer membrane protein assembly factor >Feature sequence195 893 1273 gene locus_tag LOCUS_52800 893 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 1363 6132 gene locus_tag LOCUS_52810 1363 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 6267 7760 gene locus_tag LOCUS_52820 6267 7760 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124107.1 protein_id gnl|my_center|LOCUS_52820 8661 7753 gene locus_tag LOCUS_52830 8661 7753 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_52830 9861 8824 gene locus_tag LOCUS_52840 9861 8824 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_52840 10723 9968 gene locus_tag LOCUS_52850 10723 9968 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_52850 12040 10751 gene locus_tag LOCUS_52860 12040 10751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_52860 12396 12037 gene locus_tag LOCUS_52870 12396 12037 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_52870 13531 12497 gene locus_tag LOCUS_52880 13531 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 >Feature sequence196 2491 923 gene locus_tag LOCUS_52890 2491 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 3846 2488 gene locus_tag LOCUS_52900 3846 2488 CDS product putative zinc protease y4wA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55679 protein_id gnl|my_center|LOCUS_52900 4108 5181 gene locus_tag LOCUS_52910 4108 5181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_52910 5234 6028 gene locus_tag LOCUS_52920 5234 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 6025 6849 gene locus_tag LOCUS_52930 6025 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 7945 6980 gene locus_tag LOCUS_52940 7945 6980 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_52940 8664 9347 gene locus_tag LOCUS_52950 8664 9347 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_52950 9770 9438 gene locus_tag LOCUS_52960 9770 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 11016 9772 gene locus_tag LOCUS_52970 11016 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 12421 11063 gene locus_tag LOCUS_52980 12421 11063 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_52980 <13342 12530 gene locus_tag LOCUS_52990 <13342 12530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403109.1:multidrug transporter AcrB >Feature sequence197 118 1473 gene locus_tag LOCUS_53000 118 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 1470 2117 gene locus_tag LOCUS_53010 1470 2117 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_53010 4217 2136 gene locus_tag LOCUS_53020 4217 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 5224 4214 gene locus_tag LOCUS_53030 5224 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_53030 5766 5221 gene locus_tag LOCUS_53040 5766 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 6653 5763 gene locus_tag LOCUS_53050 6653 5763 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_53050 7623 6655 gene locus_tag LOCUS_53060 7623 6655 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_53060 7807 8502 gene locus_tag LOCUS_53070 gene nth 7807 8502 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_53070 9594 8602 gene locus_tag LOCUS_53080 9594 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 9814 12138 gene locus_tag LOCUS_53090 9814 12138 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204019.1 protein_id gnl|my_center|LOCUS_53090 12167 12760 gene locus_tag LOCUS_53100 12167 12760 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 protein_id gnl|my_center|LOCUS_53100 >Feature sequence198 <1 2171 gene locus_tag LOCUS_53110 <1 2171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase 2327 3142 gene locus_tag LOCUS_53120 2327 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 3291 6029 gene locus_tag LOCUS_53130 3291 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 6175 6684 gene locus_tag LOCUS_53140 6175 6684 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB5 protein_id gnl|my_center|LOCUS_53140 7388 6816 gene locus_tag LOCUS_53150 7388 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 8887 7412 gene locus_tag LOCUS_53160 8887 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 9612 9445 gene locus_tag LOCUS_53170 9612 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 9547 10236 gene locus_tag LOCUS_53180 9547 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 10385 11224 gene locus_tag LOCUS_53190 gene parA 10385 11224 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_53190 11539 11291 gene locus_tag LOCUS_53200 11539 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 11478 11915 gene locus_tag LOCUS_53210 11478 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 12005 12358 gene locus_tag LOCUS_53220 12005 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 12374 13012 gene locus_tag LOCUS_53230 12374 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 >Feature sequence199 <1 562 gene locus_tag LOCUS_53240 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7Q5:adenosylhomocysteinase 3334 641 gene locus_tag LOCUS_53250 3334 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 7385 3558 gene locus_tag LOCUS_53260 7385 3558 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_53260 7823 8173 gene locus_tag LOCUS_53270 7823 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230611.1 protein_id gnl|my_center|LOCUS_53270 8241 9512 gene locus_tag LOCUS_53280 8241 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639137.2 protein_id gnl|my_center|LOCUS_53280 12422 9549 gene locus_tag LOCUS_53290 12422 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 13011 12532 gene locus_tag LOCUS_53300 13011 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 >Feature sequence200 172 1896 gene locus_tag LOCUS_53310 172 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 5234 2130 gene locus_tag LOCUS_53320 5234 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 5820 10178 gene locus_tag LOCUS_53330 5820 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 10411 10232 gene locus_tag LOCUS_53340 10411 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 10731 12665 gene locus_tag LOCUS_53350 10731 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 >Feature sequence201 567 1031 gene locus_tag LOCUS_53360 567 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 1164 1409 gene locus_tag LOCUS_53370 1164 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 1668 2192 gene locus_tag LOCUS_53380 1668 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 2954 2271 gene locus_tag LOCUS_53390 2954 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 3677 3354 gene locus_tag LOCUS_53400 3677 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 3899 5212 gene locus_tag LOCUS_53410 3899 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142450.1 protein_id gnl|my_center|LOCUS_53410 5778 5182 gene locus_tag LOCUS_53420 5778 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 5677 6522 gene locus_tag LOCUS_53430 5677 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 6535 9663 gene locus_tag LOCUS_53440 gene czcA 6535 9663 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_53440 9821 10759 gene locus_tag LOCUS_53450 gene czcD 9821 10759 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_53450 11017 11412 gene locus_tag LOCUS_53460 11017 11412 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_53460 11409 11732 gene locus_tag LOCUS_53470 11409 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 >Feature sequence202 1881 196 gene locus_tag LOCUS_53480 1881 196 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_53480 3173 2070 gene locus_tag LOCUS_53490 3173 2070 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_53490 3845 3204 gene locus_tag LOCUS_53500 3845 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 5917 3998 gene locus_tag LOCUS_53510 gene ggt 5917 3998 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_53510 8496 5992 gene locus_tag LOCUS_53520 8496 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 9386 8958 gene locus_tag LOCUS_53530 gene ndk 9386 8958 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ6 protein_id gnl|my_center|LOCUS_53530 10279 9536 gene locus_tag LOCUS_53540 10279 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 11162 10287 gene locus_tag LOCUS_53550 gene sucD 11162 10287 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EA4 protein_id gnl|my_center|LOCUS_53550 12328 11162 gene locus_tag LOCUS_53560 gene sucC 12328 11162 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_53560 >Feature sequence203 3 701 gene locus_tag LOCUS_53570 3 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 1085 1369 gene locus_tag LOCUS_53580 1085 1369 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMD9 protein_id gnl|my_center|LOCUS_53580 1366 1671 gene locus_tag LOCUS_53590 1366 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 3319 1775 gene locus_tag LOCUS_53600 3319 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 3752 4648 gene locus_tag LOCUS_53610 3752 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 7594 4670 gene locus_tag LOCUS_53620 7594 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 8697 7627 gene locus_tag LOCUS_53630 8697 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 >Feature sequence204 <1 1172 gene locus_tag LOCUS_53640 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AK25:adenosine deaminase 1 1175 1486 gene locus_tag LOCUS_53650 1175 1486 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565850.1 protein_id gnl|my_center|LOCUS_53650 1506 2621 gene locus_tag LOCUS_53660 gene pyrD 1506 2621 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK9 protein_id gnl|my_center|LOCUS_53660 5988 3016 gene locus_tag LOCUS_53670 5988 3016 CDS product periplasmic peptidase family S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_53670 6351 7226 gene locus_tag LOCUS_53680 gene pqqB 6351 7226 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FG4 protein_id gnl|my_center|LOCUS_53680 9003 7246 gene locus_tag LOCUS_53690 9003 7246 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_53690 9628 9110 gene locus_tag LOCUS_53700 9628 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 9808 10263 gene locus_tag LOCUS_53710 9808 10263 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_53710 11727 10300 gene locus_tag LOCUS_53720 11727 10300 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_53720 <12668 11724 gene locus_tag LOCUS_53730 <12668 11724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000277803.1:glycosyl transferase >Feature sequence205 <1 3992 gene locus_tag LOCUS_53740 <1 3992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105498.1:type IV secretion protein Rhs 3989 4711 gene locus_tag LOCUS_53750 3989 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 6248 6871 gene locus_tag LOCUS_53760 6248 6871 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_53760 6868 7278 gene locus_tag LOCUS_53770 6868 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 8096 9196 gene locus_tag LOCUS_53780 8096 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 10670 10458 gene locus_tag LOCUS_53790 10670 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 10964 10695 gene locus_tag LOCUS_53800 10964 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 10929 11381 gene locus_tag LOCUS_53810 10929 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 11775 11404 gene locus_tag LOCUS_53820 11775 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 >Feature sequence206 1612 1121 gene locus_tag LOCUS_53830 1612 1121 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_53830 3822 1786 gene locus_tag LOCUS_53840 gene pknB 3822 1786 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337392.1 protein_id gnl|my_center|LOCUS_53840 4387 3902 gene locus_tag LOCUS_53850 4387 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 5828 4569 gene locus_tag LOCUS_53860 5828 4569 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_53860 6727 5909 gene locus_tag LOCUS_53870 6727 5909 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517446.1 protein_id gnl|my_center|LOCUS_53870 8097 6829 gene locus_tag LOCUS_53880 gene gltP 8097 6829 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_53880 8229 8792 gene locus_tag LOCUS_53890 8229 8792 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_53890 8948 10996 gene locus_tag LOCUS_53900 8948 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 10984 12300 gene locus_tag LOCUS_53910 10984 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 >Feature sequence207 2482 257 gene locus_tag LOCUS_53920 2482 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 2799 4802 gene locus_tag LOCUS_53930 2799 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 4799 5758 gene locus_tag LOCUS_53940 gene prsA 4799 5758 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389491.1 protein_id gnl|my_center|LOCUS_53940 5959 7899 gene locus_tag LOCUS_53950 5959 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 7990 9477 gene locus_tag LOCUS_53960 7990 9477 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_53960 9474 11021 gene locus_tag LOCUS_53970 9474 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 11089 11802 gene locus_tag LOCUS_53980 11089 11802 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_53980 >Feature sequence208 <1 1588 gene locus_tag LOCUS_53990 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator 1911 4937 gene locus_tag LOCUS_54000 1911 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 5065 5949 gene locus_tag LOCUS_54010 5065 5949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 protein_id gnl|my_center|LOCUS_54010 6340 7629 gene locus_tag LOCUS_54020 6340 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 9499 7727 gene locus_tag LOCUS_54030 9499 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 9696 10982 gene locus_tag LOCUS_54040 9696 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 >Feature sequence209 389 1054 gene locus_tag LOCUS_54050 389 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 1090 1494 gene locus_tag LOCUS_54060 1090 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 2488 1502 gene locus_tag LOCUS_54070 2488 1502 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_54070 2714 4243 gene locus_tag LOCUS_54080 2714 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 4348 6192 gene locus_tag LOCUS_54090 4348 6192 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_54090 6666 6208 gene locus_tag LOCUS_54100 6666 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 7179 6754 gene locus_tag LOCUS_54110 7179 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 7364 8623 gene locus_tag LOCUS_54120 7364 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_54120 8883 10265 gene locus_tag LOCUS_54130 8883 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 >Feature sequence210 654 1859 gene locus_tag LOCUS_54140 654 1859 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_54140 2020 3498 gene locus_tag LOCUS_54150 2020 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 3558 4175 gene locus_tag LOCUS_54160 3558 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 4563 4943 gene locus_tag LOCUS_54170 4563 4943 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_54170 4953 5807 gene locus_tag LOCUS_54180 4953 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 6039 8930 gene locus_tag LOCUS_54190 6039 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 11292 9058 gene locus_tag LOCUS_54200 11292 9058 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_54200 >Feature sequence211 1749 1105 gene locus_tag LOCUS_54210 1749 1105 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_54210 2667 1951 gene locus_tag LOCUS_54220 2667 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 3129 2869 gene locus_tag LOCUS_54230 3129 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 4581 3292 gene locus_tag LOCUS_54240 4581 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 5694 4816 gene locus_tag LOCUS_54250 5694 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 6647 5742 gene locus_tag LOCUS_54260 gene bamD 6647 5742 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF62 protein_id gnl|my_center|LOCUS_54260 7327 6644 gene locus_tag LOCUS_54270 gene rpe 7327 6644 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_54270 8228 7443 gene locus_tag LOCUS_54280 8228 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 9583 8270 gene locus_tag LOCUS_54290 9583 8270 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_54290 11080 9815 gene locus_tag LOCUS_54300 11080 9815 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_54300 <11667 11085 gene locus_tag LOCUS_54310 <11667 11085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804130.1:iron ABC transporter permease >Feature sequence212 <1 1169 gene locus_tag LOCUS_54320 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119686.1:endo-1,4-beta-xylanase 1350 2489 gene locus_tag LOCUS_54330 1350 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 5512 2585 gene locus_tag LOCUS_54340 5512 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 7094 5751 gene locus_tag LOCUS_54350 7094 5751 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_54350 7483 7253 gene locus_tag LOCUS_54360 7483 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 7854 7573 gene locus_tag LOCUS_54370 7854 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 8075 9721 gene locus_tag LOCUS_54380 8075 9721 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_54380 >Feature sequence213 2 949 gene locus_tag LOCUS_54390 2 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 1079 2251 gene locus_tag LOCUS_54400 1079 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 2270 2644 gene locus_tag LOCUS_54410 2270 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 2674 3261 gene locus_tag LOCUS_54420 2674 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 3788 4318 gene locus_tag LOCUS_54430 3788 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 5158 4712 gene locus_tag LOCUS_54440 5158 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 5700 5533 gene locus_tag LOCUS_54450 5700 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 6450 5800 gene locus_tag LOCUS_54460 6450 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 6808 6443 gene locus_tag LOCUS_54470 6808 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 7490 7215 gene locus_tag LOCUS_54480 7490 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 7873 8250 gene locus_tag LOCUS_54490 7873 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 10365 8500 gene locus_tag LOCUS_54500 10365 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 10616 10362 gene locus_tag LOCUS_54510 10616 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 >Feature sequence214 1741 164 gene locus_tag LOCUS_54520 1741 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 3039 1741 gene locus_tag LOCUS_54530 3039 1741 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGZ5 protein_id gnl|my_center|LOCUS_54530 4236 3043 gene locus_tag LOCUS_54540 4236 3043 CDS product selenium metabolism hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_54540 5160 4294 gene locus_tag LOCUS_54550 5160 4294 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_54550 6647 5157 gene locus_tag LOCUS_54560 6647 5157 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_54560 7010 7252 gene locus_tag LOCUS_54570 gene rpmB 7010 7252 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F483 protein_id gnl|my_center|LOCUS_54570 7246 7533 gene locus_tag LOCUS_54580 gene rpmE2 7246 7533 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_54580 7643 8191 gene locus_tag LOCUS_54590 7643 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 8582 8250 gene locus_tag LOCUS_54600 8582 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 8856 9962 gene locus_tag LOCUS_54610 8856 9962 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_54610 9959 11305 gene locus_tag LOCUS_54620 9959 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_54620 >Feature sequence215 2419 1193 gene locus_tag LOCUS_54630 2419 1193 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_54630 2756 5170 gene locus_tag LOCUS_54640 2756 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_54640 5393 8782 gene locus_tag LOCUS_54650 5393 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_54650 9168 8809 gene locus_tag LOCUS_54660 9168 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_54660 11455 9224 gene locus_tag LOCUS_54670 11455 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 >Feature sequence216 4194 3253 gene locus_tag LOCUS_54680 4194 3253 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_54680 5372 4503 gene locus_tag LOCUS_54690 5372 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 6972 5551 gene locus_tag LOCUS_54700 6972 5551 CDS product 2-succinylbenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_54700 7652 6969 gene locus_tag LOCUS_54710 7652 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 8907 8026 gene locus_tag LOCUS_54720 gene menA 8907 8026 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_54720 9730 8912 gene locus_tag LOCUS_54730 gene menH 9730 8912 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23974 protein_id gnl|my_center|LOCUS_54730 <11536 9760 gene locus_tag LOCUS_54740 <11536 9760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902775.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase >Feature sequence217 2 469 gene locus_tag LOCUS_54750 2 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 2057 477 gene locus_tag LOCUS_54760 2057 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 2274 2633 gene locus_tag LOCUS_54770 2274 2633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083736.1 protein_id gnl|my_center|LOCUS_54770 2753 7327 gene locus_tag LOCUS_54780 2753 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 8136 7351 gene locus_tag LOCUS_54790 8136 7351 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228409.1 protein_id gnl|my_center|LOCUS_54790 8728 8150 gene locus_tag LOCUS_54800 8728 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 >Feature sequence218 1368 757 gene locus_tag LOCUS_54810 1368 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 1744 4110 gene locus_tag LOCUS_54820 1744 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 5203 4649 gene locus_tag LOCUS_54830 gene blc 5203 4649 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_54830 5422 7779 gene locus_tag LOCUS_54840 5422 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 8543 7809 gene locus_tag LOCUS_54850 8543 7809 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259339.1 protein_id gnl|my_center|LOCUS_54850 9564 8554 gene locus_tag LOCUS_54860 9564 8554 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QA1 protein_id gnl|my_center|LOCUS_54860 10409 9627 gene locus_tag LOCUS_54870 10409 9627 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974325.1 protein_id gnl|my_center|LOCUS_54870 10659 11426 gene locus_tag LOCUS_54880 10659 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 >Feature sequence219 389 2452 gene locus_tag LOCUS_54890 gene recD 389 2452 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH9 protein_id gnl|my_center|LOCUS_54890 3041 2463 gene locus_tag LOCUS_54900 3041 2463 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812203.1 protein_id gnl|my_center|LOCUS_54900 5329 3056 gene locus_tag LOCUS_54910 5329 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 6438 5326 gene locus_tag LOCUS_54920 6438 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 8187 6475 gene locus_tag LOCUS_54930 8187 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 9117 8275 gene locus_tag LOCUS_54940 9117 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 10911 9181 gene locus_tag LOCUS_54950 10911 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 >Feature sequence220 <1 1450 gene locus_tag LOCUS_54960 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933610.1:TonB-dependent receptor 3483 1564 gene locus_tag LOCUS_54970 3483 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 5725 3689 gene locus_tag LOCUS_54980 5725 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 8416 5789 gene locus_tag LOCUS_54990 8416 5789 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_54990 8763 10004 gene locus_tag LOCUS_55000 8763 10004 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_55000 >Feature sequence221 1616 183 gene locus_tag LOCUS_55010 1616 183 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067008.1 protein_id gnl|my_center|LOCUS_55010 2273 1740 gene locus_tag LOCUS_55020 2273 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 2495 2289 gene locus_tag LOCUS_55030 2495 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 3137 3841 gene locus_tag LOCUS_55040 3137 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 4451 4528 gene locus_tag LOCUS_t00730 4451 4528 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4836 6542 gene locus_tag LOCUS_55050 4836 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 7441 6572 gene locus_tag LOCUS_55060 7441 6572 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_55060 7676 8305 gene locus_tag LOCUS_55070 7676 8305 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_55070 8302 9552 gene locus_tag LOCUS_55080 8302 9552 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391547.1 protein_id gnl|my_center|LOCUS_55080 9644 10762 gene locus_tag LOCUS_55090 9644 10762 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_55090 >Feature sequence222 1242 292 gene locus_tag LOCUS_55100 1242 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_55100 1856 1353 gene locus_tag LOCUS_55110 1856 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 1986 2348 gene locus_tag LOCUS_55120 1986 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 3089 2571 gene locus_tag LOCUS_55130 3089 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 3907 3179 gene locus_tag LOCUS_55140 3907 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_55140 4359 4099 gene locus_tag LOCUS_55150 4359 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 5769 5158 gene locus_tag LOCUS_55160 5769 5158 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_55160 5923 6345 gene locus_tag LOCUS_55170 5923 6345 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_55170 7042 6377 gene locus_tag LOCUS_55180 7042 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 7593 7066 gene locus_tag LOCUS_55190 7593 7066 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_55190 8128 7604 gene locus_tag LOCUS_55200 8128 7604 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_55200 8656 8156 gene locus_tag LOCUS_55210 8656 8156 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_55210 8778 9011 gene locus_tag LOCUS_55220 8778 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 10164 9142 gene locus_tag LOCUS_55230 10164 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 >Feature sequence223 459 106 gene locus_tag LOCUS_55240 459 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 1400 762 gene locus_tag LOCUS_55250 1400 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 2997 1990 gene locus_tag LOCUS_55260 2997 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_55260 3448 2972 gene locus_tag LOCUS_55270 3448 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 6993 3448 gene locus_tag LOCUS_55280 6993 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 7997 6990 gene locus_tag LOCUS_55290 7997 6990 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_55290 9550 7994 gene locus_tag LOCUS_55300 9550 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 9859 9554 gene locus_tag LOCUS_55310 9859 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 >Feature sequence224 <1 2693 gene locus_tag LOCUS_55320 <1 2693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122926.1:type I restriction-modification system deoxyribonuclease 2783 4249 gene locus_tag LOCUS_55330 gene hsdM 2783 4249 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_55330 4246 5862 gene locus_tag LOCUS_55340 gene hsdS 4246 5862 CDS product type I restriction enzyme EcoEI specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122924.1 protein_id gnl|my_center|LOCUS_55340 5881 6276 gene locus_tag LOCUS_55350 5881 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 6391 7317 gene locus_tag LOCUS_55360 6391 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 8368 7322 gene locus_tag LOCUS_55370 8368 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 8883 10067 gene locus_tag LOCUS_55380 8883 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 >Feature sequence225 1505 201 gene locus_tag LOCUS_55390 1505 201 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_55390 2389 1502 gene locus_tag LOCUS_55400 2389 1502 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_55400 3654 2386 gene locus_tag LOCUS_55410 3654 2386 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_55410 4454 3651 gene locus_tag LOCUS_55420 4454 3651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224814.1 protein_id gnl|my_center|LOCUS_55420 6069 4834 gene locus_tag LOCUS_55430 6069 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721110.1 protein_id gnl|my_center|LOCUS_55430 6806 6159 gene locus_tag LOCUS_55440 6806 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 7432 6803 gene locus_tag LOCUS_55450 7432 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 7824 9080 gene locus_tag LOCUS_55460 gene rocD 7824 9080 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNN5 protein_id gnl|my_center|LOCUS_55460 10257 9208 gene locus_tag LOCUS_55470 10257 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence226 >Feature sequence227 880 3300 gene locus_tag LOCUS_55480 880 3300 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_55480 3516 4757 gene locus_tag LOCUS_55490 gene mntH 3516 4757 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125355.1 protein_id gnl|my_center|LOCUS_55490 4987 5559 gene locus_tag LOCUS_55500 4987 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55500 5668 7674 gene locus_tag LOCUS_55510 5668 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55510 9727 7778 gene locus_tag LOCUS_55520 9727 7778 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_55520 10194 10051 gene locus_tag LOCUS_55530 10194 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 >Feature sequence228 239 2290 gene locus_tag LOCUS_55540 gene ligA 239 2290 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLA4 protein_id gnl|my_center|LOCUS_55540 3576 2329 gene locus_tag LOCUS_55550 3576 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974563.1 protein_id gnl|my_center|LOCUS_55550 3804 5042 gene locus_tag LOCUS_55560 3804 5042 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3E3 protein_id gnl|my_center|LOCUS_55560 5385 5149 gene locus_tag LOCUS_55570 5385 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 6510 5566 gene locus_tag LOCUS_55580 gene phhA 6510 5566 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_55580 7657 6788 gene locus_tag LOCUS_55590 7657 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 9216 7840 gene locus_tag LOCUS_55600 9216 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 <10200 9226 gene locus_tag LOCUS_55610 <10200 9226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143535.1:alpha/beta hydrolase >Feature sequence229 1879 908 gene locus_tag LOCUS_55620 1879 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640006.1 protein_id gnl|my_center|LOCUS_55620 3722 2460 gene locus_tag LOCUS_55630 3722 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 4233 6035 gene locus_tag LOCUS_55640 4233 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 7789 6161 gene locus_tag LOCUS_55650 7789 6161 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_55650 8152 7811 gene locus_tag LOCUS_55660 8152 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55660 <10197 8207 gene locus_tag LOCUS_55670 <10197 8207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_637141.2:glucan 1,4-beta-glucosidase note possible pseudo, internal stop codon >Feature sequence230 1648 521 gene locus_tag LOCUS_55680 1648 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 5120 1728 gene locus_tag LOCUS_55690 5120 1728 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_55690 5396 5124 gene locus_tag LOCUS_55700 5396 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 7807 6314 gene locus_tag LOCUS_55710 7807 6314 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123361.1 protein_id gnl|my_center|LOCUS_55710 8923 7946 gene locus_tag LOCUS_55720 8923 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 >Feature sequence231 1366 443 gene locus_tag LOCUS_55730 1366 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 1383 1757 gene locus_tag LOCUS_55740 1383 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 1988 4408 gene locus_tag LOCUS_55750 1988 4408 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_55750 4771 6108 gene locus_tag LOCUS_55760 4771 6108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104878.1 protein_id gnl|my_center|LOCUS_55760 7157 6126 gene locus_tag LOCUS_55770 7157 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 7423 8889 gene locus_tag LOCUS_55780 7423 8889 CDS product ovoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119824.1 protein_id gnl|my_center|LOCUS_55780 9295 9047 gene locus_tag LOCUS_55790 9295 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 >Feature sequence232 1901 1269 gene locus_tag LOCUS_55800 1901 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 2690 2124 gene locus_tag LOCUS_55810 2690 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 3231 4049 gene locus_tag LOCUS_55820 3231 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 4154 4239 gene locus_tag LOCUS_t00740 4154 4239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4298 5401 gene locus_tag LOCUS_55830 4298 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 7138 5507 gene locus_tag LOCUS_55840 7138 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 8423 7425 gene locus_tag LOCUS_55850 8423 7425 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_55850 9243 8416 gene locus_tag LOCUS_55860 9243 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55860 >Feature sequence233 <1 1483 gene locus_tag LOCUS_55870 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HMD5:glycerol kinase 2527 1529 gene locus_tag LOCUS_55880 gene hemB 2527 1529 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_55880 2728 3669 gene locus_tag LOCUS_55890 2728 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 4169 3663 gene locus_tag LOCUS_55900 4169 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 4868 4365 gene locus_tag LOCUS_55910 4868 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_55910 6369 4993 gene locus_tag LOCUS_55920 6369 4993 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_55920 9059 6378 gene locus_tag LOCUS_55930 9059 6378 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_55930 <10027 9318 gene locus_tag LOCUS_55940 <10027 9318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KNP3:pseudouridine-5'-phosphate glycosidase >Feature sequence234 348 2877 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggacgatccccgctggcgcgggggagac 4021 3668 gene locus_tag LOCUS_55950 4021 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 4732 4247 gene locus_tag LOCUS_55960 4732 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 6826 4958 gene locus_tag LOCUS_55970 6826 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 8986 7115 gene locus_tag LOCUS_55980 8986 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 9881 9072 gene locus_tag LOCUS_55990 9881 9072 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_55990 >Feature sequence235 <1 1349 gene locus_tag LOCUS_56000 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT5:transcription termination/antitermination protein NusA 1459 4263 gene locus_tag LOCUS_56010 1459 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 4484 4777 gene locus_tag LOCUS_56020 4484 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_56020 4774 5130 gene locus_tag LOCUS_56030 gene rbfA 4774 5130 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_56030 5108 6124 gene locus_tag LOCUS_56040 5108 6124 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_56040 6167 7156 gene locus_tag LOCUS_56050 6167 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 7289 7558 gene locus_tag LOCUS_56060 gene rpsO 7289 7558 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2S4 protein_id gnl|my_center|LOCUS_56060 >Feature sequence236 <1 3318 gene locus_tag LOCUS_56070 <1 3318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:glycosyl hydrolase 4412 3687 gene locus_tag LOCUS_56080 4412 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 4989 4429 gene locus_tag LOCUS_56090 4989 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 7673 5205 gene locus_tag LOCUS_56100 7673 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 9664 7673 gene locus_tag LOCUS_56110 9664 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence237 139 2625 gene locus_tag LOCUS_56120 139 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 2769 5777 gene locus_tag LOCUS_56130 2769 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 5899 6279 gene locus_tag LOCUS_56140 5899 6279 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974248.1 protein_id gnl|my_center|LOCUS_56140 8628 6307 gene locus_tag LOCUS_56150 8628 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 9492 8659 gene locus_tag LOCUS_56160 9492 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 >Feature sequence238 <1 723 gene locus_tag LOCUS_56170 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72BN2:leucyl/phenylalanyl-tRNA--protein transferase 1477 755 gene locus_tag LOCUS_56180 gene truC 1477 755 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_56180 1628 2830 gene locus_tag LOCUS_56190 1628 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 2957 3946 gene locus_tag LOCUS_56200 2957 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 5409 4126 gene locus_tag LOCUS_56210 5409 4126 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_56210 5490 6440 gene locus_tag LOCUS_56220 5490 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_56220 7418 6969 gene locus_tag LOCUS_56230 7418 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 8448 7642 gene locus_tag LOCUS_56240 8448 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 <9569 8706 gene locus_tag LOCUS_56250 <9569 8706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207172.1:cyclopropane-fatty-acyl-phospholipid synthase >Feature sequence239 1 402 gene locus_tag LOCUS_56260 1 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 476 1465 gene locus_tag LOCUS_56270 476 1465 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_56270 1504 2238 gene locus_tag LOCUS_56280 1504 2238 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_56280 2350 3033 gene locus_tag LOCUS_56290 2350 3033 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_56290 3236 4480 gene locus_tag LOCUS_56300 3236 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 4504 5427 gene locus_tag LOCUS_56310 4504 5427 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_56310 6195 5515 gene locus_tag LOCUS_56320 6195 5515 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_56320 7256 6192 gene locus_tag LOCUS_56330 7256 6192 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_56330 8459 7491 gene locus_tag LOCUS_56340 8459 7491 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5C5 protein_id gnl|my_center|LOCUS_56340 8552 9244 gene locus_tag LOCUS_56350 8552 9244 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_56350 >Feature sequence240 270 1445 gene locus_tag LOCUS_56360 270 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 1442 3712 gene locus_tag LOCUS_56370 1442 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 3754 5391 gene locus_tag LOCUS_56380 3754 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 5388 7340 gene locus_tag LOCUS_56390 5388 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 8492 7347 gene locus_tag LOCUS_56400 8492 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 8752 8886 gene locus_tag LOCUS_56410 8752 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 >Feature sequence241 1436 294 gene locus_tag LOCUS_56420 gene clpX 1436 294 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_56420 1775 2455 gene locus_tag LOCUS_56430 1775 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 2515 5127 gene locus_tag LOCUS_56440 2515 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 6273 5170 gene locus_tag LOCUS_56450 gene ddl 6273 5170 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_56450 7740 6367 gene locus_tag LOCUS_56460 gene radA 7740 6367 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37572 protein_id gnl|my_center|LOCUS_56460 9044 7812 gene locus_tag LOCUS_56470 9044 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 >Feature sequence242 2341 1016 gene locus_tag LOCUS_56480 gene ugdH 2341 1016 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_56480 3463 2447 gene locus_tag LOCUS_56490 3463 2447 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_56490 4106 3738 gene locus_tag LOCUS_56500 4106 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 4273 5046 gene locus_tag LOCUS_56510 gene plsC 4273 5046 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_56510 5178 7604 gene locus_tag LOCUS_56520 5178 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 7604 7957 gene locus_tag LOCUS_56530 7604 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 8210 8749 gene locus_tag LOCUS_56540 8210 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 >Feature sequence243 1036 884 gene locus_tag LOCUS_56550 1036 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56550 2184 1138 gene locus_tag LOCUS_56560 2184 1138 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_56560 2547 2891 gene locus_tag LOCUS_56570 2547 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 2879 3448 gene locus_tag LOCUS_56580 2879 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 3475 3867 gene locus_tag LOCUS_56590 3475 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 4034 3864 gene locus_tag LOCUS_56600 4034 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 4079 5842 gene locus_tag LOCUS_56610 4079 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 5997 6866 gene locus_tag LOCUS_56620 gene rsmA 5997 6866 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_56620 >Feature sequence244 <1 1162 gene locus_tag LOCUS_56630 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267549.1:peptidase M20 1234 2688 gene locus_tag LOCUS_56640 1234 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 3919 2783 gene locus_tag LOCUS_56650 gene lacI 3919 2783 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_56650 4132 4569 gene locus_tag LOCUS_56660 4132 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 6993 4585 gene locus_tag LOCUS_56670 6993 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 8722 7043 gene locus_tag LOCUS_56680 8722 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 >Feature sequence245 2 361 gene locus_tag LOCUS_56690 2 361 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_56690 2200 548 gene locus_tag LOCUS_56700 2200 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 6576 2677 gene locus_tag LOCUS_56710 6576 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 >Feature sequence246 389 315 gene locus_tag LOCUS_t00750 389 315 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 672 598 gene locus_tag LOCUS_t00760 672 598 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 819 734 gene locus_tag LOCUS_t00770 819 734 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 925 850 gene locus_tag LOCUS_t00780 925 850 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1883 1149 gene locus_tag LOCUS_56720 1883 1149 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_56720 2465 1908 gene locus_tag LOCUS_56730 gene frr 2465 1908 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_56730 3383 2664 gene locus_tag LOCUS_56740 gene pyrH 3383 2664 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59003 protein_id gnl|my_center|LOCUS_56740 4045 3392 gene locus_tag LOCUS_56750 gene tsf 4045 3392 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_56750 5086 4250 gene locus_tag LOCUS_56760 gene rpsB 5086 4250 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_56760 5492 5100 gene locus_tag LOCUS_56770 gene rpsI 5492 5100 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX3 protein_id gnl|my_center|LOCUS_56770 5988 5539 gene locus_tag LOCUS_56780 gene rplM 5988 5539 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y8 protein_id gnl|my_center|LOCUS_56780 6344 7318 gene locus_tag LOCUS_56790 gene folD 6344 7318 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I0 protein_id gnl|my_center|LOCUS_56790 7315 7911 gene locus_tag LOCUS_56800 gene coaE 7315 7911 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZJ0 protein_id gnl|my_center|LOCUS_56800 8461 7937 gene locus_tag LOCUS_56810 8461 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 >Feature sequence247 <1 1399 gene locus_tag LOCUS_56820 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z3Q0:putative adenylate cyclase 3 1719 3176 gene locus_tag LOCUS_56830 1719 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 4972 6204 gene locus_tag LOCUS_56840 4972 6204 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887024.1 protein_id gnl|my_center|LOCUS_56840 7691 6288 gene locus_tag LOCUS_56850 gene argH 7691 6288 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 protein_id gnl|my_center|LOCUS_56850 >Feature sequence248 458 1990 gene locus_tag LOCUS_56860 458 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 2197 2868 gene locus_tag LOCUS_56870 2197 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 3060 4439 gene locus_tag LOCUS_56880 gene sdaA 3060 4439 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_56880 5595 4444 gene locus_tag LOCUS_56890 5595 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_56890 6803 5601 gene locus_tag LOCUS_56900 6803 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 7696 6815 gene locus_tag LOCUS_56910 7696 6815 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_56910 <8343 7696 gene locus_tag LOCUS_56920 <8343 7696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259304.1:carbon monoxide dehydrogenase >Feature sequence249 632 1852 gene locus_tag LOCUS_56930 632 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 1877 2467 gene locus_tag LOCUS_56940 gene tag 1877 2467 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_56940 2742 2536 gene locus_tag LOCUS_56950 2742 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 2758 4059 gene locus_tag LOCUS_56960 2758 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 4164 7496 gene locus_tag LOCUS_56970 4164 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 <8341 7520 gene locus_tag LOCUS_56980 <8341 7520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966927.1:alpha/beta hydrolase >Feature sequence250 <1 518 gene locus_tag LOCUS_56990 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B650:transporter 760 1404 gene locus_tag LOCUS_57000 gene msrA 760 1404 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_57000 2673 1420 gene locus_tag LOCUS_57010 2673 1420 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_57010 3679 2705 gene locus_tag LOCUS_57020 gene rluD 3679 2705 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_57020 4221 3676 gene locus_tag LOCUS_57030 gene lspA 4221 3676 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_57030 4604 4218 gene locus_tag LOCUS_57040 gene acpS 4604 4218 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP3 protein_id gnl|my_center|LOCUS_57040 5231 4608 gene locus_tag LOCUS_57050 gene thiE 5231 4608 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ74 protein_id gnl|my_center|LOCUS_57050 5596 5294 gene locus_tag LOCUS_57060 5596 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 5953 6837 gene locus_tag LOCUS_57070 5953 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 6997 7506 gene locus_tag LOCUS_57080 gene def 6997 7506 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_57080 7517 7894 gene locus_tag LOCUS_57090 7517 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 8008 8082 gene locus_tag LOCUS_t00790 8008 8082 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8171 8245 gene locus_tag LOCUS_t00800 8171 8245 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 <1 754 gene locus_tag LOCUS_57100 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391170.1:histidine kinase 781 969 gene locus_tag LOCUS_57110 781 969 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_57110 1941 985 gene locus_tag LOCUS_57120 1941 985 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_57120 4869 2014 gene locus_tag LOCUS_57130 4869 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 6066 5116 gene locus_tag LOCUS_57140 6066 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 6282 6548 gene locus_tag LOCUS_57150 6282 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 6989 8224 gene locus_tag LOCUS_57160 6989 8224 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_57160 >Feature sequence252 <1 2823 gene locus_tag LOCUS_57170 <1 2823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase 2872 4098 gene locus_tag LOCUS_57180 2872 4098 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_57180 5702 4356 gene locus_tag LOCUS_57190 5702 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 7506 5740 gene locus_tag LOCUS_57200 gene gspE 7506 5740 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_57200 >Feature sequence253 2302 482 gene locus_tag LOCUS_57210 2302 482 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_57210 4648 2645 gene locus_tag LOCUS_57220 4648 2645 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_57220 5129 6346 gene locus_tag LOCUS_57230 5129 6346 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_57230 6375 7043 gene locus_tag LOCUS_57240 gene tmk 6375 7043 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_57240 7040 7894 gene locus_tag LOCUS_57250 7040 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 >Feature sequence254 49 312 gene locus_tag LOCUS_57260 49 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 560 1021 gene locus_tag LOCUS_57270 560 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 3276 1018 gene locus_tag LOCUS_57280 gene rlmL 3276 1018 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_57280 3835 3410 gene locus_tag LOCUS_57290 3835 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 4695 3931 gene locus_tag LOCUS_57300 gene plsC 4695 3931 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q9 protein_id gnl|my_center|LOCUS_57300 5665 4688 gene locus_tag LOCUS_57310 5665 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 <7664 5756 gene locus_tag LOCUS_57320 <7664 5756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941123.1:exporter >Feature sequence255 <1 6145 gene locus_tag LOCUS_57330 <1 6145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs 6551 6877 gene locus_tag LOCUS_57340 6551 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 7507 7247 gene locus_tag LOCUS_57350 7507 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence256 230 457 gene locus_tag LOCUS_57360 230 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 1421 480 gene locus_tag LOCUS_57370 1421 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 2487 1432 gene locus_tag LOCUS_57380 2487 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 2686 2759 gene locus_tag LOCUS_t00810 2686 2759 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2995 3165 gene locus_tag LOCUS_57390 2995 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 4180 3200 gene locus_tag LOCUS_57400 4180 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 5528 4779 gene locus_tag LOCUS_57410 5528 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 7479 5614 gene locus_tag LOCUS_57420 7479 5614 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_57420 >Feature sequence257 1175 204 gene locus_tag LOCUS_57430 1175 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 1113 1628 gene locus_tag LOCUS_57440 1113 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 1812 2882 gene locus_tag LOCUS_57450 1812 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 4902 3052 gene locus_tag LOCUS_57460 4902 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 5321 4899 gene locus_tag LOCUS_57470 5321 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 5558 5893 gene locus_tag LOCUS_57480 5558 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 5917 6309 gene locus_tag LOCUS_57490 5917 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 6872 6324 gene locus_tag LOCUS_57500 6872 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 7101 7174 gene locus_tag LOCUS_t00820 7101 7174 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence258 1519 797 gene locus_tag LOCUS_57510 1519 797 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_57510 3240 1546 gene locus_tag LOCUS_57520 3240 1546 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972864.1 protein_id gnl|my_center|LOCUS_57520 4070 3237 gene locus_tag LOCUS_57530 4070 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 5093 4509 gene locus_tag LOCUS_57540 5093 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_57540 5319 5927 gene locus_tag LOCUS_57550 5319 5927 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_57550 >Feature sequence259 4132 317 gene locus_tag LOCUS_57560 4132 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 4680 4267 gene locus_tag LOCUS_57570 4680 4267 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185699.1 protein_id gnl|my_center|LOCUS_57570 4876 5883 gene locus_tag LOCUS_57580 4876 5883 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_57580 5928 6101 gene locus_tag LOCUS_57590 5928 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57590 6290 7027 gene locus_tag LOCUS_57600 6290 7027 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 protein_id gnl|my_center|LOCUS_57600 >Feature sequence260 501 971 gene locus_tag LOCUS_57610 gene dtd 501 971 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT1 protein_id gnl|my_center|LOCUS_57610 1272 985 gene locus_tag LOCUS_57620 gene hupB 1272 985 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_57620 2725 1490 gene locus_tag LOCUS_57630 2725 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 3238 5544 gene locus_tag LOCUS_57640 3238 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 5722 6351 gene locus_tag LOCUS_57650 5722 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 >Feature sequence261 513 2072 gene locus_tag LOCUS_57660 gene lnt 513 2072 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP1 protein_id gnl|my_center|LOCUS_57660 2314 3315 gene locus_tag LOCUS_57670 gene prfB 2314 3315 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPZ1 protein_id gnl|my_center|LOCUS_57670 3455 5092 gene locus_tag LOCUS_57680 3455 5092 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256096.1 protein_id gnl|my_center|LOCUS_57680 5122 6912 gene locus_tag LOCUS_57690 5122 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 >Feature sequence262 1806 1967 gene locus_tag LOCUS_57700 1806 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 2144 4639 gene locus_tag LOCUS_57710 2144 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 4643 5500 gene locus_tag LOCUS_57720 4643 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 5497 6618 gene locus_tag LOCUS_57730 5497 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 >Feature sequence263 <1 1091 gene locus_tag LOCUS_57740 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073002.1:peptidase S8 3017 1197 gene locus_tag LOCUS_57750 3017 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 3208 4032 gene locus_tag LOCUS_57760 3208 4032 CDS product BtpA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_57760 4046 4915 gene locus_tag LOCUS_57770 4046 4915 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250794.1 protein_id gnl|my_center|LOCUS_57770 5083 5313 gene locus_tag LOCUS_57780 5083 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 6196 5384 gene locus_tag LOCUS_57790 6196 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 >Feature sequence264 1438 512 gene locus_tag LOCUS_57800 1438 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 3122 1860 gene locus_tag LOCUS_57810 3122 1860 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_57810 3601 3131 gene locus_tag LOCUS_57820 3601 3131 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_57820 4057 3704 gene locus_tag LOCUS_57830 4057 3704 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_57830 4826 4176 gene locus_tag LOCUS_57840 4826 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 6186 5092 gene locus_tag LOCUS_57850 6186 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 >Feature sequence265 <1 2096 gene locus_tag LOCUS_57860 <1 2096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140133.1:oligopeptidase B 2463 4442 gene locus_tag LOCUS_57870 2463 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 4655 5263 gene locus_tag LOCUS_57880 4655 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 >Feature sequence266 424 1170 gene locus_tag LOCUS_57890 424 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 2368 1274 gene locus_tag LOCUS_57900 2368 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_57900 3186 2395 gene locus_tag LOCUS_57910 gene pdxH 3186 2395 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_57910 4108 3179 gene locus_tag LOCUS_57920 4108 3179 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_57920 4193 4411 gene locus_tag LOCUS_57930 4193 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 4669 5283 gene locus_tag LOCUS_57940 4669 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 5374 5805 gene locus_tag LOCUS_57950 5374 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 >Feature sequence267 1 582 gene locus_tag LOCUS_57960 1 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 2238 616 gene locus_tag LOCUS_57970 2238 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 3047 2559 gene locus_tag LOCUS_57980 3047 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 3639 3031 gene locus_tag LOCUS_57990 3639 3031 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_57990 5029 5973 gene locus_tag LOCUS_58000 5029 5973 CDS product plasmid replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_58000 >Feature sequence268 503 15 gene locus_tag LOCUS_58010 503 15 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_58010 901 578 gene locus_tag LOCUS_58020 901 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 786 1583 gene locus_tag LOCUS_58030 786 1583 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_58030 1658 2431 gene locus_tag LOCUS_58040 1658 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 2956 4518 gene locus_tag LOCUS_58050 2956 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 <6417 4748 gene locus_tag LOCUS_58060 <6417 4748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140642.1:glucosamine-6-sulfatase >Feature sequence269 824 246 gene locus_tag LOCUS_58070 824 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 2441 1101 gene locus_tag LOCUS_58080 2441 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 2818 4065 gene locus_tag LOCUS_58090 2818 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 4062 4325 gene locus_tag LOCUS_58100 4062 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 5444 4227 gene locus_tag LOCUS_58110 5444 4227 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_58110 6300 5479 gene locus_tag LOCUS_58120 6300 5479 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_58120 >Feature sequence270 <1 831 gene locus_tag LOCUS_58130 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958496.1:EF-P beta-lysylation protein EpmB 1009 2418 gene locus_tag LOCUS_58140 1009 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 3717 2539 gene locus_tag LOCUS_58150 3717 2539 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_58150 6165 3736 gene locus_tag LOCUS_58160 6165 3736 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_58160 >Feature sequence271 530 895 gene locus_tag LOCUS_58170 530 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029504.1 protein_id gnl|my_center|LOCUS_58170 1855 1184 gene locus_tag LOCUS_58180 1855 1184 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_58180 2239 3366 gene locus_tag LOCUS_58190 2239 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 <6322 3986 gene locus_tag LOCUS_58200 <6322 3986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969213.1:relaxase >Feature sequence272 <1 742 gene locus_tag LOCUS_58210 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404630.1:peptidase 2881 818 gene locus_tag LOCUS_58220 2881 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142567.1 protein_id gnl|my_center|LOCUS_58220 3205 4728 gene locus_tag LOCUS_58230 3205 4728 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_58230 5166 4903 gene locus_tag LOCUS_58240 5166 4903 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_58240 5447 6070 gene locus_tag LOCUS_58250 5447 6070 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_58250 >Feature sequence273 1300 500 gene locus_tag LOCUS_58260 1300 500 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_58260 1545 3095 gene locus_tag LOCUS_58270 1545 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 3104 3811 gene locus_tag LOCUS_58280 3104 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 6147 3871 gene locus_tag LOCUS_58290 6147 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence274 936 1913 gene locus_tag LOCUS_58300 936 1913 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_58300 1903 2673 gene locus_tag LOCUS_58310 1903 2673 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 protein_id gnl|my_center|LOCUS_58310 2707 4638 gene locus_tag LOCUS_58320 2707 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 4635 5807 gene locus_tag LOCUS_58330 4635 5807 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640160.1 protein_id gnl|my_center|LOCUS_58330 >Feature sequence275 334 1776 gene locus_tag LOCUS_58340 334 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 2069 1851 gene locus_tag LOCUS_58350 2069 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 2026 3939 gene locus_tag LOCUS_58360 2026 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 >Feature sequence276 202 2091 gene locus_tag LOCUS_58370 202 2091 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_58370 2088 3689 gene locus_tag LOCUS_58380 2088 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 >Feature sequence277 581 2023 gene locus_tag LOCUS_58390 581 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 2147 2569 gene locus_tag LOCUS_58400 2147 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 2584 4095 gene locus_tag LOCUS_58410 2584 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 4118 4642 gene locus_tag LOCUS_58420 gene yitI 4118 4642 CDS product putative N-acetyltransferase YitI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06744 protein_id gnl|my_center|LOCUS_58420 >Feature sequence278 1492 614 gene locus_tag LOCUS_58430 1492 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58430 1872 1672 gene locus_tag LOCUS_58440 1872 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 3833 1872 gene locus_tag LOCUS_58450 gene feoB 3833 1872 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_58450 4129 3863 gene locus_tag LOCUS_58460 4129 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 >Feature sequence279 1459 407 gene locus_tag LOCUS_58470 1459 407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248974.1 protein_id gnl|my_center|LOCUS_58470 1615 3240 gene locus_tag LOCUS_58480 1615 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 3465 4841 gene locus_tag LOCUS_58490 gene dhs1 3465 4841 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_58490 >Feature sequence280 1233 964 gene locus_tag LOCUS_58500 1233 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_58500 1408 2754 gene locus_tag LOCUS_58510 1408 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 4567 2789 gene locus_tag LOCUS_58520 gene sopT 4567 2789 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_58520 >Feature sequence281 3545 2403 gene locus_tag LOCUS_58530 gene solA 3545 2403 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_58530 3844 3569 gene locus_tag LOCUS_58540 3844 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 5274 5008 gene locus_tag LOCUS_58550 5274 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 >Feature sequence282 8 1552 gene locus_tag LOCUS_58560 8 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 2529 1558 gene locus_tag LOCUS_58570 gene asd 2529 1558 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_58570 3446 2670 gene locus_tag LOCUS_58580 gene pssA 3446 2670 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_58580 3868 3650 gene locus_tag LOCUS_58590 3868 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 4634 4143 gene locus_tag LOCUS_58600 gene rimI 4634 4143 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJL0 protein_id gnl|my_center|LOCUS_58600 >Feature sequence283 854 1045 gene locus_tag LOCUS_58610 854 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 1222 3675 gene locus_tag LOCUS_58620 1222 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 3672 5018 gene locus_tag LOCUS_58630 3672 5018 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_58630 >Feature sequence284 2082 1222 gene locus_tag LOCUS_58640 2082 1222 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_58640 3134 2079 gene locus_tag LOCUS_58650 gene troA 3134 2079 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_58650 >Feature sequence285 924 25 gene locus_tag LOCUS_58660 924 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 2051 927 gene locus_tag LOCUS_58670 2051 927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_58670 2223 2729 gene locus_tag LOCUS_58680 2223 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 3530 2775 gene locus_tag LOCUS_58690 gene ybgI 3530 2775 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6N4 protein_id gnl|my_center|LOCUS_58690 4743 3634 gene locus_tag LOCUS_58700 4743 3634 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870467.1 protein_id gnl|my_center|LOCUS_58700 >Feature sequence286 3344 2139 gene locus_tag LOCUS_58710 3344 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 4782 3358 gene locus_tag LOCUS_58720 4782 3358 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_58720 >Feature sequence287 1970 3226 gene locus_tag LOCUS_58730 1970 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 3228 4814 gene locus_tag LOCUS_58740 3228 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence288 448 714 gene locus_tag LOCUS_58750 448 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 1515 2801 gene locus_tag LOCUS_58760 1515 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 2825 4240 gene locus_tag LOCUS_58770 2825 4240 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_58770 >Feature sequence289 2232 3947 gene locus_tag LOCUS_58780 2232 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 >Feature sequence290 1442 1834 gene locus_tag LOCUS_58790 1442 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 2582 1857 gene locus_tag LOCUS_58800 2582 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 3480 4649 gene locus_tag LOCUS_58810 3480 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 >Feature sequence291 823 1407 gene locus_tag LOCUS_58820 823 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 1407 2087 gene locus_tag LOCUS_58830 1407 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 2080 2679 gene locus_tag LOCUS_58840 2080 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 2666 3421 gene locus_tag LOCUS_58850 2666 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 3537 3947 gene locus_tag LOCUS_58860 3537 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 >Feature sequence292 >Feature sequence293 1206 2066 gene locus_tag LOCUS_58870 1206 2066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_58870 >Feature sequence294 1711 323 gene locus_tag LOCUS_58880 1711 323 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLK6 protein_id gnl|my_center|LOCUS_58880 2921 1713 gene locus_tag LOCUS_58890 2921 1713 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLK5 protein_id gnl|my_center|LOCUS_58890 <4389 3043 gene locus_tag LOCUS_58900 <4389 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227836.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence295 1040 1810 gene locus_tag LOCUS_58910 1040 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 >Feature sequence296 1010 243 gene locus_tag LOCUS_58920 1010 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 2027 1149 gene locus_tag LOCUS_58930 2027 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 3500 2094 gene locus_tag LOCUS_58940 3500 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 >Feature sequence297 2272 80 gene locus_tag LOCUS_58950 2272 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 3707 2712 gene locus_tag LOCUS_58960 3707 2712 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_58960 4078 3890 gene locus_tag LOCUS_58970 4078 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 >Feature sequence298 2083 683 gene locus_tag LOCUS_58980 2083 683 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_58980 3034 2135 gene locus_tag LOCUS_58990 3034 2135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_58990 3998 3069 gene locus_tag LOCUS_59000 3998 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 >Feature sequence299 947 1363 gene locus_tag LOCUS_59010 947 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 1364 1825 gene locus_tag LOCUS_59020 1364 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 2184 2615 gene locus_tag LOCUS_59030 2184 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence300 >Feature sequence301 1545 1745 gene locus_tag LOCUS_59040 1545 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 2283 1717 gene locus_tag LOCUS_59050 2283 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 2469 3314 gene locus_tag LOCUS_59060 gene mscS-2 2469 3314 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_59060 3678 3385 gene locus_tag LOCUS_59070 3678 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 >Feature sequence302 2673 1303 gene locus_tag LOCUS_59080 gene proA 2673 1303 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_59080 <3892 2744 gene locus_tag LOCUS_59090 <3892 2744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89X86:glutamate 5-kinase >Feature sequence303 <1 806 gene locus_tag LOCUS_59100 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64VV7:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex 1004 1639 gene locus_tag LOCUS_59110 1004 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_59110 >Feature sequence304 2112 691 gene locus_tag LOCUS_59120 2112 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 2398 3540 gene locus_tag LOCUS_59130 2398 3540 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_59130 >Feature sequence305 2827 458 gene locus_tag LOCUS_59140 2827 458 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_59140 3300 2824 gene locus_tag LOCUS_59150 3300 2824 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_59150 >Feature sequence306 1797 478 gene locus_tag LOCUS_59160 1797 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 >Feature sequence307 1676 3388 gene locus_tag LOCUS_59170 1676 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 >Feature sequence308 452 126 gene locus_tag LOCUS_59180 452 126 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140361.1 protein_id gnl|my_center|LOCUS_59180 715 449 gene locus_tag LOCUS_59190 gene parD4 715 449 CDS product antitoxin ParD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A458 protein_id gnl|my_center|LOCUS_59190 2948 1038 gene locus_tag LOCUS_59200 2948 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 >Feature sequence309 >Feature sequence310 1654 287 gene locus_tag LOCUS_59210 1654 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59210 2057 2908 gene locus_tag LOCUS_59220 gene pyrF 2057 2908 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR8 protein_id gnl|my_center|LOCUS_59220 >Feature sequence311 71 928 gene locus_tag LOCUS_59230 gene cobB 71 928 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIH7 protein_id gnl|my_center|LOCUS_59230 1450 941 gene locus_tag LOCUS_59240 1450 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 2289 1447 gene locus_tag LOCUS_59250 2289 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_59250 >Feature sequence312 >Feature sequence313 >Feature sequence314 207 440 gene locus_tag LOCUS_59260 207 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 521 778 gene locus_tag LOCUS_59270 521 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 1667 786 gene locus_tag LOCUS_59280 1667 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 3315 1828 gene locus_tag LOCUS_59290 3315 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 >Feature sequence315 1598 108 gene locus_tag LOCUS_59300 1598 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 2299 1595 gene locus_tag LOCUS_59310 2299 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 2934 2329 gene locus_tag LOCUS_59320 2934 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 >Feature sequence316 1340 228 gene locus_tag LOCUS_59330 gene dinB2 1340 228 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_59330 2357 1566 gene locus_tag LOCUS_59340 2357 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 2693 2424 gene locus_tag LOCUS_59350 2693 2424 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_59350 >Feature sequence317 <1 1107 gene locus_tag LOCUS_59360 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074377.1:integrase 1911 1270 gene locus_tag LOCUS_59370 1911 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 2695 2021 gene locus_tag LOCUS_59380 2695 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 >Feature sequence318 919 1704 gene locus_tag LOCUS_59390 919 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 1818 2573 gene locus_tag LOCUS_59400 1818 2573 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_59400 >Feature sequence319 >Feature sequence320 591 22 gene locus_tag LOCUS_59410 591 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 1977 616 gene locus_tag LOCUS_59420 1977 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 2465 1974 gene locus_tag LOCUS_59430 2465 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 >Feature sequence321 1013 2686 gene locus_tag LOCUS_59440 1013 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 >Feature sequence322 1243 443 gene locus_tag LOCUS_59450 1243 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 1974 1330 gene locus_tag LOCUS_59460 1974 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 >Feature sequence323 1202 267 gene locus_tag LOCUS_59470 1202 267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640248.1 protein_id gnl|my_center|LOCUS_59470 <2597 1199 gene locus_tag LOCUS_59480 <2597 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202627.1:coproporphyrinogen III oxidase >Feature sequence324 1976 348 gene locus_tag LOCUS_59490 1976 348 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029980.1 protein_id gnl|my_center|LOCUS_59490 >Feature sequence325 <1 2011 gene locus_tag LOCUS_59500 <1 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:membrane protein >Feature sequence326 <1 903 gene locus_tag LOCUS_59510 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638169.2:endoproteinase ArgC >Feature sequence327 >Feature sequence328 2 421 gene locus_tag LOCUS_59520 2 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 1342 845 gene locus_tag LOCUS_59530 1342 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 >Feature sequence329 1531 191 gene locus_tag LOCUS_59540 1531 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 1908 1528 gene locus_tag LOCUS_59550 1908 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 >Feature sequence330 1560 460 gene locus_tag LOCUS_59560 1560 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59560 >Feature sequence331 1147 1935 gene locus_tag LOCUS_59570 1147 1935 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_59570 >Feature sequence332 981 487 gene locus_tag LOCUS_59580 981 487 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_59580 1975 995 gene locus_tag LOCUS_59590 1975 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 >Feature sequence333 117 1583 gene locus_tag LOCUS_59600 gene istA 117 1583 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_59600 >Feature sequence334 1769 99 gene locus_tag LOCUS_59610 1769 99 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_59610 >Feature sequence335 137 511 gene locus_tag LOCUS_59620 137 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 844 1815 gene locus_tag LOCUS_59630 844 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 >Feature sequence336 1688 297 gene locus_tag LOCUS_59640 1688 297 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_59640 >Feature sequence337