>Feature sequence001 392 307 gene locus_tag LOCUS_t00010 392 307 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 756 409 gene locus_tag LOCUS_00010 gene secG 756 409 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769079.1 protein_id gnl|my_center|LOCUS_00010 1505 759 gene locus_tag LOCUS_00020 gene tpiA 1505 759 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLD8 protein_id gnl|my_center|LOCUS_00020 2041 1574 gene locus_tag LOCUS_00030 2041 1574 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_00030 2156 3460 gene locus_tag LOCUS_00040 gene dnaA 2156 3460 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD8 protein_id gnl|my_center|LOCUS_00040 3664 4767 gene locus_tag LOCUS_00050 gene dnaN 3664 4767 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXS8 protein_id gnl|my_center|LOCUS_00050 4773 5858 gene locus_tag LOCUS_00060 gene recF 4773 5858 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43767 protein_id gnl|my_center|LOCUS_00060 6004 8406 gene locus_tag LOCUS_00070 gene gyrB 6004 8406 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_00070 8429 9313 gene locus_tag LOCUS_00080 gene prk 8429 9313 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC81 protein_id gnl|my_center|LOCUS_00080 9462 10706 gene locus_tag LOCUS_00090 9462 10706 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_00090 13176 10717 gene locus_tag LOCUS_00100 gene leuS 13176 10717 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_00100 14146 13184 gene locus_tag LOCUS_00110 gene pyrD 14146 13184 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGM0 protein_id gnl|my_center|LOCUS_00110 14141 14827 gene locus_tag LOCUS_00120 14141 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15185 14829 gene locus_tag LOCUS_00130 gene sspB 15185 14829 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948401.1 protein_id gnl|my_center|LOCUS_00130 15825 15196 gene locus_tag LOCUS_00140 gene sspA 15825 15196 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACA3 protein_id gnl|my_center|LOCUS_00140 16599 15910 gene locus_tag LOCUS_00150 gene petC 16599 15910 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 protein_id gnl|my_center|LOCUS_00150 17827 16601 gene locus_tag LOCUS_00160 17827 16601 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_00160 18433 17840 gene locus_tag LOCUS_00170 gene petA 18433 17840 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ1 protein_id gnl|my_center|LOCUS_00170 18849 18544 gene locus_tag LOCUS_00180 18849 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18916 21594 gene locus_tag LOCUS_00190 gene secA 18916 21594 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Q8 protein_id gnl|my_center|LOCUS_00190 21587 22663 gene locus_tag LOCUS_00200 gene anmK 21587 22663 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_00200 22653 23684 gene locus_tag LOCUS_00210 gene pyrC 22653 23684 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72170 protein_id gnl|my_center|LOCUS_00210 24599 23664 gene locus_tag LOCUS_00220 24599 23664 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S91 protein_id gnl|my_center|LOCUS_00220 25667 24618 gene locus_tag LOCUS_00230 gene mutY 25667 24618 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261209.1 protein_id gnl|my_center|LOCUS_00230 25896 25684 gene locus_tag LOCUS_00240 25896 25684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27006 25942 gene locus_tag LOCUS_00250 27006 25942 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_00250 27842 27006 gene locus_tag LOCUS_00260 27842 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 protein_id gnl|my_center|LOCUS_00260 29058 27871 gene locus_tag LOCUS_00270 29058 27871 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_00270 29393 29067 gene locus_tag LOCUS_00280 gene fbp 29393 29067 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_00280 30109 29402 gene locus_tag LOCUS_00290 30109 29402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_00290 31083 30208 gene locus_tag LOCUS_00300 gene purC 31083 30208 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K063 protein_id gnl|my_center|LOCUS_00300 31193 31807 gene locus_tag LOCUS_00310 31193 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32911 31802 gene locus_tag LOCUS_00320 32911 31802 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_00320 34055 32904 gene locus_tag LOCUS_00330 gene dxr 34055 32904 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_00330 34852 34052 gene locus_tag LOCUS_00340 gene cdsA 34852 34052 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44937 protein_id gnl|my_center|LOCUS_00340 35559 34852 gene locus_tag LOCUS_00350 gene uppS 35559 34852 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME1 protein_id gnl|my_center|LOCUS_00350 35632 36405 gene locus_tag LOCUS_00360 gene hisF 35632 36405 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_00360 36473 37006 gene locus_tag LOCUS_00370 36473 37006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37006 37902 gene locus_tag LOCUS_00380 gene cyoE 37006 37902 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 protein_id gnl|my_center|LOCUS_00380 37920 38114 gene locus_tag LOCUS_00390 37920 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39220 38240 gene locus_tag LOCUS_00400 gene ctaA 39220 38240 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_00400 40123 39296 gene locus_tag LOCUS_00410 40123 39296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_00410 40326 41423 gene locus_tag LOCUS_00420 40326 41423 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IS0 protein_id gnl|my_center|LOCUS_00420 41440 43047 gene locus_tag LOCUS_00430 gene coxA 41440 43047 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_00430 43225 43674 gene locus_tag LOCUS_00440 43225 43674 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_00440 43692 44576 gene locus_tag LOCUS_00450 gene coxC 43692 44576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_00450 44604 44831 gene locus_tag LOCUS_00460 44604 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44828 45517 gene locus_tag LOCUS_00470 44828 45517 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_00470 45688 47106 gene locus_tag LOCUS_00480 gene ccoN2 45688 47106 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_00480 47119 47850 gene locus_tag LOCUS_00490 47119 47850 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268423.1 protein_id gnl|my_center|LOCUS_00490 47850 47996 gene locus_tag LOCUS_00500 47850 47996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48009 49175 gene locus_tag LOCUS_00510 48009 49175 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TP18 protein_id gnl|my_center|LOCUS_00510 49297 49372 gene locus_tag LOCUS_t00020 49297 49372 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49604 50038 gene locus_tag LOCUS_00520 gene norC 49604 50038 CDS product nitric oxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59646 protein_id gnl|my_center|LOCUS_00520 50050 51441 gene locus_tag LOCUS_00530 gene norB 50050 51441 CDS product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59647 protein_id gnl|my_center|LOCUS_00530 51516 52079 gene locus_tag LOCUS_00540 51516 52079 CDS product cytochrome C oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_00540 52136 52345 gene locus_tag LOCUS_00550 52136 52345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52356 53150 gene locus_tag LOCUS_00560 gene nirQ 52356 53150 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_00560 53134 53526 gene locus_tag LOCUS_00570 53134 53526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53527 55359 gene locus_tag LOCUS_00580 53527 55359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51484 protein_id gnl|my_center|LOCUS_00580 56322 55348 gene locus_tag LOCUS_00590 56322 55348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57098 56316 gene locus_tag LOCUS_00600 57098 56316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58335 57202 gene locus_tag LOCUS_00610 58335 57202 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 protein_id gnl|my_center|LOCUS_00610 60838 58721 gene locus_tag LOCUS_00620 gene nosR 60838 58721 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_00620 61035 61505 gene locus_tag LOCUS_00630 61035 61505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63203 62310 gene locus_tag LOCUS_00640 gene nosF 63203 62310 CDS product copper ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_00640 64401 63181 gene locus_tag LOCUS_00650 gene nosD 64401 63181 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083148.1 protein_id gnl|my_center|LOCUS_00650 66435 64519 gene locus_tag LOCUS_00660 gene nosZ 66435 64519 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ6 protein_id gnl|my_center|LOCUS_00660 >Feature sequence002 473 63 gene locus_tag LOCUS_00670 473 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 904 467 gene locus_tag LOCUS_00680 gene dtd 904 467 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX9 protein_id gnl|my_center|LOCUS_00680 2947 911 gene locus_tag LOCUS_00690 gene glyS 2947 911 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43822 protein_id gnl|my_center|LOCUS_00690 3669 2956 gene locus_tag LOCUS_00700 gene minC 3669 2956 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV87 protein_id gnl|my_center|LOCUS_00700 4082 3666 gene locus_tag LOCUS_00710 4082 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5008 4082 gene locus_tag LOCUS_00720 5008 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5460 5008 gene locus_tag LOCUS_00730 gene tolR 5460 5008 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242259.1 protein_id gnl|my_center|LOCUS_00730 6138 5470 gene locus_tag LOCUS_00740 6138 5470 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_00740 6529 6128 gene locus_tag LOCUS_00750 6529 6128 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_00750 7550 6522 gene locus_tag LOCUS_00760 gene ruvB 7550 6522 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44631 protein_id gnl|my_center|LOCUS_00760 8064 7573 gene locus_tag LOCUS_00770 8064 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8179 9429 gene locus_tag LOCUS_00780 gene hemA 8179 9429 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ24 protein_id gnl|my_center|LOCUS_00780 9429 10520 gene locus_tag LOCUS_00790 gene prfA 9429 10520 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_00790 11306 10512 gene locus_tag LOCUS_00800 gene znuB 11306 10512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969555.1 protein_id gnl|my_center|LOCUS_00800 11723 11316 gene locus_tag LOCUS_00810 gene fur 11723 11316 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 protein_id gnl|my_center|LOCUS_00810 11787 12557 gene locus_tag LOCUS_00820 11787 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 12571 13173 gene locus_tag LOCUS_00830 gene ccmA 12571 13173 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE3 protein_id gnl|my_center|LOCUS_00830 13170 13835 gene locus_tag LOCUS_00840 13170 13835 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE4 protein_id gnl|my_center|LOCUS_00840 14014 15147 gene locus_tag LOCUS_00850 gene metK 14014 15147 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_00850 15279 16649 gene locus_tag LOCUS_00860 gene sahH 15279 16649 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_00860 16841 17824 gene locus_tag LOCUS_00870 16841 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 18107 19006 gene locus_tag LOCUS_00880 gene glyQ 18107 19006 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_00880 19013 19585 gene locus_tag LOCUS_00890 19013 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_00890 19575 20153 gene locus_tag LOCUS_00900 19575 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 20171 21208 gene locus_tag LOCUS_00910 20171 21208 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_00910 21260 22543 gene locus_tag LOCUS_00920 gene miaB 21260 22543 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV6 protein_id gnl|my_center|LOCUS_00920 22857 22540 gene locus_tag LOCUS_00930 22857 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 23674 22985 gene locus_tag LOCUS_00940 23674 22985 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_00940 24169 23675 gene locus_tag LOCUS_00950 24169 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 24625 24245 gene locus_tag LOCUS_00960 24625 24245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 24738 25655 gene locus_tag LOCUS_00970 24738 25655 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_00970 25648 26733 gene locus_tag LOCUS_00980 gene mnmA 25648 26733 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_00980 26726 27364 gene locus_tag LOCUS_00990 gene hflD 26726 27364 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLJ4 protein_id gnl|my_center|LOCUS_00990 27451 27711 gene locus_tag LOCUS_01000 gene rpsT 27451 27711 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD9 protein_id gnl|my_center|LOCUS_01000 27776 28258 gene locus_tag LOCUS_01010 27776 28258 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_01010 28262 29665 gene locus_tag LOCUS_01020 gene xseA 28262 29665 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E765 protein_id gnl|my_center|LOCUS_01020 29652 30476 gene locus_tag LOCUS_01030 29652 30476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_01030 30466 30861 gene locus_tag LOCUS_01040 30466 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 30932 31171 gene locus_tag LOCUS_01050 30932 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 31189 31524 gene locus_tag LOCUS_01060 31189 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 31631 32284 gene locus_tag LOCUS_01070 gene ispD 31631 32284 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ2 protein_id gnl|my_center|LOCUS_01070 32281 32754 gene locus_tag LOCUS_01080 gene ispF 32281 32754 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z805 protein_id gnl|my_center|LOCUS_01080 32751 34172 gene locus_tag LOCUS_01090 gene murC 32751 34172 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_01090 34182 35015 gene locus_tag LOCUS_01100 gene murB 34182 35015 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_01100 >Feature sequence003 1874 1278 gene locus_tag LOCUS_01110 gene sdhC 1874 1278 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_01110 2343 1861 gene locus_tag LOCUS_01120 2343 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2633 5005 gene locus_tag LOCUS_01130 2633 5005 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA34 protein_id gnl|my_center|LOCUS_01130 4986 5810 gene locus_tag LOCUS_01140 4986 5810 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_01140 5867 7591 gene locus_tag LOCUS_01150 5867 7591 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887488.1 protein_id gnl|my_center|LOCUS_01150 7588 8898 gene locus_tag LOCUS_01160 gene mifR 7588 8898 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_01160 9016 10014 gene locus_tag LOCUS_01170 gene dctP 9016 10014 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU18 protein_id gnl|my_center|LOCUS_01170 10152 10664 gene locus_tag LOCUS_01180 gene dctQ 10152 10664 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS0 protein_id gnl|my_center|LOCUS_01180 10661 11959 gene locus_tag LOCUS_01190 gene dctM 10661 11959 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU16 protein_id gnl|my_center|LOCUS_01190 12374 12826 gene locus_tag LOCUS_01200 gene mraZ 12374 12826 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIF8 protein_id gnl|my_center|LOCUS_01200 12823 13749 gene locus_tag LOCUS_01210 gene rsmH 12823 13749 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P0 protein_id gnl|my_center|LOCUS_01210 13749 14045 gene locus_tag LOCUS_01220 13749 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 14042 15934 gene locus_tag LOCUS_01230 gene ftsI 14042 15934 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039091.1 protein_id gnl|my_center|LOCUS_01230 17751 15931 gene locus_tag LOCUS_01240 gene dnaG 17751 15931 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_01240 17765 18661 gene locus_tag LOCUS_01250 gene htrB 17765 18661 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL5 protein_id gnl|my_center|LOCUS_01250 18746 19006 gene locus_tag LOCUS_01260 gene rpsO 18746 19006 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_01260 19078 20172 gene locus_tag LOCUS_01270 gene prfB 19078 20172 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSP3 protein_id gnl|my_center|LOCUS_01270 20185 21579 gene locus_tag LOCUS_01280 gene gor 20185 21579 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 protein_id gnl|my_center|LOCUS_01280 22058 21582 gene locus_tag LOCUS_01290 22058 21582 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853387.1 protein_id gnl|my_center|LOCUS_01290 22114 22494 gene locus_tag LOCUS_01300 22114 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 22487 22801 gene locus_tag LOCUS_01310 gene hisE 22487 22801 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60536 protein_id gnl|my_center|LOCUS_01310 22824 23042 gene locus_tag LOCUS_01320 22824 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 23052 23360 gene locus_tag LOCUS_01330 23052 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 23357 24283 gene locus_tag LOCUS_01340 gene tatC 23357 24283 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_01340 24871 24287 gene locus_tag LOCUS_01350 gene nasT 24871 24287 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765699.1 protein_id gnl|my_center|LOCUS_01350 25332 24889 gene locus_tag LOCUS_01360 25332 24889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_01360 26705 25488 gene locus_tag LOCUS_01370 gene amtB 26705 25488 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_01370 27063 26716 gene locus_tag LOCUS_01380 27063 26716 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_01380 28258 27323 gene locus_tag LOCUS_01390 28258 27323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 30156 28255 gene locus_tag LOCUS_01400 gene ligA 30156 28255 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence004 297 815 gene locus_tag LOCUS_01410 gene ampD 297 815 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_01410 812 1345 gene locus_tag LOCUS_01420 812 1345 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268860.1 protein_id gnl|my_center|LOCUS_01420 1342 1641 gene locus_tag LOCUS_01430 1342 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2054 1638 gene locus_tag LOCUS_01440 gene atpC 2054 1638 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI1 protein_id gnl|my_center|LOCUS_01440 3434 2055 gene locus_tag LOCUS_01450 gene atpD 3434 2055 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 protein_id gnl|my_center|LOCUS_01450 4334 3471 gene locus_tag LOCUS_01460 gene atpG 4334 3471 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL23 protein_id gnl|my_center|LOCUS_01460 5885 4344 gene locus_tag LOCUS_01470 gene atpA 5885 4344 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B8 protein_id gnl|my_center|LOCUS_01470 6461 5913 gene locus_tag LOCUS_01480 gene atpH 6461 5913 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXP9 protein_id gnl|my_center|LOCUS_01480 6941 6471 gene locus_tag LOCUS_01490 gene atpF 6941 6471 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F4Z4 protein_id gnl|my_center|LOCUS_01490 7218 6982 gene locus_tag LOCUS_01500 gene atpE 7218 6982 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTD2 protein_id gnl|my_center|LOCUS_01500 8122 7259 gene locus_tag LOCUS_01510 gene atpB 8122 7259 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS8 protein_id gnl|my_center|LOCUS_01510 8367 8104 gene locus_tag LOCUS_01520 8367 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 8568 9854 gene locus_tag LOCUS_01530 gene sqr 8568 9854 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_01530 11567 9903 gene locus_tag LOCUS_01540 gene recN 11567 9903 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_01540 12401 11580 gene locus_tag LOCUS_01550 gene nadK 12401 11580 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX6 protein_id gnl|my_center|LOCUS_01550 12490 13035 gene locus_tag LOCUS_01560 gene grpE 12490 13035 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3A5 protein_id gnl|my_center|LOCUS_01560 13405 13070 gene locus_tag LOCUS_01570 13405 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13681 13409 gene locus_tag LOCUS_01580 13681 13409 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM64 protein_id gnl|my_center|LOCUS_01580 14238 13951 gene locus_tag LOCUS_01590 14238 13951 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_01590 14462 14238 gene locus_tag LOCUS_01600 gene parD-4 14462 14238 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_01600 14992 15630 gene locus_tag LOCUS_01610 gene adk 14992 15630 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_01610 15805 18033 gene locus_tag LOCUS_01620 gene dsbD 15805 18033 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B02 protein_id gnl|my_center|LOCUS_01620 18124 18567 gene locus_tag LOCUS_01630 gene aroQ 18124 18567 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRC4 protein_id gnl|my_center|LOCUS_01630 18571 19020 gene locus_tag LOCUS_01640 18571 19020 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_01640 19017 20378 gene locus_tag LOCUS_01650 gene accC 19017 20378 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43873 protein_id gnl|my_center|LOCUS_01650 20393 21424 gene locus_tag LOCUS_01660 gene argC 20393 21424 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_01660 21434 21787 gene locus_tag LOCUS_01670 gene erpA 21434 21787 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45344 protein_id gnl|my_center|LOCUS_01670 21953 23089 gene locus_tag LOCUS_01680 21953 23089 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCG7 protein_id gnl|my_center|LOCUS_01680 23094 23834 gene locus_tag LOCUS_01690 gene ubiE 23094 23834 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIF2 protein_id gnl|my_center|LOCUS_01690 23842 24354 gene locus_tag LOCUS_01700 23842 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence005 541 44 gene locus_tag LOCUS_01710 541 44 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_01710 635 844 gene locus_tag LOCUS_01720 635 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 844 1110 gene locus_tag LOCUS_01730 844 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1916 1278 gene locus_tag LOCUS_01740 1916 1278 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 protein_id gnl|my_center|LOCUS_01740 2904 2047 gene locus_tag LOCUS_01750 2904 2047 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272870.1 protein_id gnl|my_center|LOCUS_01750 3775 2897 gene locus_tag LOCUS_01760 gene argB 3775 2897 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY1 protein_id gnl|my_center|LOCUS_01760 4273 3842 gene locus_tag LOCUS_01770 4273 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4742 4335 gene locus_tag LOCUS_01780 4742 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5206 4913 gene locus_tag LOCUS_01790 5206 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6328 5222 gene locus_tag LOCUS_01800 6328 5222 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_01800 6922 6335 gene locus_tag LOCUS_01810 6922 6335 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 protein_id gnl|my_center|LOCUS_01810 6985 7644 gene locus_tag LOCUS_01820 gene rpiA 6985 7644 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT5 protein_id gnl|my_center|LOCUS_01820 8982 7651 gene locus_tag LOCUS_01830 8982 7651 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946910.1 protein_id gnl|my_center|LOCUS_01830 9090 9314 gene locus_tag LOCUS_01840 9090 9314 CDS product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 protein_id gnl|my_center|LOCUS_01840 9343 9858 gene locus_tag LOCUS_01850 9343 9858 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_01850 10610 9957 gene locus_tag LOCUS_01860 10610 9957 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_01860 11203 10613 gene locus_tag LOCUS_01870 11203 10613 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JE5 protein_id gnl|my_center|LOCUS_01870 12493 11207 gene locus_tag LOCUS_01880 gene hemL 12493 11207 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_01880 13434 12502 gene locus_tag LOCUS_01890 13434 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 14129 13512 gene locus_tag LOCUS_01900 gene tmk 14129 13512 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E35 protein_id gnl|my_center|LOCUS_01900 15829 14135 gene locus_tag LOCUS_01910 15829 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 15967 16698 gene locus_tag LOCUS_01920 15967 16698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_01920 16695 17441 gene locus_tag LOCUS_01930 16695 17441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_01930 17453 17803 gene locus_tag LOCUS_01940 17453 17803 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_01940 17803 18216 gene locus_tag LOCUS_01950 17803 18216 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263098.1 protein_id gnl|my_center|LOCUS_01950 18303 18920 gene locus_tag LOCUS_01960 18303 18920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 19030 19977 gene locus_tag LOCUS_01970 19030 19977 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_01970 20312 20001 gene locus_tag LOCUS_01980 20312 20001 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_01980 21742 20321 gene locus_tag LOCUS_01990 gene pepA 21742 20321 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_01990 21825 22544 gene locus_tag LOCUS_02000 21825 22544 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 protein_id gnl|my_center|LOCUS_02000 22534 23796 gene locus_tag LOCUS_02010 gene rsmB 22534 23796 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45679 protein_id gnl|my_center|LOCUS_02010 23842 24252 gene locus_tag LOCUS_02020 23842 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 <25151 24306 gene locus_tag LOCUS_02030 <25151 24306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P74956:Lon protease >Feature sequence006 2323 707 gene locus_tag LOCUS_02040 gene yidC 2323 707 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR81 protein_id gnl|my_center|LOCUS_02040 2907 2566 gene locus_tag LOCUS_02050 gene rnpA 2907 2566 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TR4 protein_id gnl|my_center|LOCUS_02050 3195 4283 gene locus_tag LOCUS_02060 gene smf 3195 4283 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_02060 4294 4785 gene locus_tag LOCUS_02070 gene smg 4294 4785 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66823 protein_id gnl|my_center|LOCUS_02070 4785 7193 gene locus_tag LOCUS_02080 gene topA 4785 7193 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X7 protein_id gnl|my_center|LOCUS_02080 7268 7450 gene locus_tag LOCUS_02090 7268 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7450 8157 gene locus_tag LOCUS_02100 7450 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8158 8766 gene locus_tag LOCUS_02110 gene trpF 8158 8766 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_02110 8763 9968 gene locus_tag LOCUS_02120 gene trpB 8763 9968 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL8 protein_id gnl|my_center|LOCUS_02120 10396 11232 gene locus_tag LOCUS_02130 10396 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 12781 11414 gene locus_tag LOCUS_02140 gene sda 12781 11414 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338178.1 protein_id gnl|my_center|LOCUS_02140 14045 12879 gene locus_tag LOCUS_02150 14045 12879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206489.1 protein_id gnl|my_center|LOCUS_02150 15404 14046 gene locus_tag LOCUS_02160 gene glmU 15404 14046 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KB0 protein_id gnl|my_center|LOCUS_02160 16064 15405 gene locus_tag LOCUS_02170 16064 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 16193 18550 gene locus_tag LOCUS_02180 16193 18550 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261908.1 protein_id gnl|my_center|LOCUS_02180 18635 18847 gene locus_tag LOCUS_02190 gene rpmE 18635 18847 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS9 protein_id gnl|my_center|LOCUS_02190 18964 19998 gene locus_tag LOCUS_02200 gene hemE 18964 19998 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_02200 20001 20798 gene locus_tag LOCUS_02210 gene trpA 20001 20798 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_02210 20818 21666 gene locus_tag LOCUS_02220 gene accD 20818 21666 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN6 protein_id gnl|my_center|LOCUS_02220 21659 22069 gene locus_tag LOCUS_02230 gene fkpB 21659 22069 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGK5 protein_id gnl|my_center|LOCUS_02230 22066 22992 gene locus_tag LOCUS_02240 gene ispH 22066 22992 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_02240 >Feature sequence007 75 551 gene locus_tag LOCUS_02250 75 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02250 544 1623 gene locus_tag LOCUS_02260 544 1623 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_02260 1620 2684 gene locus_tag LOCUS_02270 gene hisC2 1620 2684 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_02270 2681 3535 gene locus_tag LOCUS_02280 2681 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3556 4857 gene locus_tag LOCUS_02290 3556 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02290 5251 4925 gene locus_tag LOCUS_02300 gene tusE 5251 4925 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57539 protein_id gnl|my_center|LOCUS_02300 5342 6226 gene locus_tag LOCUS_02310 gene lepB 5342 6226 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIN7 protein_id gnl|my_center|LOCUS_02310 7101 6253 gene locus_tag LOCUS_02320 gene spoOJ 7101 6253 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_02320 7886 7116 gene locus_tag LOCUS_02330 gene parA 7886 7116 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_02330 9227 7890 gene locus_tag LOCUS_02340 9227 7890 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946247.1 protein_id gnl|my_center|LOCUS_02340 9330 9980 gene locus_tag LOCUS_02350 9330 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 10008 10322 gene locus_tag LOCUS_02360 10008 10322 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137286.1 protein_id gnl|my_center|LOCUS_02360 10360 10436 gene locus_tag LOCUS_t00030 10360 10436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10449 11222 gene locus_tag LOCUS_02370 gene lgt 10449 11222 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_02370 11219 12073 gene locus_tag LOCUS_02380 gene thyA 11219 12073 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P1 protein_id gnl|my_center|LOCUS_02380 12129 12458 gene locus_tag LOCUS_02390 12129 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404727.1 protein_id gnl|my_center|LOCUS_02390 13698 12667 gene locus_tag LOCUS_02400 13698 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14438 13770 gene locus_tag LOCUS_02410 14438 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 14476 15144 gene locus_tag LOCUS_02420 gene rnc 14476 15144 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB2 protein_id gnl|my_center|LOCUS_02420 15144 16028 gene locus_tag LOCUS_02430 gene era 15144 16028 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_02430 16021 16710 gene locus_tag LOCUS_02440 gene recO 16021 16710 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSA8 protein_id gnl|my_center|LOCUS_02440 16717 17442 gene locus_tag LOCUS_02450 gene pdxJ 16717 17442 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJY6 protein_id gnl|my_center|LOCUS_02450 17439 17861 gene locus_tag LOCUS_02460 gene acpS 17439 17861 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP3 protein_id gnl|my_center|LOCUS_02460 18171 17866 gene locus_tag LOCUS_02470 18171 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 18953 18252 gene locus_tag LOCUS_02480 gene ubiG 18953 18252 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_02480 19399 18950 gene locus_tag LOCUS_02490 gene bcp 19399 18950 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_02490 19444 21231 gene locus_tag LOCUS_02500 gene lepA 19444 21231 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_02500 22037 21252 gene locus_tag LOCUS_02510 22037 21252 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence008 828 223 gene locus_tag LOCUS_02520 gene rnfG 828 223 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ6 protein_id gnl|my_center|LOCUS_02520 1772 825 gene locus_tag LOCUS_02530 1772 825 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM66 protein_id gnl|my_center|LOCUS_02530 3273 1765 gene locus_tag LOCUS_02540 3273 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3808 3266 gene locus_tag LOCUS_02550 3808 3266 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_02550 4299 3808 gene locus_tag LOCUS_02560 gene rnfA 4299 3808 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_02560 4916 4479 gene locus_tag LOCUS_02570 4916 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5071 5541 gene locus_tag LOCUS_02580 5071 5541 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_02580 6268 5534 gene locus_tag LOCUS_02590 6268 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7593 6268 gene locus_tag LOCUS_02600 gene glmM 7593 6268 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M0 protein_id gnl|my_center|LOCUS_02600 8404 7595 gene locus_tag LOCUS_02610 gene folP 8404 7595 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_02610 10336 8423 gene locus_tag LOCUS_02620 gene hflB 10336 8423 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_02620 10489 10941 gene locus_tag LOCUS_02630 10489 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10931 11950 gene locus_tag LOCUS_02640 gene holA 10931 11950 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_02640 11938 13197 gene locus_tag LOCUS_02650 gene proA 11938 13197 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_02650 13212 14396 gene locus_tag LOCUS_02660 gene tyrS2 13212 14396 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU92 protein_id gnl|my_center|LOCUS_02660 14421 14767 gene locus_tag LOCUS_tm00010 14421 14767 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15191 14802 gene locus_tag LOCUS_02670 15191 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15521 15273 gene locus_tag LOCUS_02680 15521 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 16327 15548 gene locus_tag LOCUS_02690 gene djlA 16327 15548 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_02690 17761 16433 gene locus_tag LOCUS_02700 gene rhlE 17761 16433 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMW4 protein_id gnl|my_center|LOCUS_02700 18426 18196 gene locus_tag LOCUS_02710 18426 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 19697 18429 gene locus_tag LOCUS_02720 19697 18429 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL9 protein_id gnl|my_center|LOCUS_02720 20393 19716 gene locus_tag LOCUS_02730 20393 19716 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_02730 20638 20465 gene locus_tag LOCUS_02740 20638 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 21709 20819 gene locus_tag LOCUS_02750 21709 20819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869215.1 protein_id gnl|my_center|LOCUS_02750 22314 21706 gene locus_tag LOCUS_02760 22314 21706 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence009 515 1471 gene locus_tag LOCUS_02770 515 1471 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_02770 1606 2229 gene locus_tag LOCUS_02780 1606 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2279 2572 gene locus_tag LOCUS_02790 2279 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2905 2663 gene locus_tag LOCUS_02800 2905 2663 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_02800 3232 2939 gene locus_tag LOCUS_02810 3232 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4301 3243 gene locus_tag LOCUS_02820 4301 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_02820 4908 4375 gene locus_tag LOCUS_02830 4908 4375 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_02830 5826 4918 gene locus_tag LOCUS_02840 5826 4918 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 protein_id gnl|my_center|LOCUS_02840 6722 5844 gene locus_tag LOCUS_02850 6722 5844 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJI0 protein_id gnl|my_center|LOCUS_02850 7214 9133 gene locus_tag LOCUS_02860 gene prlC 7214 9133 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309824.1 protein_id gnl|my_center|LOCUS_02860 9170 9385 gene locus_tag LOCUS_02870 9170 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10672 9434 gene locus_tag LOCUS_02880 gene fabF 10672 9434 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJC8 protein_id gnl|my_center|LOCUS_02880 10981 10754 gene locus_tag LOCUS_02890 gene acpP 10981 10754 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_02890 11752 11066 gene locus_tag LOCUS_02900 gene queC 11752 11066 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A28 protein_id gnl|my_center|LOCUS_02900 13628 11745 gene locus_tag LOCUS_02910 gene parE 13628 11745 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_02910 15352 13721 gene locus_tag LOCUS_02920 gene groL1 15352 13721 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7P5 protein_id gnl|my_center|LOCUS_02920 15654 15367 gene locus_tag LOCUS_02930 gene groS 15654 15367 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_02930 16547 15705 gene locus_tag LOCUS_02940 gene rpoH 16547 15705 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM47 protein_id gnl|my_center|LOCUS_02940 17193 16588 gene locus_tag LOCUS_02950 gene gmk 17193 16588 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329K8 protein_id gnl|my_center|LOCUS_02950 17462 17193 gene locus_tag LOCUS_02960 17462 17193 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67616 protein_id gnl|my_center|LOCUS_02960 18988 17459 gene locus_tag LOCUS_02970 gene murJ 18988 17459 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_02970 19800 19003 gene locus_tag LOCUS_02980 gene lpxA 19800 19003 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_02980 20276 19833 gene locus_tag LOCUS_02990 gene fabZ 20276 19833 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_02990 21277 20279 gene locus_tag LOCUS_03000 gene lpxD2 21277 20279 CDS product UDP-3-O-acylglucosamine N-acyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEP9 protein_id gnl|my_center|LOCUS_03000 <22200 21298 gene locus_tag LOCUS_03010 <22200 21298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F5W8:outer membrane protein assembly factor BamA >Feature sequence010 1108 68 gene locus_tag LOCUS_03020 1108 68 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_03020 1171 1449 gene locus_tag LOCUS_03030 1171 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1456 2067 gene locus_tag LOCUS_03040 gene lipB 1456 2067 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8I1 protein_id gnl|my_center|LOCUS_03040 2057 3022 gene locus_tag LOCUS_03050 gene lipA 2057 3022 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNA3 protein_id gnl|my_center|LOCUS_03050 3135 4256 gene locus_tag LOCUS_03060 3135 4256 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_03060 4259 7537 gene locus_tag LOCUS_03070 4259 7537 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_03070 11358 7861 gene locus_tag LOCUS_03080 11358 7861 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_03080 12442 11366 gene locus_tag LOCUS_03090 12442 11366 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_03090 12746 13708 gene locus_tag LOCUS_03100 gene pdxA 12746 13708 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E864 protein_id gnl|my_center|LOCUS_03100 13701 14489 gene locus_tag LOCUS_03110 gene rsmA 13701 14489 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG5 protein_id gnl|my_center|LOCUS_03110 14467 14838 gene locus_tag LOCUS_03120 gene apaG 14467 14838 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_03120 14839 15636 gene locus_tag LOCUS_03130 gene apaH 14839 15636 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST8 protein_id gnl|my_center|LOCUS_03130 16400 15633 gene locus_tag LOCUS_03140 gene dapF 16400 15633 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_03140 16539 16892 gene locus_tag LOCUS_03150 16539 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 protein_id gnl|my_center|LOCUS_03150 16898 18235 gene locus_tag LOCUS_03160 gene rseP 16898 18235 CDS product regulator of sigma E protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9A4 protein_id gnl|my_center|LOCUS_03160 >Feature sequence011 536 372 gene locus_tag LOCUS_03170 gene rubA 536 372 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_03170 1208 609 gene locus_tag LOCUS_03180 1208 609 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_03180 1339 2727 gene locus_tag LOCUS_03190 gene cysS 1339 2727 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXE6 protein_id gnl|my_center|LOCUS_03190 2702 3418 gene locus_tag LOCUS_03200 2702 3418 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_03200 3871 3467 gene locus_tag LOCUS_03210 3871 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4068 4550 gene locus_tag LOCUS_03220 4068 4550 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF47 protein_id gnl|my_center|LOCUS_03220 4638 5882 gene locus_tag LOCUS_03230 gene pfp 4638 5882 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_03230 5910 6560 gene locus_tag LOCUS_03240 gene adK 5910 6560 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1V5 protein_id gnl|my_center|LOCUS_03240 6647 7810 gene locus_tag LOCUS_03250 6647 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7969 9966 gene locus_tag LOCUS_03260 gene hppA 7969 9966 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_03260 10451 10080 gene locus_tag LOCUS_03270 10451 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10962 10456 gene locus_tag LOCUS_03280 10962 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 11333 10968 gene locus_tag LOCUS_03290 11333 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 13394 11499 gene locus_tag LOCUS_03300 13394 11499 CDS product adenylylsulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_03300 13872 13381 gene locus_tag LOCUS_03310 13872 13381 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_03310 14787 13900 gene locus_tag LOCUS_03320 14787 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 16186 14978 gene locus_tag LOCUS_03330 gene sat 16186 14978 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_03330 16777 16292 gene locus_tag LOCUS_03340 16777 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17645 16770 gene locus_tag LOCUS_03350 17645 16770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 17722 18306 gene locus_tag LOCUS_03360 gene thiE 17722 18306 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_03360 <19697 18303 gene locus_tag LOCUS_03370 <19697 18303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958091.1:ATP-dependent helicase >Feature sequence012 58 513 gene locus_tag LOCUS_03380 58 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 498 1400 gene locus_tag LOCUS_03390 498 1400 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_03390 1397 2284 gene locus_tag LOCUS_03400 gene yvoD 1397 2284 CDS product putative membrane protein YvoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34382 protein_id gnl|my_center|LOCUS_03400 2348 3616 gene locus_tag LOCUS_03410 gene hisS 2348 3616 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y9 protein_id gnl|my_center|LOCUS_03410 3613 4227 gene locus_tag LOCUS_03420 3613 4227 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947272.1 protein_id gnl|my_center|LOCUS_03420 4240 5646 gene locus_tag LOCUS_03430 gene der 4240 5646 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV99 protein_id gnl|my_center|LOCUS_03430 5992 5660 gene locus_tag LOCUS_03440 5992 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7633 5993 gene locus_tag LOCUS_03450 gene pyrG 7633 5993 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_03450 7712 9433 gene locus_tag LOCUS_03460 gene msbA 7712 9433 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYI1 protein_id gnl|my_center|LOCUS_03460 10873 9488 gene locus_tag LOCUS_03470 10873 9488 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_03470 12512 10875 gene locus_tag LOCUS_03480 12512 10875 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_03480 14014 12509 gene locus_tag LOCUS_03490 gene glsF 14014 12509 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_03490 15058 14090 gene locus_tag LOCUS_03500 15058 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_03500 15265 15059 gene locus_tag LOCUS_03510 15265 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15492 15271 gene locus_tag LOCUS_03520 15492 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233032.2 protein_id gnl|my_center|LOCUS_03520 15583 16131 gene locus_tag LOCUS_03530 15583 16131 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_03530 16124 16762 gene locus_tag LOCUS_03540 16124 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 16860 17288 gene locus_tag LOCUS_03550 16860 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958561.1 protein_id gnl|my_center|LOCUS_03550 17449 17943 gene locus_tag LOCUS_03560 17449 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 <18948 18241 gene locus_tag LOCUS_03570 <18948 18241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903403.1:anthranilate phosphoribosyltransferase >Feature sequence013 256 531 gene locus_tag LOCUS_03580 256 531 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_03580 639 1064 gene locus_tag LOCUS_03590 gene ndk 639 1064 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_03590 1118 2191 gene locus_tag LOCUS_03600 gene rlmN 1118 2191 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_03600 2175 2477 gene locus_tag LOCUS_03610 2175 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2474 3562 gene locus_tag LOCUS_03620 gene ispG 2474 3562 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_03620 4051 3557 gene locus_tag LOCUS_03630 4051 3557 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263295.1 protein_id gnl|my_center|LOCUS_03630 5850 4048 gene locus_tag LOCUS_03640 gene dxs 5850 4048 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU8 protein_id gnl|my_center|LOCUS_03640 7259 5904 gene locus_tag LOCUS_03650 gene yegQ 7259 5904 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_03650 7316 7906 gene locus_tag LOCUS_03660 7316 7906 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 protein_id gnl|my_center|LOCUS_03660 7963 8292 gene locus_tag LOCUS_03670 7963 8292 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_03670 9085 8435 gene locus_tag LOCUS_03680 9085 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_03680 13129 9302 gene locus_tag LOCUS_03690 gene purL 13129 9302 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_03690 13869 13126 gene locus_tag LOCUS_03700 13869 13126 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_03700 14859 13912 gene locus_tag LOCUS_03710 gene nadA 14859 13912 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_03710 16616 14865 gene locus_tag LOCUS_03720 gene aspS 16616 14865 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_03720 17229 16621 gene locus_tag LOCUS_03730 17229 16621 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_03730 18062 17286 gene locus_tag LOCUS_03740 gene map 18062 17286 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_03740 <18927 18066 gene locus_tag LOCUS_03750 <18927 18066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q885Q3:protease HtpX >Feature sequence014 707 417 gene locus_tag LOCUS_03760 707 417 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_03760 1069 902 gene locus_tag LOCUS_03770 1069 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1277 2209 gene locus_tag LOCUS_03780 gene prmA 1277 2209 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44402 protein_id gnl|my_center|LOCUS_03780 2218 3267 gene locus_tag LOCUS_03790 2218 3267 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_03790 3464 3264 gene locus_tag LOCUS_03800 3464 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3730 3461 gene locus_tag LOCUS_03810 3730 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3855 4976 gene locus_tag LOCUS_03820 gene carA 3855 4976 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M9 protein_id gnl|my_center|LOCUS_03820 4973 5659 gene locus_tag LOCUS_03830 4973 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_03830 5685 8894 gene locus_tag LOCUS_03840 5685 8894 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ1 protein_id gnl|my_center|LOCUS_03840 8907 9383 gene locus_tag LOCUS_03850 gene greA 8907 9383 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFC6 protein_id gnl|my_center|LOCUS_03850 10100 9390 gene locus_tag LOCUS_03860 gene kipR 10100 9390 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206800.1 protein_id gnl|my_center|LOCUS_03860 10287 11591 gene locus_tag LOCUS_03870 gene aceA 10287 11591 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_03870 11663 13417 gene locus_tag LOCUS_03880 gene aceK 11663 13417 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MX7 protein_id gnl|my_center|LOCUS_03880 13423 13902 gene locus_tag LOCUS_03890 13423 13902 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_03890 13896 16013 gene locus_tag LOCUS_03900 gene glcB 13896 16013 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_03900 16911 16033 gene locus_tag LOCUS_03910 gene xerD 16911 16033 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB4 protein_id gnl|my_center|LOCUS_03910 17325 16975 gene locus_tag LOCUS_03920 gene rplS 17325 16975 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF7 protein_id gnl|my_center|LOCUS_03920 >Feature sequence015 1458 283 gene locus_tag LOCUS_03930 gene aspC 1458 283 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_03930 1519 3513 gene locus_tag LOCUS_03940 gene uvrB 1519 3513 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE83 protein_id gnl|my_center|LOCUS_03940 3510 4148 gene locus_tag LOCUS_03950 gene queE 3510 4148 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_03950 4633 4154 gene locus_tag LOCUS_03960 4633 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6284 4731 gene locus_tag LOCUS_03970 6284 4731 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_03970 6175 6396 gene locus_tag LOCUS_03980 6175 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7421 6321 gene locus_tag LOCUS_03990 gene aroC 7421 6321 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_03990 7726 7472 gene locus_tag LOCUS_04000 7726 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947967.1 protein_id gnl|my_center|LOCUS_04000 8960 7770 gene locus_tag LOCUS_04010 8960 7770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_04010 9062 10105 gene locus_tag LOCUS_04020 9062 10105 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105677.1 protein_id gnl|my_center|LOCUS_04020 10193 10117 gene locus_tag LOCUS_t00040 10193 10117 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10831 10217 gene locus_tag LOCUS_04030 10831 10217 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_04030 10899 11402 gene locus_tag LOCUS_04040 10899 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 11406 11696 gene locus_tag LOCUS_04050 11406 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11709 12404 gene locus_tag LOCUS_04060 gene pyrF 11709 12404 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_04060 12473 12549 gene locus_tag LOCUS_t00050 12473 12549 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13592 12618 gene locus_tag LOCUS_04070 13592 12618 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_04070 13721 14053 gene locus_tag LOCUS_04080 gene hxlR 13721 14053 CDS product HTH-type transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42406 protein_id gnl|my_center|LOCUS_04080 14058 15146 gene locus_tag LOCUS_04090 14058 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15515 15141 gene locus_tag LOCUS_04100 15515 15141 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_04100 15612 16811 gene locus_tag LOCUS_04110 15612 16811 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243976.1 protein_id gnl|my_center|LOCUS_04110 16811 17449 gene locus_tag LOCUS_04120 gene pdxH 16811 17449 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI46 protein_id gnl|my_center|LOCUS_04120 <18121 17438 gene locus_tag LOCUS_04130 <18121 17438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87KE4:shikimate dehydrogenase (NADP(+)) >Feature sequence016 <1 864 gene locus_tag LOCUS_04140 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071563.1:membrane protein 1668 856 gene locus_tag LOCUS_04150 1668 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3235 1685 gene locus_tag LOCUS_04160 gene proS 3235 1685 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_04160 3425 4054 gene locus_tag LOCUS_04170 3425 4054 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809953.1 protein_id gnl|my_center|LOCUS_04170 5461 4061 gene locus_tag LOCUS_04180 5461 4061 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR7 protein_id gnl|my_center|LOCUS_04180 6895 5465 gene locus_tag LOCUS_04190 gene gatB 6895 5465 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_04190 8345 6897 gene locus_tag LOCUS_04200 gene gatA 8345 6897 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_04200 8634 8347 gene locus_tag LOCUS_04210 gene gatC 8634 8347 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_04210 9221 8637 gene locus_tag LOCUS_04220 9221 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 10318 9242 gene locus_tag LOCUS_04230 gene aroB 10318 9242 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZE3 protein_id gnl|my_center|LOCUS_04230 13086 10318 gene locus_tag LOCUS_04240 gene ileS 13086 10318 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7N4 protein_id gnl|my_center|LOCUS_04240 14582 13854 gene locus_tag LOCUS_04250 gene rluB 14582 13854 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG05 protein_id gnl|my_center|LOCUS_04250 15784 14585 gene locus_tag LOCUS_04260 gene trpS 15784 14585 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SR0 protein_id gnl|my_center|LOCUS_04260 16498 15830 gene locus_tag LOCUS_04270 gene coaX 16498 15830 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_04270 <17783 16491 gene locus_tag LOCUS_04280 <17783 16491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071215.1:sodium:proton antiporter NhaD >Feature sequence017 1078 743 gene locus_tag LOCUS_04290 1078 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 1321 1136 gene locus_tag LOCUS_04300 1321 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2028 1333 gene locus_tag LOCUS_04310 gene narV 2028 1333 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617139.1 protein_id gnl|my_center|LOCUS_04310 2555 2040 gene locus_tag LOCUS_04320 gene narJ 2555 2040 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814219.1 protein_id gnl|my_center|LOCUS_04320 4117 2567 gene locus_tag LOCUS_04330 gene narH 4117 2567 CDS product respiratory nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_04330 7881 4138 gene locus_tag LOCUS_04340 gene narG 7881 4138 CDS product respiratory nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 protein_id gnl|my_center|LOCUS_04340 9683 8070 gene locus_tag LOCUS_04350 9683 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 10996 9719 gene locus_tag LOCUS_04360 10996 9719 CDS product nitrite extrusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_04360 11203 11733 gene locus_tag LOCUS_04370 gene mogA 11203 11733 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_04370 12138 11737 gene locus_tag LOCUS_04380 12138 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 14382 12145 gene locus_tag LOCUS_04390 14382 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 15232 14396 gene locus_tag LOCUS_04400 gene nirQ 15232 14396 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_04400 16749 15367 gene locus_tag LOCUS_04410 gene cbbM 16749 15367 CDS product ribulose bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX55 protein_id gnl|my_center|LOCUS_04410 >Feature sequence018 959 615 gene locus_tag LOCUS_04420 gene trxA 959 615 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI68 protein_id gnl|my_center|LOCUS_04420 1750 962 gene locus_tag LOCUS_04430 1750 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2449 2021 gene locus_tag LOCUS_04440 2449 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3330 2554 gene locus_tag LOCUS_04450 3330 2554 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 protein_id gnl|my_center|LOCUS_04450 4436 3339 gene locus_tag LOCUS_04460 4436 3339 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_04460 5605 4442 gene locus_tag LOCUS_04470 gene aapQ 5605 4442 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 protein_id gnl|my_center|LOCUS_04470 6690 5668 gene locus_tag LOCUS_04480 6690 5668 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_04480 6979 6800 gene locus_tag LOCUS_04490 6979 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7453 7100 gene locus_tag LOCUS_04500 7453 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 7692 9566 gene locus_tag LOCUS_04510 gene nadE 7692 9566 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_04510 10858 9563 gene locus_tag LOCUS_04520 gene trpE 10858 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_04520 11543 10860 gene locus_tag LOCUS_04530 11543 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12131 11550 gene locus_tag LOCUS_04540 gene pal 12131 11550 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_04540 13421 12147 gene locus_tag LOCUS_04550 gene tolB 13421 12147 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F59 protein_id gnl|my_center|LOCUS_04550 13669 13418 gene locus_tag LOCUS_04560 13669 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_04560 15838 13700 gene locus_tag LOCUS_04570 15838 13700 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266256.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence019 <1 677 gene locus_tag LOCUS_04580 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WGH9:diaminopimelate decarboxylase 670 972 gene locus_tag LOCUS_04590 670 972 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_04590 980 2068 gene locus_tag LOCUS_04600 gene lpxB 980 2068 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH6 protein_id gnl|my_center|LOCUS_04600 2061 2882 gene locus_tag LOCUS_04610 gene nadC 2061 2882 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_04610 3647 2865 gene locus_tag LOCUS_04620 gene cysQ-1 3647 2865 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957684.1 protein_id gnl|my_center|LOCUS_04620 3749 3673 gene locus_tag LOCUS_t00060 3749 3673 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5581 3767 gene locus_tag LOCUS_04630 gene rpoD 5581 3767 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H2 protein_id gnl|my_center|LOCUS_04630 6634 5672 gene locus_tag LOCUS_04640 gene prsA 6634 5672 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH21 protein_id gnl|my_center|LOCUS_04640 6858 6784 gene locus_tag LOCUS_t00070 6858 6784 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7704 6838 gene locus_tag LOCUS_04650 gene ispE 7704 6838 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C5 protein_id gnl|my_center|LOCUS_04650 8239 7697 gene locus_tag LOCUS_04660 gene orn 8239 7697 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_04660 9270 8251 gene locus_tag LOCUS_04670 gene trpD 9270 8251 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_04670 10496 9267 gene locus_tag LOCUS_04680 gene pepP 10496 9267 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_04680 10533 11249 gene locus_tag LOCUS_04690 gene rsmE 10533 11249 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK7 protein_id gnl|my_center|LOCUS_04690 12275 11235 gene locus_tag LOCUS_04700 12275 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13486 12656 gene locus_tag LOCUS_04710 gene proC 13486 12656 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_04710 13582 14223 gene locus_tag LOCUS_04720 gene gph 13582 14223 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_04720 14343 15581 gene locus_tag LOCUS_04730 gene bioA 14343 15581 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC5 protein_id gnl|my_center|LOCUS_04730 >Feature sequence020 286 41 gene locus_tag LOCUS_04740 286 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 430 897 gene locus_tag LOCUS_04750 430 897 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_04750 1385 894 gene locus_tag LOCUS_04760 1385 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1932 1525 gene locus_tag LOCUS_04770 1932 1525 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_04770 2595 2077 gene locus_tag LOCUS_04780 2595 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3062 2619 gene locus_tag LOCUS_04790 3062 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3521 3180 gene locus_tag LOCUS_04800 3521 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4030 3602 gene locus_tag LOCUS_04810 4030 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4121 7774 gene locus_tag LOCUS_04820 gene metH 4121 7774 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L95 protein_id gnl|my_center|LOCUS_04820 8268 8023 gene locus_tag LOCUS_04830 8268 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8944 8507 gene locus_tag LOCUS_04840 gene nusB 8944 8507 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45150 protein_id gnl|my_center|LOCUS_04840 9450 8947 gene locus_tag LOCUS_04850 gene ribH 9450 8947 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIR4 protein_id gnl|my_center|LOCUS_04850 10536 9460 gene locus_tag LOCUS_04860 gene ribB 10536 9460 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_04860 11133 10540 gene locus_tag LOCUS_04870 gene ribE 11133 10540 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103236.1 protein_id gnl|my_center|LOCUS_04870 12009 11236 gene locus_tag LOCUS_04880 12009 11236 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E985 protein_id gnl|my_center|LOCUS_04880 13600 12014 gene locus_tag LOCUS_04890 gene ybiT 13600 12014 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168223.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence021 531 1082 gene locus_tag LOCUS_04900 531 1082 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_04900 2230 1079 gene locus_tag LOCUS_04910 2230 1079 CDS product 2-octaprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983782.1 protein_id gnl|my_center|LOCUS_04910 3546 2227 gene locus_tag LOCUS_04920 gene pmbA 3546 2227 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_04920 4327 3551 gene locus_tag LOCUS_04930 4327 3551 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_04930 5175 4327 gene locus_tag LOCUS_04940 5175 4327 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_04940 5510 5214 gene locus_tag LOCUS_04950 5510 5214 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6P8 protein_id gnl|my_center|LOCUS_04950 6244 5510 gene locus_tag LOCUS_04960 gene hisA 6244 5510 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_04960 7782 6250 gene locus_tag LOCUS_04970 gene yifB 7782 6250 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_04970 8777 7752 gene locus_tag LOCUS_04980 gene ygjD 8777 7752 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_04980 9498 8764 gene locus_tag LOCUS_04990 9498 8764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_04990 10286 9534 gene locus_tag LOCUS_05000 10286 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 10567 10265 gene locus_tag LOCUS_05010 gene dgkA 10567 10265 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF02 protein_id gnl|my_center|LOCUS_05010 10705 11421 gene locus_tag LOCUS_05020 gene truA 10705 11421 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW2 protein_id gnl|my_center|LOCUS_05020 13242 11485 gene locus_tag LOCUS_05030 gene hvsT 13242 11485 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880808.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence022 572 1204 gene locus_tag LOCUS_05040 gene nth 572 1204 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW8 protein_id gnl|my_center|LOCUS_05040 1213 1632 gene locus_tag LOCUS_05050 1213 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020393.1 protein_id gnl|my_center|LOCUS_05050 2274 1657 gene locus_tag LOCUS_05060 gene hisH 2274 1657 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_05060 2868 2287 gene locus_tag LOCUS_05070 gene hisB 2868 2287 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_05070 3906 2881 gene locus_tag LOCUS_05080 gene asd 3906 2881 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_05080 4739 4002 gene locus_tag LOCUS_05090 gene ybgI 4739 4002 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6N4 protein_id gnl|my_center|LOCUS_05090 5793 4732 gene locus_tag LOCUS_05100 gene hisC 5793 4732 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYH7 protein_id gnl|my_center|LOCUS_05100 6547 5795 gene locus_tag LOCUS_05110 6547 5795 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105183.1 protein_id gnl|my_center|LOCUS_05110 7173 6553 gene locus_tag LOCUS_05120 gene dsbA 7173 6553 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_05120 7681 7187 gene locus_tag LOCUS_05130 7681 7187 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_05130 8030 7674 gene locus_tag LOCUS_05140 gene folB 8030 7674 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_05140 8029 8649 gene locus_tag LOCUS_05150 gene plsY 8029 8649 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44603 protein_id gnl|my_center|LOCUS_05150 9397 8639 gene locus_tag LOCUS_05160 gene yadH 9397 8639 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJN4 protein_id gnl|my_center|LOCUS_05160 10313 9399 gene locus_tag LOCUS_05170 gene yadG 10313 9399 CDS product putative ABC transporter ATP-binding protein YadG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36879 protein_id gnl|my_center|LOCUS_05170 10426 11997 gene locus_tag LOCUS_05180 gene aceF 10426 11997 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN8 protein_id gnl|my_center|LOCUS_05180 11994 13400 gene locus_tag LOCUS_05190 gene lpdA 11994 13400 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E67 protein_id gnl|my_center|LOCUS_05190 >Feature sequence023 99 704 gene locus_tag LOCUS_05200 99 704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939714.1 protein_id gnl|my_center|LOCUS_05200 1285 707 gene locus_tag LOCUS_05210 1285 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_05210 1408 1896 gene locus_tag LOCUS_05220 gene purE 1408 1896 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT7 protein_id gnl|my_center|LOCUS_05220 1900 2991 gene locus_tag LOCUS_05230 gene purK 1900 2991 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_05230 3011 3316 gene locus_tag LOCUS_05240 3011 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3697 3323 gene locus_tag LOCUS_05250 3697 3323 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244324.1 protein_id gnl|my_center|LOCUS_05250 4535 3702 gene locus_tag LOCUS_05260 gene folD1 4535 3702 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN1 protein_id gnl|my_center|LOCUS_05260 5294 4548 gene locus_tag LOCUS_05270 gene kdsB 5294 4548 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44490 protein_id gnl|my_center|LOCUS_05270 5459 5298 gene locus_tag LOCUS_05280 5459 5298 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_05280 6403 5456 gene locus_tag LOCUS_05290 gene lpxK 6403 5456 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK0 protein_id gnl|my_center|LOCUS_05290 6841 6410 gene locus_tag LOCUS_05300 6841 6410 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_05300 6903 8138 gene locus_tag LOCUS_05310 6903 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_05310 8131 8796 gene locus_tag LOCUS_05320 gene lolD 8131 8796 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57031 protein_id gnl|my_center|LOCUS_05320 9157 8789 gene locus_tag LOCUS_05330 gene panD 9157 8789 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_05330 10432 9302 gene locus_tag LOCUS_05340 10432 9302 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_05340 12280 10448 gene locus_tag LOCUS_05350 12280 10448 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_05350 12531 12286 gene locus_tag LOCUS_05360 12531 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12639 12555 gene locus_tag LOCUS_t00080 12639 12555 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12870 12652 gene locus_tag LOCUS_05370 gene infA 12870 12652 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSB2 protein_id gnl|my_center|LOCUS_05370 >Feature sequence024 <1 567 gene locus_tag LOCUS_05380 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JIF4:putative protein kinase UbiB 686 1354 gene locus_tag LOCUS_05390 gene rplY 686 1354 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX3 protein_id gnl|my_center|LOCUS_05390 1372 1947 gene locus_tag LOCUS_05400 gene pth 1372 1947 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9L4 protein_id gnl|my_center|LOCUS_05400 1989 3080 gene locus_tag LOCUS_05410 gene ychF 1989 3080 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ23 protein_id gnl|my_center|LOCUS_05410 3107 4648 gene locus_tag LOCUS_05420 gene gpmI 3107 4648 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2F0 protein_id gnl|my_center|LOCUS_05420 4689 5363 gene locus_tag LOCUS_05430 gene rpe 4689 5363 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A31 protein_id gnl|my_center|LOCUS_05430 5632 6546 gene locus_tag LOCUS_05440 gene rpsB 5632 6546 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_05440 6604 7482 gene locus_tag LOCUS_05450 gene tsf 6604 7482 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_05450 8153 7536 gene locus_tag LOCUS_05460 gene nrdG 8153 7536 CDS product class III (anaerobic) ribonucleoside-triphosphate reductase activating protein NrdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114930.1 protein_id gnl|my_center|LOCUS_05460 8313 8155 gene locus_tag LOCUS_05470 8313 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 10333 8282 gene locus_tag LOCUS_05480 10333 8282 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_05480 10541 11029 gene locus_tag LOCUS_05490 10541 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11045 11308 gene locus_tag LOCUS_05500 11045 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11379 12293 gene locus_tag LOCUS_05510 11379 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 <13157 12304 gene locus_tag LOCUS_05520 <13157 12304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193564.1:U32 family peptidase >Feature sequence025 776 955 gene locus_tag LOCUS_05530 776 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 958 1458 gene locus_tag LOCUS_05540 958 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2192 1455 gene locus_tag LOCUS_05550 2192 1455 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066623.1 protein_id gnl|my_center|LOCUS_05550 3687 2389 gene locus_tag LOCUS_05560 gene fccB-2 3687 2389 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_05560 4290 3700 gene locus_tag LOCUS_05570 4290 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4568 5032 gene locus_tag LOCUS_05580 4568 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5661 5038 gene locus_tag LOCUS_05590 gene pvcD 5661 5038 CDS product paerucumarin biosynthesis protein PvcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113737.1 protein_id gnl|my_center|LOCUS_05590 6138 5671 gene locus_tag LOCUS_05600 6138 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6539 6231 gene locus_tag LOCUS_05610 gene soxZ 6539 6231 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_05610 6995 6561 gene locus_tag LOCUS_05620 6995 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 7499 7023 gene locus_tag LOCUS_05630 gene napF 7499 7023 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 protein_id gnl|my_center|LOCUS_05630 8109 7507 gene locus_tag LOCUS_05640 8109 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10665 8122 gene locus_tag LOCUS_05650 gene napA 10665 8122 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE47 protein_id gnl|my_center|LOCUS_05650 11628 10768 gene locus_tag LOCUS_05660 11628 10768 CDS product ferredoxin-type protein NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_05660 12476 11625 gene locus_tag LOCUS_05670 12476 11625 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_05670 12733 12479 gene locus_tag LOCUS_05680 12733 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence026 2089 125 gene locus_tag LOCUS_05690 2089 125 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951337.1 protein_id gnl|my_center|LOCUS_05690 2397 2092 gene locus_tag LOCUS_05700 gene nuoK 2397 2092 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU8 protein_id gnl|my_center|LOCUS_05700 3008 2397 gene locus_tag LOCUS_05710 gene nuoJ 3008 2397 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_05710 3511 3020 gene locus_tag LOCUS_05720 gene nuoI 3511 3020 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZP7 protein_id gnl|my_center|LOCUS_05720 4603 3524 gene locus_tag LOCUS_05730 gene nuoH 4603 3524 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_05730 6858 4600 gene locus_tag LOCUS_05740 gene nuoG 6858 4600 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU4 protein_id gnl|my_center|LOCUS_05740 8126 6858 gene locus_tag LOCUS_05750 gene nuoF 8126 6858 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948473.1 protein_id gnl|my_center|LOCUS_05750 8596 8123 gene locus_tag LOCUS_05760 8596 8123 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_05760 9992 8739 gene locus_tag LOCUS_05770 gene nuoD 9992 8739 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN8 protein_id gnl|my_center|LOCUS_05770 10615 9995 gene locus_tag LOCUS_05780 gene nuoC 10615 9995 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU0 protein_id gnl|my_center|LOCUS_05780 11091 10612 gene locus_tag LOCUS_05790 gene nuoB1 11091 10612 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN6 protein_id gnl|my_center|LOCUS_05790 11466 11095 gene locus_tag LOCUS_05800 gene nuoA 11466 11095 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_05800 >Feature sequence027 1358 897 gene locus_tag LOCUS_05810 1358 897 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_05810 1999 1370 gene locus_tag LOCUS_05820 gene narL 1999 1370 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856701.1 protein_id gnl|my_center|LOCUS_05820 3484 2006 gene locus_tag LOCUS_05830 3484 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4827 3484 gene locus_tag LOCUS_05840 gene mnmE 4827 3484 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY5 protein_id gnl|my_center|LOCUS_05840 6308 4830 gene locus_tag LOCUS_05850 gene gshA 6308 4830 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG77 protein_id gnl|my_center|LOCUS_05850 6419 7342 gene locus_tag LOCUS_05860 6419 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_05860 7707 7339 gene locus_tag LOCUS_05870 7707 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8789 8004 gene locus_tag LOCUS_05880 8789 8004 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_05880 >Feature sequence028 1011 493 gene locus_tag LOCUS_05890 1011 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2381 1131 gene locus_tag LOCUS_05900 gene icd 2381 1131 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZH99 protein_id gnl|my_center|LOCUS_05900 2680 2402 gene locus_tag LOCUS_05910 2680 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4316 2823 gene locus_tag LOCUS_05920 gene ilvA-2 4316 2823 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK8 protein_id gnl|my_center|LOCUS_05920 5061 4300 gene locus_tag LOCUS_05930 5061 4300 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_05930 5153 5563 gene locus_tag LOCUS_05940 5153 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6713 5784 gene locus_tag LOCUS_05950 gene thiL 6713 5784 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_05950 7216 6710 gene locus_tag LOCUS_05960 7216 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 7845 7267 gene locus_tag LOCUS_05970 gene nfuA 7845 7267 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_05970 8687 7848 gene locus_tag LOCUS_05980 gene panC 8687 7848 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_05980 9469 8687 gene locus_tag LOCUS_05990 gene panB 9469 8687 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP07 protein_id gnl|my_center|LOCUS_05990 9939 9466 gene locus_tag LOCUS_06000 gene folK 9939 9466 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_06000 10703 9933 gene locus_tag LOCUS_06010 10703 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 11709 10696 gene locus_tag LOCUS_06020 gene obg 11709 10696 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS70 protein_id gnl|my_center|LOCUS_06020 >Feature sequence029 83 6 gene locus_tag LOCUS_t00090 83 6 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 252 178 gene locus_tag LOCUS_t00100 252 178 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 350 275 gene locus_tag LOCUS_t00110 350 275 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 430 1158 gene locus_tag LOCUS_06030 gene pksB 430 1158 CDS product putative polyketide biosynthesis zinc-dependent hydrolase PksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34769 protein_id gnl|my_center|LOCUS_06030 1155 1781 gene locus_tag LOCUS_06040 gene nadD 1155 1781 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDG1 protein_id gnl|my_center|LOCUS_06040 1778 2116 gene locus_tag LOCUS_06050 gene rsfS 1778 2116 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_06050 2122 2589 gene locus_tag LOCUS_06060 gene rlmH 2122 2589 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXV5 protein_id gnl|my_center|LOCUS_06060 2629 3291 gene locus_tag LOCUS_06070 2629 3291 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 protein_id gnl|my_center|LOCUS_06070 3641 3294 gene locus_tag LOCUS_06080 gene yfgD 3641 3294 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCJ8 protein_id gnl|my_center|LOCUS_06080 3654 4175 gene locus_tag LOCUS_06090 3654 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5111 4167 gene locus_tag LOCUS_06100 gene yjeK 5111 4167 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 protein_id gnl|my_center|LOCUS_06100 5346 5161 gene locus_tag LOCUS_06110 5346 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5465 7630 gene locus_tag LOCUS_06120 gene uvrD 5465 7630 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A56 protein_id gnl|my_center|LOCUS_06120 8061 7780 gene locus_tag LOCUS_06130 8061 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9044 8058 gene locus_tag LOCUS_06140 gene nagZ 9044 8058 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJA0 protein_id gnl|my_center|LOCUS_06140 10521 9052 gene locus_tag LOCUS_06150 10521 9052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_06150 10949 10560 gene locus_tag LOCUS_06160 10949 10560 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_06160 11386 10946 gene locus_tag LOCUS_06170 11386 10946 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_06170 <12244 11396 gene locus_tag LOCUS_06180 <12244 11396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVI4:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence030 1581 1243 gene locus_tag LOCUS_06190 gene glnK 1581 1243 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_06190 2411 1734 gene locus_tag LOCUS_06200 gene trmD 2411 1734 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 protein_id gnl|my_center|LOCUS_06200 3543 2413 gene locus_tag LOCUS_06210 gene dapE 3543 2413 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_06210 4708 3548 gene locus_tag LOCUS_06220 4708 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6624 4705 gene locus_tag LOCUS_06230 gene ccmF 6624 4705 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_06230 7452 6631 gene locus_tag LOCUS_06240 gene serB 7452 6631 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 protein_id gnl|my_center|LOCUS_06240 7557 7473 gene locus_tag LOCUS_t00120 7557 7473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7622 7840 gene locus_tag LOCUS_06250 7622 7840 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_06250 9231 7846 gene locus_tag LOCUS_06260 gene cysG 9231 7846 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_06260 9311 9718 gene locus_tag LOCUS_06270 9311 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10389 9715 gene locus_tag LOCUS_06280 10389 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86235 protein_id gnl|my_center|LOCUS_06280 10957 10400 gene locus_tag LOCUS_06290 10957 10400 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_06290 11012 12013 gene locus_tag LOCUS_06300 gene purM 11012 12013 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH0 protein_id gnl|my_center|LOCUS_06300 >Feature sequence031 590 120 gene locus_tag LOCUS_06310 590 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1734 658 gene locus_tag LOCUS_06320 1734 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2047 1736 gene locus_tag LOCUS_06330 2047 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_06330 2753 2034 gene locus_tag LOCUS_06340 2753 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_06340 2873 3301 gene locus_tag LOCUS_06350 gene msrA 2873 3301 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_06350 3294 4034 gene locus_tag LOCUS_06360 gene moeB 3294 4034 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_06360 4214 4396 gene locus_tag LOCUS_06370 4214 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4740 5993 gene locus_tag LOCUS_06380 gene glyA 4740 5993 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_06380 6012 6464 gene locus_tag LOCUS_06390 gene nrdR 6012 6464 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT4 protein_id gnl|my_center|LOCUS_06390 6464 7825 gene locus_tag LOCUS_06400 gene radA 6464 7825 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB3 protein_id gnl|my_center|LOCUS_06400 7913 8245 gene locus_tag LOCUS_06410 7913 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8921 8313 gene locus_tag LOCUS_06420 gene btuR 8921 8313 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262293.1 protein_id gnl|my_center|LOCUS_06420 9512 8931 gene locus_tag LOCUS_06430 9512 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 10164 9559 gene locus_tag LOCUS_06440 10164 9559 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_06440 11986 10211 gene locus_tag LOCUS_06450 11986 10211 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence032 1385 1008 gene locus_tag LOCUS_06460 1385 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1430 2803 gene locus_tag LOCUS_06470 gene algC 1430 2803 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_06470 3809 2928 gene locus_tag LOCUS_06480 3809 2928 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_06480 5187 3835 gene locus_tag LOCUS_06490 5187 3835 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD7 protein_id gnl|my_center|LOCUS_06490 5534 5238 gene locus_tag LOCUS_06500 gene yfiA-2 5534 5238 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_06500 5697 5900 gene locus_tag LOCUS_06510 5697 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5965 7122 gene locus_tag LOCUS_06520 gene argD 5965 7122 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_06520 7138 8034 gene locus_tag LOCUS_06530 gene argF 7138 8034 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_06530 8727 8038 gene locus_tag LOCUS_06540 8727 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_06540 9131 8715 gene locus_tag LOCUS_06550 9131 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 10663 9131 gene locus_tag LOCUS_06560 gene leuA 10663 9131 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_06560 11582 10824 gene locus_tag LOCUS_06570 gene pssA 11582 10824 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence033 835 281 gene locus_tag LOCUS_06580 gene rnhB 835 281 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF1 protein_id gnl|my_center|LOCUS_06580 2100 832 gene locus_tag LOCUS_06590 gene purD 2100 832 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV81 protein_id gnl|my_center|LOCUS_06590 2747 2109 gene locus_tag LOCUS_06600 2747 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3674 2763 gene locus_tag LOCUS_06610 gene truB 3674 2763 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSE0 protein_id gnl|my_center|LOCUS_06610 4021 3683 gene locus_tag LOCUS_06620 4021 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6483 4027 gene locus_tag LOCUS_06630 gene infB 6483 4027 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L5 protein_id gnl|my_center|LOCUS_06630 8014 6539 gene locus_tag LOCUS_06640 gene nusA 8014 6539 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ4 protein_id gnl|my_center|LOCUS_06640 8485 8024 gene locus_tag LOCUS_06650 gene rimP 8485 8024 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L7 protein_id gnl|my_center|LOCUS_06650 8733 8657 gene locus_tag LOCUS_t00130 8733 8657 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9088 8804 gene locus_tag LOCUS_06660 9088 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9194 10159 gene locus_tag LOCUS_06670 gene gshB 9194 10159 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_06670 10544 10152 gene locus_tag LOCUS_06680 gene crcB 10544 10152 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE9 protein_id gnl|my_center|LOCUS_06680 11746 10541 gene locus_tag LOCUS_06690 11746 10541 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence034 411 1421 gene locus_tag LOCUS_06700 411 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1744 4020 gene locus_tag LOCUS_06710 gene nrdA 1744 4020 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG7 protein_id gnl|my_center|LOCUS_06710 4039 5175 gene locus_tag LOCUS_06720 gene nrdB 4039 5175 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706176.1 protein_id gnl|my_center|LOCUS_06720 5185 5448 gene locus_tag LOCUS_06730 5185 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6537 5437 gene locus_tag LOCUS_06740 gene selU 6537 5437 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_06740 7573 6530 gene locus_tag LOCUS_06750 gene selD 7573 6530 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK99 protein_id gnl|my_center|LOCUS_06750 8873 7542 gene locus_tag LOCUS_06760 8873 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9564 8956 gene locus_tag LOCUS_06770 9564 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10511 9561 gene locus_tag LOCUS_06780 10511 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11386 10493 gene locus_tag LOCUS_06790 11386 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence035 775 149 gene locus_tag LOCUS_06800 775 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1427 792 gene locus_tag LOCUS_06810 1427 792 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_06810 4218 1660 gene locus_tag LOCUS_06820 gene clpB 4218 1660 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_06820 4302 4763 gene locus_tag LOCUS_06830 gene trmL 4302 4763 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 protein_id gnl|my_center|LOCUS_06830 5960 4755 gene locus_tag LOCUS_06840 5960 4755 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_06840 6892 5963 gene locus_tag LOCUS_06850 gene fmt 6892 5963 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA8 protein_id gnl|my_center|LOCUS_06850 8301 6892 gene locus_tag LOCUS_06860 gene argH 8301 6892 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_06860 8810 8298 gene locus_tag LOCUS_06870 8810 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8809 9729 gene locus_tag LOCUS_06880 gene hemC 8809 9729 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8T5 protein_id gnl|my_center|LOCUS_06880 9726 10007 gene locus_tag LOCUS_06890 9726 10007 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_06890 10011 10688 gene locus_tag LOCUS_06900 10011 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence036 333 587 gene locus_tag LOCUS_06910 333 587 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_06910 604 2316 gene locus_tag LOCUS_06920 604 2316 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 protein_id gnl|my_center|LOCUS_06920 2388 2864 gene locus_tag LOCUS_06930 2388 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2868 4700 gene locus_tag LOCUS_06940 2868 4700 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_06940 4697 5392 gene locus_tag LOCUS_06950 4697 5392 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_06950 5462 7375 gene locus_tag LOCUS_06960 gene acsA2 5462 7375 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_06960 8100 7384 gene locus_tag LOCUS_06970 8100 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9180 8191 gene locus_tag LOCUS_06980 gene hemB 9180 8191 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_06980 >Feature sequence037 1397 1146 gene locus_tag LOCUS_06990 gene cspC 1397 1146 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057116.1 protein_id gnl|my_center|LOCUS_06990 3381 1519 gene locus_tag LOCUS_07000 gene deaD-1 3381 1519 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_07000 4020 3469 gene locus_tag LOCUS_07010 4020 3469 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_07010 4777 4040 gene locus_tag LOCUS_07020 4777 4040 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_07020 5451 4777 gene locus_tag LOCUS_07030 5451 4777 CDS product hydrolase TatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071443.1 protein_id gnl|my_center|LOCUS_07030 5611 6039 gene locus_tag LOCUS_07040 gene rplM 5611 6039 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ3 protein_id gnl|my_center|LOCUS_07040 6054 6449 gene locus_tag LOCUS_07050 gene rpsI 6054 6449 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR92 protein_id gnl|my_center|LOCUS_07050 7130 6501 gene locus_tag LOCUS_07060 gene bax 7130 6501 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_07060 7725 7204 gene locus_tag LOCUS_07070 7725 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_07070 8699 7722 gene locus_tag LOCUS_07080 gene gpsA 8699 7722 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGH1 protein_id gnl|my_center|LOCUS_07080 8950 8699 gene locus_tag LOCUS_07090 gene grx 8950 8699 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_07090 9386 8967 gene locus_tag LOCUS_07100 9386 8967 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_07100 9976 9389 gene locus_tag LOCUS_07110 9976 9389 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_07110 <10626 9996 gene locus_tag LOCUS_07120 <10626 9996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NBM1:carboxy-S-adenosyl-L-methionine synthase >Feature sequence038 1407 742 gene locus_tag LOCUS_07130 1407 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1805 1404 gene locus_tag LOCUS_07140 1805 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_07140 2269 1802 gene locus_tag LOCUS_07150 gene ccmH 2269 1802 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_07150 2332 4185 gene locus_tag LOCUS_07160 2332 4185 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 protein_id gnl|my_center|LOCUS_07160 4182 4724 gene locus_tag LOCUS_07170 4182 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4897 4721 gene locus_tag LOCUS_07180 4897 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6693 4903 gene locus_tag LOCUS_07190 gene uvrC 6693 4903 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV4 protein_id gnl|my_center|LOCUS_07190 6742 7380 gene locus_tag LOCUS_07200 6742 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_07200 7380 8639 gene locus_tag LOCUS_07210 gene murA 7380 8639 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 protein_id gnl|my_center|LOCUS_07210 8652 9269 gene locus_tag LOCUS_07220 gene hisG 8652 9269 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence039 1598 828 gene locus_tag LOCUS_07230 1598 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_07230 2370 1600 gene locus_tag LOCUS_07240 2370 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2984 2373 gene locus_tag LOCUS_07250 gene rsmG 2984 2373 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS4 protein_id gnl|my_center|LOCUS_07250 4849 2981 gene locus_tag LOCUS_07260 gene mnmG 4849 2981 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XAY0 protein_id gnl|my_center|LOCUS_07260 5978 4917 gene locus_tag LOCUS_07270 gene fbaB 5978 4917 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_07270 7451 6003 gene locus_tag LOCUS_07280 7451 6003 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N36 protein_id gnl|my_center|LOCUS_07280 8618 7455 gene locus_tag LOCUS_07290 gene pgk 8618 7455 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHH3 protein_id gnl|my_center|LOCUS_07290 9025 8636 gene locus_tag LOCUS_07300 9025 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880355.1 protein_id gnl|my_center|LOCUS_07300 10064 9069 gene locus_tag LOCUS_07310 gene gapA 10064 9069 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 protein_id gnl|my_center|LOCUS_07310 10363 10094 gene locus_tag LOCUS_07320 10363 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence040 40 1431 gene locus_tag LOCUS_07330 40 1431 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278556.1 protein_id gnl|my_center|LOCUS_07330 1436 3136 gene locus_tag LOCUS_07340 1436 3136 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_07340 3143 4597 gene locus_tag LOCUS_07350 3143 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5631 4594 gene locus_tag LOCUS_07360 gene pdxB 5631 4594 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QR1 protein_id gnl|my_center|LOCUS_07360 6338 5670 gene locus_tag LOCUS_07370 gene ung2 6338 5670 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_07370 6820 6320 gene locus_tag LOCUS_07380 6820 6320 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073013.1 protein_id gnl|my_center|LOCUS_07380 7001 7726 gene locus_tag LOCUS_07390 7001 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 8207 7728 gene locus_tag LOCUS_07400 8207 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 9744 8284 gene locus_tag LOCUS_07410 9744 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence041 766 203 gene locus_tag LOCUS_07420 766 203 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_07420 2829 763 gene locus_tag LOCUS_07430 2829 763 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_07430 3369 2965 gene locus_tag LOCUS_07440 3369 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3644 3447 gene locus_tag LOCUS_07450 3644 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4014 3574 gene locus_tag LOCUS_07460 4014 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4745 4137 gene locus_tag LOCUS_07470 4745 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4936 5628 gene locus_tag LOCUS_07480 gene creB 4936 5628 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_07480 5625 7079 gene locus_tag LOCUS_07490 gene creC 5625 7079 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_07490 7981 7115 gene locus_tag LOCUS_07500 gene sucD 7981 7115 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53591 protein_id gnl|my_center|LOCUS_07500 9156 7990 gene locus_tag LOCUS_07510 gene sucC 9156 7990 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_07510 <9663 9162 gene locus_tag LOCUS_07520 <9663 9162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3D1:dihydrolipoyl dehydrogenase >Feature sequence042 2829 1774 gene locus_tag LOCUS_07530 2829 1774 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR0 protein_id gnl|my_center|LOCUS_07530 3625 2834 gene locus_tag LOCUS_07540 gene folE2 3625 2834 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_07540 3897 3628 gene locus_tag LOCUS_07550 3897 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6312 4075 gene locus_tag LOCUS_07560 gene parC 6312 4075 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M4 protein_id gnl|my_center|LOCUS_07560 9200 6402 gene locus_tag LOCUS_07570 gene gcvP 9200 6402 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I05 protein_id gnl|my_center|LOCUS_07570 >Feature sequence043 272 757 gene locus_tag LOCUS_07580 gene ppiB 272 757 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VX98 protein_id gnl|my_center|LOCUS_07580 761 1468 gene locus_tag LOCUS_07590 gene lpxH 761 1468 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG24 protein_id gnl|my_center|LOCUS_07590 3262 1445 gene locus_tag LOCUS_07600 3262 1445 CDS product ribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021737.1 protein_id gnl|my_center|LOCUS_07600 3649 3275 gene locus_tag LOCUS_07610 gene gcvH 3649 3275 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_07610 4873 3797 gene locus_tag LOCUS_07620 gene gcvT 4873 3797 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PL4 protein_id gnl|my_center|LOCUS_07620 5530 4883 gene locus_tag LOCUS_07630 gene yciB 5530 4883 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NVM4 protein_id gnl|my_center|LOCUS_07630 5825 5911 gene locus_tag LOCUS_t00140 5825 5911 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6024 6431 gene locus_tag LOCUS_07640 6024 6431 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_07640 6580 8646 gene locus_tag LOCUS_07650 gene recG 6580 8646 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TB3 protein_id gnl|my_center|LOCUS_07650 8661 9131 gene locus_tag LOCUS_07660 gene ubiC 8661 9131 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence044 <1 502 gene locus_tag LOCUS_07670 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWC4:transcription termination/antitermination protein NusG 584 1012 gene locus_tag LOCUS_07680 gene rplK 584 1012 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KQ0 protein_id gnl|my_center|LOCUS_07680 1017 1712 gene locus_tag LOCUS_07690 gene rplA 1017 1712 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E234 protein_id gnl|my_center|LOCUS_07690 1911 2429 gene locus_tag LOCUS_07700 gene rplJ 1911 2429 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET2 protein_id gnl|my_center|LOCUS_07700 2460 2834 gene locus_tag LOCUS_07710 gene rplL 2460 2834 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E236 protein_id gnl|my_center|LOCUS_07710 3006 7088 gene locus_tag LOCUS_07720 gene rpoB 3006 7088 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ0 protein_id gnl|my_center|LOCUS_07720 >Feature sequence045 654 1817 gene locus_tag LOCUS_07730 gene hflK 654 1817 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_07730 1817 2674 gene locus_tag LOCUS_07740 1817 2674 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_07740 2682 3635 gene locus_tag LOCUS_07750 gene hisZ 2682 3635 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_07750 3673 4992 gene locus_tag LOCUS_07760 gene purA 3673 4992 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40607 protein_id gnl|my_center|LOCUS_07760 4996 7161 gene locus_tag LOCUS_07770 gene rnr 4996 7161 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_07770 7197 7679 gene locus_tag LOCUS_07780 7197 7679 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_07780 <9311 7694 gene locus_tag LOCUS_07790 <9311 7694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PJ98:dihydroxy-acid dehydratase >Feature sequence046 347 892 gene locus_tag LOCUS_07800 gene rplF 347 892 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I3 protein_id gnl|my_center|LOCUS_07800 910 1257 gene locus_tag LOCUS_07810 gene rplR 910 1257 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V5 protein_id gnl|my_center|LOCUS_07810 1298 1816 gene locus_tag LOCUS_07820 gene rpsE 1298 1816 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66587 protein_id gnl|my_center|LOCUS_07820 1816 1998 gene locus_tag LOCUS_07830 gene rpmD 1816 1998 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK52 protein_id gnl|my_center|LOCUS_07830 2002 2436 gene locus_tag LOCUS_07840 gene rplO 2002 2436 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E895 protein_id gnl|my_center|LOCUS_07840 2440 3738 gene locus_tag LOCUS_07850 gene secY 2440 3738 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9K3 protein_id gnl|my_center|LOCUS_07850 3996 4349 gene locus_tag LOCUS_07860 gene rpsM 3996 4349 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHU6 protein_id gnl|my_center|LOCUS_07860 4365 4748 gene locus_tag LOCUS_07870 gene rpsK 4365 4748 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_07870 4758 5384 gene locus_tag LOCUS_07880 gene rpsD 4758 5384 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E890 protein_id gnl|my_center|LOCUS_07880 5395 6375 gene locus_tag LOCUS_07890 gene rpoA 5395 6375 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_07890 6385 6771 gene locus_tag LOCUS_07900 gene rplQ 6385 6771 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E888 protein_id gnl|my_center|LOCUS_07900 6784 6999 gene locus_tag LOCUS_07910 gene rpsU 6784 6999 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD7 protein_id gnl|my_center|LOCUS_07910 7089 7535 gene locus_tag LOCUS_07920 7089 7535 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_07920 7557 8162 gene locus_tag LOCUS_07930 7557 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8265 8981 gene locus_tag LOCUS_07940 8265 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence047 <1 1084 gene locus_tag LOCUS_07950 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87ND6:DNA gyrase subunit A 1228 1470 gene locus_tag LOCUS_07960 1228 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3042 1474 gene locus_tag LOCUS_07970 gene prfC 3042 1474 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX60 protein_id gnl|my_center|LOCUS_07970 3497 3045 gene locus_tag LOCUS_07980 3497 3045 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_07980 4583 3498 gene locus_tag LOCUS_07990 gene mraY 4583 3498 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_07990 5588 4590 gene locus_tag LOCUS_08000 5588 4590 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957220.1 protein_id gnl|my_center|LOCUS_08000 5709 5942 gene locus_tag LOCUS_08010 5709 5942 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 protein_id gnl|my_center|LOCUS_08010 7118 6003 gene locus_tag LOCUS_08020 gene agxT 7118 6003 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_08020 8096 7215 gene locus_tag LOCUS_08030 8096 7215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462872.1 protein_id gnl|my_center|LOCUS_08030 <8717 8100 gene locus_tag LOCUS_08040 <8717 8100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258192.1:C4-dicarboxylate ABC transporter >Feature sequence048 400 2811 gene locus_tag LOCUS_08050 gene pepN 400 2811 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_08050 2811 3281 gene locus_tag LOCUS_08060 2811 3281 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_08060 3265 4233 gene locus_tag LOCUS_08070 gene dusA 3265 4233 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_08070 4220 5437 gene locus_tag LOCUS_08080 gene ftsA 4220 5437 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q0 protein_id gnl|my_center|LOCUS_08080 5443 6354 gene locus_tag LOCUS_08090 gene lpxC 5443 6354 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_08090 6419 8152 gene locus_tag LOCUS_08100 gene ilvI 6419 8152 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYI0 protein_id gnl|my_center|LOCUS_08100 8155 8631 gene locus_tag LOCUS_08110 gene ilvH 8155 8631 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence049 723 55 gene locus_tag LOCUS_08120 723 55 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_08120 1661 720 gene locus_tag LOCUS_08130 1661 720 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_08130 2487 1654 gene locus_tag LOCUS_08140 2487 1654 CDS product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_08140 3605 2487 gene locus_tag LOCUS_08150 3605 2487 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947238.1 protein_id gnl|my_center|LOCUS_08150 4605 3610 gene locus_tag LOCUS_08160 4605 3610 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947593.1 protein_id gnl|my_center|LOCUS_08160 5612 4605 gene locus_tag LOCUS_08170 gene mrdB 5612 4605 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707028.1 protein_id gnl|my_center|LOCUS_08170 6103 5741 gene locus_tag LOCUS_08180 6103 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 6192 6644 gene locus_tag LOCUS_08190 6192 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6641 8029 gene locus_tag LOCUS_08200 gene gltX 6641 8029 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ0 protein_id gnl|my_center|LOCUS_08200 >Feature sequence050 74 1378 gene locus_tag LOCUS_08210 gene dsrA-2 74 1378 CDS product sulfite reductase, dissimilatory-type subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_08210 1422 2495 gene locus_tag LOCUS_08220 gene dsrB-1 1422 2495 CDS product sulfite reductase, dissimilatory-type beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_08220 2508 2909 gene locus_tag LOCUS_08230 gene tusD 2508 2909 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTA8 protein_id gnl|my_center|LOCUS_08230 2911 3315 gene locus_tag LOCUS_08240 gene dsrF 2911 3315 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_08240 3328 3624 gene locus_tag LOCUS_08250 gene dsrH 3328 3624 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_08250 3652 3975 gene locus_tag LOCUS_08260 3652 3975 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_08260 4053 4826 gene locus_tag LOCUS_08270 4053 4826 CDS product menaquinol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_08270 4828 6411 gene locus_tag LOCUS_08280 4828 6411 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938585.1 protein_id gnl|my_center|LOCUS_08280 6429 8387 gene locus_tag LOCUS_08290 6429 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence051 2 703 gene locus_tag LOCUS_08300 2 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 707 2842 gene locus_tag LOCUS_08310 707 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2835 3449 gene locus_tag LOCUS_08320 2835 3449 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105558.1 protein_id gnl|my_center|LOCUS_08320 4179 3472 gene locus_tag LOCUS_08330 4179 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4572 4267 gene locus_tag LOCUS_08340 4572 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5037 4594 gene locus_tag LOCUS_08350 5037 4594 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881178.1 protein_id gnl|my_center|LOCUS_08350 5575 5093 gene locus_tag LOCUS_08360 5575 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086304.1 protein_id gnl|my_center|LOCUS_08360 7674 5713 gene locus_tag LOCUS_08370 gene priA 7674 5713 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR5 protein_id gnl|my_center|LOCUS_08370 7731 8171 gene locus_tag LOCUS_08380 gene ybeY 7731 8171 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_08380 >Feature sequence052 1406 807 gene locus_tag LOCUS_08390 gene engB 1406 807 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG0 protein_id gnl|my_center|LOCUS_08390 1489 1770 gene locus_tag LOCUS_08400 1489 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1869 2510 gene locus_tag LOCUS_08410 gene cc4 1869 2510 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_08410 2618 3913 gene locus_tag LOCUS_08420 gene tig 2618 3913 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFC0 protein_id gnl|my_center|LOCUS_08420 3914 4510 gene locus_tag LOCUS_08430 gene clpP 3914 4510 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_08430 4513 5781 gene locus_tag LOCUS_08440 gene clpX 4513 5781 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R79 protein_id gnl|my_center|LOCUS_08440 5791 7101 gene locus_tag LOCUS_08450 gene hflX 5791 7101 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV3 protein_id gnl|my_center|LOCUS_08450 >Feature sequence053 <1 1666 gene locus_tag LOCUS_08460 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKQ7:chaperone protein HscA 1693 2031 gene locus_tag LOCUS_08470 gene fdx 1693 2031 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_08470 2546 2124 gene locus_tag LOCUS_08480 2546 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3690 2608 gene locus_tag LOCUS_08490 3690 2608 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIY7 protein_id gnl|my_center|LOCUS_08490 3775 5778 gene locus_tag LOCUS_08500 gene metG 3775 5778 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N07 protein_id gnl|my_center|LOCUS_08500 5974 6061 gene locus_tag LOCUS_t00150 5974 6061 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6527 6330 gene locus_tag LOCUS_08510 6527 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6829 6545 gene locus_tag LOCUS_08520 6829 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7116 6826 gene locus_tag LOCUS_08530 7116 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7772 7128 gene locus_tag LOCUS_08540 7772 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence054 <1 907 gene locus_tag LOCUS_08550 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase 1147 962 gene locus_tag LOCUS_08560 1147 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1752 1267 gene locus_tag LOCUS_08570 gene folA 1752 1267 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_08570 1809 2411 gene locus_tag LOCUS_08580 1809 2411 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH1 protein_id gnl|my_center|LOCUS_08580 2416 5871 gene locus_tag LOCUS_08590 gene mfd 2416 5871 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV82 protein_id gnl|my_center|LOCUS_08590 6426 5863 gene locus_tag LOCUS_08600 6426 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7199 6648 gene locus_tag LOCUS_08610 7199 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7732 7196 gene locus_tag LOCUS_08620 7732 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence055 2573 192 gene locus_tag LOCUS_08630 gene nirB 2573 192 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973414.1 protein_id gnl|my_center|LOCUS_08630 2887 3345 gene locus_tag LOCUS_08640 gene moaE 2887 3345 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 protein_id gnl|my_center|LOCUS_08640 3939 3334 gene locus_tag LOCUS_08650 3939 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4526 3942 gene locus_tag LOCUS_08660 gene mobA 4526 3942 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44899 protein_id gnl|my_center|LOCUS_08660 4605 5870 gene locus_tag LOCUS_08670 4605 5870 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_08670 5867 6343 gene locus_tag LOCUS_08680 gene moaC 5867 6343 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT79 protein_id gnl|my_center|LOCUS_08680 6336 7331 gene locus_tag LOCUS_08690 gene moaA 6336 7331 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E1 protein_id gnl|my_center|LOCUS_08690 7328 7564 gene locus_tag LOCUS_08700 gene moaD 7328 7564 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 protein_id gnl|my_center|LOCUS_08700 >Feature sequence056 1071 355 gene locus_tag LOCUS_08710 gene ttcA 1071 355 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW7 protein_id gnl|my_center|LOCUS_08710 2819 1074 gene locus_tag LOCUS_08720 2819 1074 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_08720 4111 2819 gene locus_tag LOCUS_08730 4111 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4629 4108 gene locus_tag LOCUS_08740 gene aroK 4629 4108 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34003 protein_id gnl|my_center|LOCUS_08740 4827 4636 gene locus_tag LOCUS_08750 4827 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5756 4824 gene locus_tag LOCUS_08760 gene ilvE 5756 4824 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_08760 6984 5761 gene locus_tag LOCUS_08770 6984 5761 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_08770 7754 7077 gene locus_tag LOCUS_08780 7754 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence057 3 2711 gene locus_tag LOCUS_08790 gene dnaE 3 2711 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWX2 protein_id gnl|my_center|LOCUS_08790 4074 2746 gene locus_tag LOCUS_08800 4074 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6560 5367 gene locus_tag LOCUS_08810 6560 5367 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266260.1 protein_id gnl|my_center|LOCUS_08810 7573 6557 gene locus_tag LOCUS_08820 gene ribD 7573 6557 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q9 protein_id gnl|my_center|LOCUS_08820 >Feature sequence058 <1 700 gene locus_tag LOCUS_08830 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272584.1:oxidoreductase 725 2080 gene locus_tag LOCUS_08840 gene cbiA 725 2080 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI09 protein_id gnl|my_center|LOCUS_08840 2077 2409 gene locus_tag LOCUS_08850 2077 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4188 3052 gene locus_tag LOCUS_08860 4188 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4643 4176 gene locus_tag LOCUS_08870 4643 4176 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_08870 5581 4628 gene locus_tag LOCUS_08880 5581 4628 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_08880 5632 6240 gene locus_tag LOCUS_08890 5632 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6244 6975 gene locus_tag LOCUS_08900 gene hemD 6244 6975 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958636.1 protein_id gnl|my_center|LOCUS_08900 7035 7472 gene locus_tag LOCUS_08910 7035 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence059 1160 585 gene locus_tag LOCUS_08920 1160 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3246 1180 gene locus_tag LOCUS_08930 3246 1180 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_08930 3426 4469 gene locus_tag LOCUS_08940 gene rnd 3426 4469 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THH7 protein_id gnl|my_center|LOCUS_08940 4453 4983 gene locus_tag LOCUS_08950 gene ppa 4453 4983 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M4 protein_id gnl|my_center|LOCUS_08950 4987 5562 gene locus_tag LOCUS_08960 4987 5562 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_08960 5588 6067 gene locus_tag LOCUS_08970 gene coaD 5588 6067 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8C1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence060 178 1278 gene locus_tag LOCUS_08980 gene ald 178 1278 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_08980 1913 1275 gene locus_tag LOCUS_08990 gene pyrE 1913 1275 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T92 protein_id gnl|my_center|LOCUS_08990 1944 2711 gene locus_tag LOCUS_09000 gene xth 1944 2711 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_09000 2708 3397 gene locus_tag LOCUS_09010 gene trmB 2708 3397 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHE9 protein_id gnl|my_center|LOCUS_09010 3399 3854 gene locus_tag LOCUS_09020 gene fxsA 3399 3854 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_09020 3842 5032 gene locus_tag LOCUS_09030 gene folC 3842 5032 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_09030 5095 5943 gene locus_tag LOCUS_09040 5095 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence061 <1 822 gene locus_tag LOCUS_09050 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886P5:bifunctional uridylyltransferase/uridylyl-removing enzyme 914 1240 gene locus_tag LOCUS_09060 gene trxA 914 1240 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8U4 protein_id gnl|my_center|LOCUS_09060 1342 2604 gene locus_tag LOCUS_09070 gene rho 1342 2604 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_09070 2634 3791 gene locus_tag LOCUS_09080 2634 3791 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_09080 3862 4260 gene locus_tag LOCUS_09090 gene queF 3862 4260 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_09090 4235 5410 gene locus_tag LOCUS_09100 gene pcnB 4235 5410 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_09100 5410 6243 gene locus_tag LOCUS_09110 gene ybbO 5410 6243 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_09110 6247 6471 gene locus_tag LOCUS_09120 gene xseB 6247 6471 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU6 protein_id gnl|my_center|LOCUS_09120 >Feature sequence062 916 494 gene locus_tag LOCUS_09130 916 494 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 protein_id gnl|my_center|LOCUS_09130 1644 979 gene locus_tag LOCUS_09140 1644 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2008 1721 gene locus_tag LOCUS_09150 2008 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2094 3383 gene locus_tag LOCUS_09160 gene serS 2094 3383 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGC4 protein_id gnl|my_center|LOCUS_09160 3396 3731 gene locus_tag LOCUS_09170 gene yajC 3396 3731 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_09170 3748 5601 gene locus_tag LOCUS_09180 gene secD 3748 5601 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_09180 5598 6524 gene locus_tag LOCUS_09190 gene secF 5598 6524 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_09190 >Feature sequence063 <1 954 gene locus_tag LOCUS_09200 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECM2:S-adenosylmethionine:tRNA ribosyltransferase-isomerase 977 1333 gene locus_tag LOCUS_09210 977 1333 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_09210 1330 1659 gene locus_tag LOCUS_09220 1330 1659 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071041.1 protein_id gnl|my_center|LOCUS_09220 2423 1656 gene locus_tag LOCUS_09230 2423 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3333 2464 gene locus_tag LOCUS_09240 gene sucD 3333 2464 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08371 protein_id gnl|my_center|LOCUS_09240 4502 3330 gene locus_tag LOCUS_09250 gene sucC 4502 3330 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_09250 4555 5118 gene locus_tag LOCUS_09260 gene efp 4555 5118 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B3 protein_id gnl|my_center|LOCUS_09260 5172 6050 gene locus_tag LOCUS_09270 5172 6050 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR3 protein_id gnl|my_center|LOCUS_09270 >Feature sequence064 <1 876 gene locus_tag LOCUS_09280 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932700.1:thiosulfohydrolase SoxB 939 2057 gene locus_tag LOCUS_09290 939 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3179 2214 gene locus_tag LOCUS_09300 3179 2214 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_09300 3232 3708 gene locus_tag LOCUS_09310 gene ptpA 3232 3708 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_09310 3773 4198 gene locus_tag LOCUS_09320 gene rpsL 3773 4198 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN9 protein_id gnl|my_center|LOCUS_09320 4227 4694 gene locus_tag LOCUS_09330 gene rpsG 4227 4694 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7U8 protein_id gnl|my_center|LOCUS_09330 4713 6815 gene locus_tag LOCUS_09340 gene fusA 4713 6815 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_09340 >Feature sequence065 <1 2052 gene locus_tag LOCUS_09350 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZXL2:valine--tRNA ligase 2054 2701 gene locus_tag LOCUS_09360 2054 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2703 4163 gene locus_tag LOCUS_09370 gene guaB 2703 4163 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUR9 protein_id gnl|my_center|LOCUS_09370 4172 4555 gene locus_tag LOCUS_09380 4172 4555 CDS product globin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813267.1 protein_id gnl|my_center|LOCUS_09380 4950 4579 gene locus_tag LOCUS_09390 4950 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5463 4963 gene locus_tag LOCUS_09400 5463 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 <6844 5648 gene locus_tag LOCUS_09410 <6844 5648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071339.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence066 <1 563 gene locus_tag LOCUS_09420 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JZI6:3-isopropylmalate dehydratase small subunit 571 1161 gene locus_tag LOCUS_09430 gene ruvA 571 1161 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA3 protein_id gnl|my_center|LOCUS_09430 4351 1301 gene locus_tag LOCUS_09440 4351 1301 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_09440 6215 4410 gene locus_tag LOCUS_09450 gene bipA 6215 4410 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence067 <1 1101 gene locus_tag LOCUS_09460 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29365:homoserine dehydrogenase 1114 2178 gene locus_tag LOCUS_09470 gene thrC 1114 2178 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_09470 2210 3106 gene locus_tag LOCUS_09480 gene cysM 2210 3106 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_09480 3110 4381 gene locus_tag LOCUS_09490 3110 4381 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931118.1 protein_id gnl|my_center|LOCUS_09490 4800 4378 gene locus_tag LOCUS_09500 4800 4378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence068 3221 2607 gene locus_tag LOCUS_09510 gene yciO 3221 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFR6 protein_id gnl|my_center|LOCUS_09510 4054 3221 gene locus_tag LOCUS_09520 4054 3221 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_09520 4133 4606 gene locus_tag LOCUS_09530 gene rfaH 4133 4606 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DB2 protein_id gnl|my_center|LOCUS_09530 4676 6529 gene locus_tag LOCUS_09540 gene glmS 4676 6529 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT25 protein_id gnl|my_center|LOCUS_09540 >Feature sequence069 250 175 gene locus_tag LOCUS_t00160 250 175 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1239 295 gene locus_tag LOCUS_09550 gene trxB 1239 295 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW4 protein_id gnl|my_center|LOCUS_09550 1322 3601 gene locus_tag LOCUS_09560 gene ftsK 1322 3601 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_09560 3594 4169 gene locus_tag LOCUS_09570 3594 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5523 4162 gene locus_tag LOCUS_09580 gene hemN 5523 4162 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K117 protein_id gnl|my_center|LOCUS_09580 5714 6439 gene locus_tag LOCUS_09590 gene dnr 5714 6439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence070 <1 1083 gene locus_tag LOCUS_09600 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPD3:L-aspartate oxidase 1086 1577 gene locus_tag LOCUS_09610 gene def 1086 1577 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5P6 protein_id gnl|my_center|LOCUS_09610 1586 2560 gene locus_tag LOCUS_09620 gene dusB 1586 2560 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS1 protein_id gnl|my_center|LOCUS_09620 2557 2787 gene locus_tag LOCUS_09630 gene fis 2557 2787 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 protein_id gnl|my_center|LOCUS_09630 2838 4379 gene locus_tag LOCUS_09640 gene purH 2838 4379 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_09640 4389 4802 gene locus_tag LOCUS_09650 4389 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4805 5317 gene locus_tag LOCUS_09660 gene apt 4805 5317 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6E1 protein_id gnl|my_center|LOCUS_09660 5310 5912 gene locus_tag LOCUS_09670 5310 5912 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039Q1 protein_id gnl|my_center|LOCUS_09670 6394 5909 gene locus_tag LOCUS_09680 6394 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence071 1053 478 gene locus_tag LOCUS_09690 1053 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2243 1059 gene locus_tag LOCUS_09700 2243 1059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817380.1 protein_id gnl|my_center|LOCUS_09700 3484 2240 gene locus_tag LOCUS_09710 3484 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3732 3481 gene locus_tag LOCUS_09720 3732 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4439 3729 gene locus_tag LOCUS_09730 4439 3729 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_09730 4735 4436 gene locus_tag LOCUS_09740 4735 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_09740 5478 4747 gene locus_tag LOCUS_09750 gene dapB 5478 4747 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_09750 6351 5512 gene locus_tag LOCUS_09760 6351 5512 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951387.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence072 <1 1154 gene locus_tag LOCUS_09770 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q883H9:threonine--tRNA ligase 1349 1690 gene locus_tag LOCUS_09780 1349 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1847 2044 gene locus_tag LOCUS_09790 gene rpmI 1847 2044 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER7 protein_id gnl|my_center|LOCUS_09790 2057 2425 gene locus_tag LOCUS_09800 gene rplT 2057 2425 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_09800 2558 3571 gene locus_tag LOCUS_09810 gene pheS 2558 3571 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_09810 3576 5966 gene locus_tag LOCUS_09820 gene pheT 3576 5966 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_09820 5966 6250 gene locus_tag LOCUS_09830 gene ihfA 5966 6250 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5G4 protein_id gnl|my_center|LOCUS_09830 >Feature sequence073 1394 450 gene locus_tag LOCUS_09840 gene fabH 1394 450 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXR6 protein_id gnl|my_center|LOCUS_09840 2409 1387 gene locus_tag LOCUS_09850 gene plsX 2409 1387 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_09850 2611 2417 gene locus_tag LOCUS_09860 gene rpmF 2611 2417 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV2 protein_id gnl|my_center|LOCUS_09860 3122 2616 gene locus_tag LOCUS_09870 3122 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709643.1 protein_id gnl|my_center|LOCUS_09870 3232 4653 gene locus_tag LOCUS_09880 3232 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5361 4660 gene locus_tag LOCUS_09890 5361 4660 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266128.1 protein_id gnl|my_center|LOCUS_09890 5419 6054 gene locus_tag LOCUS_09900 gene pgp 5419 6054 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence074 <1 622 gene locus_tag LOCUS_09910 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTX3:putative binding protein component of ABC iron transporter 772 2319 gene locus_tag LOCUS_09920 772 2319 CDS product binding-protein-dependent transport system inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_09920 2362 3546 gene locus_tag LOCUS_09930 gene argJ 2362 3546 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_09930 3543 4394 gene locus_tag LOCUS_09940 gene purU 3543 4394 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP74 protein_id gnl|my_center|LOCUS_09940 4449 5207 gene locus_tag LOCUS_09950 4449 5207 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 protein_id gnl|my_center|LOCUS_09950 <6055 5204 gene locus_tag LOCUS_09960 <6055 5204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057872.1:transcriptional regulator >Feature sequence075 870 1112 gene locus_tag LOCUS_09970 870 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1493 1116 gene locus_tag LOCUS_09980 1493 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2371 1814 gene locus_tag LOCUS_09990 2371 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_09990 3330 2368 gene locus_tag LOCUS_10000 gene pyrB 3330 2368 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59653 protein_id gnl|my_center|LOCUS_10000 3746 3327 gene locus_tag LOCUS_10010 3746 3327 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P766 protein_id gnl|my_center|LOCUS_10010 4936 3743 gene locus_tag LOCUS_10020 4936 3743 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072082.1 protein_id gnl|my_center|LOCUS_10020 4949 5890 gene locus_tag LOCUS_10030 gene apbE 4949 5890 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV3 protein_id gnl|my_center|LOCUS_10030 >Feature sequence076 1393 710 gene locus_tag LOCUS_10040 gene ybgJ 1393 710 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261967.1 protein_id gnl|my_center|LOCUS_10040 2066 1386 gene locus_tag LOCUS_10050 2066 1386 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLG8 protein_id gnl|my_center|LOCUS_10050 2101 3018 gene locus_tag LOCUS_10060 2101 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_10060 3079 3726 gene locus_tag LOCUS_10070 gene dut 3079 3726 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_10070 3745 4683 gene locus_tag LOCUS_10080 3745 4683 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_10080 4692 5507 gene locus_tag LOCUS_10090 4692 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5504 5863 gene locus_tag LOCUS_10100 5504 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence077 333 1676 gene locus_tag LOCUS_10110 333 1676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085050.1 protein_id gnl|my_center|LOCUS_10110 1827 2843 gene locus_tag LOCUS_10120 1827 2843 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039304.1 protein_id gnl|my_center|LOCUS_10120 2847 3983 gene locus_tag LOCUS_10130 2847 3983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205316.1 protein_id gnl|my_center|LOCUS_10130 3985 4743 gene locus_tag LOCUS_10140 3985 4743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_10140 4743 5498 gene locus_tag LOCUS_10150 4743 5498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence078 86 955 gene locus_tag LOCUS_10160 gene xerC 86 955 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_10160 952 1485 gene locus_tag LOCUS_10170 gene tsaC 952 1485 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83JD1 protein_id gnl|my_center|LOCUS_10170 1482 2402 gene locus_tag LOCUS_10180 gene hemF 1482 2402 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FI90 protein_id gnl|my_center|LOCUS_10180 2407 2631 gene locus_tag LOCUS_10190 2407 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_10190 2771 4186 gene locus_tag LOCUS_10200 gene glnA 2771 4186 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3E0 protein_id gnl|my_center|LOCUS_10200 4285 5238 gene locus_tag LOCUS_10210 gene bioB 4285 5238 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK6 protein_id gnl|my_center|LOCUS_10210 >Feature sequence079 3050 324 gene locus_tag LOCUS_10220 3050 324 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 protein_id gnl|my_center|LOCUS_10220 3123 3842 gene locus_tag LOCUS_10230 gene znuC 3123 3842 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RE5 protein_id gnl|my_center|LOCUS_10230 4363 3887 gene locus_tag LOCUS_10240 4363 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 <5643 4360 gene locus_tag LOCUS_10250 <5643 4360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074321.1:cytochrome c oxidase accessory protein CcoG >Feature sequence080 1965 2678 gene locus_tag LOCUS_10260 gene pyrH 1965 2678 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E1 protein_id gnl|my_center|LOCUS_10260 2681 3238 gene locus_tag LOCUS_10270 gene frr 2681 3238 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E2 protein_id gnl|my_center|LOCUS_10270 3697 3305 gene locus_tag LOCUS_10280 3697 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3764 4717 gene locus_tag LOCUS_10290 gene cmoB 3764 4717 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF5 protein_id gnl|my_center|LOCUS_10290 >Feature sequence081 2401 275 gene locus_tag LOCUS_10300 2401 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 465 577 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttgctgcttagcaggttg 3468 2749 gene locus_tag LOCUS_10310 3468 2749 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_10310 3554 4579 gene locus_tag LOCUS_10320 3554 4579 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence082 101 1717 gene locus_tag LOCUS_10330 101 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1732 2055 gene locus_tag LOCUS_10340 1732 2055 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57554 protein_id gnl|my_center|LOCUS_10340 2073 2657 gene locus_tag LOCUS_10350 gene recR 2073 2657 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFY1 protein_id gnl|my_center|LOCUS_10350 3139 2750 gene locus_tag LOCUS_10360 gene gloA 3139 2750 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q1 protein_id gnl|my_center|LOCUS_10360 3188 3799 gene locus_tag LOCUS_10370 3188 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_10370 4028 3813 gene locus_tag LOCUS_10380 4028 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4294 4025 gene locus_tag LOCUS_10390 4294 4025 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence083 574 272 gene locus_tag LOCUS_10400 gene soxZ 574 272 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_10400 1057 611 gene locus_tag LOCUS_10410 1057 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1415 1068 gene locus_tag LOCUS_10420 gene soxX 1415 1068 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932695.1 protein_id gnl|my_center|LOCUS_10420 2989 1535 gene locus_tag LOCUS_10430 2989 1535 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_10430 5160 3073 gene locus_tag LOCUS_10440 5160 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence084 2215 1067 gene locus_tag LOCUS_10450 gene sucB 2215 1067 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_10450 4943 2217 gene locus_tag LOCUS_10460 gene sucA 4943 2217 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence085 727 83 gene locus_tag LOCUS_10470 727 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1050 820 gene locus_tag LOCUS_10480 1050 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1614 1174 gene locus_tag LOCUS_10490 gene rnhA 1614 1174 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH79 protein_id gnl|my_center|LOCUS_10490 3395 1599 gene locus_tag LOCUS_10500 3395 1599 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_10500 3451 4851 gene locus_tag LOCUS_10510 gene leuC 3451 4851 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEZ0 protein_id gnl|my_center|LOCUS_10510 >Feature sequence086 1065 3659 gene locus_tag LOCUS_10520 gene acnB 1065 3659 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPU4 protein_id gnl|my_center|LOCUS_10520 3908 3753 gene locus_tag LOCUS_10530 gene rpmG 3908 3753 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD09 protein_id gnl|my_center|LOCUS_10530 4154 3918 gene locus_tag LOCUS_10540 gene rpmB 4154 3918 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44364 protein_id gnl|my_center|LOCUS_10540 4277 4366 gene locus_tag LOCUS_t00170 4277 4366 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 929 1099 gene locus_tag LOCUS_10550 929 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1123 1371 gene locus_tag LOCUS_10560 1123 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1374 2387 gene locus_tag LOCUS_10570 1374 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_10570 2390 2632 gene locus_tag LOCUS_10580 2390 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2643 3344 gene locus_tag LOCUS_10590 2643 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3344 3853 gene locus_tag LOCUS_10600 3344 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3888 4475 gene locus_tag LOCUS_10610 3888 4475 CDS product SOS error prone mutagenesis protein UmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947431.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence088 1676 213 gene locus_tag LOCUS_10620 1676 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1767 2549 gene locus_tag LOCUS_10630 1767 2549 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CI38 protein_id gnl|my_center|LOCUS_10630 3066 2611 gene locus_tag LOCUS_10640 3066 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4091 3060 gene locus_tag LOCUS_10650 4091 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 <4801 4176 gene locus_tag LOCUS_10660 <4801 4176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WE31:sulfurtransferase >Feature sequence089 2472 274 gene locus_tag LOCUS_10670 2472 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3132 2647 gene locus_tag LOCUS_10680 gene cumB 3132 2647 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C1 protein_id gnl|my_center|LOCUS_10680 <4704 3123 gene locus_tag LOCUS_10690 <4704 3123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZX09:GMP synthase [glutamine-hydrolyzing] >Feature sequence090 2115 244 gene locus_tag LOCUS_10700 2115 244 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105893.1 protein_id gnl|my_center|LOCUS_10700 3415 2228 gene locus_tag LOCUS_10710 gene prpF 3415 2228 CDS product 2-methyl-aconitate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW4 protein_id gnl|my_center|LOCUS_10710 <4688 3415 gene locus_tag LOCUS_10720 <4688 3415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJW3:2-methylcitrate dehydratase (2-methyl-trans-aconitate forming) >Feature sequence091 1069 2286 gene locus_tag LOCUS_10730 gene trpB 1069 2286 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C8 protein_id gnl|my_center|LOCUS_10730 2346 2690 gene locus_tag LOCUS_10740 2346 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3461 2682 gene locus_tag LOCUS_10750 gene thiG 3461 2682 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_10750 3810 3998 gene locus_tag LOCUS_10760 gene txe 3810 3998 CDS product toxin-antitoxin system, toxin, HigB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_004888450.1 protein_id gnl|my_center|LOCUS_10760 4012 4296 gene locus_tag LOCUS_10770 4012 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence092 741 52 gene locus_tag LOCUS_10780 741 52 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_10780 1238 906 gene locus_tag LOCUS_10790 1238 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1309 1980 gene locus_tag LOCUS_10800 gene dnaQ 1309 1980 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957503.1 protein_id gnl|my_center|LOCUS_10800 1992 3458 gene locus_tag LOCUS_10810 gene ubiD 1992 3458 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_10810 3521 3597 gene locus_tag LOCUS_t00180 3521 3597 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3672 3748 gene locus_tag LOCUS_t00190 3672 3748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3757 3832 gene locus_tag LOCUS_t00200 3757 3832 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <4487 3970 gene locus_tag LOCUS_10820 <4487 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098812.1:integrase >Feature sequence093 7 1692 gene locus_tag LOCUS_10830 gene pbpA 7 1692 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10830 2019 1669 gene locus_tag LOCUS_10840 2019 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3140 2031 gene locus_tag LOCUS_10850 gene tgt 3140 2031 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNT0 protein_id gnl|my_center|LOCUS_10850 <4420 3149 gene locus_tag LOCUS_10860 <4420 3149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_002347544.1:ABC transport protein >Feature sequence094 20 1525 gene locus_tag LOCUS_10870 gene nuoM 20 1525 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_10870 1537 2991 gene locus_tag LOCUS_10880 gene nuoN 1537 2991 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR8 protein_id gnl|my_center|LOCUS_10880 3270 3521 gene locus_tag LOCUS_10890 3270 3521 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422642.1 protein_id gnl|my_center|LOCUS_10890 <4359 3774 gene locus_tag LOCUS_10900 <4359 3774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83E64:malonyl-[acyl-carrier protein] O-methyltransferase 1 >Feature sequence095 1655 609 gene locus_tag LOCUS_10910 gene alr-1 1655 609 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH11 protein_id gnl|my_center|LOCUS_10910 3115 1670 gene locus_tag LOCUS_10920 gene dnaB 3115 1670 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEZ0 protein_id gnl|my_center|LOCUS_10920 3638 3186 gene locus_tag LOCUS_10930 gene rplI 3638 3186 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_10930 3904 3650 gene locus_tag LOCUS_10940 gene rpsR 3904 3650 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UY4 protein_id gnl|my_center|LOCUS_10940 4261 3914 gene locus_tag LOCUS_10950 gene rpsF 4261 3914 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ2 protein_id gnl|my_center|LOCUS_10950 >Feature sequence096 <1 1154 gene locus_tag LOCUS_10960 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SV8:UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase 1151 1750 gene locus_tag LOCUS_10970 gene ubiX 1151 1750 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP17 protein_id gnl|my_center|LOCUS_10970 2561 1779 gene locus_tag LOCUS_10980 2561 1779 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_10980 3274 2549 gene locus_tag LOCUS_10990 3274 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence097 2716 989 gene locus_tag LOCUS_11000 2716 989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence098 788 306 gene locus_tag LOCUS_11010 788 306 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXQ7 protein_id gnl|my_center|LOCUS_11010 1338 913 gene locus_tag LOCUS_11020 1338 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3544 1466 gene locus_tag LOCUS_11030 3544 1466 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW5 protein_id gnl|my_center|LOCUS_11030 >Feature sequence099 2 139 gene locus_tag LOCUS_11040 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 228 539 gene locus_tag LOCUS_11050 gene rpsJ 228 539 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_11050 569 1276 gene locus_tag LOCUS_11060 gene rplC 569 1276 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44344 protein_id gnl|my_center|LOCUS_11060 1286 1900 gene locus_tag LOCUS_11070 gene rplD 1286 1900 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD6 protein_id gnl|my_center|LOCUS_11070 1897 2187 gene locus_tag LOCUS_11080 gene rplW 1897 2187 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I6 protein_id gnl|my_center|LOCUS_11080 2200 3030 gene locus_tag LOCUS_11090 gene rplB 2200 3030 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_11090 3033 3302 gene locus_tag LOCUS_11100 3033 3302 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003856781.1 protein_id gnl|my_center|LOCUS_11100 3312 3647 gene locus_tag LOCUS_11110 gene rplV 3312 3647 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSY4 protein_id gnl|my_center|LOCUS_11110 >Feature sequence100 358 1785 gene locus_tag LOCUS_11120 gene murE 358 1785 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX16 protein_id gnl|my_center|LOCUS_11120 1850 3103 gene locus_tag LOCUS_11130 gene murF 1850 3103 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_11130 3157 3233 gene locus_tag LOCUS_t00210 3157 3233 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3286 3870 gene locus_tag LOCUS_11140 gene pgsA 3286 3870 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947999.1 protein_id gnl|my_center|LOCUS_11140 3925 4000 gene locus_tag LOCUS_t00220 3925 4000 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4060 4133 gene locus_tag LOCUS_t00230 4060 4133 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 186 1505 gene locus_tag LOCUS_11150 186 1505 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_11150 2240 1683 gene locus_tag LOCUS_11160 2240 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence102 595 1245 gene locus_tag LOCUS_11170 595 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1250 1909 gene locus_tag LOCUS_11180 1250 1909 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705925.1 protein_id gnl|my_center|LOCUS_11180 1936 2685 gene locus_tag LOCUS_11190 gene ccmC 1936 2685 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 protein_id gnl|my_center|LOCUS_11190 2685 2852 gene locus_tag LOCUS_11200 2685 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2858 3274 gene locus_tag LOCUS_11210 gene ccmE 2858 3274 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_11210 3277 3822 gene locus_tag LOCUS_11220 gene ccmG 3277 3822 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence103 <1 914 gene locus_tag LOCUS_11230 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679762.1:membrane protein 914 1720 gene locus_tag LOCUS_11240 914 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_11240 1724 3019 gene locus_tag LOCUS_11250 1724 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_11250 3081 3659 gene locus_tag LOCUS_11260 3081 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence104 391 104 gene locus_tag LOCUS_11270 gene parE4 391 104 CDS product toxin ParE4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A459 protein_id gnl|my_center|LOCUS_11270 646 410 gene locus_tag LOCUS_11280 gene parD-4 646 410 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_11280 1100 825 gene locus_tag LOCUS_11290 1100 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1703 1416 gene locus_tag LOCUS_11300 1703 1416 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074402.1 protein_id gnl|my_center|LOCUS_11300 1941 1696 gene locus_tag LOCUS_11310 1941 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2258 3304 gene locus_tag LOCUS_11320 2258 3304 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_11320 3512 3294 gene locus_tag LOCUS_11330 3512 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence105 2932 446 gene locus_tag LOCUS_11340 2932 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2987 3424 gene locus_tag LOCUS_11350 2987 3424 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence106 2804 2178 gene locus_tag LOCUS_11360 2804 2178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970482.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence107 520 1683 gene locus_tag LOCUS_11370 gene metZ 520 1683 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_11370 1720 2226 gene locus_tag LOCUS_11380 gene fabA 1720 2226 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_11380 2226 3443 gene locus_tag LOCUS_11390 gene fabB 2226 3443 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072970.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence108 1298 1107 gene locus_tag LOCUS_11400 1298 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2209 1358 gene locus_tag LOCUS_11410 gene yrfI 2209 1358 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRR3 protein_id gnl|my_center|LOCUS_11410 2227 3051 gene locus_tag LOCUS_11420 2227 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3279 3052 gene locus_tag LOCUS_11430 3279 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence109 2595 1501 gene locus_tag LOCUS_11440 gene cca 2595 1501 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7ND45 protein_id gnl|my_center|LOCUS_11440 2637 3002 gene locus_tag LOCUS_11450 gene msrB 2637 3002 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence110 1953 757 gene locus_tag LOCUS_11460 gene argG 1953 757 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_11460 2365 1946 gene locus_tag LOCUS_11470 2365 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2814 2365 gene locus_tag LOCUS_11480 2814 2365 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence111 524 448 gene locus_tag LOCUS_t00240 524 448 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 621 1217 gene locus_tag LOCUS_11490 gene coaE 621 1217 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7C397 protein_id gnl|my_center|LOCUS_11490 1514 1203 gene locus_tag LOCUS_11500 1514 1203 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_11500 2497 1661 gene locus_tag LOCUS_11510 gene rsmI 2497 1661 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH08 protein_id gnl|my_center|LOCUS_11510 2496 2867 gene locus_tag LOCUS_11520 2496 2867 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX3 protein_id gnl|my_center|LOCUS_11520 >Feature sequence112 1668 1081 gene locus_tag LOCUS_11530 1668 1081 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7W0 protein_id gnl|my_center|LOCUS_11530 2281 1703 gene locus_tag LOCUS_11540 2281 1703 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266180.1 protein_id gnl|my_center|LOCUS_11540 <3270 2332 gene locus_tag LOCUS_11550 <3270 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086294.1:thioredoxin >Feature sequence113 <1 1555 gene locus_tag LOCUS_11560 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389659.1:anti-sigma factor antagonist 2140 1628 gene locus_tag LOCUS_11570 gene rimM 2140 1628 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC2 protein_id gnl|my_center|LOCUS_11570 2584 2144 gene locus_tag LOCUS_11580 2584 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3221 2643 gene locus_tag LOCUS_11590 3221 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence114 1280 1945 gene locus_tag LOCUS_11600 1280 1945 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSA1 protein_id gnl|my_center|LOCUS_11600 1968 2513 gene locus_tag LOCUS_11610 gene rppH 1968 2513 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH98 protein_id gnl|my_center|LOCUS_11610 >Feature sequence115 868 713 gene locus_tag LOCUS_11620 868 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1598 939 gene locus_tag LOCUS_11630 gene aat 1598 939 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_11630 2079 1591 gene locus_tag LOCUS_11640 gene nudE 2079 1591 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038008.1 protein_id gnl|my_center|LOCUS_11640 2205 3161 gene locus_tag LOCUS_11650 2205 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence116 476 195 gene locus_tag LOCUS_11660 476 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 784 509 gene locus_tag LOCUS_11670 784 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2024 777 gene locus_tag LOCUS_11680 2024 777 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence117 219 128 gene locus_tag LOCUS_t00250 219 128 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 697 263 gene locus_tag LOCUS_11690 697 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1312 899 gene locus_tag LOCUS_11700 1312 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_11700 2131 1334 gene locus_tag LOCUS_11710 gene trpC 2131 1334 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNZ4 protein_id gnl|my_center|LOCUS_11710 2201 3037 gene locus_tag LOCUS_11720 gene kdsA 2201 3037 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 protein_id gnl|my_center|LOCUS_11720 >Feature sequence118 2301 2002 gene locus_tag LOCUS_11730 2301 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 <3151 2303 gene locus_tag LOCUS_11740 <3151 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45332:lipopolysaccharide export system permease protein LptG >Feature sequence119 14 289 gene locus_tag LOCUS_11750 gene hup 14 289 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_11750 349 424 gene locus_tag LOCUS_t00260 349 424 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 437 513 gene locus_tag LOCUS_t00270 437 513 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 779 2623 gene locus_tag LOCUS_11760 779 2623 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R77 protein_id gnl|my_center|LOCUS_11760 >Feature sequence120 2166 1006 gene locus_tag LOCUS_11770 gene prpC 2166 1006 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT5 protein_id gnl|my_center|LOCUS_11770 3044 2169 gene locus_tag LOCUS_11780 gene prpB 3044 2169 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0X5 protein_id gnl|my_center|LOCUS_11780 >Feature sequence121 705 223 gene locus_tag LOCUS_11790 gene smpB 705 223 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI80 protein_id gnl|my_center|LOCUS_11790 731 1132 gene locus_tag LOCUS_11800 731 1132 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_11800 1132 1656 gene locus_tag LOCUS_11810 gene rluC 1132 1656 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFW2 protein_id gnl|my_center|LOCUS_11810 1643 2431 gene locus_tag LOCUS_11820 1643 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence122 706 122 gene locus_tag LOCUS_11830 706 122 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_11830 2360 699 gene locus_tag LOCUS_11840 gene ttrS 2360 699 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence123 679 1701 gene locus_tag LOCUS_11850 679 1701 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947618.1 protein_id gnl|my_center|LOCUS_11850 1942 2592 gene locus_tag LOCUS_11860 1942 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence124 3 440 gene locus_tag LOCUS_11870 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1936 488 gene locus_tag LOCUS_11880 gene trkH 1936 488 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_11880 2804 1950 gene locus_tag LOCUS_11890 2804 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence125 1508 78 gene locus_tag LOCUS_11900 gene glcD 1508 78 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_11900 2677 1529 gene locus_tag LOCUS_11910 gene lldD 2677 1529 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence126 604 1464 gene locus_tag LOCUS_11920 gene dapA 604 1464 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_11920 1466 2599 gene locus_tag LOCUS_11930 1466 2599 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192155.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence127 574 92 gene locus_tag LOCUS_11940 574 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11940 693 1901 gene locus_tag LOCUS_11950 gene pgi 693 1901 CDS product putative glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMD4 protein_id gnl|my_center|LOCUS_11950 >Feature sequence128 1751 1308 gene locus_tag LOCUS_11960 1751 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 <2644 1751 gene locus_tag LOCUS_11970 <2644 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072738.1:short-chain dehydrogenase >Feature sequence129 365 898 gene locus_tag LOCUS_11980 365 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 898 2031 gene locus_tag LOCUS_11990 gene glcF 898 2031 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MUF3 protein_id gnl|my_center|LOCUS_11990 >Feature sequence130 314 1399 gene locus_tag LOCUS_12000 314 1399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_12000 1511 2128 gene locus_tag LOCUS_12010 1511 2128 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence131 <1 748 gene locus_tag LOCUS_12020 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63SN1:cysteine desulfurase IscS 825 1202 gene locus_tag LOCUS_12030 gene nifU 825 1202 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_12030 1209 1532 gene locus_tag LOCUS_12040 1209 1532 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S26 protein_id gnl|my_center|LOCUS_12040 1559 2074 gene locus_tag LOCUS_12050 gene hscB 1559 2074 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E781 protein_id gnl|my_center|LOCUS_12050 >Feature sequence132 1816 1085 gene locus_tag LOCUS_12060 gene sdhB 1816 1085 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_12060 <2601 1813 gene locus_tag LOCUS_12070 <2601 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence133 287 1027 gene locus_tag LOCUS_12080 287 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1703 1011 gene locus_tag LOCUS_12090 1703 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 <2566 1709 gene locus_tag LOCUS_12100 <2566 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072517.1:lytic transglycosylase >Feature sequence134 <1 1820 gene locus_tag LOCUS_12110 <1 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015947.1:hemin receptor 1908 2489 gene locus_tag LOCUS_12120 1908 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence135 748 512 gene locus_tag LOCUS_12130 748 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1865 783 gene locus_tag LOCUS_12140 1865 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 <2469 1885 gene locus_tag LOCUS_12150 <2469 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881170.1:MBL fold metallo-hydrolase >Feature sequence136 1139 831 gene locus_tag LOCUS_12160 gene bolA 1139 831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_12160 2149 1136 gene locus_tag LOCUS_12170 2149 1136 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence137 370 1176 gene locus_tag LOCUS_12180 370 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1169 2191 gene locus_tag LOCUS_12190 gene murG 1169 2191 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820X3 protein_id gnl|my_center|LOCUS_12190 >Feature sequence138 <1 712 gene locus_tag LOCUS_12200 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDM7:SoxAX cytochrome complex subunit A 722 1042 gene locus_tag LOCUS_12210 722 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence139 <1 2097 gene locus_tag LOCUS_12220 <1 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVD6:pyruvate dehydrogenase E1 component >Feature sequence140 1176 187 gene locus_tag LOCUS_12230 1176 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_12230 2078 1167 gene locus_tag LOCUS_12240 2078 1167 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882065.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence141 >Feature sequence142 <1 565 gene locus_tag LOCUS_12250 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002555108.1:rod shape-determining protein 597 1394 gene locus_tag LOCUS_12260 gene mreC 597 1394 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXC0 protein_id gnl|my_center|LOCUS_12260 1391 1861 gene locus_tag LOCUS_12270 1391 1861 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS3 protein_id gnl|my_center|LOCUS_12270 >Feature sequence143 <1 723 gene locus_tag LOCUS_12280 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KG22:signal recognition particle protein 730 1758 gene locus_tag LOCUS_12290 gene arsP 730 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence144 <1 688 gene locus_tag LOCUS_12300 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704890.1:membrane protein 974 744 gene locus_tag LOCUS_12310 974 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1985 1134 gene locus_tag LOCUS_12320 gene ubiA 1985 1134 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q327U7 protein_id gnl|my_center|LOCUS_12320 >Feature sequence145 177 491 gene locus_tag LOCUS_12330 177 491 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_12330 1226 483 gene locus_tag LOCUS_12340 gene rlmB 1226 483 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63180 protein_id gnl|my_center|LOCUS_12340 2146 1238 gene locus_tag LOCUS_12350 2146 1238 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AC4 protein_id gnl|my_center|LOCUS_12350 >Feature sequence146 105 1202 gene locus_tag LOCUS_12360 105 1202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957472.1 protein_id gnl|my_center|LOCUS_12360 1224 1691 gene locus_tag LOCUS_12370 gene ssb 1224 1691 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LA3 protein_id gnl|my_center|LOCUS_12370 2119 1784 gene locus_tag LOCUS_12380 2119 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence147 <1 1056 gene locus_tag LOCUS_12390 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000457515.1:DNA polymerase V subunit UmuC <2122 1159 gene locus_tag LOCUS_12400 <2122 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBZ7:ferrochelatase 2 >Feature sequence148 >Feature sequence149 398 958 gene locus_tag LOCUS_12410 398 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1105 1692 gene locus_tag LOCUS_12420 1105 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1762 1837 gene locus_tag LOCUS_t00280 1762 1837 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 234 1514 gene locus_tag LOCUS_12430 gene eno1 234 1514 CDS product enolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M3 protein_id gnl|my_center|LOCUS_12430 >Feature sequence151 1219 782 gene locus_tag LOCUS_12440 gene recX 1219 782 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW6 protein_id gnl|my_center|LOCUS_12440 <2060 1197 gene locus_tag LOCUS_12450 <2060 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUJ7:protein RecA >Feature sequence152 415 104 gene locus_tag LOCUS_12460 gene rplX 415 104 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60733 protein_id gnl|my_center|LOCUS_12460 783 415 gene locus_tag LOCUS_12470 gene rplN 783 415 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDT2 protein_id gnl|my_center|LOCUS_12470 1074 808 gene locus_tag LOCUS_12480 gene rpsQ 1074 808 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T04 protein_id gnl|my_center|LOCUS_12480 1259 1071 gene locus_tag LOCUS_12490 1259 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1669 1259 gene locus_tag LOCUS_12500 gene rplP 1669 1259 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44354 protein_id gnl|my_center|LOCUS_12500 >Feature sequence153 >Feature sequence154 66 689 gene locus_tag LOCUS_12510 66 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 701 1027 gene locus_tag LOCUS_12520 701 1027 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_12520 1392 1024 gene locus_tag LOCUS_12530 gene trxC 1392 1024 CDS product putative thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RD25 protein_id gnl|my_center|LOCUS_12530 >Feature sequence155 1630 680 gene locus_tag LOCUS_12540 gene accA 1630 680 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH05 protein_id gnl|my_center|LOCUS_12540 >Feature sequence156 <1 834 gene locus_tag LOCUS_12550 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881170.1:MBL fold metallo-hydrolase 835 1260 gene locus_tag LOCUS_12560 835 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880563.1 protein_id gnl|my_center|LOCUS_12560 1267 1479 gene locus_tag LOCUS_12570 1267 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence157 <1 662 gene locus_tag LOCUS_12580 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957353.1:3-deoxy-D-manno-octulosonic acid transferase 1080 655 gene locus_tag LOCUS_12590 1080 655 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_12590 <1898 1376 gene locus_tag LOCUS_12600 <1898 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VG1:phosphomethylpyrimidine synthase >Feature sequence158 1021 212 gene locus_tag LOCUS_12610 gene mutM 1021 212 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP0 protein_id gnl|my_center|LOCUS_12610 1111 1686 gene locus_tag LOCUS_12620 1111 1686 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence159 473 1066 gene locus_tag LOCUS_12630 473 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1066 1380 gene locus_tag LOCUS_12640 1066 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1384 1602 gene locus_tag LOCUS_12650 1384 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence160 595 1065 gene locus_tag LOCUS_12660 595 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence161 604 53 gene locus_tag LOCUS_12670 604 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1583 594 gene locus_tag LOCUS_12680 1583 594 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence162 1438 1004 gene locus_tag LOCUS_12690 1438 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence163 <1 895 gene locus_tag LOCUS_12700 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886S6:lysine--tRNA ligase 892 1560 gene locus_tag LOCUS_12710 gene cmk 892 1560 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence164 1412 654 gene locus_tag LOCUS_12720 1412 654 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459005.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence165 1467 517 gene locus_tag LOCUS_12730 gene rluD 1467 517 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6I2 protein_id gnl|my_center|LOCUS_12730 1726 1649 gene locus_tag LOCUS_t00290 1726 1649 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 1334 588 gene locus_tag LOCUS_12740 gene trmJ 1334 588 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A4 protein_id gnl|my_center|LOCUS_12740 >Feature sequence167 <1 771 gene locus_tag LOCUS_12750 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83A98:arginine--tRNA ligase >Feature sequence168 934 389 gene locus_tag LOCUS_12760 934 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1622 936 gene locus_tag LOCUS_12770 1622 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence169 >Feature sequence170 <1 588 gene locus_tag LOCUS_12780 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072274.1:serine acetyltransferase 677 1099 gene locus_tag LOCUS_12790 677 1099 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence171 693 181 gene locus_tag LOCUS_12800 693 181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_12800 1119 781 gene locus_tag LOCUS_12810 1119 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 <1709 1129 gene locus_tag LOCUS_12820 <1709 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P6D0:thiopurine S-methyltransferase >Feature sequence172 439 912 gene locus_tag LOCUS_12830 439 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1465 1118 gene locus_tag LOCUS_12840 1465 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence173 411 1226 gene locus_tag LOCUS_12850 gene dapD 411 1226 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K152 protein_id gnl|my_center|LOCUS_12850 >Feature sequence174 >Feature sequence175 1086 349 gene locus_tag LOCUS_12860 1086 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 <1605 1083 gene locus_tag LOCUS_12870 <1605 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MJ89:phosphoribosylglycinamide formyltransferase >Feature sequence176 >Feature sequence177 <1 928 gene locus_tag LOCUS_12880 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45339:putative ribosome biogenesis GTPase RsgA 1596 931 gene locus_tag LOCUS_12890 1596 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence178 255 1226 gene locus_tag LOCUS_12900 gene ispB 255 1226 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021158.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence179 303 842 gene locus_tag LOCUS_12910 gene rplE 303 842 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER4 protein_id gnl|my_center|LOCUS_12910 848 1153 gene locus_tag LOCUS_12920 gene rpsN 848 1153 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44381 protein_id gnl|my_center|LOCUS_12920 >Feature sequence180 >Feature sequence181 >Feature sequence182 307 564 gene locus_tag LOCUS_12930 gene rpmA 307 564 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 protein_id gnl|my_center|LOCUS_12930 >Feature sequence183 160 1239 gene locus_tag LOCUS_12940 gene serC 160 1239 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_12940 >Feature sequence184 >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 >Feature sequence189 301 879 gene locus_tag LOCUS_12950 301 879 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_12950 1011 938 gene locus_tag LOCUS_t00300 1011 938 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence190 <1049 203 gene locus_tag LOCUS_12960 <1049 203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87L06:tRNA dimethylallyltransferase >Feature sequence191 <1010 460 gene locus_tag LOCUS_12970 <1010 460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477331.1:SAM-dependent methyltransferase >Feature sequence192